Molecular Physiology and Pathophysiology of ... - CiteSeerX

Physiol Rev 85: 423– 493, 2005; doi:10.1152/physrev.00011.2004.

Molecular Physiology and Pathophysiology of Electroneutral Cation-Chloride Cotransporters GERARDO GAMBA Molecular Physiology Unit, Instituto Nacional de Ciencias Me´dicas y Nutricio´n Salvador Zubira´n and Instituto de Investigaciones Biome´dicas, Universidad Nacional Auto´noma de Me´xico, Mexico City, Mexico

I. Introduction II. Molecular Biology A. Na⫹-coupled chloride cotransporters B. K⫹-coupled chloride cotransporters C. Orphan members D. Genes and promoter characteristics E. Phylogenetic and sequence comparison III. Functional Properties A. Thiazide-sensitive Na⫹-Cl⫺ cotransporter B. Apical bumetanide-sensitive Na⫹-K⫹-2Cl⫺ cotransporter C. Basolateral bumetanide-sensitive Na⫹-K⫹-2Cl⫺ cotransporter D. K⫹-Cl⫺ cotransporter 1 E. K⫹-Cl⫺ cotransporter 2 F. K⫹-Cl⫺ cotransporter 3 G. K⫹-Cl⫺ cotransporter 4 H. Orphan members IV. Structure-Function Relationships A. Na⫹-coupled chloride cotransporters B. K⫹-coupled chloride cotransporters V. Physiological Roles A. Thiazide-sensitive Na⫹-Cl⫺ cotransporter B. Apical bumetanide-sensitive Na⫹-K⫹-2Cl⫺ cotransporter C. Basolateral bumetanide-sensitive Na⫹-K⫹-2Cl⫺ cotransporter D. K⫹-Cl⫺ cotransporter 1 E. K⫹-Cl⫺ cotransporter 2 F. K⫹-Cl⫺ cotransporter 3 G. K⫹-Cl⫺ cotransporter 4 VI. Pathophysiological Roles A. Gitelman’s disease B. Bartter’s disease C. Anderman’s disease D. Gordon’s disease E. Potential role in polygenic diseases VII. Conclusions and Perspective

424 424 425 430 432 433 435 437 437 439 442 442 444 446 447 448 448 448 457 458 459 461 463 466 466 468 469 470 470 473 476 476 478 481

Gamba, Gerardo. Molecular Physiology and Pathophysiology of Electroneutral Cation-Chloride Cotransporters. Physiol Rev 85: 423– 493, 2005; doi:10.1152/physrev.00011.2004.—Electroneutral cation-Cl⫺ cotransporters compose a family of solute carriers in which cation (Na⫹ or K⫹) movement through the plasma membrane is always accompanied by Cl⫺ in a 1:1 stoichiometry. Seven well-characterized members include one gene encoding the thiazide-sensitive Na⫹-Cl⫺ cotransporter, two genes encoding loop diuretic-sensitive Na⫹-K⫹-2Cl⫺ cotransporters, and four genes encoding K⫹-Cl⫺ cotransporters. These membrane proteins are involved in several physiological activities including transepithelial ion absorption and secretion, cell volume regulation, and setting intracellular Cl⫺ concentration below or above its electrochemical potential equilibrium. In addition, members of this family play an important role in cardiovascular and neuronal pharmacology and pathophysiology. Some of these cotransporters serve as targets for loop diuretics and thiazide-type diuretics, which are among the most commonly prescribed drugs in the world, and inactivating mutations of three members of the family cause inherited diseases such as Bartter’s, www.prv.org

0031-9333/05 $18.00 Copyright © 2005 the American Physiological Society

423

424

GERARDO GAMBA

Gitelman’s, and Anderman’s diseases. Major advances have been made in the past decade as consequences of molecular identification of all members in this family. This work is a comprehensive review of the knowledge that has evolved in this area and includes molecular biology of each gene, functional properties of identified cotransporters, structure-function relationships, and physiological and pathophysiological roles of each cotransporter.

I. INTRODUCTION In absorptive and secretory epithelia, transcellular ion transport depends on specific plasma membrane proteins for mediating ion entry into and exit from cells. In basolateral membrane of almost all epithelia (with exception of choroidal plexus), sodium exit and potassium entrance occur through Na⫹-K⫹-ATPase, generating electrochemical gradients that constitute a driving force for Na⫹ influx and K⫹ efflux. Transport of these ions following their gradients can be accomplished by specific ion channels, allowing membrane passage of ions alone or by transporters in which Na⫹ or K⫹ transport is accompanied by other ions or solutes by means of several different solute transporters. These membrane proteins are known as secondary transporters because ion or molecule translocation is not dependent on ATP hydrolysis but rather on gradients generated by primary transporters. A secondary transport mechanism that is very active in trancellular ion transport in epithelial cells is one in which cations (Na⫹ or K⫹) are coupled with chloride, with a stoichiometry of 1:1; therefore, ion translocation produces no change in transmembrane potential. For this reason, these transporters are known as electroneutral cation-Cl⫺ coupled cotransporters. In addition to being heavily implicated in ion absorptive and secretory mechanisms, electroneutral cation-Cl⫺ coupled cotransporters play a key role in maintenance and regulation of cell volume in both epithelial and nonepithelial cells. Because Na⫹ influx and K⫹ efflux by electroneutral cotransporters are rapidly corrected by Na⫹-K⫹-ATPase, the net effect of its activity is Cl⫺ movement inside or outside cells. This is known to be accompanied by changes in cell volume. Finally, a variety of new physiological roles for electroneutral cotransporters are emerging. One example is regulation of intraneuronal Cl⫺ concentration, thus modulation of neurotransmission (77). Four groups of electroneutral cotransporter systems have been functionally identified based on cation(s) coupled with chloride, stoichiometry of transport process, and sensitivity to inhibitors. These systems include 1) the benzothiadiazine (or thiazide)-sensitive Na⫹-Cl⫺ cotransporter, 2 and 3) the sulfamoylbenzoic (or bumetanide)sensitive Na⫹-K⫹-2Cl⫺ and Na⫹-Cl⫺ cotransporters, and 4) the dihydroindenyloxy-alkanoic acid (DIOA)-sensitive K⫹-Cl⫺ cotransporter. There is some overlap in sensitivity to inhibitors in the last two groups because Na⫹-K⫹-2Cl⫺ and K⫹-Cl⫺ cotransporters can be inhibited by high concentration of DIOA or loop diuretics, respectively; howPhysiol Rev • VOL

ever, affinity for inhibitor and the cation coupled with chloride clearly differentiate between both groups of transporters. Physiological evidence for these transport mechanisms became available at the beginning of the 1980s (341) (95, 138, 237), and a remarkable amount of information was generated in the following years by characterizing these transport systems in many different cells and experimental conditions. Major advances have been made in the past decade in molecular identification and characterization of solute carriers. To date, Human Genome Organization (HUGO) Nomenclature Committee Database recognizes 43 solute carries (SLC) families, which include a total of 298 transporter genes encoding for uniporters (passive transporters), cotransporters (coupled transporters), antiporters (exchangers), vesicular transporters, and mitochondrial transporters (175). This amount of solute carrier genes represents ⬃1% of the total pool of genes that have been calculated to compose human genome. One of the families that was identified at the molecular level during the last decade contains all genes encoding for electroneutral cation-Cl⫺ coupled cotransporters and is known as the SLC12 family (173). With molecular identification of the first members, several tools became available to isolate remaining members and to study these proteins from molecular organization of their genes, to their role in monogenic and polygenic disease. To date, seven clearly characterized genes and two orphan members compose this family. It is the major goal of this review to present comprehensive information of knowledge generated in SLC12 family as a consequence of cloning cDNAs encoding its different members. Information is divided into five major subjects that include 1) molecular biology of each gene, 2) functional properties of the recombinant proteins, 3) insights into structure-function analysis, 4) physiological role of each cotransporter, and 5) involvement of electroneutral cotransporters in pathophysiology of monogenic and polygenic disease. II. MOLECULAR BIOLOGY After the discovery of electrically silent cotransport mechanisms in mammalian cells and tissues 25 years ago (138, 340), several laboratories undertook unrewarded attempts to identify the proteins responsible for such a transport system (94, 107, 121, 197, 251, 406). However, the major breakthrough in this field came in the early 1990s from two different laboratories that were able to identify the genes responsible for Na⫹-Cl⫺ (136, 137) and

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

Na⫹-K⫹-2Cl⫺ cotransporters (136, 311, 440). As eloquently predicted by Homer Smith in his remarkably elegant book about fish and philosophy (378), cDNA encoding these proteins were identified first from fish sources, because tissue from these animals proved to be an ideal source of proteins and mRNA, due to the robust expression of these transport systems. Thereafter, homologybased approaches were used to identify corresponding orthologs from mammalian tissues. A. Naⴙ-Coupled Chloride Cotransporters 1. The thiazide-sensitive Na⫹-Cl⫺ cotransporter The first electroneutral cotransporter protein identified at the molecular level was the thiazide-sensitive Na⫹Cl⫺ cotransporter from Pseudopleuronectes americanus (winter flounder) urinary bladder (137). Original evidence that suggested the existence of a Na⫹-Cl⫺ cotransporter was obtained by Renfro (340), who observed that sodium and chloride were actively transported by the flounder’s urinary bladder in which Renfro thought there was an electrically silent mechanism. Subsequently, he was able to demonstrate in isolated perfused urinary bladder a clear interdependence of active Na⫹ and Cl⫺ transport that was independent of transepithelial voltage (341). A few years later, pharmacological properties of this Na⫹Cl⫺ cotransport system were defined by Stokes et al. in two studies (389, 388) in which the investigators observed in bladder preparations that mucosal-to-serosal Na⫹ and Cl⫺ transport were completely inhibited in a dose-dependent fashion by thiazide-type diuretics hydrochlorothiazide and metolazone. These drugs had no effect when applied to the serosal side of the bladder. It was also shown that the Na⫹-Cl⫺ cotransporter was not inhibited by barium, acetazolamide, furosemide, amiloride, DIDS, ouabain, and diphenolamine carboxylate (DPC). In fact, in the absence of a mammalian tissue to test the potency of thiazides, winter flounder urinary bladder was suggested as a model to assess effectiveness of this class of diuretics (244). In addition to these observations, another similarity observed between mammalian distal convoluted tubule (DCT) and winter flounder urinary bladder was that in both epithelia, inhibition of Na⫹-Cl⫺ cotransporter with thiazides resulted in increased calcium absorption (63, 452). In the marine teleost, urinary bladder is functionally and anatomically an extension of mesonephric kidney, that is, the embryologically derived form of mesoderm, representing a kind of distal tubule located outside the kidney (227). All this information was taken by Hebert and co-workers (137) to identify a clone from a winter flounder urinary bladder size-fractionated, poly(A)⫹-RNA directional cDNA library constructed into pSPORT1, which encodes a thiazide-sensitive Na⫹-Cl⫺ cotransporter using a functional expression strategy in Physiol Rev • VOL

