Int. J. Cancer: 99, 560 –567 (2002) © 2002 Wiley-Liss, Inc.
Publication of the International Union Against Cancer
MOLECULAR GENETIC CHARACTERIZATION OF THE EWS/ATF1 FUSION GENE IN CLEAR CELL SARCOMA OF TENDONS AND APONEUROSES Ioannis PANAGOPOULOS1*, Fredrik MERTENS1, Maria DEˆ BIEC-RYCHTER2, Margareth ISAKSSON1, Janusz LIMON3, Iwona KARDAS3, Henryk A. DOMANSKI4, Raf SCIOT5, Danuta PEREK6, Sead CRNALIC7, Olle LARSSON8 and Nils MANDAHL1 1 Department of Clinical Genetics, Lund University Hospital, Lund, Sweden 2 Center of Human Genetics, Katholieke Universiteit Leuven, Leuven, Belgium 3 Department of Biology and Genetics, Medical University of Gdansk, Gdansk, Poland 4 Department of Pathology and Cytology, Lund University Hospital, Lund, Sweden 5 Department of Pathology, Katholieke Universiteit Leuven, Leuven, Belgium 6 Department of Oncology, Children’s Memorial Health Institute, Warsaw, Poland 7 Department of Orthopedics, University Hospital, Umeå, Sweden 8 Department of Cellular and Molecular Tumor Pathology, Karolinska Hospital, Stockholm, Sweden Clear cell sarcoma (CCS) is a rare malignant soft tissue tumor particularly associated with tendons and aponeuroses. The cytogenetic hallmark is the translocation t(12;22)(q13; q12) resulting in a chimeric EWS/ATF1 gene in which the 3ⴕ-terminal part of EWS at 22q is replaced by the 3ⴕ-terminal part of ATF1 at 12q. To date, only 13 cases of CCS have been analyzed for fusion genes at the transcription level, and there is no information about the breakpoints at the genomic level. In the present study, we describe the molecular genetic characteristics of CCS from 10 patients. Karyotypes were obtained from 10 cases, 7 of which showed the characteristic t(12;22). As an initial step in the characterization of the EWS/ATF1 and ATF1/EWS chimeras, we constructed an exon/ intron map of the ATF1 gene. The entire ATF1 gene spanned >40 kb and was composed of 7 exons. Intron 3, in which most of the genomic breakpoints occurred, was to a large extent (83%) composed of repetitive elements. RT-PCR amplified EWS/ATF1 cDNA fragments in all patients and ATF1/EWS cDNA fragments in 6 of 10 patients. Four types of EWS/ATF1 chimeric transcript, designated types 1– 4, were identified. The most frequent chimeric transcript (type 1) was an inframe fusion of exon 8 of EWS with exon 4 of ATF1. This was the only chimeric transcript in 5 patients but found together with other variants in 3 tumors. The type 2 transcript of EWS/ATF1, an in-frame fusion of exon 7 of EWS with exon 5 of ATF1, was detected in 4 patients, as the only transcript in 1 case and together with other variants in 3 cases. An in-frame fusion of exon 10 of EWS with exon 5 of ATF1 (type 3) was found in 1 patient as the only transcript, and an out-of-frame fusion of EWS exon 7 with ATF1 exon 7 (type 4) was detected in 1 patient together with type 1 and type 2 transcripts. Sequencing of the amplified ATF1/EWS cDNA fragments showed in 5 patients that ATF1 exon 3 was fused with EWS exon 10, resulting in an out-of-frame chimeric transcript. In 1 case, nt 428 of ATF1 (exon 4) was fused with EWS exon 8; at the junction, there was an insertion of 4 nucleotides, also resulting in an out-of-frame transcript. Genomic extra long PCR and sequence analysis mapped the genomic breakpoints to introns 7, 8 and 9 of EWS and intron 3 and exon 4 of ATF1. While a simple end-to-end fusion was observed in 2 cases, additional nucleotides were found at the junctions in 2 other cases. In addition, topoisomerase I consensus sequences were found close to the junctions, suggesting that this enzyme may participate in the genesis of the EWS/ATF1 fusion. © 2002 Wiley-Liss, Inc. Key words: clear cell sarcoma; translocation; EWS gene; ATF1 gene; reverse transcription; PCR; fusion gene
Clear cell sarcoma (CCS, also called malignant melanoma of soft parts) is a rare malignant soft tissue tumor first described by Enzinger1 and since accepted as a distinct clinicopathologic entity. The tumor is particularly associated with tendons and aponeuroses,2 but other unusual locations have been reported, e.g., the head and neck, duodenum, ileum and kidney.2,3 CCS is most commonly found in young adults between the ages of 20 – 40 years but has also been described in children and elderly men.4,5 Local recur-
rences are very common and it may metastasize, primarily to lymph nodes, the lungs, brain, liver and skeleton.4 – 8 Follow-up studies have shown that approximately 55% of patients die of their disease within 5 years after diagnosis.5,7,8 Since CCS displays a number of histopathologic features that overlap with conventional malignant melanoma, there may be difficulties in the distinction between CCS and metastatic malignant melanoma with an unknown primary site.2,9 Clonal chromosomal abnormalities have been described in 25 CCSs, and the translocation t(12;22)(q13;q12-13), detected in 17 of the cases, appears to be a characteristic rearrangement.10 –12 The t(12;22) results in rearrangements of the EWS gene on chromosome 22 and the ATF1 gene at 12q13, creating a chimeric EWS/ ATF1 gene in which the 3⬘-terminal part of EWS is replaced by the 3⬘-terminal part of ATF1.13 To date, only 13 cases of CCS have been analyzed for fusion genes at the transcription level and there is no information about the breakpoints at the genomic level.10,11,13–19 In the present study, we describe the molecular genetic characteristics of CCS from 10 patients. MATERIAL AND METHODS
Clinical and cytogenetic data on 10 patients with CCS are presented in Table I. Short-term culturing, harvesting and cytogenetic analysis were performed as described.20 Karyotypes were described according to the ISCN (1995).21 Tumor tissue pieces adjacent to those used for cytogenetic analysis and histologic examination had been frozen and stored at – 80°C. Total RNA was extracted from the frozen specimens using Trizol reagent according to the manufacturer’s instructions (GIBCO BRL, Stockholm, Sweden). DNA was extracted using standard methods.22 Primers The primers used for PCR amplification and sequence analysis are presented in Table II. EWS primers were based on the EWS Grant sponsor: Swedish Cancer Society; Grant sponsor: Swedish Child Cancer Fund; Grant sponsor: Gunnar Nilsson Cancer Foundation; Grant sponsor: Polish State Committee for Scientific Research; Grant Number: 4PO5A07117. *Correspondence to: Department of Clinical Genetics, Lund University Hospital, SE-221 85 Lund, Sweden. Fax: ⫹46-46-131061. E-mail:
[email protected] Received 4 January 2002; Revised 18 February 2002; Accepted 22 February 2002 DOI 10.1002/ijc.10404 Published online 00 Month 2002 in Wiley InterScience (www.interscience. wiley.com).
