MOLECULAR IDENTIFICATION OF ENDOPHYTIC

Jurnal Farmasi Indonesia Vol. 4 No. 4 Juli 2009: 156 -160

MOLECULAR IDENTIFICATION OF ENDOPHYTIC FUNGI ISOLATED FROM Garcinia porrecta AND Garcinia forbesii Maksum Radji, Femi Arifah Nugraheni, Atiek Sumiati Laboratory of Microbiology and Biotechnology, Department of Pharmacy Faculty of Mathematics and Sciences, University of Indonesia. Depok, 16424, Indonesia Korespondensi: Dr. Maksum Radji MBiomed. Departemen Farmasi Fakultas Matematika dan Ilmu Pengetahuan Alam Universitas Indonesia, Depok 16424, Indonesia [email protected]

ABSTRAK Penelitian ini dilakukan untuk mengidentifikasi isolat-isolat kapang endofit yang telah diisolasi dari tanaman Garcinia porrecta dan Garcinia forbesii yang dikoleksi di Laboratorium Mikrobiologi dan Bioteknologi Departemen Farmasi Universitas Indonesia. Lima galur isolat yang telah terbukti menunjukkan bioaktivitasnya sebagai antimikroba dan antioksidan diidentifikasi secara molekuler menggunakan profil sekuen DNA yang berasal dari gen penyandi ribosomal RNA. Identifikasi isolat kapang endofit dilakukan dengan metode Polymerase Chain Reaction (PCR) menggunakan primer NS1 dan NS4. Hasil amplifikasi dengan PCR selanjutnya dianalisis dengan sekuensing DNA yang kemudian dibandingkan dengan data pada GenBank dengan program BLAST (Basic Local Alignment Search Tools). Berdasarkan hasil analisis sekuens DNA, 5 isolat berhasil diidentifikasi. Empat isolat kapang endofit teridentifikasi sampai tingkat spesies yaitu: Penicillium purpurogenum, Zasmidium cellare, Colletothricum gloeosporioides, dan Nectria curta. Sedangkan satu isolat lain teridentifikasi sampai tingkat genus yaitu Pestalotiopsis sp. Kata kunci: Garcinia porrecta, Garcinia forbesii, identifikasi molekuler, endofit.

ABSTRACT The objective of this study was to identify the endophytic fungi isolated from Garcinia porrecta and Garcinia forbesii deposited in Laboratory of Microbiology and Biotechnology, Department of Pharmacy, University of Indonesia by using molecular tools. Five isolates of endophytic strains which were displayed the strongest antibacterial and antioxidant activities were identified based on ribosomal RNA (rRNA) gene sequence analysis. The Polymerase Chain Reaction (PCR) was used to identify these endophytic fungi by using primer NS1 and NS4. Amplicon or PCR product was analyzed by sequencing method to determine the DNA sequence. The result of sequencing DNA then compared with GenBank’s database using Basic Local Alignment Search Tool (BLAST). The results revealed that five isolates of endophytic strains had been successfully identified by this method. Four of them were identified up to the level of species as Penicillium purpurogenum, Zasmidium cellare, Colletothricum gloeosporioides, and Nectria curta, while the other one was identified up to the level of genus namely Pestaloptiosis sp. Keywords: Garcinia porrecta, Garcinia forbesii, molecular identification, endophytic fungi.

156

Molecular identification of endophytic fungi isolated from Garcinia porrecta and G.forbesii (Maksum Radji, Femi Arifah Nugraheni, Atiek Sumiati )

INTRODUCTION Endophytic microorganisms live within host plants without causing any noticeable symptoms of disease (1). It is hypothesized that the endophytes, in contrast to known pathogens, generally have far greater phenotypic plasticity and thus more options to interact with their host than pathogens (2). Endophytic fungi have been recognized as useful sources of bioactive secondary metabolites. The coevolving with the medicinal plants, some endophytic fungi have developed the abilities to produce same or similar bioactive substances as their host plants produces (3,4,5). Many endophytic fungi have the ability to produce antimicrobial substances (6,7,8,9,10,11,12,13,14) Garcinia plants belong to the family Clusiaceae have been used as a traditional medicine in many countries. Garcinia plants are native plants to Asia, Australia, southern Africa, and Polynesia. Some species have been used in traditional medicine to treat infections. In Indonesia, leaves and seeds of G.dulcis have been used for the treatment of lymphangitis, trauma and parotitis (15). In Thailand, pericarps of G. mangostana have been used as an antidiarrheal agent and for the treatment of wounds (16). The increasing consumption of Garcinia plants in recent years, over exploitation and over cutting of original plants has caused depletion of natural resources. In the recent years some investigation have been carried out to isolate and to elucidate the bioactive substances of Garcinia plants. Some of previous studies demonstrated that the endophytic fungi isolated from Garcinia species (17), Garcinia porrecta and Garcinia forbesii produced antimicrobial substances against human pathogens (18) and antioxidant activity (19).