425

Xenopus laevis oocytes. The cloning strategy was based on the ability of mRNA isolated from winter flounder urinary bladder to give rise to thiazide-(metolazone)-sensitive Cl⫺-dependent 22Na⫹ uptake when injected into X. laevis oocytes. Consistent with previous observations, it was shown that furosemide, acetazolamide, ouabain, amiloride, and DIDS had no effect on cotransporter activity. The 3.7-kb cDNA clone was named flTSC for flounder thiazide-sensitive cotransporter. As shown in Table 1, nucleotide sequence predicted an open reading frame (ORF) of 3,069 bp encoding a protein of 1,023 amino acid residues with a core molecular mass of 112 kDa. Hydropathy analysis following the algorithm proposed by Kyte and Doolittle (226) revealed the basic structure of the Na⫹-coupled chloride cotransporters shown in Figure 1, featuring a central hydrophobic domain containing 12 ␣-helices compatible with putative transmembrane-spanning segments that is flanked by a short hydrophilic amino-terminal domain and a long predominantly hydrophilic carboxy-terminal domain. The latter two domains are presumably located within the cell. There is a long hydrophilic loop connecting transmembrane segments 7 and 8, exhibiting three putative N-glycosylation sites that are located toward the putative extracellular side of the protein. Tissue distribution analysis by Northern blot in winter flounder revealed expression of a 3.7-kb transcript in urinary bladder and a shorter 3.0-kb message in several tissues including gonads, intestine, eye, brain, skeletal muscle, and heart (137). It was also observed that this shorter transcript of 3.0 kb is the result of an alternative splicing mechanism, in which the first 229 residues encoding the amino-terminal domain and the first three putative transmembrane segments are lost. The functional consequence of such splicing has not been resolved (276). Primary sequences of the thiazide-sensitive cotransporter were thereafter reported from four mammalian species, including Rattus norvegicus (rat), Mus musculus (mouse), Oryctolagus cuniculus (rabbit), and Homo sapiens (human). Tissue distribution analysis by Northern blot revealed the presence of transcripts only in total RNA extracted from kidney. As shown in Table 1, two alternative transcripts were identified from rat kidney (136). Both transcripts were apparent in Northern blot analysis using RNA extracted from rat renal cortex and exhibited the same ORF of 3,006 bp encoding a protein of 1,002 amino acid residues with a molecular mass of 110 kDa, that is 61% identical to the flounder cotransporter. The two transcripts differ in length of the 3⬘-untranslated region (UTR) as a result of alternative splicing. TSC cDNA from mouse and rabbit were isolated using a polymerase chain reaction (PCR) strategy designed to amplify only the ORF; thus no information with regard to length and characteristics of the 5⬘-UTR and 3⬘-UTR are available. In mouse, the ORF of 3,006 bp predicts a 1,002-amino acid

85 • APRIL 2005 •

www.prv.org

426 TABLE

GERARDO GAMBA

1.

Source

Identified members of the Na⫹-coupled Cl⫺ cotransporter branch (SLC12A1-3) Name

Clone Size, kb

5⬘-UTR, kb

3⬘-UTR, kb

ORF, kb

Number of Residues

Molecular Mass, kDa

Accession No./ Reference Nos.

112 85 110 110 110 112 112 112 114

L11615/(137) AF333796/(347) U10097/(136)

The thiazide-sensitive Na⫹-Cl⫺ cotransporter (SLC12A3) Flounder Rat Mouse Rabbit Human

flTSC flTSC-ov rTSCa rTSCb mNCC hTSC hTSC hTSC

3,686 3,093 4,394 3,315 3,006 3,087

107 201 8 8 0

510 510 1,380 231 0 3

4,211 3,131

26

1,122

3,069 2,382 3,006 3,006 2,006 3,084 3,063 3,063 3,090

1,023 794 1,002 1,002 1,002 1,028 1,021 1,021 1,030

U61085/(221) AF028241/(413) NM000339/(377) X91220/(265) NM_000339/**

The apical bumetanide-sensitive Na⫹-K⫹-2Cl⫺ cotransporter (SLC12A1) Shark Rat Mouse

Rabbit

Human

NKCC2A NKCC2F rBSC1 mNKCC2A mNKCC2B mNKCC2F mBSC1-L mBSC1-S NKCC2A NKCC2B NKCC2F hNKCC2

4,376 4,376 4,546

193 193 215

899 899 1,045

3,285 3,285 3,285

1,095 1,095 1,095

120 120 120

4,655

230

1,140

3,285

1,095

120

4,605 2,968

180 220

1,130 445

3,285 2,310

1,095 770

120 85

4,750

279

1,171

3,300

1,099

121

3,362

19

46

3,297

1,099

121

AF521915/(134) AF521917/(134) U10096/(136) U20973/(187) U20974/(187) U20975/(187) U94518/(290) U61381/(290) U07547/(311) U07548/(311) U07549/(311) U58130/(375)

129 126 125 130 130 130 132

U05958/(440) AJ486858/(69) AJ486859/(69) AF051561/(284) NM_009194/(80) U70138/(448) U30246(313)

The basolateral bumetanide-sensitive Na⫹-K⫹-2Cl⫺ cotransporter (SLC12A2) Shark Eel Rat Mouse Bovine Human

NKCC1 NKCC1a NKCC1b rtNKCC1 mBSC2 bNKCC1 hNKCC1

5,260 4,063 3,429 6,402 4,707 4,106 3,498

438 549

1,249 40

127 129 490 164

2,666 963 13 298

cotransporter that is 97 and 61% identical to predicted TSC sequences in rat and flounder, respectively (221). In contrast, rabbit TSC cDNA exhibits an ORF of 3,084 bp

3,573 3,474 3,429 3,609 3,615 3,603 3,036

1,191 1,158 1,143 1,203 1,205 1,201 1,212

predicting a protein of 1,028 amino acid residues with a molecular mass of 112 kDa. Degree of identity with flounder TSC is 61%, whereas with rat, mouse, or human TSC

FIG. 1. Proposed topologies for members of the electroneutral cation-chloride cotransporter family. SLC12A1–3 in black is the topology proposed for Na⫹-coupled chloride cotransporters BSC1/NKCC2, BSC2/NKCC1, and TSC. SLC12A4 –7 in blue depict the topology proposed for K⫹-coupled chloride cotransporters KCC1, KCC2, KCC3, and KCC4. SLC12A8/CCC9 in red corresponds to topology for the orphan member CCC9. This is the most distant member, because there are only 11 predicted transmembrane segments and the carboxy-terminal domain is predicted to be located outside the cell. SLC12A9/CIP in green is the topology proposed for an orphan member known as CIP or cotransporter interacting protein and resembles the topology for KCCs cotransporters.

Physiol Rev • VOL

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

it is 90% (413). Human TSC was simultaneously identified by two groups. Simon et al. (377) identified a TSC primary sequence with 1,021 residues as part of their cloning effort to identify the complete gene during their study of Gitelman’s disease. Supporting this observation, Mastroianni et al. (265) screened a human kidney cDNA library and isolated a 4,211-bp cDNA clone that encodes an identical TSC with 1,021 residues containing 5⬘-and 3⬘-UTRs of 26 and 1,122 bp, respectively. Identity degree of human TSC with other mammalian TSC is ⬃90%, while with flounder it is ⬃60%. Rabbit and human TSC are longer than rat and mouse orthologs due to presence of 17–26 amino acid residues in the carboxy-terminal domain that are not present in rat and mouse TSC (Fig. 2). These extra residues were shown to be encoded by a separate exon (exon 20) in humans that is not present in mouse or rat. However, two distinct Homo sapien TSC mRNA sequences have been deposited into the genome database (www.ncbi.nlm.nih.gov). The sequence from Mastroianni et al. (265) (X91220) exhibits 1,021 residues, including 17 extra amino acids not present in rat or mouse TSC sequence. In contrast, one sequence deposited by Simon et al. (377) (NM_000339) exhibits 1,030 residues with 26 extra residues not present in rat or mouse (Table 1). As shown in Figure 2, rabbit TSC sequence is similar to the sequence reported by Simon et al., because the 26 extra residues from exon 20 are present in this rodent. BLAST search of genomic databases with 78 bp encompassing the DNA sequence encoding the 26amino acid fragment revealed that this sequence aligns perfectly with a fragment of the RP11–325K4 clone containing full sequence of human chromosome 16, suggesting that exon 20 indeed encodes 26 residues, instead of 17. It is noteworthy that in humans there is a putative protein kinase A (PKA) site (RPS) within the extra fragment that is not present in rabbit, mouse, or rat TSC. 2. The apical bumetanide-sensitive Na⫹-K⫹-2Cl⫺ cotransporter Two genes encoding bumetanide-sensitive Na⫹-K⫹2Cl cotransporters were identified as part of the SLC12 family. These genes are known as SLC12A1 and SLC12A2 ⫺

427

and encode for the apical and basolateral isoforms, respectively. The SLC12A1 gene is a renal-specific Na⫹-K⫹2Cl⫺ cotransporter isoform exclusively expressed in the apical membrane of thick ascending limb of Henle (TALH). The cDNA encoding this cotransporter was simultaneously identified from mammalian kidney in 1994 by two groups. Payne and Forbush (311) screened rabbit cortical and medullary cDNA libraries inserted in ␭ZAP using a 32P-DNA random-primed probe constructed from cDNA encoding the T84 human colonic basolateral Na⫹K⫹-2Cl⫺ cotransporter. As shown in Table 1, a full-length clone of 4,750 bp was identified, with an ORF of 3,297 bp encoding a protein of 1,099 amino acid residues. Tissue distribution analysis by Northern blot revealed the presence of transcripts only in total RNA extracted from kidney. No functional expression was presented, but based on high homology with basolateral Na⫹-K⫹-2Cl⫺ cotransporter, it was proposed that the isolated clone encoded the apical isoform of this cotransporter. Because in 1994 this group first cloned the basolateral isoform (see later) that was named NKCC1, their clone encoding the apical, renal-specific isoform of the Na⫹-K⫹-2Cl⫺ cotransporter was denominated NKCC2. Simultaneously, Gamba et al. (136) isolated a 4,546-bp clone from a size-fractionated cDNA library constructed from poly(A)⫹ RNA extracted from inner stripe of outer medulla of rat kidney. The library was screened using a random-primed 32P-DNA probe derived from the coding region of flTSC transporter. The 3,285-bp ORF encodes a 1,095-residue protein exhibiting 93% identity with rabbit NKCC2. Tissue distribution by Northern blot analysis also showed that transcripts were present only in total RNA from kidney; all other tissues were negative. Functional expression analysis in X. laevis oocytes demonstrated that the isolated clone induced a significant increase in 86Rb⫹ uptake that was Cl⫺ dependent, Na⫹ dependent, and bumetanide sensitive, indicating that it encodes for a Na⫹-K⫹-2Cl⫺ cotransporter. Because this investigative group previously denominated the thiazide-sensitive Na⫹-Cl⫺ cotransporter cDNA clone from flounder urinary bladder as flTSC (137), the identified cDNA clone from renal outer medulla was denominated rBSC1 for rat bumetanide-sensitive

FIG. 2. Sequence alignment of the carboxy-terminal domain fragment in TSC from several species, from residues 789 – 826 of human TSC. Human 1 and human 2 correspond to sequences deposited in Genebank by Simon et al. (Genebank accession no. NM_000339) and Mastroianni et al. (Genebank accession no. X91220), respectively. The box in human 1 sequence highlights a putative protein kinase A phosphorylation site.