M/28 F/19 F/60
F/55
F/64
6 7 8a 8b 8c 9
10
R
M/16 M/9 4 5
P X P X R P
M/30 F/21 2 3
P P
M/38 1
1 P, primary; M, metastasis; R, local recurrence; X, xenograft.—2DOD, dead of disease, LTF, lost to follow-up; NED, no evidence of disease; AWD, alive with disease. Figures indicate follow-up in years.
R,M Leg
NED 12
— Leg
NED 0.9
M — R Thoracic wall Foot Leg
DOD 2.7 NED 2 DOD 2
M — Gluteal Thoracic wall
LTF AWD 1.4
M M Stomach Leg M P
AWD 11 DOD 0.6
70–100⬍4n⬎,XXYY,i(1)(q10),⫺4,add(4)(p16),del(6)(q12)x2,⫹7,⫺8,⫺9,⫹10,⫺11,⫺11,⫺12, t(12;22) (q13;q13),⫹14,⫹15,add(17)(q25)⫻2,⫹19,der(22)t(12;22)(q13;q13)[cp20] 46,XY,inv(5)(p15q31),t(12;22)(q13;q12)[15] 42–45,X,⫺X,t(1;4)(p21;p16),⫹8,del(8)(p21),⫺9,⫺10,der(12)t(12;22)(q13;q12),⫺16,⫺18,⫺20, der(22)t(12;22)(q13;q12)[4],der(22)t(9;22)(p11;p11)t(12;22)(q13;q13)[10][cp14] 53,XY,⫹del(1)(p31),⫹7,⫹7,⫹8,⫹8,t(12;22)(q13;q12),⫹17,⫹21[12] 46–47,XY,del(1)(p13),dic(3;11)(p21;p11),⫹8,del(11)(p12),t(12;22)(q13;q12),add(13) (p11),⫺14,⫺15,del(18)(p11),der(19)t(1;19)(p12;q13),der(20)t(14;20)(q22;q13),add(21)(p11)[20] 46,XY[7] 45,XX,add(7)(p15),i(8)(q10),add(9)(p11),t(12;22)(q13;q12),⫺14,add(18)(q23)[9]/46,idem,⫹mar[4] Failure 50–51,XX,del(1)(q41),der(6)t(6;12)(p23;q13),⫹7,⫹8,⫹9,der(16)t(1;16)(q11;q11),⫹2mar[cp5] 47–48,XX,del(1)(q41),der(6)t(6;12)(p23;q13),add(15)(q2?2),der(16)t(1;16)(q11;q11)[cp6] 48,XX,⫹8,⫹i(8)(q10),t(12;22)(q13;q12)[7]/47,XX,⫹8,der(12)t(12;22)t(16;22)(p11;q13),del(16) (p11),der(22)t(12;22)[3]/46,XX[11] 39–43,X,⫺X,der(1)t(1;3)(p13;p14)⫻2,⫺3,⫺5,⫺9,⫺10,⫺11,add(11)(q13),⫺12,add(12)(q24),⫺14, ⫹3mar[cp7]/46,XX[59] DOD 21 M Foot M
Outcome2 Relapse1 Location Case
Source
1
Sex/age (years)
TABLE I – CLINICAL AND CYTOGENETIC DATA ON 10 CASES OF CCS
Karyotype
MOLECULAR GENETICS OF CLEAR CELL SARCOMA
561
cDNA and genomic DNA sequences (accession numbers X66899 and Y07848, respectively). ATF1 primers were based on the ATF1 cDNA and genomic DNA sequences (accession numbers X55544 and AC013244, respectively). RT-PCR analysis RT-PCR was carried out for the detection of EWS/ATF1 and ATF1/EWS chimeric transcripts using total RNA as the starting material. Total RNA (5 g) was reverse-transcribed in a 20 l reaction volume containing 50 mM TRIS-HCl (pH 8.3, at 25°C), 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 1 mM of each dNTP, 37 units RNA guard (Pharmacia, Uppsala, Sweden), 10 pmol random hexamers, 1 g oligo (dT)10 and 400 units MMLV reverse transcriptase (GIBCO BRL). The reaction was carried out at 37°C for 60 min, heated for 10 min at 65°C and then kept at 4°C. PCR amplifications were performed in a 50 l reaction volume containing 20 mM TRIS-HCl (pH 8.4), 50 mM KCl, 1.25 mM MgCl2, 0.2 mM of each dNTP, 1 unit PlatinumTaq polymerase (GIBCO BRL), 0.5 M of each of the forward and reverse primers (Table II) and 2 l of cDNA. The first PCR products were diluted 1:100, and 2 l of this dilution were reamplified in a second PCR with the inner primers. The PCR was run on a PCT-200 DNA Engine (MJ Research, Waltham, MA), and all amplifications had an identical cycling profile: initial denaturation at 94°C for 5 min, followed by 30 cycles of 1 min at 94°C, 1 min at 60°C, 1 min at 72°C and a final extension for 10 min at 72°C. For amplification of the EWS/ATF1 fusion transcripts, primers EWS501F and ATF902R as well as EWS225F and ATF803R were used as outer and inner primer combinations, respectively (Table II). For amplification of the ATF1/EWS fusion transcript, primers ATF92F and EWS1453R as well as ATF192F and EWS1389R were used as outer and inner primer combinations, respectively (Table II). Genomic extra long PCR For the detection of genomic EWS/ATF1 and ATF1/EWS hybrids, extra long (XL) PCR was