Therefore it is necessary to carry out the systematic investigation of endophyitic fungi from Garcinia plants, not only to find the new bioactive strains but also to provide the useful ecological information about endophytic fungi in Garcinia. The objective of this study was to identify the potentially useful endophytic fungi isolated from Garcinia porrecta and Garcinia forbesii which were displayed the strongest antimicrobial and antioxidant activity by using molecular tools. MATERIALS AND METHODS Source of endopyhic fungi Five endophytic strains used in this study were taken from the culture collection of the Laboratory of Microbiology and Biotechnology, Department of University of Indonesia. They were isolated previously from Garcinia porrecta and Garcinia forbesii. The endophytic strains (BF6, BP8, IxDF, AFI4 and DPI3) which were used in this study have displayed the strongest antibacterial activity and antioxidant activity. Each fungal isolate was checked for purity and transferred to the potato dextrose agar (PDA) medium, and incubated at 25oC for 5-7 days. The mycelia of fungi were inoculated into 5 ml potato dextrose broth (PDB) and incubated at room temperature for 5-7 days in orbital shaker. DNA extraction, PCR and DNA sequencing Genomic DNA was extracted from fungal mycelia using PrepMAN Ultra Sample Preparation Reagent kit according to the manufacturer's recommendation [Applied Biosystem]. Briefly, 200 l of the PrepMAN Ultra Sample Preparation Reagent kit was transferred to a micro tube with a capacity of 1.5 ml. The mycelia of 157


endophytic fungi from PDA medium to amplify the gene encoding for 18S were added into the reagent kit and rRNA in genomic DNA of endophytic were homogenized by vortex for 30 fungi isolated from Garcinia porrecta seconds. The micro tube was and Garcinia forbesii. The PCR assay incubated for 10 min at 100°C and of five isolate strains (BF6, BP8, IxDF, immediately chilled on ice. The tube AFI4 and DPI3) showed the amplified was centrifuged for 3 min at 16,000 × g product of the size 1100 bp as shown at 4°C. The supernatant was carefully in Figure 1 and Figure 2. transferred to a new micro tube and an aliquot of 10 µl of the supernatant was used as the template DNA in the PCR. 1 2 3 M A pair of primer NS1 (5’GTAGTCATATGCTTGTCTC3’) [Qiagen] and NS4 (5’CTTCCGTCAATTCCTTTAAG3’) [Qiagen] were used to amplify the the highly specific for endophytic fungi targetting the gene encoding for 18S 1100 bp rRNA (20). PCR was carried out in a programmable thermal controller (MJ Mini Biorad). PCR reaction mixture (25 µl) contained of 10 µl template DNA, Figure 1. Gel electrophoresis of PCR 12.5 µl PCR Master Mix (PCR Buffer, product of isolated 4mM MgCl2, 0,4 mM of each dNTP, endophytic fungi. 0,05 U/µl Taq polymerase; Fermentas), M=1 kb Plus DNA Ladder 1 µM of each primer ( NS1 and NS4) lane 1=BF6; lane 2=BP8; lane and ddH2O to make up the volume. 3=IxDF The PCR cycling condition were: denaturation at 94oC for 1 min, primer annealing at 45oC for 2 min, and 1 2 M extension at 72oC for 2 minutes for a total 30 cycles and a final extension step at 72 °C for 10 minutes. PCR amplicons were electrophoresed in a 2 % agarose gel. 1100 bp After staining with ethidium bromide, the amplified fragments in the gel were visualized. The molecular mass marker used was 1kb plus DNA ladder marker (Invitrogen). Figure 2. Gel electrophoresis of PCR The amplified DNA fragment products of isolated approximately 1100 bp was purified endophytic fungi. and then was sequenced by Genetic M=1 kb Plus DNA Ladder; lane Analyzer [AB3130]. A BLAST (Basic 1 = AFI4; lane 2 = DPI3 Local Alignment Search Tools) was used to search for closest matched The screening of antimicrobial sequences in the GenBank database. activity and antioxidant activity of endophytic fungi of Garcinia porrecta RESULTS AND DISCUSSION and Garcinia forbesii (19,20), revealed that from 17 isolates which had been The NS1 and NS4 primer pair was isolated from Garcinia porrecta and used in this study revealed that specific Garcinia forbesii, some isolated 158

Molecular identification of endophytic fungi isolated from Garcinia porrecta and G.forbesii (Maksum Radji, Femi Arifah Nugraheni, Atiek Sumiati )

displayed antimicrobial and antioxidant activity. With regard to these previous study (19) we found that Colletotrichum gloeosporioides was the most active secondary metabolite producers which displayed antimicrobial activity, whereas the Nectria curta, Penicillium purpurogenum and Zasmidium cellare were exhibited antioxidant activities. These isolates could be good

candidates for further studies of their antimicrobial and antioxidant activities. In addition, investigation of the extract of the culture filtrate of the active isolates led to the isolation and structural elucidation of bioactive compound produced by these endophytic strains.

Table 1. Identity of endophytic fungal species isolated from Garcinia porrecta and Garcinia forbesii based on partly sequenced of isolates and BLAST database No

Isolate code

1

AFI4

2

BF6

3

IxDF

4

BP8

5

DPI3

Plant organ Roots (G.forbessi) Branches (G.forbessi) Leaves (G.forbessi) Branches (G.porrecta) Leaves (G.porrecta)

Most closely related fungal sequance

Identity (%)

Netria curta

98%

Colletotrichum gloeosporioides

99%

Zasmidium cellare

99%

Pestaloptiosis sp.