Physiol Rev • VOL

85 • APRIL 2005 •

www.prv.org

428

GERARDO GAMBA

Na⫹-K⫹-2Cl⫺ cotransporter 1; thus the apical Na⫹-K⫹2Cl⫺ cotransporter encoded by SLC12A1 gene is indistinctly known as BSC1 or NKCC2. Hereafter I will refer to this cotransporter as BSC1/NKCC2. After initial cloning of BSC1/NKCC2 from rat and rabbit kidney, the same cotransporter was identified at the molecular level from mouse and human kidney (Table 1). Igarashi et al. (187) identified a 4,655-bp clone from a mouse renal outer medulla library containing a 3,285 ORF that encodes a 1,095-amino acid transporter that is 93 and 97% identical to rabbit and rat BSC1/NKCC2, respectively. By Northern blot and in situ hybridization analysis, they showed that in mouse, BSC1/NKCC2 is also expressed exclusively in kidney, including developing kidney from the hybridization signal in mouse embryo detected only in metanephros. Finally, Simon et al. (375) reported the primary structure of human BSC1/NKCC2 as part of their study of SLC12A1 gene involvement in Bartter’s disease. Human BSC1/ NKCC2 is 95% identical to rabbit and 93% to rat or mouse BSC1/NKCC2. As shown in Figure 1, the proposed topology of BSC1/NKCC2 is very similar to that of TSC or BSC2/NKCC1. A central hydrophobic domain of ⬃475 residues containing 12 putative membrane-spanning segments is flanked by two predominantly hydrophilic domains: a short amino-terminal domain of ⬃165 amino acids and a long carboxy-terminal domain of ⬃450 residues. Both domains are presumably located within the cell and contain several putative PKA and protein kinase C (PKC) phosphorylation sites. Central hydrophobic domain exhibits a long hydrophilic loop located between transmembrane segments 7 and 8 that contains two putative N-glycosylation sites. Molecular diversity in electroneutral cotransporter family is increased due to existence of alternative splicing isoforms or variants. At least six isoforms of BSC1/ NKCC2 are expressed in mouse kidney due to combina-

tion of two alternatively splicing mechanisms (Fig. 3) (135, 290). The first was described by Payne and Forbush during cloning of rabbit Na⫹-K⫹-2Cl⫺ cotransporter (311) and was also observed to be present in mouse (187), rat (447), and human (375) kidney. This splicing mechanism is due to presence of three mutually exclusive cassette exons of 96 bp designated A, B, and F, which encode for 32 amino acid residues corresponding to the second half of the putative transmembrane domain TM2 and the contiguous intracellular loop between TM2 and TM3 (Fig. 3). This splicing mechanism produces three BSC1/NKCC2 proteins that are identical, with the exception of the 32 amino acids encoded by A, B, or F cassettes. Existence of an isoform containing exons A and F together was suggested by Yang et al. (447) following amplification of a DNA band for such an isoform by PCR; nonetheless, its real existence as a protein was not addressed. BSC1/ NKCC2 orthologs for isoforms A and F were also identified at the molecular level by Gagnon et al. (134) from Squalus acanthias (shark) kidney. Interestingly, no isoform B is expressed in shark kidney, which lacks a welldeveloped juxtaglomerular complex. Because there are data to support that B isoform could be the Na⫹-K⫹-2Cl⫺ sensing isoform in macula densa cells (see sect. VB), this observation suggests that B exon arose later in the evolutionary chain, when complete tubuloglomerular feedback mechanisms were developed. Interestingly, the AF isoform was also observed by Gagnon et al. (134) in shark kidney, together with other spliced variants lacking transmembrane segment 8; however, all these variants were not functional when expressed in HEK-293 cells or in X. laevis oocytes. Second splicing of SLC12A1 gene has been observed only in mouse kidney, is produced by utilization of a polyadenylation site in the intron between coding exons 16 and 17, and predicts a protein with a significantly

⫹ ⫹ ⫺ FIG. 3. Splice variants of the mouse apical, renal specific Na -K -2Cl cotransporter BSC1/NKCC2. The central hydrophobic domain containing 12 putative transmembrane segments is flanked by predominantly hydrophilic amino- and carboxy-terminal domains. Two glycosylation sites are depicted in the extracellular loop between membrane segments 7 and 8. The region of transmembrane domain 2 and the interconnecting segment between transmembrane domains 2 and 3 that are highlighted in green depict the mutually exclusive cassette exons A, B, or F. The long isoform BSC1-L contains 329 amino acid residues in the carboxy-terminal domain (highlighted in red) that are not present in the shorter isoform BSC1-S, which contains 55 unique residues at the end of the carboxy-terminal domain (highlighted in blue). Arrows show putative protein kinase A phosphorylation sites unique to each isoform.

Physiol Rev • VOL

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

shorter carboxy-terminal domain (290). This splicing produces two BSC1/NKCC2 proteins that are identical at the amino-terminal and transmembrane domains but differ in length and sequence from the carboxy-terminal domain. The longer isoform exhibits a carboxy terminus of 457 amino acid residues, of which the last 383 are not present in the shorter isoform. In contrast, the shorter truncated isoform contains a carboxy terminus of 129 residues, of which the last 55 are not present in the longer isoform. Interestingly, long and short carboxy-terminal domains contain different putative PKA and PKC phosphorylation sites and are currently known as BSC1-L (for long) and BSC1-S (for short) (269). Mount et al. (290) using a PCR strategy demonstrated that both splicing events are independent from each other in such a way that a total of six isoforms are produced in mouse kidney: three BSC1-L isoforms (A, B, and F) and three BSC1-S isoforms (A, B, and F). Rabbit polyclonal antibody raised against the 55 unique piece of BSC1-S was useful to demonstrate by Western blot and immunohistochemical analysis that BSC1-S protein of the expected size is present in mouse kidney, exclusively expressed in apical membrane of TALH (290). The functional significance of spliced isoforms is discussed in section IIIB. 3. The basolateral bumetanide-sensitive Na⫹-K⫹-2Cl⫺ cotransporter SLC12A2 gene encodes the Na⫹-K⫹-2Cl⫺ cotransporter that is ubiquitously expressed. This cotransporter is present in both epithelial and nonepithelial cells. In epithelial cells, its expression is confined to basolateral membrane, some examples of which are gills, trachea, intestine, and renal collecting duct. The sole exception is choroid plexus, in which this cotransporter is expressed in apical membrane (326). In 1994, the same two independent research teams who cloned BSC1/NKCC2 also identified cDNA encoding the basolateral cotransporter. Xu et al. (440) using monoclonal antibodies J3 and J7 that recognize epitopes in the carboxy-terminal half of the cotransporter (256) were able to isolate from a shark rectal gland cDNA library a single 5,260-bp cDNA clone that encoded a protein of 1,191 amino acid residues. When this clone was transfected into HEK-293 cells, a robust bumetanide-sensitive Na⫹-K⫹-2Cl⫺ cotransporter mechanism was induced, exhibiting functional properties similar to those previously shown as present in shark rectal gland (127). As shown in Table 1, full-length cDNA clone was denominated NKCC1. Tissue distribution analysis by Northern blot revealed presence of NKCC1 transcripts in all tissues. Also in 1994, this team was also able to identify the mammalian ortholog from a human colonic (T84 epithelial cell line) cDNA library using a probe constructed from shark NKCC1 cDNA. ORF of 3,036 bp predicted that human NKCC1 is a 1,212-amino acid residue cotransPhysiol Rev • VOL

429

porter with molecular mass of 132 kDa, which by Northern blot analysis was also shown to be expressed in most tissues. Simultaneously, a cDNA encoding the basolateral Na⫹-K⫹-2Cl⫺ cotransporter was identified from a mouse inner medullary collecting duct cell line (mIMCD-3) cDNA library by Delpire et al. (80), using degenerative primers that were designed over highly homologous regions of putative transmembrane domains 1 and 10 of TSC and BSC1 (136, 137). Because these authors previously denominated thiazide-sensitive Na⫹-Cl⫺ cotransporter as TSC (137) and apical renal-specific bumetanide-sensitive Na⫹-K⫹-2Cl⫺ cotransporter BSC1 (136), basolateral isoform was denominated BSC2. Hereafter I will refer to this cotransporter as BSC2/NKCC1. As shown in Figure 1, the proposed topology of BSC2/NKCC1 is similar to that of TSC or BSC1/NKCC2. The central hydrophobic domain exhibits a long hydrophilic loop located between transmembrane segments 7 and 8 that contains two putative N-glycosylation sites, both of which are conserved in BSC1/NKCC2, but only one of which is present in TSC. BSC2/NKCC1 is the only member of the family to date for which proposed topology is supported by experimental data. Gerelsaikhan and Turner (140) studied transmembrane topology of NKCC1 using an in vitro translation system designed to test membrane-insertion properties of putative membrane-spanning helices, by fusing each with a carboxy terminal reported sequence containing multiple N-linked glycosylation sites. With this strategy, they observed that NKCC1 is indeed composed of 12 membrane-spanning segments. The first eight segments exhibit the classical ⬃20 residue length helices, while segments 9 and 10, as well as segments 11 and 12 together are ⬃36 residues in length, suggesting that these transmembrane segments form a hairpin-like structure in the membrane or take up either a nonhelical or a partial helical structure. Presence of asparagine and proline residues in the middle between segments 9 and 10, and segments 11 and 12 are in accord with the possibility that hairpin helices are present (282). As shown in Table 1, basolateral Na⫹-K⫹-2Cl⫺ cotransporter BSC2/NKCC1 has been identified at the molecular level from other three species including rat (284), Bos taurus (bovine) (448), and Anguilla anguilla (eel) (69). The case of eel is interesting because Cutler and Cramb (69) identified two different genes encoding highly homologous NKCC1 isoforms that were denominated NKCC1a and NKCC1b. Degree of identity at amino acid level between both cotransporters is ⬃80%. The majority of the divergence is located in the first 80 –90 residues of the amino-terminal domain in which degree of identity is not ⬎35%; however, the remainder of the sequence exhibits an identity of 85%. NKCC1a of ⬃13 kb was present in all tissues, whereas NKCC1b of 6 kb was observed only in brain RNA. The authors proposed that existence of two NKCC1 genes in eel fits with the paradigm that a certain

85 • APRIL 2005 •

www.prv.org

430

GERARDO GAMBA

percentage of the teleost genome underwent ancient duplication. Functional differences between both cotransporters have not been explored. Molecular diversity in BSC2 is also increased by existence of one alternatively spliced isoform. As part of their cloning and characterization of mouse SLC12A2 gene, Randall et al. (332) intentionally searched for alternative spliced isoforms by PCR-amplifying segments containing two to three exons. A spliced variant was detected from mouse brain total RNA; it lacked the 48 bp that correspond to entire exon 21. Thus 16 residues within the carboxy terminal are not present. Existence of spliced transcript was confirmed by RNase protection assay. Analysis of distribution within brain showed that transcript lacking exon 21 is present in all areas examined except in choroid plexus, in which the only isoform containing exon 21 is expressed. This spliced variant, however, was also observed in human ocular-trabecular meshwork cells; in addition, with the use of a kinetic PCR strategy it was observed that exon 21-lacking isoform is expressed in several human tissues, with an up to 68-fold variation in isoforms ratio among 14 tested tissues. Brain was the only tissue in which the isoform lacking exon 21 was significantly more abundant than the longer one (418). Spliced variant performs as an Na⫹-K⫹-2Cl⫺ cotransporter (418), but its physiological significance is not yet known. However, it is important to note that the absence of the exon 21 sequence removes the sole putative PKA site present in the entire BSC2 sequence. B. Kⴙ-Coupled Chloride Cotransporters The K⫹-Cl⫺ cotransport mechanism was first described in low-potassium sheep red blood cells as a swelling- and N-ethylmaleimide (NEM)-activated K⫹ efflux pathway (95, 237). Cotransport of K⫹ and Cl⫺ is interdependent, with a 1:1 stoichiometry and low-affinity constants for both ions (for excellent reviews, see Refs. 62, 235). Although red blood cells have remained as the primary model tissue for this class of ion transport, functional and physiological evidence for existence of a similar K⫹-Cl⫺ cotransporter was soon reported in several cells and tissues including neurons (346), vascular smooth muscle (4), endothelium (317), epithelia (12, 155), heart (445), and skeletal muscle (430), suggesting that K⫹-Cl⫺ cotransport is implicated not only in regulatory volume decrease, but also in transepithelial salt absorption (12), renal K⫹ secretion (108), myocardial K⫹ loss during ischemia (445), and regulation of neuronal Cl⫺ concentration (346). Molecular identification of genes encoding K⫹-Cl⫺ cotransporters was possible due to their homology with Na⫹-coupled Cl⫺ cotransporters. Four genes encoding K⫹-Cl⫺ cotransporters were identified as part of the SLC12 family; these genes are known as Physiol Rev • VOL