carried out using the XL PCR kit (PE Applied Biosystems, Foster City, CA) with the primers listed in Table II. Reactions were carried out in 100 l of 1:3 diluted 3.3 ⫻ XL buffer, 1.1 mM Mg(OAc)2, 0.2 mM of each dNTP, 1 unit of rTth DNA polymerase XL, 0.4 M of each of the forward and reverse primers and 1.0 g DNA. Two microliters of the first PCR product were reamplified in a second PCR. For the first and second rounds of PCR for EWS/ATF1, we used primers EWS868F and ATF488R as well as EWS964F and ATF436R, respectively (for case 2, primers EWS685F and ATF664R as well as EWS720F and ATF561 were used). The ATF1/EWS chimera was generated by the primer sets ATF315F and EWS1059R as well as ATF362F and EWS1022R as outer and inner primer combinations, respectively (Table II). PCR cycles included denaturation for 1 min at 94°C, 32 cycles of 15 sec at 94°C, 10 min at 68°C and a final extension for 10 min at 72°C. Fifteen microliters of PCR product were analyzed by electrophoresis through 1.2% agarose gels, stained with ethidium bromide and photographed. Sequence analysis Fragments amplified by PCR were run on 1.2% agarose gels, purified using the Qiagen (Hilden, Germany) gel extraction kit and directly sequenced using the dideoxy procedure with an ABI Prism BigDye terminator cycle sequencing ready reaction kit (PE Applied Biosystems) with various primers on the model 373A DNA sequencing system. BLAST software [http://www.ncbi.nlm.nih. gov/BLAST/] was used for computer analysis of sequence data, and screening for repetitive elements was performed using the repeatmasker web server [http://ftp.genome.washington.edu/cgibin/RepeatMasker].
562
PANAGOPOULOS ET AL. TABLE II – PRIMERS USED FOR RT-PCR, GENOMIC XL PCR AND SEQUENCE ANALYSES Designation
Sequence(5⬘ 3 3⬘)
Direction
Position
Gene (accession number)
EWS501F EWS225F EWS685F EWS720F EWS868F EWS964F EWS1022R EWS1059R ATF92F ATF129F ATF315F ATF362F ATF436R ATF488R ATF561R ATF664R ATF803R ATF902R
CCAGCCCAGCCTAGGATATTGACA ACAGTTATCCCCAGGTACCTGGG TGGGCAACCGAGCAGCTATGGAC ATGGTCAACAAAGCAGCTATGGGC GGGTGTTTATGGGCAGGAGTCTGG TGATCGTGGAGGCATGAGCAGAG TTGAAGCCACCTCGCTCTCCAGC CAAGATCTGGTCCTTCATCCATGG GAGGGGGTGGGGAAGTGGGTAG CTGGGAGGGGGGAGTGGAAG AGGACTCATCCGACAGCATAGGC CTAGCACGGCGCCCATCTTACAG AGAAGTGACAGCAGCAGAAACTCCAG TGTCCGCTGCTAGTCTGATAGATGGG CCTGGACTTGCCAACTGTAAGGC TGATTGCTGGGCACAAGTATCTGC GGGGGTCATCTGTCTTAGTTGTCTG ACTCGGTTTTCCAGGCATTTCAC
Forward Forward Forward Forward Forward Forward Reverse Reverse Forward Forward Forward Forward Reverse Reverse Reverse Reverse Reverse Reverse
520–543 552–574 685–707 720–743 868–891 964–986 1022–1044 1059–1082 92–113 129–148 315–337 362–384 447–472 488–513 539–561 664–688 803–827 902–924
EWS (X66899) EWS (X66899) EWS (X66899) EWS (X66899) EWS (X66899) EWS(X66899) EWS(X66899) EWS (X66899) ATF1 (X55544) ATF1 (X55544) ATF1 (X55544) ATF1 (X55544) ATF1 (X55544) ATF1 (X55544) ATF1 (X55544) ATF1 (X55544) ATF1 (X55544) ATF1 (X55544)
TABLE III – EXON/INTRON MAP OF THE ATF1 GENE Exon/intron number
1 2 3 4 5 6 7 1
Introns1 (size, bp) Start . . . end
Exons (size, bp) Start . . . end (in X55522)
GCTTAGGACA . . . GCAGCCACAG 9–184 TTGATTATGG . . . TGCTCAACAG 185–283 GTATCATCTT . . . CATCTTACAG 284–384 AAAAATTTTG . . . GGACAGTACA 385–518 TTGCCATTGC . . . GTCGTACAAA 519–701 CTGCATCAGG . . . TGAAAAACAG 702–861 AGAAGCTGCT . . . TATCTTACGC 862–1141
(176)
gtaagtgggg . . . ccccttatag (⬎16,500)
(99)
gtaagggagg . . . tcttttttag (⬎3,500)
(101)
gtgagtactc . . . ttttttacag (13,448)
(134)
gtatgtatag . . . ttgattaaag (4,422)
(183)
gtaagtatgc . . . taccatctag (89)
(160)
gtaggtagta . . . tcatatttag (5,197)
(280)
Introns 1 and 2 estimated from the sequence with accession number AF013244.