99%

Penicillium purpurogenum

99%

CONCLUSION From these results it can be concluded that the molecular analysis at the sequence level provided a powerful technique for assessing and identification of endophytic fungi isolated from Garcinia porrecta and Garcinia forbesii. The identity of endophytic fungi in this study were Penicillium purpurogenum, Pestaloptiosis sp. Colletothricum gloeosporioides, Zasmidium cellare and Nectria curta, REFERENCES 1. Pinto LSRC, Azevedo JL, Pereira JO, Vieira MLC, and Labate CA. Symptom less infection of banana and maize by endophytic fungi impairs photosynthetic efficiency. New Phytologist 2000; 147: 609-615.

2. Schultz, B. and Boyle, C. The endophytic continuum. Mycological Research, 2005; 109, 661-686. 3. Schulz B, Boyle C, Draeger S, Römmert A-K & Krohn K. Endophytic fungi: a source of novel biologically active secondary metabolites. Mycol Res 2002; 106: 996–1004. 4. Strobel GA. Endophytes as sources of bioactive products. Microbe Infect 2003; 5: 535–544. 5. Radji M. The role of Biotechnology and microbial endophytic in the development of herbal medicines. Indon J Pharm Scie 2005; 3: 113-118. 6. Stinson M, Ezra D, Hess WM, Sears J & Strobel G An endophytic Gliocladium sp. of Eucryphia cordifolia producing selective volatile antimicrobial compounds. Plant Sci 2003; 165: 913– 922. 7. Corrado M & Rodrigues KF. Antimicrobial evaluation of fungal extracts produced by endophytic strains 159


of Phomopsis sp. J Basic Microbiol 2004 44: 157–160. 8. Ezra D, Hess WM & Strobel GA. New endophytic isolates of Muscodor albus, a volatile-antibiotic-producing fungus. Microbiology 2004; 150: 4023–4031. 9. Kim S, Shin D-S, Lee T & Oh K-B. Periconicins, two new fusicoccane diterpenes produced by an endophytic fungus Periconia sp. with antibacterial activity. J Nat Prod 2004; 67: 448–450. 10. Liu JY, Song YC, Zhang Z, Wang L, Guo ZJ, Zou WX & Tan RX. Aspergillus fumigatus CY018, an endophytic fungus in Cynodon dactylon as a versatile producer of new and bioactive metabolites. J Biotechnol 2004; 114: 279–287. 11. Wiyakrutta S, Sriubolmas N, Panphut W, Thongon N, Danwisetkanjana K, Ruangrungsri N & Meevootisom V Endophytic fungi with anti-microbial, anti-cancer and anti-malarial activities isolated from Thai medicinal plants. World J Microbiol Biotechnol 2004; 20: 256–272 12. Atmosukarto I, Castillo U, Hess WM, Sears J & Strobel G. Isolation and characterization of Muscodor albus I41.3 s, a volatile antibiotic producing fungus. Plant Sci 2005; 169: 854–861. 13. Chomchoen P, Wiyakrutta S, Sriubolmas N, Ngamrojanavanich N, Isarangkul D & Kittakoop P. 3Nitropropionic acid (3-NPA), a potent antimycobacterial agent from endophytic fungi: is 3-NPA in some plants produced by endophytes? J Nat Prod 2005; 68: 1103–1105. 14. Li Y, Song YC, Liu JY, Ma YM & Tan RX. Anti- Helicobacter pylori substances from endophytic fungal cultures. World J Microbiol Biotechnol 2005; 21: 553–558.

160

15. Kasaha S & Henmi S. Medicinal Herb Index in Indonesia. 1986; Eisai Indonesia, Jakarta. 16. Farnsworth NR & Bunyapraphatsara N. Medicinal Plants. Recommended for Primary Health Care System.1992; Thai Prachachon Co. Ltd, Bangkok. 17. Phongpaichit S, Rungjindamai N, Rukachaisirikul V, Sakayaroj J. Antimicrobial activity in cultures of endophytic fungi isolated from Garcinia species. FEMS Immunol Med Microbiol 2006; 48: 367-372. 18. Taqwim SF. Toxicity Test and Antibacterial Test of Secondary Metabolites from Garcinia forbesii King and Garcinia porrecta Wall Endophytic Fungi Against Staphylococcus aureus, Bacillus subtilis, Escherichia coli, Salmonella typhosa, and Pseudomonas aeruginosa. Bachelor thesis. 2007; Department of Pharmacy University of Indonesia, Depok. 19. Farida Y. Antioxidant activity of Secondary Metabolites from Garcinia forbesii King and Garcinia porrecta Wall Endophytic Fungi. Bachelor thesis. 2008; Department of Pharmacy University of Indonesia, Depok. 20. Wu Z, Wang XR, Blomquist G. Evaluation of Primers and PCR Conditions for Spesific Detection of Common Airborne Fungi. J. Environ Monit, 2002. 4: 377-382.