SLC12A4, SLC12A5, SLC12A6, and SLC12A7 and encode the isoforms known as KCC1, KCC2, KCC3, and KCC4, respectively. 1. The K⫹-Cl⫺ cotransporter KCC1 Identification of four K⫹-Cl⫺ cotransporter genes was possible due to the so-called in silico cloning strategies (291) that were based on identification of sequences in Genebank, particularly the expressed sequence tag databases (dbEST), which were initiated in 1992 and that underwent dramatic enlargement throughout the 1990s. Molecular identification of human KCC1 was based on finding several human dbEST that were ⬍50% identical to BSC1/NKCC2, BSC2/NKCC1, or TSC, indicating that EST sequences belonged to an unidentified member of the family. Therefore, probes derived from dbEST were used by Gillen et al. (142) to isolate full-length clones from human, rat, and rabbit kidneys that encode a membrane protein of 1,085 amino acid residues (see Table 2) that is expressed in all tested tissues as a predominant 3.8-kb transcript. Stable HEK-293 cells transfected with rabbit KCC1 cDNA exhibited 86Rb⫹ uptake and efflux mechanisms compatible with known characteristics of the red blood cell K⫹-Cl⫺ cotransporter, i.e., 86Rb⫹ transport induced by rabbit KCC1 was Na⫹ independent, Cl⫺ dependent, furosemide sensitive, and activated by NEM or cell swelling. KCC1 sequence exhibits low identity with Na⫹-coupled chloride cotransporters BSC1/NKCC2, BSC2/NKCC1, and TSC of ⬃25%, but with a remarkable similarity in proposed secondary structure. Hydrophobicity analysis of KCC1 using the Kyte-Doolittle algorithm (226) predicts existence of a central hydrophobic domain flanked by short amino-terminal and long carboxy-terminal domains predicted to be intracellular. The central domain is composed by 12 putative transmembrane segments. As shown in Figure 1, proposed topology is very similar, but with a noticeable structural difference between KCC1 (and all KCCs) and Na⫹-coupled chloride cotransporters, which include location and length of the extracellular loop containing potential N-linked glycosylation sites. This loop in KCC1 is larger and is predicted to be located between putative TM5 and TM6, with four potential N-linked glycosylation sites, conserved among rat, rabbit, and human KCC1. In contrast, as discussed previously, extracellular N-linked glycosylation loop of Na⫹-coupled chloride cotransporters is shorter and predicted to be located between TM7 and TM8. As shown in Table 2, after initial cloning of KCC1 cDNA by Gillen et al. (142), KCC1 orthologs have been cloned from other species. Pellegrino et al. (316) using a homology PCR-based approach isolated cDNA clones encoding KCC1 from human erythroleukemia cell line K256 and also from mouse erythroleukemia cell line MEL. De-

85 • APRIL 2005 •

www.prv.org

431

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS TABLE

2.

Source

Identified members of the K⫹-coupled Cl⫺ cotransporter branch (SLC12A4-7) Name

Clone Size, kb

5⬘-UTR, kb

3⬘-UTR kb

ORF, kb

Number of Residues

Molecular Mass, kDa

Accession No./ Reference Nos.

1,085 1,085 1,085 1,085 1,086 1,085 1,085 1,011 1,068 1,085

120 120 120 120 120 120 120 112 118 120

U55815/(142) AF047339/(316) AF121118/(370) U55053/(142) AF028807/(180) U55054/(142) AF047338/(316) AF054505/(316) AF054506/(316) BC021193/(391)

1,116 1,114 1,115 1,116

123 123 123 123

U55816/(313) BC054808/(391) AF332064 AF208159/(380)

1,099 1,150 1,150 1,011 1,099

122 127 127 112 122

AF211855 AF105366/(292) AF116242/(331) AF477977 AF108831/(178)

1,083 1,106 1,083

119 120 119

AF087436/(290) AF538347/(414) AF105365/(292)

K⫹-Cl⫺ cotransporter 1 (SLC12A4) Rat Mouse Rabbit Pig Human

KCC1 KCC1 KCC1 KCC1 KCC1 KCC1 KCC1 KCC1-1 KCC1-2 KCC1

3,726 3,755 3,764 3,734 3,351 3,722 3,613 3,761 3,768 3,888

0 0 67 20 36 55 0 0 0 69

471 520 442 459 57 412 358 728 564 560

3,255 3,255 3,255 3,255 3,258 3,255 3,255 3,033 3,204 3,255

K⫹-Cl⫺ cotransporter 2 (SLC12A5) Rat Mouse Human

KCC2 KCC2 KCC2 KCC2

5,560 5,708 3,656 5,907

115 84 85 0

2,103 2,282 226 3,348

3,348 3,342 3,345 2,559

K⫹Cl⫺ cotransporter 3 (SLC12A6) Mouse Human

KCC3b KCC3a KCC3a KCC3 variant KCC3b

5,964 4,260 3,450 4,453 3,767

0 164 0 774 51

2,667 646 0 646 419

3,297 3,450 3,450 3,033 3,297

K⫹-Cl⫺ cotransporter 4 (SLC12A7) Mouse Rabbit Human

KCC4 KCC4 KCC4

5,155 4,331 5,239

72 184 4

1,834 829 1,986

gree of identity among human, rat, rabbit, and mouse KCC1 is ⬃96%. Interestingly, KCC1 was not present in human or mouse reticulocytes but was present during the early stages of erythroleukemia cell differentiation, suggesting that level of expression of KCC1 mRNA may play a role in early stages of erythroid maturation. Pellegrino et al. (316) also isolated two distinct mRNAs exhibiting different ends of the protein; one mRNA contained a stop codon at residue 1,012, resulting in a 73-amino acid truncated protein, and the second contained distinct sequence after residue 1,056 and resulted in a 23-amino acid truncated protein. It was suggested that both could be alternatively spliced isoforms; however, no further actions were taken to support this hypothesis. Finally, KCC1 has also been identified from Sus Scorfa (pig) and from Caenorhabditis elegans, exhibiting 94 and 42% identity, respectively, with other mammalian KCC1 orthologs. Both clones were shown in HEK-293 transfected cells to encode a K⫹-Cl⫺ cotransporter (180). 2. The K⫹-Cl⫺ cotransporter KCC2 Finding two EST from human brain exhibiting 35% identity with human BSC2/NKCC1 allowed Payne et al. (313) to amplify by PCR a 286-bp cDNA fragment from rat brain that was then used as a template to prepare a 32 P-DNA random primed probe to screen a rat brain cDNA Physiol Rev • VOL

3,249 3,318 3,249

library under low-stringency conditions. From 19 clones isolated, 7 were KCC1 and 12 corresponded to a new closely related cDNA named KCC2. The 5,566-bp fulllength clone encodes a protein of 1,116 amino acid residues with predicted molecular mass of 123 kDa that is 67% identical to KCC1. As shown in Table 2, a similar cDNA was later isolated and sequenced from mouse as part of a large-scale project launched to identify all human and mouse ORFs by the Mammalian Gene Collection Program Team (http//mgc.nci.nih.gov) (391). Hydrophobicity analysis revealed a protein with 12 putative-transmembrane segments with a topology similar to KCC1 (Fig. 1) in which the glycosylated extracellular loop is located between transmembrane segments 5 and 6. Northern blot analysis revealed that a single transcript of ⬃5.6 kb was expressed only in poly(A)⫹ RNA from the central nervous system (CNS), indicating that KCC2 is a brainspecific gene. By PCR analysis, several rat nervous system-derived cell lines such as primary astrocytes, glioma cell line, and pheochromocytoma cell line were positive for KCC1 but negative for KCC2. In addition, in situ hybridization analysis revealed that KCC2 is present in all layers of cortex, all areas of hippocampus, and the granular layer of the cerebellum, whereas white matter was devoid of any signal, suggesting that KCC2 is expressed exclusively in neurons.

85 • APRIL 2005 •

www.prv.org

432

GERARDO GAMBA

The KCC2 cotransporter has been also isolated and sequenced from other two species. Human KCC2 cDNA was isolated by Song et al. (380) using a PCR-based homology approach. As shown in Table 2, a single 5,907-bp cDNA was isolated that encodes a 1,116-residue protein that is 99% identical to rat KCC2. Differentiated NT2-N cells with retinoic acid exhibited expression of KCC2, corroborating the presence of this transcript in a neuronal-derived cell line. KCC2 cDNA has been also isolated and sequenced from mouse by means of a highthroughput sequence study designed to identify gene-coding variants within alcohol-related QTLs in a mouse model of alcohol addiction (102) and also by the Mammalian Gene Collection Program Team (http//mgc.nci.nih.gov) (391). 3. The K⫹-Cl⫺ cotransporter KCC3 Three groups simultaneously identified a third gene encoding a K⫹-Cl⫺ cotransporter (SLC12A6) from human mRNA by means of two different strategies. Hiki et al. (178) used a differential display PCR strategy in human umbilical vein endothelial cells (HUVEC) designed to identify transcripts that exhibited change in expression level after cells were treated with vascular endothelial cell growth factor (VEGF). A consistent upregulated band was sliced off and used as a probe to isolate corresponding full-length cDNA from a HUVEC library that corresponded to a putative membrane transporter with 77% identity with KCC1 and 73% with KCC2; thus isolated cDNA clone was named KCC3 and encodes a protein of 1,099 amino acid residues with a hydropathy profile identical to that of KCC1 and KCC2 (Fig. 1). It was shown in the same study in transfected HEK-293 cells that KCC3 performed as a furosemide-sensitive K⫹-Cl⫺ cotransporter that exhibited, however, no response to hypotonicity. The new gene was located at human chromosome 15q13 and was shown to be expressed in several tissues including brain, kidney, and liver. Simultaneously, Mount et al. (292) following the in silico strategy identified several human ESTs that were useful to isolate two new members of K⫹-Cl⫺ cotransporter subfamily that were named KCC3 and KCC4. These proteins exhibited ⬃70% identity with KCC1 and KCC2. KCC3 cDNA was isolated from a human muscle cDNA library, and Northern blot analysis revealed variable expression of two 6- to 7-kb bands in several tissues, suggesting the possibility of alternative splicing. KCC3 was also isolated by Race et al. (331) following the in silico strategy from a human placenta cDNA library. These authors, using transfected HEK-293 cells, showed that KCC3 encodes a furosemidesensitive and an NEM-activated K⫹-Cl⫺ cotransporter that exhibited a slight but significant activation by hypotonicity. As shown in Table 2, full-length KCC3 cDNA isolated by Mount et al. (292) and by Race et al. (331) encodes a Physiol Rev • VOL