RESULTS
Cytogenetic findings Cytogenetic data were available for all cases (Table I). A normal karyotype was found in case 6. The remaining 9 cases had abnormal karyotypes, with chromosome numbers ranging from hypodiploidy to hypertetraploidy. Case 2 was pseudodiploid with only 2 structural aberrations, whereas all other tumors showed multiple numerical and structural aberrations. The characteristic t(12;22)(q13;q12) was found in 7 cases. In case 8, there was a breakpoint in 12q13, but no involvement of 12q13 or 22q12 could be detected in case 10. No other recurrent structural rearrangements were seen, though 5 cases showed breakpoints in the pericentromeric region of chromosome 1. The most frequent genomic imbalances were ⫹8q (6 cases), –9p (4 cases) and ⫹1q12-q41, ⫹7 and –14pter-q22 (3 cases each). ATF1 genomic organization As an initial step in the characterization of the EWS/ATF1 and ATF1/EWS chimeras, we constructed an exon/intron map of the ATF1 gene. By searching the ATF1 cDNA (accession number X55544) against the sequences of GenBank⫹EMBL⫹DDBJ⫹ PDB through the blast service of the National Center for Biotechnology Information, a genomic clone (accession number AC013244) was retrieved that contained the ATF1 gene (except the first 8 nucleotides of the cDNA). The ATF1 cDNA was then aligned with the genomic sequence to identify splice sites and the number of exons. The entire ATF1 gene spanned ⬎40 kb and was composed of 7 exons (Table III). The size of introns 1 and 2 could not be determined precisely. All acceptor sites match the canonical GT/AG sequence.23 Exons 2 and 7 are the smallest (99 bp) and the
largest (280 bp), respectively. Exon 2 contains the initiation ATG codon. The phosphorylation box is encoded by exon 3, the basic domain by exons 6 and 7 and the leucine zipper by exon 7.24,25 Intron 3, in which most of the genomic breakpoints occurred, is 13,448 bp. It consists of 83% repetitive elements, including 19 Alu repeats, 1 LINE 1, 1 L3/CR1 and 2 MER1-type elements. RT-PCR analysis RT-PCR with EWS forward primers located in exon 6 (EWS501F and EWS225F) and ATF1 reverse primers located in exons 7 (ATF902R) and 6 (ATF803R) amplified cDNA fragments of various sizes in all patients (Fig. 1a, Table IV). PCR with ATF1 forward primers located in the first exon (ATF92F and ATF129F) and EWS reverse primers in exons 14 (EWS1559R) and 13 (EWS1453R) generated cDNA fragments in 6 of 10 patients (Fig. 1b, Table IV). To verify the presence and investigate further the type of EWS/ATF1 and ATF1/EWS chimeric transcripts, amplified products were analyzed by direct sequencing. Four types of EWS/ ATF1 chimeric transcript, types 1– 4, were determined (Fig. 1c, Tables IV, V). The most frequent chimeric transcript (type 1) was an in-frame fusion of exon 8 of EWS (corresponding to EWS cDNA nucleotide 1016 or codon 365) with exon 4 of the ATF1 gene (corresponding to ATF1 cDNA nucleotide 385 or codon 65) (Table V). This transcript was found in 8 patients, as the only chimeric transcript in 5 patients and together with other variants in 3 patients (Table V). The type 2 transcript of EWS/ATF1, an in-frame fusion of exon 7 of EWS (corresponding to EWS cDNA nucleotide 836 and codon 265) with exon 5 of ATF1 (corresponding to ATF1 cDNA nucleotide 519 or codon 110), was detected in
563
MOLECULAR GENETICS OF CLEAR CELL SARCOMA
FIGURE 1 – Detection of chimeric transcripts in CCS. Total RNA was reverse-transcribed and cDNA used as template in PCR amplifications. (a) EWS/ATF1 chimeric transcripts detected in tumors from patients 1, 2 and 9 with EWS501F and ATF902R primers. (b) ATF1/ EWS chimeric transcripts amplified in patients 7 and 2 using the ATF92F and EWS1559R primer combination. B, No RNA in the cDNA synthesis; N, cDNA in the PCR amplification from K562 chronic myeloid leukemia cell line; M, 100 bp DNA ladder. (c) Partial sequence chromatograms showing the 4 identified types (1– 4) of EWS/ATF1 chimeric transcript. Arrows indicate the junction of the EWS and ATF1 genes. (d) Partial sequence chromatograms showing the 2 identified types of ATF1/EWS chimeric transcript. Arrows indicate the junction of the ATF1 and EWS genes. TABLE IV – AMPLIFIED EWS/ATF1 AND ATF1/EWS TRANSCRIPTS Case
First-round RT-PCR EWS501F ⫹ ATF902R fragment (bp)
Nested RT-PCR EWS225F ⫹ ATF803R fragment (bp)
First-round RT-PCR ATF92F ⫹ EWS1559R fragment (bp)
Nested RT-PCR ATF129F ⫹ EWS1453R fragment (bp)
1 2 3 4 5 6 7 8a–c 9 10
1,038 723 1,038 1,038 1,038,723 1,038 1,038 1,038,723 975 1,038,723,380
909 594 909 909 909,594 909 909 909,594 846 909,594
Negative 1,064 796 796 796 796 796 Negative Negative Negative
Negative 914 646 646 646 646 646 Negative Negative Negative
4 patients (Table V), as the only transcript in 1 case (Fig. 1a) and together with other variants in 3 cases (Table IV). An in-frame fusion of exon 10 of EWS with exon 5 of ATF1 (type 3) was found as the only transcript in patient 9 (Fig. 1a, Table V). Finally, an out-of-frame fusion of EWS exon 7 with ATF1 exon 7 (type 4) was detected together with transcript types 1 and 2 in patient 10. Sequencing of the amplified ATF1/EWS cDNA fragments showed that ATF1 exon 3 was fused with EWS exon 10, resulting in an out-of-frame chimeric transcript, in patients 3–7 (Fig. 1b,d, Tables IV, V). In case 2, nucleotide 428 of ATF1 (in exon 4) was fused with EWS exon 8 (Fig. 1Bb,d). At the junction, there was an insertion of 4 nucleotides (TGCA), also resulting in an out-offrame chimeric transcript. Cloning genomic breakpoints Nested XL PCR with 2 forward EWS primers located in exon 7 (EWS685F and EWS720F) and 2 reverse ATF1 primers located in exon 5 (ATF575R and ATF561R) generated a 5.3 kb fragment in case 2. PCR with the EWS868F (located in exon 8) and ATF488R