1,150-amino acid residue cotransporter. The difference with the 1,099-residue protein from Hiki et al. (178) resides in length and sequence of the amino-terminal domain, due to the presence of two alternative first exons in the SLC12A6 gene with transcriptional initiation at separate promoters, which were denominated as exon 1a and exon 1b, thus generating the terminology of KCC3a and KCC3b for long and short isoforms, respectively (315). Exon 1a encodes 90 amino acids not present in the 39residue exon 1b. mRNA encoding KCC3a is widely expressed, with abundant message by Northern blot analysis in brain, kidney, muscle, lung, and heart, while the KCC3b transcript is more abundant in kidney than in any other tissue. Interestingly, there are several potential phosphorylation sites for PKC (292) within the 51 amino acid residues present in KCC3a (exon 1a) that are thus not present in KCC3b (exon 1b) (178), suggesting that these isoforms are subjected to different posttranslational regulation. As discussed in section IIIF, KCC3a and KCC3b isoforms perform as hypotonically activated K⫹-Cl⫺ cotransporters when X. laevis oocytes were used as the heterologous expression system. 4. The K⫹-Cl⫺ cotransporter KCC4 There is a fourth gene encoding an isoform of the K⫹-Cl⫺ cotransporter, which was identified by Mount et al. (292) from mouse and human kidney mRNA by PCR using several ESTs to guide the design of appropriate primers. KCC4 cDNA encodes a protein of 1,083 amino acid residues with a hydropathy profile similar to that of other K⫹-Cl⫺ cotransporters (Fig. 1). The degree of identity with KCC1, KCC2, and KCC3 is 67, 72, and 67%, respectively. KCC4 is expressed in several tissues, with higher levels in heart and kidney and very low levels in brain. Within the CNS, the main localization of KCC4 protein is on cranial nerves (204). Functional expression in X. laevis oocytes demonstrated that KCC4 encodes a K⫹-Cl⫺ cotransporter that can be activated by incubation in hypotonicity or after NEM exposure (275, 292). KCC4 cDNA has also been isolated from rabbit kidney by Vela´zquez and Silva (414) and encodes a 1,106-amino acid protein that contains 23 extra residues not present in mouse or human orthologs. These extra residues are located within the amino-terminal domain as two separate fragments of 11 and 12 residues. No studies were done to demonstrate if this is due to alternative splicing or is a cloning artefact. C. Orphan Members Two orphan members of the cation-chloride cotransporter family have been described. Caron et al. (49) identified human ESTs with 25% degree of identity with KCCs, BSC1/NKCC2, BSC2/NKCC1, and TSC, suggesting that the

85 • APRIL 2005 •

www.prv.org

433

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

gene encoding such a transcript could be a distant but related member of the family. A ␭ZAP II/human heart cDNA library was screened using a random primed 32PDNA probe constructed from EST under low-stringency conditions until a 3,276-bp full-length transcript clone was isolated and named CIP for cotransporter interacting protein (GeneBank accession no. AF284422). A single ORF of 2,742 bp predicted a protein of 915 amino acid residues with a molecular mass of 96 kDa. As shown in Figure 1, hydropathy analysis of CIP protein revealed a topology that more closely resembles KCC cotransporters, because the long glycosylated extracellular loop is located between transmembrane segments 5 and 6. CIP amino- and carboxy-terminal domains are 44 and 370 amino acids in length, respectively. Northern blot analysis revealed wide distribution along tissues, and functional expression flux studies were performed in both HEK-293 cells and X. laevis oocytes transfected with cDNA and cRNA, respectively. Unfortunately, no increase in 22Na⫹, 86Rb⫹, or 36 ⫺ Cl was observed under any multiple experimental approaches tested. For this reason, CIP is considered an orphan member of the family because its transport substrate is not known. However, coinjection experiments that were performed revealed that BSC2/NKCC1, but not BSC1/NKCC2 or KCC1, was significantly and reproducibly inhibited when coinjected with CIP; for this reason the new clone was denominated CIP for cotransporter interacting protein. Coimmunoprecipitation experiments suggested that a potential explanation for CIP effects upon NKCC1 involves physical interaction between both proteins. The gene SLC12A9 encoding this cotransporter was located to human chromosome 7q22. Finally, the most recent and distant member of the family has been provisionally denoted SLC12A8 (289) (GeneBank accession no. AF345197). This is a membrane protein that is much shorter than the remainder of family TABLE

3.

members (714 amino acids), and it is ⬃30% identical to BSC1/NKCC2, with particular conservation of predicted transmembrane segments 1, 2, 6, and 7. Predicted topology (Fig. 1) is unique in the family because there is a short intracellular amino-terminal domain followed by 11 membrane segments, with a glycosylated carboxy-terminal tail. Transport function is not yet known because heterologous expression in X. laevis oocytes failed to detect significant activity in transport of 36Cl⫺, 86Rb⫹, and 22Na⫹ and revealed no interaction with coinjected TSC, BSC1/ NKCC2, or KCC4, suggesting that this protein does not form heterodimers with other family members. There are clear orthologs within Drosophila and C. elegans genomes, and interestingly, this gene has been identified as a psoriasis-susceptibility candidate gene on chromosome 3q21 (176). D. Genes and Promoter Characteristics 1. Na⫹-coupled chloride cotransporters The gene encoding the renal-specific bumetanidesensitive Na⫹-K⫹-2Cl⫺ cotransporter (SLC12A1) has been mapped in humans at chromosome 15 (375), in rat at chromosome 3 (423), and in mouse at chromosome 2 (330). SLC12A1 in humans encompasses 80 kb and contains 26 exons (Table 3). Intron range spans from 120 bp to 15 kb. A GT dinucleotide repeat within the gene is highly polymorphic with 42% heterozygosity in 50 unrelated subjects (375). SLC12A1 promoter region has been cloned from mouse genomic DNA (188). It was first shown in this study, using nuclear run-off assays, that BSC1/NKCC2 kidney-specific expression is due to regulation at the level of initiation of gene transcription and not at posttranscriptional regulation. Subsequently, the promoter was cloned, and transcription initiation was de-

Characteristics of SLC12 genes and their promoters

Gene

Cotransporter

SLC12A1

BSC1/NKCC2

SLC12A2

BSC2/NKCC1

SLC12A3

TSC

SLC12A4

KCC1

SLC12A5

KCC2

SLC12A6 SLC12A7 SLC12A8 SLC12A9

KCC3 KCC4 CCC9 CIP

Chromosome

Human: 15 Rat: 3 Mouse: 8 Human: 5 Mouse: 18 Human: 16 Rat: 19 Mouse: 8 Human: 16 Mouse: 5 Human: 20 Mouse: 8 Human: 15 Human: 5 Human: 3 Human: 7

Size, kb

Number of Exons

Promoter, bp

Start Site, bp

Reference Nos.

80

26

2,255

⫺280

188, 330, 375, 423

75

28

2,063

⫺270

80, 314, 332

55

26

1,019

⫺18

23

24

1,938

⫺121

30

24

NA

NA

354, 380

NA NA NA NA

NA NA NA NA

NA NA NA NA

NA NA NA NA

178, 292 292 NA 49

NA, information not available. Physiol Rev • VOL

85 • APRIL 2005 •

www.prv.org

257, 308, 37, 400

180, 231, 392

434

GERARDO GAMBA

fined as ⫺280 bp of the 5⬘ start codon. It was observed, however, that in mouse SLC12A1, there is a first exon of 34 bp in length that is noncoding, followed by a first intron of 1,101 bp and a second exon containing the translation start codon. Cloned promoter is composed of 2,255 bp, and sequence analysis revealed a TATA box located at position ⫺29 and consensus recognition sites for several transcription factors, of which the most interesting could be a binding site for HNF-1 at ⫺211 bp. In developing mouse kidney, expression of HNF-1 precedes expression of BSC1/NKCC2 (239), and this factor has been implicated in regulation of tissue-specific expression in liver, pancreas, kidney, and intestine. One example is renal epithelium-specific expression of the Ksp-cadherin that is due to interaction with transcription factors NHF-1␣ and NHF-1␤ (21). In this regard, transfection of TALH-derived cells with pGL3B-NKCC2 construct, that contained 2,255 bp of SLC12A1 promoter region fused to a luciferase reporter gene, resulting in a 130-fold increase in luciferase activity, while transfection of NIH 3T3 cells resulted in no activity. With the use of TALH-derived cells, it was demonstrated that deletion of ⫺2,255 to ⫺1,529 bp produced an approximately threefold increase in luciferase activity, suggesting that this region contains negative regulatory elements. Deletion from ⫺1,529 to ⫺469 bp had no further effect, but deletion from ⫺469 to ⫺190 resulted in 76% reduction of promoter activity, suggesting that this region contains positive regulatory elements. HFN-1 binding site is located in this region. Finally, a cAMP response-element binding protein is located at nucleotide ⫺1,111. This site could be important because it is known that Na⫹-K⫹2Cl⫺ cotransporter activity in TALH is increased by vasopressin (171, 280) and that chronic administration of 1desamino-[8-D-arginine]vasopressin (DDAVP) to SpragueDawley and Brattleboro rats is associated with increase in BSC1/NKCC2 abundance at protein level (209). It is not known whether this effect is at the regulation of gene transcription or by increasing protein stability. The effect of DDAVP on mRNA levels, however, has not been reported. As shown in Table 3, basolateral Na⫹-K⫹-2Cl⫺ cotransporter isoform gene SLC12A2 has been shown as located at chromosomes 5q23 in humans (314) and at chromosome 18 in mouse (80). The complete gene has been cloned from mouse DNA, covering a region of 75 kb (332), and is composed of 28 exons that are on average 111 bp in length, except for exons 1 and 27 that are 864 and 941 bp long, respectively. Transcription start site was defined at ⫺270 bp upstream of the ORF start codon. Randall et al. (332) first cloned the promoter region. Sequence revealed numerous SP1 consensus sites and binding sites for different transcription factors, including MEF2, a CACCC binding, OTF/1–2A, NF␬B, and AP-2. Transfection of mouse IMDC3 cells with 2,063-bp promoter region ligated to a luciferase reporter gene (pGL3) Physiol Rev • VOL

yielded significant luciferase activity. Then, similar to the observation made on SLC12A1 promoter (188), deletions of ⬎1 kb that reduced promoter region to 702 or 516 bp resulted in a significant increase in luciferase activity, suggesting the existence of silencer sequences in deleted bases. Further deletions resulted in progressive reduction of luciferase activity, suggesting the presence of enhancer elements. The gene encoding thiazide-sensitive Na⫹-Cl⫺ cotransporter (SLC12A3) has been mapped at chromosomes 16q13 in humans (265, 377), 19p12–14 in rats (400), and 8 in mice (308). As shown in Table 3, human SLC12A3 is 55 kb long and contains 26 exons (377). All exon-intron boundaries have the conventional 5⬘-GT and 3⬘-AT consensus splice sites. There is a polymorphic genetic marker of a GT-dinucleotide repeat within SLC12A3 gene that exhibited heterozygosity of 48% in 45 unrelated Caucasian subjects. SLC12A3 promoter region has been cloned from humans (257) and rat (400) genomic DNA. In humans, transcription initiation is confined to an area from ⫺18 to ⫺6 upstream of the translation start codon, and maximum promoter activity in mouse distal convoluted cell line (MDCT) (257) transfected with pCAT3 constructs was obtained with construct containing 1,019 bp of the 5⬘flanking region; however, 75% of activity was observed with a promoter containing only 134 bp of the 5⬘-flanking region. Sequence analysis of promoter revealed the presence of a TATA element, two Sp binding sites, and potential binding sites for NF-1/CTF or NY-I/CP-I. Consistent with the general belief that TSC exhibits kidney-specific expression, the promoter region in humans displayed repressor activity in Chinese hamster ovary-derived cell line CHO-K1, which requires the presence of two Sp binding sites. Promoter activity in MDCT cells transfected with a pACT3 construct containing ⫺1,019 to ⫹1 of the 5⬘-flanking region was shown to inhibit transcription in response to acidification of the extracellular medium, but not to hypertonicity or presence of mineralocorticoid DOCA. The observation that acidosis inhibited promoter activity is consistent with a marked fall in renal cortical abundance of TSC assessed by either Western blot of renal cortical proteins (211) or by [3H]metolazone binding to plasma membranes from renal cortex (119) of rats exposed to chronic NH4Cl loading. With the use of luciferase reporter gene analysis in HEK-293 cells, maximal activity of rat SLC12A3 promoter was obtained with ⫺2,093 bp of the 5⬘-flanking region; nonetheless, most activity was found present using a ⫺580-bp fragment. The transcription initiation site in the rat was located 18 bases upstream of the start codon. Several putative consensus transcription factor recognition sequences were observed, including a TATA box in position ⫺42, three SRY, five Pit-1, and two Sp1 binding sites, two glucocorticoid response elements (GRE), one cAMP response element (CRE), and an HFH-3 binding