(located in exon 4) primer combination successfully amplified genomic fragments of 3.5, 9.0, 4.0 and 6.0 kb from cases 1, 5, 7 and 8, respectively, but not from a healthy individual (data not shown). Nested PCR with EWS964F and ATF436R primers generated genomic fragments of 3.3, 8.8, 3.8 and 5.8 kb from cases 1, 5, 7 and 8, respectively (Fig. 2a). No amplified fragments were observed in the other cases, not even when analyzed with nested PCR. The reciprocal fusion was successfully amplified only in case 5 (Fig. 2b). XL PCR with the ATF315F (located in exon 3) and the EWS1059R (located in exon 10) primers gave rise to an 8.3 kb fragment in case 5 (Fig. 2b). Sequence analyses showed that the amplified fragments obtained by the EWS868F and ATF488R primer combination were genomic 5⬘-EWS/ATF1-3⬘ hybrids and that the one amplified with the primers ATF315F and EWS1059R was a genomic 5⬘-ATF1/ EWS-3⬘ chimera (Fig. 2c,d). In case 1, the breakpoints in the EWS/ATF1 fusion were located at nucleotide 2103 of EWS intron 8 and at nucleotide 12078 of
564
PANAGOPOULOS ET AL. TABLE V – MOLECULAR DATA ON 10 CASES OF CCS
Cases
1 2 3 4 5 6 7 8a–c 9 10
1
EWS/ATF1 transcript
EWS EWS EWS EWS EWS EWS EWS EWS EWS EWS EWS EWS EWS EWS
exon exon exon exon exon exon exon exon exon exon exon exon exon exon
8/ATF1 exon 4 7/ATF1 exon 5 8/ATF1 exon 4 8/ATF1 exon 4 8/ATF1 exon 4, 7/ATF1 exon 5 8/ATF1 exon 4 8/ATF1 exon 4 8/ATF1 exon 4, 7/ATF1 exon 5 10/ATF1 exon 5 8/ATF1 exon 4, 7/ATF1 exon 5, 7/ATF1 exon 7
ATF1/EWS transcript1
EWS/ATF1 genomic
ATF1/EWS genomic
Negative ATF1 nt428/TGCA/EWS exon 8 ATF1 exon 3/EWS exon 10 ATF1 exon 3/EWS exon 10 ATF1 exon 3/EWS exon 10
EWS intron 8/ATF1 intron 3 EWS intron 7/ATF1 exon 4 Negative Negative EWS intron 9/ATF1 intron 3
Negative Not done Negative Negative ATF1 intron 3/EWS intron 9
ATF1 exon 3/EWS exon 10 ATF1 exon 3/EWS exon 10 Negative
Negative EWS intron 9/ATF1 intron 3 EWS intron 8/ATF1 intron 3
Negative Not done Negative
Negative Negative
Negative Not done
Negative Not done
All detected ATF1/EWS transcripts were out-of-frame.
FIGURE 2 – XL PCR for the detection of EWS/ATF1 and the reciprocal ATF1/EWS hybrid genomic DNA. (a) Nested PCR for EWS/ATF1 using the EWS964F and ATF436R primer combination amplified genomic fragments of 3.5 kb in case 1, 9.0 kb in case 5 and 4.0 kb in case 7 but not from cases 3 and 4. (b) PCR for ATF1/EWS using the ATF315F and the EWS1059R primer combination amplified a 8.3 kb fragment in case 5; no fragments were observed in the other cases. M, 1 kb DNA ladder; B, blank (no DNA in PCR). (c) Partial nucleotide sequence spanning the genomic breakpoints of the EWS/ATF1 chimeras. (d) Partial nucleotide sequence spanning the genomic breakpoints of the ATF1/ EWS chimeras. Arrows show the junction between the 2 genes. Numbers refer to positions in the intronic sequences. In cases 1 and 7, there was an end-to-end fusion between EWS and ATF1. Insertions of 40 and 3 nucleotides were found at the junction in cases 2 and 8, respectively. Boxed sequences are topoisomerase I sites.
ATF1 intron 3, roughly 230 nucleotides upstream of an AluS repeat (Fig. 2c). In case 2, the breaks occurred at nucleotide 548 of intron 7 of the EWS gene and in exon 4 of ATF1 (nucleotide 481 in the cDNA sequence with accession number X55444). In case 5, the breakpoints in the EWS/ATF1 fusion were located at nucleotide 477 of EWS intron 9 and at nucleotide 8144 of ATF1 intron 3. In the reciprocal ATF1/EWS, the breakpoints were located at nucleotide 8056 of ATF1 intron 3 and at nucleotide 506 of EWS intron 9. Thus, deletions of 29 and 88 nucleotides in the EWS and ATF1 genes, respectively, accompanied the translocation (Fig. 2c,d). In case 7, the breakpoints in the EWS/ATF1 fusion were located at nucleotide 1914 of EWS intron 8 and at nucleotide 11373 of ATF1 intron 3, 24 nucleotides upstream of a LINE-1 element. In case 8, the breakpoints in the EWS/ATF1 fusion were located at nucleotide
504 of EWS intron 8 and at nucleotide 7989 of ATF1 intron 3, in the beginning of a LINE-1 element. DISCUSSION
The pattern of cytogenetic aberrations detected in the present CCS series is very similar to that found in previously published cases.3,12 The combined data show that these tumors are, with few exceptions, characterized by multiple chromosomal rearrangements and unbalanced karyotypes. The 12;22 translocation was found in 22 of 31 cases. Complete or partial gain of chromosome 8 was frequently seen, with gain of 8q being detected in 22 cases. Other imbalances present in at least one-fifth of the cases were ⫹7p11-q35 (13 cases), –9p (10 cases), –1p36 (8 cases), –14pter-
MOLECULAR GENETICS OF CLEAR CELL SARCOMA
565
FIGURE 3 – Diagram showing the currently known EWS/ATF1 chimeric transcripts found in CCS based on the present study and literature data, altogether 23 cases. Number of cases with the different types of transcript is given in parentheses. Type 2 transcript has been found as the only transcript in 4 tumors and together with type 1 in 3 tumors, whereas type 4 was found together with type 1 and type 2 transcripts in 1 tumor.