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

site. Rat promoter displays repressor activity in a human hepatocyte cell line (HepG2) and a rat vascular smooth muscle cell line (A10), but not in human embryonic kidney cells HEK-293 (400). In addition, transgenic rats harboring a construct containing 5⬘-flanking region of rat SLC12A3 promoter fused to LacZ gene displayed immunoreactivity against ␤-galacosidase exclusively in DCT (400). One potential explanation for TSC kidney-specific expression is presence of the HFH-3 binding site in ⫺393 bp of rat promoter. The HFH-3 transcription factor belongs to HFH/winged helix factor family, and its expression in mammalian kidney has also been shown to be restricted to the epithelium of DCT (305). Members of the HFH/winged family are known to be involved in tissuespecific gene expression and differentiation during embryonic development (228); thus HFH-3 transcription factor could be involved in defining TSC tissue-specific expression. Consistent with this view, Taniyama et al. (400) showed that overexpression of HFH-3 transcription factor stimulated activity of the 5⬘-FL/rTSC promoter construct in HepG2 cells, assessed by luciferase activity, and that point mutations in HFH-3 binding site on rTSC promoter were associated with marked loss of HFH-3 transcription factor effect. Stimulation, however, was only approximately threefold over activity observed in mock transfected HepG2 cells, while in HEK-293 5⬘-FL/TSC transfected cells, luciferase activity was 25-fold over mocktransfected cells, suggesting that other elements are probably involved in defining TSC gene expression. 2. The K⫹-coupled chloride cotransporters Ubiquitously expressed K⫹-Cl⫺ cotransporter KCC1 gene SLC12A4 has been localized on chromosomes 16q22 in humans (231) and on chromosome 8 in mice (392) and encompasses a region of 23 kb in the genome and is composed of 24 exons (180). As shown in Table 3, this is the smallest gene of the electroneutral cotransporter family. Intron length ranges from 75 bp to 4.5 kb, while the exon range spans 95–242 bp. All intron-exon boundaries possess conventional 5⬘-GT and 3⬘-AT consensus splice sites. In contrast, gene encoding KCC1 in Caenorhabditis elegans is composed of 9 exons and 10 introns that encompass 3.5 kb (180). Zhou et al. (451) recently screened a human genomic BAC library and identified a 1,938-bp KCC1 promoter. A single transcription initiation site was located 121 bp before the first methionine encoding codon ATG. KCC1 promoter lacks TATA and CCAAT consensus sequences but contains one GATA-1 consensus site, two AP-2 sites, and three GC/CACC binding-related proteins that are motifs for several transcription factors including Sp-1. Transfection of different size promoters (⫺1938, ⫺720, and ⫺369) with luciferase reporter into K562 and HeLa cells demonstrated that promoter is active in both erythroid and nonerythroid cells. Finally, mutaPhysiol Rev • VOL

435

tions designed to eliminate AP-2 sites reduced promoter activity by one-half, and those in which consensus sequences InR and DPE are eliminated reduced activity by ⬎10-fold. Neuronal-specific K⫹-Cl⫺ cotransporter KCC2 gene SLC12A5 has been mapped at chromosome 20q13 in humans (354, 380) and at chromosome 5 in mice (354) (Table 3). Human SLC12A5 encompasses 24 coding exons spread over ⬃30 kb of genomic DNA. Exons 21 and 22 encode a carboxy-terminal insertion unique to KCC2 discussed later. All intron-exon boundaries obey GT-AG (380). Mean exon size is 140 bp, ranging from 45 to 242 bp. The SLC12A5 promoter region has not been studied in detail. However, it is known that neuron-restricted expression pattern in KCC2 is at least due in part to the presence of a neuronal-restrictive silencing element (NRSE). A genomic clone containing ⬃7 kb of KCC2 5⬘-flanking region, exon 1, and ⬃11 kb of downstream sequence revealed that mouse KCC2 gene contains the sequence TTCAGCACCACGGACAGCGCC within intron 1 (205). This sequence was also observed within intron 1 in humans (380) and is 80% homologous to consensus site for a neuronal-restrictive silencing factor binding (NRSF). This NSRF is known to be responsible for negative transcriptional regulation of genes in nonneuronal cells (360). Mouse putative NRSE contains four mismatched nucleotides when compared with classical NRSE; however, three have been previously shown to be nonessential for NRSF binding (360). In addition, Karadsheh and Delpire (205) observed that the 21-bp fragment containing the putative NRSE was able to interact with proteins isolated from C17 nonneuronal cells and that addition of cold NRSE fragment displaced the binding. In addition, in a luciferase gene reported assay carried out in C17 cells, investigators observed that luciferase activity yielded by KCC2 promoter alone was completely prevented with KCC2 promoter construct also containing NSRE sequence. SLC12A6 and SLC12A7 genes that encode KCC3 and KCC4 isoforms of K⫹-Cl⫺ cotransporters have been located at human chromosomes 15q13–14 and 5p15.3, respectively (178, 292). To date, however, complete gene or promoter regions have not been reported. Similarly, SLC12A9 cDNA encoding CIP was cloned from a human heart cDNA library, and the gene was located at human chromosome 7q22. The complete gene or promoter regions have not been described. Finally, by BLAST search analysis, the gene encoding SLC12A8 has been localized at human chromosome 3q21–22. E. Phylogenetic and Sequence Comparison Figure 4 shows the phylogenetic tree, and Table 4 shows the degree of identity obtained from alignment

85 • APRIL 2005 •

www.prv.org

436

GERARDO GAMBA

analysis of all members of electroneutral cotransporter family. Alignment was performed according to the Clustal W method using DNASTAR MegaAlign software. For this analysis, predicted sequences of human cotransporter proteins were used. As shown in Figure 4, two main branches are clearly separated: one branch is composed of cotransporters that utilize Na⫹ as cation in the coupled process, regardless of their use of K⫹, and include BSC1/ NKCC2, BSC2/NKCC1, and TSC, while the remaining branch is composed of cotransporters that use K⫹ as a unique cation coupled with Cl⫺ include KCC1, KCC2, KCC3, and KCC4. As seen in Table 4, degree of identity between members of one branch with the other is ⬃25%. The K⫹-coupled Cl⫺ cotransporters branch is subdivided into two subfamilies: one composed of KCC1 and KCC3 that exhibit ⬃75% identity, and the other of KCC2 and KCC4 that share ⬃72% of amino acid residues. Identity between both KCC subfamilies is ⬃65%. Finally, overall

FIG. 4. Phylogenetic tree of the electroneutral cation-coupled chloride cotransporter family SLC12. Numbers indicate degree of identity.

TABLE

4.

Degree of identity among members of the electroneutral cotransporter family Full sequence

KCC1

KCC3

KCC2

KCC4

BSC1

BSC2

TSC

CIP

CCC9

KCC1

100

75.3

69.3

68.8

25.0

25.5

22.3

24.2

19.2

KCC1

KCC3

79.7

100

69.4

69.2

25.4

24

25

24.7

18.1

KCC3

KCC2

75.6

76.5

100

72.6

23.8

23.7

22.7

25.1

18.2

KCC2 KCC4

KCC4

74.0

75.4

80.0

100

24.4

25.6

24.4

23.3

20.0

BSC1

31.4

30.4

30.6

30.6

100

62.4

51.8

23.3

22.9

BSC1

BSC2

32.6

30.9

31.3

32.0

78.7

100

52.2

22.8

24.3

BSC2

TSC

27.5

27.8

27.1

27.1

60.5

58.8

100

21.6

21.8

TSC

19.2

CIP

CIP

27.9

28.7

27.0

26.8

25.4

26.3

24.6

100

KCC1

KCC3

KCC2

KCC4

BSC1

BSC2

TSC

CIP

CCC9

Central hydrophobic domain sequence Amino-terminal domain sequence

KCC1

KCC3

KCC2

KCC4

BSC1

BSC2

TSC

CIP

KCC1

100

38.1

44.3

39.8

13.6

16.1

15.3

22.0

KCC3

81.1

100

49.5

33.1

12.4

12.4

15.4

17.1

KCC3

KCC2

66.8

69.5

100

49.5

15.5

17.5

12.4

19.5

KCC2

KCC4

67.4

68.1

68.4

100

12.7

14.4

12.7

24.4

KCC4

BSC1

21.0

21.9

19.1

20.1

100

27.7

23.5

24.4

BSC1

BSC2

18.0

19.1

17.0

20.4

55.9

100

21.3

24.4

BSC2

TSC

19.6

20.1

21.1

19.9

48.4

50.1

100

17.1

TSC

CIP

KCC1

18.2

18.2

18.2

19.4

18.2

20.3

16.7

100

CIP

KCC1

KCC3

KCC2

KCC4

BSC1

BSC2

TSC

CIP

CCC9

Carboxy-terminal domain sequence

Physiol Rev • VOL

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

identity of orphan members CIP and CCC9, between the two, and with the remainder of the family is ⬃20%. In Table 4, overall degree of identity using the full sequence of all cotransporters is shown in the green boxes. Degree of identity of only the central hydrophobic domain, which according to Kyte-Doolittle (226) algorithm contains 12 ␣-helices that correspond to putative transmembrane segments, is shown in blue boxes, while degree of identity using only amino- or carboxy-terminal domains are shown in red and black boxes, respectively. As mentioned previously, topology has been experimentally corroborated only in BSC2/NKCC1 (140); thus BSC2/ NKCC1 sequence was used as a guide to define each domain. As shown in Table 4, the central domain is the protein section possessing the highest conservation. Length of this region is ⬃470 and ⬃ 540 residues in Na⫹-coupled and K⫹-coupled cotransporters, respectively. There is a slight increase in degree of identity when alignment analysis is performed using only sequences of central hydrophobic domain (Table 4), compared with full sequence. Amino-terminal domain (defined as the portion that extends from the first methionine to the beginning of transmembrane segment 1) is the most variable segment of these proteins. Length ranges from 41–285 residues and identity among KCCs is between 45–50%, while in Na⫹coupled cotransporters identity is ⬍30%, and between both branches is ⬍15% (Table 4). Alternative splicing affecting sequence of amino-terminal domain has been described in KCC3, in which two different amino-terminal sequences are possible (315). The other member in which alternative splicing involves amino-terminal domain is TSC because an isoform lacking amino-terminal domain, and the first three transmembrane segments have been identified in several tissues of winter flounder (276). The carboxy-terminal domain (defined as the segment extending from first amino acid residue after transmembrane segment 12 to the end of the protein) is more conserved in the KCC branch than in Na⫹-coupled cotransporters. As shown in Table 4, among KCCs the percentage of identity in carboxy-terminal domain is similar to the degree observed within central hydrophobic domain, while in Na⫹-coupled cotransporters the identity is lower. The length of this domain ranges from 413 to 480 residues. An alternatively splicing isoform in BSC2/ NKCC1 due to lack of 21 residues of the carboxy-terminal domain has been described. Consequences of the splicing are not yet known (332). As previously discussed, there is also evidence for a shorter carboxy-terminal domainspliced variant in BSC1/NKCC2 (290). Modifications in the carboxy-terminal sequence and length confer upon the cotransporter with interesting changes in functional properties that are discussed in section IIIB. Finally, there are two unique regions within the carboxy-terminal domain. One in the Na⫹-K⫹-2Cl⫺ cotransporter of ⬃60 amino acid residues that is not present in TSC, which exhibits a Physiol Rev • VOL