q22 (7 cases) and ⫹1q12-q41, – 6q, –11q23-q25, –15q22-qter, –16q22-qter and ⫹17q (6 cases each). There was a good correspondence between the cytogenetic and molecular genetic findings. The only discrepancies were seen in cases 8 and 10, in which EWS/ATF1 fusions were found but no t(12;22). In case 8, there was rearrangement of 12q13 but not 22q12, and neither band 12q13 nor 22q12 was rearranged in case 10. In case 6, it appears that there was outgrowth of stromal cells, giving rise to the normal karyotype. Prior to the present study, molecular genetic data were available on 13 CCSs. EWS/ATF1 transcript types 1, 2 and 3 had been found in 9, 3 and 1 tumors, respectively.10,11,13–19 In the present study, 3 cases showed multiple transcripts as the result of alternative splicing. The most common fusion transcript was type 1 (EWS exon 8 fused with ATF1 exon 4), found in 8 patients, followed by type 2 (EWS exon 7 fused with ATF1 exon 5), found in 4 patients, though only in 1 case as the sole chimeric transcript (Fig. 1, Tables IV, V). The type 3 transcript (EWS exon 10 fused with ATF1 exon 5) was also found in 1 case as the only transcript, and, finally, an out-offrame fusion of EWS exon 7 with ATF1 exon 7 was detected in patient 10 together with transcript types 1 and 2 (Fig. 1a, Tables IV, V). Taking all data into consideration, it appears that type 1 is the most common chimeric EWS/ATF1 transcript in CCS (Fig. 3). The EWS gene is the 5⬘ partner in many sarcoma-associated fusion genes. Exon 7 of EWS is the most frequent site of fusion in Ewing’s sarcoma and related primitive neuroectodermal tumors, in which the EWS gene is fused to the part encoding the DNAbinding domain of various members of the ETS family of genes.26,27 Similarly, exon 7 is the most common fusion point in the EWS/WT1 and EWS/CHOP chimeras found in desmoplastic small round cell tumors and myxoid liposarcomas, respectively.26,28 –30 In extraskeletal myxoid chondrosarcoma, however, exon 12 of EWS is the most common fusion point in EWS/CHN chimeras, though hybrid transcripts with EWS exon 7/CHN have been described.31 In CCS, EWS exon 8 appears to be the preferred fusion point, but transcripts joining EWS exon 7 with ATF1 (types 2 and 4) may also be generated. Exon 8 of EWS significantly contributes to the transcription activation of the EWS/ATF1 chimera. Constructs lacking exon 8 of EWS in the EWS/ATF1 transcript activated transcription 3 time less efficiently than those containing exon 8.32 Moreover, the beginning of exon 8 codes for serine-266, which is the protein kinase phosphorylation site.33,34 Phosphorylation of serine-266 regulates DNA-binding activity, transcriptional activation and subcellular localization of the EWS/ATF1 chimera.34 Thus, the different types
of chimeric transcript might have different oncogenetic potentials and different prognostic impacts. The only previous investigation on the reciprocal ATF1/EWS transcript is that by Zucman et al,13 who showed that ATF1/EWS was formed but that it was out-of-frame due to a deletion or splicing out of exon 9 of EWS. In the present study, ATF1/EWS was not found in all tumors. Indeed, only 6 of 10 patients with EWS/ATF1 carried a reciprocal ATF1/EWS transcript, which, in all cases, was out-of-frame (Fig. 1b,d Tables IV, V). In 5 patients, the ATF1/EWS transcript was identical to that detected by Zucman et al.13 The transcript was lacking exon 9 of EWS, and the deduced translation product would be a protein composed of the first 65 amino acids of ATF1 followed by 3 amino acids (threonine, histidine and glutamine) before the stop codon. In case 2, the out-of frame ATF1/EWS fusion was caused by insertion of 4 nucleotides at the fusion point (Fig. 1b,d). Thus, it may be concluded that ATF1/EWS transcripts are not involved in tumorigenesis. As an initial step in the characterization of the genomic breakpoints, an exon/intron map of the ATF1 gene was constructed (Table III). Previously, there was no information on the genomic structure of ATF1, and hence, the position of the breaks could not be determined. Using genomic XL PCR and sequence analyses, the breakpoints were mapped to intron 3 in 4 cases and to exon 4 in 1 case (Fig. 2). In case 1, the break was close to an AluS repeat and, in cases 7 and 8, close to LINE repetitive elements. It is noteworthy that 83% of the sequence of intron 3 of ATF1 is composed of repetitive elements. Clustering of such motifs may make a region unstable and highly plastic, increasing the likelihood of rearrangements.35 Although homologous recombination between various repetitive elements was not observed, the involvement of these sequences in the genesis of chromosomal translocations cannot be ruled out. In EWS, the breaks occurred in introns 7, 8 and 9. Intron 7 contains repetitive elements and appears to be prone to illegitimate recombination.36 However, intron 8, which harbors most of the breakpoints in CCS, does not contain any repetitive elements. One possible reason for the breakpoint clustering in intron 8 is the maintenance of an open reading frame in the type 1 EWS/ATF1 chimeric transcript. In Ewing’s sarcoma with EWS exon 7 fusions, about half of the genomic rearrangements actually occur in intron 8 of EWS, similar to CCS.36 However, exon 8 of EWS is spliced out in the chimeric RNA because it would interrupt the reading frame. In case 7, the break occurred in intron 9 and the open reading frame of EWS/ATF1 was maintained by splicing out EWS exon 9.
566
PANAGOPOULOS ET AL.