437

degree of identity ⬍13% between BSC1/NKCC2 and BSC2/ NKCC1; thus this is a unique region in both cotransporters. The presence of several putative phosphorylation sites, including one putative PKA site in BSC2/NKCC1, suggests that this region may be associated with specific regulatory properties of each cotransporter. The remaining unique region belongs to KCC2. There are 73 amino acid residues in the carboxy-terminal domain of KCC2 that are not present in KCC1, KCC3, and KCC4. This region also contains several putative regulatory sites, including one for PKA phosphorylation. III. FUNCTIONAL PROPERTIES Since the discovery of these membrane transport systems, several investigators have studied in different cells and organisms the functional characteristics of the basolateral Na⫹-K⫹-2Cl⫺ and K⫹-Cl⫺ cotransporters. Characterization of the same cotransport system in several different cells has yielded important functional differences in which it is difficult to define whether they are related to the cotransporter protein itself, to species differences in the protein, or to the environment in which it was studied. In the case of K⫹-Cl⫺ cotransporter, most functional characterization has been carried out in erythrocytes and before knowing that there are four different genes encoding this cotransporter. We will not review here the functional characterization that has been performed in situ in cells expressing these cotransporters. For in-depth reviews about it see References 161, 162, 164, 235, 234, 337, 351, 427. Due to its unique and specific localization in the kidney, together with absence of reliable stable cell lines from TALH and DCT, functional characterization of apical Na⫹-K⫹-2Cl⫺ and Na⫹-Cl⫺ cotransporters has been less active (for review, see Refs. 19, 302, 348). In recent years, with identification and cloning of cDNA encoding all members of the family, in-depth characterization of the major functional, pharmacological, and some regulatory properties has been possible, increasing our understanding of the cotransporter process. In this section we review the functional characterization of each member of electroneutral cotransporter family that has been performed by means of functional expression assays of cloned cDNAs in mammalian (v.gr. HEK-293 cells, MDCK cells, etc.) or nonmammalian (v.gr. X. laevis oocytes) expression systems. A. Thiazide-Sensitive Naⴙ-Clⴚ Cotransporter As discussed in the previous section and shown in Table 1, TSC cDNA has been identified and cloned in fish from winter flounder urinary bladder (137) and in mammals from rat (136), mouse (221), rabbit (43), and human (265, 377) renal cortex. Heterologous expression of te-

85 • APRIL 2005 •

www.prv.org

438

GERARDO GAMBA

leost, rat, mouse, and human TSC has been achieved in X. laevis oocytes (72, 136, 137, 221, 283, 352). This expression system has shown to be an excellent tool to obtain clean and reproducible TSC expression, whereas transfection in mammalian cells has not been successful. The best results obtained to date using wild-type TSC cDNA transfected into mammalian cells (MDCK cells) consisted of a small increase over background not ⬎25% (74). Thus basically all TSC functional characterization has been performed using X. laevis oocytes as expression system. Initial characterization of TSC was obtained after cloning of the flounder cotransporter, in which observations from Renfro (341) and Stokes et al. (389) were confirmed, i.e., that Na⫹ and Cl⫺ transport was indeed interdependent and specifically inhibited by thiazide-type diuretics, with an affinity profile similar to that previously shown for inhibition of Cl⫺-dependent Na⫹ absorption in flounder urinary bladder, assessed as the short-circuit current (244) and for thiazide competition for high-affinity [3H]metolazone binding site on rat kidney cortical membranes (26). More recently, functional, pharmacological, and some regulatory properties of rat TSC (rTSC) (283), mouse TSC (mTSC) (352), and flounder (flTSC) (410) were described by assessing 22Na⫹ uptake in X. laevis oocytes microinjected with cRNA in vitro transcribed from each of these orthologs. As shown in Table 5, a number of interesting differences were observed between fish and mammalian TSC. Analysis of ion transport kinetic properties revealed that apparent Km values for Na⫹ and Cl⫺ in mammalian TSC proteins, either rTSC or mTSC, are significantly lower than Km values observed in the teleost protein flTSC. Km values of ⬍10 mM for Na⫹ and Cl⫺ observed in rTSC by Monroy et al. (283) agree with previous observations by Vela´zquez et al. (412) that Na⫹ and Cl⫺ in DCT absorption were interdependent, with one-half maximal concentration of both ions ⬃10 mM; thus mammalian TSC exhibits significantly higher affinity for cotransported ions. Interestingly, in mammalian TSC, affinity for both ions is similar, whereas in teleost TSC, affinity for extracellular Cl⫺ is higher than affinity for Na⫹. The polythiazide ⬎ metolazone ⬎ bendroflumethiazide ⬎ trichloromethiazide ⬎ chlorthalidone inhibitory profile is similar between teleost and mammalian TSC, but flTSC exhibited lower affinity for every thiazide di-

5. Ion transport and thiazide-sensitive kinetics of TSC orthologs

TABLE

Na⫹ Km, mM Cl⫺ Km, mM Polythiazide IC50, ␮M

Rat TSC (283)

Mouse TSC (352)

Flounder TSC (410)

7.6 ⫾ 1.6 6.3 ⫾ 1.1 3 ⫻ 10⫺7

7.2 ⫾ 0.4 5.6 ⫾ 0.6 4 ⫻ 10⫺7

58.2 ⫾ 7.1 22.1 ⫾ 4.2 7 ⫻ 10⫺6

Reference numbers are given in parentheses. Physiol Rev • VOL

FIG. 5. Kinetics of metolazone inhibition of rat (rTSC) and flounder (flTSC) thiazide-sensitive Na⫹-Cl⫺ cotransporter expressed in Xenopus laevis oocytes, as stated. rTSC and flTSC activity is expressed as percent of control 22Na⫹ uptake (60 min) in the absence of inhibitor.

uretic tested. One example is depicted in Figure 5 that shows dose-dependent inhibition of rTSC and flTSC expressed in X. laevis oocytes in a simultaneous experiment in which oocytes injected with each cotransporter cRNA were exposed to identical uptake mediums containing different concentrations of the drug. EC50 values are shown in Table 5. In fact, at 10⫺4 M concentration, certain thiazides such as trichloromethiazide and chlorthalidone reduced flTSC activity by only 68 and 46%, respectively (410), whereas the same concentration of all thiazides inhibited rTSC by ⬎95% (283). Therefore, in TSC higher affinity for ions accompanies higher affinity for thiazides. Two different proposals for order of ion binding to cotransporter have been advanced for TSC. One was based on data obtained by Tran et al. (404) who assessed the cotransporter by measuring [3H]metolazone binding to membranes extracted from renal cortex, while the other data were obtained by Monroy et al. (283), based on functional expression experiments of rTSC expressed in X. laevis oocytes. Beamount et al. (26) observed that tracer [3H]metolazone is able to bind to plasma membranes at two different sites: one with high affinity (Kd ⫽ 4.27 nM) and the other with low affinity (Kd ⫽ 289 nM). This latter site was unspecific, whereas the high-affinity [3H]metolazone binding site was found present only in renal cortical membrane preparations and was selectively blocked by thiazides, with an affinity profile similar to their potency as clinical diuretics. In addition, high-resolution autoradiography of kidney sections with tracer [3H]metolazone as marker strongly suggested that the high-affinity binding site was present only in cells from DCT (27). Thus, before TSC cDNA and protein became available, assessing the high-affinity site for metolazone in membrane preparations from renal cortex was the stan-

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

dard approach to assess putative thiazide receptor, i.e., the thiazide-sensitive Na⫹-Cl⫺ cotransporter, and much information regarding the cotransporter role in several physiological and pathophysiological processes was obtained following this strategy (25, 28, 53, 54, 117–119). In one of these studies, Tran et al. (404) analyzed the effect of extracellular ion concentration on [3H]metolazone binding to renal cortical membranes and basically observed that in putative thiazide-sensitive transport protein sodium increases, while chloride decreases the affinity for metolazone and sodium increases the affinity for chloride. Based on these data, they proposed that TSC contains two binding sites: one that is selective for sodium and the one that can recognize either chloride or metolazone in a competitive fashion, that is, chloride and metolazone share the same site on the cotransporter or that binding of chloride or metolazone to its own site prevents binding of the other. In this model, occupancy of the sodium site increases affinity of the second site for chloride and/or metolazone; similar results were observed using a numerical computerized model to perform kinetic predictions in TSC (52). Monroy et al. (283) proposed a different model for ion and diuretic interactions. This model is based on analysis of functional properties of rTSC expressed in X. laevis oocytes. In this model, it was observed that affinity for Na⫹ or Cl⫺ was changed as a function of counterion concentration in the uptake medium. For instance, the apparent Km for extracellular Cl⫺ varied from 6.4 ⫾ 1.7 to 21.2 ⫾ 0.4 mM when extracellular Na⫹ concentration was 40 or 2 mM, respectively. Thus the lower the extracellular Na⫹ concentration, the lower the Cl⫺ affinity, supporting predictions advanced by Tran et al. (404) that Na⫹ increases Cl⫺ binding. However, a similar observation was obtained for affinity of extracellular Na⫹ because Km values for Na⫹ moved from 7.2 ⫾ 2.4 mM when extracellular Cl⫺ concentration was 40 mM to 41.9 ⫾ 6.9 when Cl⫺ concentration in the uptake medium was 2 mM. These data suggested that binding of each ion is random but that it is nevertheless affected by concentration of the counterion. A similar observation was made with regard to metolazone affinity. When metolazone dose-response effect was performed in low Na⫹ or Cl⫺ concentration, it was observed that IC50 was shifted to the left, indicating that the lower the Na⫹ or the Cl⫺ concentration, the higher the affinity for metolazone, suggesting that both ions compete with metolazone for binding in the cotransporter. Thus the proposed model included a random order of binding with both ions affecting affinity for the counterion and competing with thiazide diuretics (283). To date, data discussed in section IVA, in which some specific point mutations have been studied in TSC protein, appears to favor the Cl⫺ to metolazone interaction hypothesis. Interestingly, competition between ions and thiazides in TSC generated another functional difference bePhysiol Rev • VOL

439

tween rat and flounder TSC because in the latter species, ion concentration has no effect on affinity for thiazide diuretics (410). In addition to kinetic and pharmacological differences, mammalian and teleost TSC are differently regulated by cell volume because behavior of rTSC and flTSC is different in response to changes in extracellular medium osmolarity. rTSC activity is reduced by ⬃40% in hypotonicity, whereas flTSC activity is reduced in hypertonicity. Thus mammalian TSC is activated by cell shrinkage, while flounder TSC is activated by cell swelling. Because X. laevis oocytes were used for both experiments, this observation also suggests that a different response to cell volume changes is encoded within the cargo molecule. B. Apical Bumetanide-Sensitive Naⴙ-Kⴙ-2Clⴚ Cotransporter Apical and renal specific isoforms of the Na⫹-K⫹2Cl cotransporter have been cloned and analyzed at the functional level from shark (134), rat (136), mouse (187, 290), rabbit (311), and human (384) kidney. Initial cloning demonstrated in X. laevis oocytes that the 1,095 amino acid residues isolated from rat outer medulla by Gamba et al. (136) induced appearance of significant 86Rb⫹ uptake over background that was Na⫹ and Cl⫺ dependent, bumetanide sensitive, but metolazone and DIDS resistant. Simultaneously, Payne and Forbush (311) also cloned the Na⫹-K⫹-2Cl⫺ cotransporter cDNA from a rabbit outer medulla ␭ZAP cDNA library. No functional expression was present, but as shown in Table 1, the investigators were able to isolate what appeared to be three alternatively spliced isoforms, due to the existence of three mutually exclusive cassette exons denominated A, B, and F. The same isoforms were later shown as present also in Na⫹-K⫹-2Cl⫺ cotransporter from mouse (187, 290) and human (384) kidney. As shown in Figure 6, differences among A, B, and F isoforms in exon sequence are subtle. The majority of amino acid residues are identical among A, B, and F isoforms. There are only three residues not ⫺

FIG. 6. Amino acid sequence of mutually exclusive cassette exons A, B, and F of mouse apical renal specific Na⫹-K⫹-2Cl⫺ cotransporter. Red boxes depict amino acid residues that are different in the three exons. Orange boxes highlight the residues that are unique to isoform A, blue box the residue that is unique to isoform B, and green boxes the residues unique to isform F.