While in cases 1 and 7 a simple end-to-end fusion was observed (the genomic sequences of ATF1 followed directly those of EWS), additional nucleotides were found at the junctions in cases 2 and 8 and a microdeletion was seen in case 5 (Fig. 2c,d). In case 2, a 40-nucleotide insertion was detected, which did not reveal any similarities with other known sequences. Perhaps the 40-nucleotide insertion was synthesized de novo during the process of recombination. In case 8, a trinucleotide AAA of unknown origin was found at the junction; and in case 5, the translocation was accompanied by deletions of 29 and 88 nucleotides in the EWS and ATF1 genes, respectively. Such concomitant genetic events are frequent at, or in the vicinity of, the breakpoints of fusion genes and have been reported in Ewing’s sarcoma, myxoid liposarcoma and leukemias.35–39 This indicates that the chromosomal translocations do not require sequence-specific recombinases or extensive
homology between the recombined sequences.40 Moreover, in all cases, topoisomerase I consensus sequences [A/T-C/G-A/T-T] were found close to the junctions, suggesting that topoisomerase I may participate in the genesis of the EWS/ATF1 chimera (Fig. 2c,d). Topoisomerase I sites have also been described at the junctions of RET rearrangements in radiation-induced papillary thyroid carcinomas41 and at the breakpoints of other illegitimate recombinations,42,43 but functional data supporting the involvement of topoisomerase I in generating neoplasia-associated chromosomal abnormalities are lacking. ACKNOWLEDGEMENTS
We are grateful to Dr. P. Pauwels (Eindhoven, the Netherlands) for providing material from case 2.
REFERENCES
1. 2. 3. 4. 5. 6. 7. 8. 9.
10.
11.
12. 13.
14.
15.
16. 17. 18.
19.
20.
Enzinger FM. Clear-cell sarcoma of tendons and aponeuroses. An analysis of 21 cases. Cancer 1965;18:1163–74. Enzinger FM, Weiss SW. Soft tissue tumors, 3rd ed. St. Louis: Mosby, 1995. Sandberg AA, Bridge JA. Updates on the cytogenetics and molecular genetics of bone and soft tissue tumors: clear cell sarcoma (malignant melanoma of soft parts). Cancer Genet Cytogenet 2001;130:1–7. Chung EB, Enzinger FM. Malignant melanoma of soft parts. A reassessment of clear cell sarcoma. Am J Surg Pathol 1983;7:405–13. Deenik W, Mooi WJ, Rutgers EJ, Peterse JL, Hart AA, Kroon BB. Clear cell sarcoma (malignant melanoma) of soft parts: a clinicopathologic study of 30 cases. Cancer 1999;86:969 –75. Eckardt JJ, Pritchard DJ, Soule EH. Clear cell sarcoma. A clinicopathologic study of 27 cases. Cancer 1983;52:1482– 8. Lucas DR, Nascimento AG, Sim FH. Clear cell sarcoma of soft tissues. Mayo Clinic experience with 35 cases. Am J Surg Pathol 1992;16:1197–204. Finley JW, Hanypsiak B, McGrath B, Kraybill W, Gibbs JF. Clear cell sarcoma: the Roswell Park experience. J Surg Oncol 2001;77:16 –20. Graadt van Roggen JF, Mooi WJ, Hogendoorn PC. Clear cell sarcoma of tendons and aponeuroses (malignant melanoma of soft parts) and cutaneous melanoma: exploring the histogenetic relationship between these two clinicopathological entities. J Pathol 1998;186:3–7. Hiraga H, Nojima T, Abe S, Yamashiro K, Yamawaki S, Kaneda K, Nagashima K. Establishment of a new continuous clear cell sarcoma cell line. Morphological and cytogenetic characterization and detection of chimaeric EWS/ATF-1 transcripts. Virchows Arch 1997;431: 45–51. Sonobe H, Takeuchi T, Taguchi T, Shimizu K, Iwata J, Furihata M, Ohtsuki Y. Further characterization of the human clear cell sarcoma cell line HS-MM demonstrating a specific t(12;22)(q13;q12) translocation and hybrid EWS/ATF-1 transcript. J Pathol 1999;187:594 –7. Mitelman F, Johansson B, Mertens F, eds. Mitelman database of chromosome aberrations in cancer. 2001. [http://cgap.nci.nih.gov/ Chromosomes/Mitelman] Zucman J, Delattre O, Desmaze C, Epstein AL, Stenman G, Speleman F, Fletcher CD, Aurias A, Thomas G. EWS and ATF-1 gene fusion induced by t(12;22) translocation in malignant melanoma of soft parts. Nat Genet 1993;4:341–5. Speleman F, Delattre O, Peter M, Hauben E, Van Roy N, Van Marck E. Malignant melanoma of the soft parts (clear-cell sarcoma): confirmation of EWS and ATF-1 gene fusion caused by a t(12;22) translocation. Mod Pathol 1997;10:496 –9. Pellin A, Monteagudo C, Lopez-Gines C, Carda C, Boix J, LlombartBosch A. New type of chimeric fusion product between the EWS and ATF1 genes in clear cell sarcoma (malignant melanoma of soft parts). Genes Chromosomes Cancer 1998;23:358 – 60. Ohba Y, Suzuki H, Hiraga H, Ito T, Sawa H, Nagai M, Satoh SI, Iwaki H, Nagashima K. Melanotic peritoneal sarcomatosis originating from clear cell sarcoma. Pathol Int 1999;49:653–7. Fukuda T, Kakihara T, Baba K, Yamaki T, Yamaguchi T, Suzuki T. Clear cell sarcoma arising in the transverse colon. Pathol Int 2000; 50:412– 6. Naito N, Kawai A, Ouchida M, Dan’ura T, Morimoto Y, Ozaki T, Shimizu K, Inoue H. A reverse transcriptase-polymerase chain reaction assay in the diagnosis of soft tissue sarcomas. Cancer 2000;89: 1992– 8. Langezaal SM, Graadt van Roggen JF, Cleton-Jansen AM, Baelde JJ, Hogendoorn PC. Malignant melanoma is genetically distinct from clear cell sarcoma of tendons and aponeurosis (malignant melanoma of soft parts). Br J Cancer 2001;84:535– 8. Mandahl N, Heim S, Arheden K, Rydholm A, Will´en H, Mitelman F.
21. 22. 23. 24.
25. 26. 27.
28. 29.
30.
31.
32. 33. 34. 35.
36. 37.
38.
Three major cytogenetic subgroups can be identified among chromosomally abnormal solitary lipomas. Hum Genet 1988;79:203– 8. Mitelman F, ed. ISCN. An international system for human cytogenetic nomenclature. Basel: Karger, 1995. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1989. Breathnach R, Chambon P. Organization and expression of eucaryotic split genes coding for proteins. Annu Rev Biochem 1981;50:349 – 83. Yoshimura T, Fujisawa J, Yoshida M. Multiple cDNA clones encoding nuclear proteins that bind to the tax-dependent enhancer of HTLV-1: all contain a leucine zipper structure and basic amino acid domain. EMBO J 1990;9:2537– 42. Masson N, John J, Lee KA. In vitro phosphorylation studies of a conserved region of the transcription factor ATF1. Nucleic Acids Res 1993;21:4166 –73. Kim J, Pelletier J. Molecular genetics of chromosome translocations involving EWS and related family members. Physiol Genom 1999;1: 127–38. Sandberg AA, Bridge JA. Updates on cytogenetics and molecular genetics of bone and soft tissue tumors: Ewing sarcoma and peripheral primitive neuroectodermal tumors. Cancer Genet Cytogenet 2000; 123:1–26. Panagopoulos I, H¨oglund M, Mertens F, Mandahl N, Mitelman F, ˚ man P. Fusion of the EWS and CHOP genes in myxoid liposarcoma. A Oncogene 1996;12:489 –94. ˚ man P, Samson I, Mandahl N, Dal Cin P, Sciot R, Panagopoulos I, A Mitelman F, Van den Berge H, Fletcher CDM. Additional evidence of a variant translocation t(12;22) with EWS/CHOP fusion in myxoid liposarcoma: clinicopathological features. J Pathol 1997;182:437– 41. Antonescu CR, Elahi A, Healey JH, Brennan MF, Lui MY, Lewis J, Jhanwar SC, Woodruff JM, Ladanyi M. Monoclonality of multifocal myxoid liposarcoma: confirmation by analysis of TLS-CHOP or EWSCHOP rearrangements. Clin Cancer Res 2000;6:2788 –93. Labelle Y, Zucman J, Stenman G, Kindblom L-G, Knight J, TurcCarel C, Dockhorn-Dworniczak B, Mandahl N, Desmaze C, Peter M, Aurias A, Delattre O, et al. Oncogenic conversion of a novel orphan nuclear receptor by chromosome translocation. Hum Mol Genet 1995; 4:2219 –26. Pan S, Ming KY, Dunn TA, Li KK, Lee KA. The EWS/ATF1 fusion protein contains a dispersed activation domain that functions directly. Oncogene 1998;16:1625–31. Deloulme JC, Prichard L, Delattre O, Storm DR. The prooncoprotein EWS binds calmodulin and is phosphorylated by protein kinase C through an IQ domain. J Biol Chem 1997;272:27369 –77. Olsen RJ, Hinrichs SH. Phosphorylation of the EWS IQ domain regulates transcriptional activity of the EWS/ATF1 and EWS/FLI1 fusion proteins. Oncogene 2001;20:1756 – 64. Wiemels J, Alexander F, Cazzaniga G, Biondi A, Mayer S, Greaves M. Microclustering of TEL-AML1 translocation breakpoints in childhood acute lymphoblastic leukemia. Genes Chromosomes Cancer 2000;29:219 –28. Zucman-Rossi J, Legoix P, Victor JM, Lopez B, Thomas G. Chromosome translocation based on illegitimate recombination in human tumors. Proc Natl Acad Sci USA 1998;95:11786 –91. Kanoe H, Nakayama T, Hosaka T, Murakami H, Yamamoto H, Nakashima Y, Tsuboyama T, Nakamura T, Ron D, Sasaki MS, Toguchida J. Characteristics of genomic breakpoints in TLS-CHOP translocations in liposarcomas suggest the involvement of Translin and topoisomerase II in the process of translocation. Oncogene 1999; 18:721–9. Gillert E, Leis T, Repp R, Reichel M, Hosch A, Breitenlohner I,
MOLECULAR GENETICS OF CLEAR CELL SARCOMA
Angermuller S, Borkhardt A, Harbott J, Lampert F, Griesinger F, Greil J, et al. A DNA damage repair mechanism is involved in the origin of chromosomal translocations t(4;11) in primary leukemic cells. Oncogene 1999;18:4663–71. 39. Reichel M, Gillert E, Nilson I, Siegler G, Greil J, Fey GH, Marschalek R. Fine structure of translocation breakpoints in leukemic blasts with chromosomal translocation t(4;11): the DNA damage-repair model of translocation. Oncogene 1998;17:3035– 44. 40. Pfeiffer P, Goedecke W, Obe G. Mechanisms of DNA double-strand break repair and their potential to induce chromosomal aberrations. Mutagenesis 2000;15:289 –302.
567
41. Klugbauer S, Pfeiffer P, Gassenhuber H, Beimfohr C, Rabes HM. RET rearrangements in radiation-induced papillary thyroid carcinomas: high prevalence of topoisomerase I sites at breakpoints and microhomology-mediated end joining in ELE1 and RET chimeric genes. Genomics 2001;73:149 – 60. 42. Konopka AK. Compilation of DNA strand exchange sites for nonhomologous recombination in somatic cells. Nucleic Acids Res 1988; 16:1739 –58. 43. Murru S, Casula L, Pecorara M, Mori P, Cao A, Pirastu M. Illegitimate recombination produced a duplication within the FVIII gene in a patient with mild hemophilia A. Genomics 1990;7:115– 8.