85 • APRIL 2005 •

www.prv.org

440

GERARDO GAMBA

conserved among the three isoforms (boxed in red in Fig. 6); in addition, few residues not conserved in one isoform are identical in the other two, i.e., are unique to one isoform. These include three residues in A isoform (highlighted in orange boxes), one residue in B isoform (highlighted in blue box), and four residues in F isoform (highlighted in green boxes). Because differences in the sequence of exon 4 are subtle, it was proposed that exon cassettes could endow the cotransporter with different ion affinities or even with different ion specificities. In this regard, Eveloff and Calamia (116) and Sun et al. (393) previously showed that rabbit and mouse TALH, respectively, exhibited expression of a K⫹-independent, but nonetheless bumetanide-sensitive Na⫹-Cl⫺ transport mechanism. However, the first functional characterization of Na⫹-K⫹-2Cl⫺ with each different cassette exon performed by Plata et al. (325) showed that the three murine isoforms (A, B, and F) of the SLC12A1 gene encode the Na⫹-K⫹-2Cl⫺ and not Na⫹-Cl⫺ cotransporter, suggesting that difference among spliced variants could be in ion transport or bumetanide-affinity kinetics. This hypothesis was also supported by intrarenal localization studies of Payne and Forbush (311), Igarashi et al. (187), and Yang et al. (447), which demonstrated by Northern blot analysis, in situ hybridization analysis with specific probes, and single-nephron RT-PCR, respectively, that these isoforms exhibited axial distribution along TALH of rabbit, mouse, and rat kidney, respectively. As shown in Figure 7, the F isoform was absent in cortical TALH (cTALH) and present in medullary TALH (mTALH), with higher levels of expression in the inner than in the outer stripe of the outer medulla. The A isoform is present in

both cTALH and mTALH, with higher expression in the outer stripe of outer medulla, whereas the B isoform is present only in cTALH. No B isoform was observed in mTALH. Early studies on isolated cTALH segments by Burg (45) and on mTALH segments by Rocha and Kokko (347) indicated that NaCl transport rate in mTALH is significantly more rapid than in cTALH, but with greater diluting power in the later segment (334). These observations suggested the existence of heterogeneity of transport properties along TALH. The hypothesis was also supported by the fact that apparent affinity for Cl⫺ observed by Greger (150), Hus-Citharel and Morel (186), and Eveloff (115) when cTALH was used as a source of plasma membrane vesicles, was different from the apparent affinity obtained by Koenig (217) and Burnham (46) when mTALH was used. Thus it was speculated that heterogeneity in salt transport along TALH could be due to axial distribution of the three isoforms, namely, A, B, and F, of the Na⫹-K⫹-2Cl⫺ cotransporter, exhibiting different ion affinities and transport rate. Plata et al. (324) and Gime´nez et al. (144) simultaneously obtained evidence that this is indeed the case in mouse and rabbit isoforms, respectively. When expressed in X. laevis oocytes, F isoform was shown to be the variant with the lowest affinity for cotransported ions (Table 6). This is the isoform that is predominantly expressed in the inner stripe of outer medulla, where salt concentration is very high and where greater changes in extracellular osmolarity occur. The A isoform was shown to be the variant with the highest transport capacity, together with affinity for cotransported ions that was higher than in the F isoform,

⫹ ⫹ ⫺ FIG. 7. Localization of the F, A, and B isoforms of apical Na -K -2Cl cotransporter BSC1/NKCC2 along the thick ascending limb of Henle (TALH). Isoform F in green is mainly expressed in the inner strip of the outer medulla, isoform A is present all along the TALH, and isoform B is exclusively expressed in the cortical portion of the TALH.

Physiol Rev • VOL

85 • APRIL 2005 •

www.prv.org

441

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

6. Major functional properties of mutually exclusive cassette exon isoforms A, B, and F of the renal specific Na⫹-K⫹-2Cl⫺ cotransporter BSC1/NKCC2

TABLE

Sodium, mM

F A B

Potassium, mM

Chloride, mM

Mouse*

Rabbit†

Mouse*

Rabbit†

Mouse*

Rabbit†

Bumetanide‡ IC50, ␮M

20.6 ⫾ 7.2 5.0 ⫾ 3.9 3.0 ⫾ 0.6

66.7 ⫾ 5.8 16.4 ⫾ 1.9 20.6 ⫾ 2.4

1.54 ⫾ 0.16 0.96 ⫾ 0.16 0.76 ⫾ 0.07

2.93 ⫾ 4.48 0.78 ⫾ 0.08 0.89 ⫾ 0.17

29.2 ⫾ 2.1 22.2 ⫾ 4.8 11.6 ⫾ 0.7

111 ⫾ 13.4 44.6 ⫾ 3.87 8.95 ⫾ 1.13

3.4 2.0 0.60

Uptake,‡ nmol/oocyte

Response to Cell Swelling‡

19.3 ⫾ 1.9 13.2 ⫾ 1.6 12.0 ⫾ 1.5

222 2 22

* Expressed as EC50 (324). † Expressed as Km (144). ‡ Analyzed only in mouse BSC1/NKCC2 (324).

but lower than in the B isoform. Thus the Na⫹-K⫹-2Cl⫺ variant with high capacity, middle affinity is expressed all along mTALH and cTALH. Finally, the B isoform was observed to be the variant with the highest affinity for three cotransported ions. Therefore, the B isoform only present in cTALH, in which Na⫹-Cl⫺ concentration of tubular fluid has been greatly reduced, exhibits the highest affinity for ions. This explains the dilution power of cTALH. Interestingly, the A and F isoforms, but not the B variant, are expressed in shark kidney (134), supporting the proposed relationship between the B exon and the macula densa, due to the fact that this latter isoform is expressed in this region of the nephron, which is lacking in shark kidneys. As shown in Table 6, in addition to differences in ion transport kinetics, Plata et al. (324) observed three major differences among the isoforms. 1) The B isoform is the one with highest affinity for bumetanide, while the A and F isoforms were very similar. 2) The A isoform is the molecular variant with the highest capacity for transport. Although each time oocytes were injected with similar amounts of cRNA, combined data from 11 experiments (Table 6) showed that uptake in oocytes injected with the A isoform cRNA was significantly higher than uptake observed in B and F oocytes. However, analysis performed by confocal microscopy in oocytes injected with cRNA from each isoform in which enhanced green fluorescence protein (EGFP) was attached in-frame to the amino-terminal domain revealed that surface expression of the three isoforms was similar. Thus, although similar amounts of cotransporter isoforms were present in the plasma membrane, 86Rb⫹ uptake was higher in oocytes injected with the A isoform, suggesting that this is the variant with the highest capacity. 3) The F isoform exhibits the highest sensitivity to extracellular osmolarity. When oocytes injected with each isoform were exposed to the same hypotonic medium, inhibition of 86Rb⫹ uptake was significantly higher in F than in A or B oocytes. In this regard, it is known that changes in interstitial osmolarity occur with greater intensity in inner stripe of the outer medulla, where the F isoform is mainly expressed. Thus higher sensitivity for changes in cell volume in the F isoform agrees with its proposed localization. Physiol Rev • VOL

As discussed later and shown in Table 1, a carboxyterminal domain spliced isoform has been identified from a mouse outer medulla cDNA library (290). This shorter isoform contains 55 amino acid residues at the end of carboxy-terminal domain that are not present in the Na⫹K⫹-2Cl⫺ cotransporter. Using rabbit polyclonal antibody against this 55 unique piece, Mount et al. (290) were able to demonstrate the existence of this shorter protein in mouse outer medulla by Western blot analysis. In addition, immunohistochemistry demonstrated that antiBSC1-S antibody exclusively labeled TALH cells apical membrane. Labeling was heterogeneous because not all cells were positive, suggesting that some cells do and others do not express this shorter isoform. Staining decreased in frequency along individual medullary rays toward the cortex. In addition to observed cellular heterogeneity, staining of mTALH with BSC1-S antibody lacked sharp apical definition, suggesting a significant component of subapical expression. Functional expression in X. laevis oocytes has suggested two different roles for this shorter BSC1-S isoform: as a regulatory molecule and as a cotransporter. As a regulatory molecule, BSC1-S exerts a dominant-negative effect on the longer Na⫹-K⫹-2Cl⫺ cotransporter isoform that can be abrogated by cAMP (325). In multiple experiments, Plata et al. (325) observed that BSC1-S reduced transport activity of the high-expressing BSC1-L isoform. This effect occurred irrespective of which of the mutually exclusive cassettes (A, B, and F) were included in coexpressed cRNAs. The possibility of competition for translation in BSC1-S/BSC1-L coinjected oocytes was ruled out, because coinjections of BSC1-L with unrelated cRNAs did not significantly reduce uptake. In addition, cAMP abrogated the inhibitory effect of BSC1-S isoform, suggesting a specific functional effect. Thus Plata et al. (325) concluded that the carboxy-terminal truncated isoform of SLC12A1 gene in mouse exerts a dominant-negative function on ion transport by the Na⫹-K⫹-2Cl⫺ cotransporter, a property that is reversed by cAMP. More recently, using a confocal microcopy strategy, in BSC1-L and BSC1-S proteins in which EGFP was attached in frame to the amino-terminal domain, Meade et al. (269) observed that the mechanism by which BSC1-S reduced Na⫹-K⫹-2Cl⫺ cotransporter activity is by preventing ar-

85 • APRIL 2005 •

www.prv.org

442

GERARDO GAMBA

rival of the cotransporter to the plasma membrane; again, this effect can be prevented by cAMP. Thus it is likely that in mouse mTALH, activation of the Na⫹-K⫹-2Cl⫺ cotransporter by hormones generating cAMP via their respective Gs-coupled receptors (v.gr. vasopressin) requires the presence of the shorter BSC1-S isoform. In this hypothesis, absence of cAMP allows BSC1-S to reduce cotransporter activity, while in the presence of cAMP, the BSC1-S negative effect upon the longer BSC1-L isoform is inhibited. In this regard, Mount et al. (290) observed that expression of BSC1-S is axially distributed along the TALH, because cTALH appears to express many fewer BSC1-S than mTALH segments. This heterogeneity may explain the observation that in mouse the vasopressin effect is present in mTALH but absent in cTALH (170). The murine shorter isoform BSC1-S also exhibits activity as a cotransporter. Using X. laevis oocytes as an expression system, Plata et al. (323) observed that BSC1-S cRNA encodes a K⫹-independent, but nevertheless loop diuretic-sensitive, Na⫹-Cl⫺ cotransporter that requires exposure to hypotonicity for activation, by a mechanism that includes a shift in expression of the cotransporter protein from cytosol to plasma membrane. In addition, it was also shown that Na⫹-Cl⫺ transport function of BSC1-S in hypotonic media is inhibited by addition of cAMP and further stimulated by blocking PKA activity with H-89. In this regard, existence of a K⫹-independent, furosemide-sensitive Na⫹-Cl⫺ cotransporter in rabbit and mouse mTALH was proposed years before that by Eveloff and co-workers (11, 116) and Sun et al. (393), respectively. In rabbit mTALH cells exposed to hypotonicity, the furosemide-sensitive Na⫹-Cl⫺ cotransporter was apparent, whereas when cells were exposed to isotonicity, furosemide-sensitive Na⫹ uptake became K⫹ dependent, constituting the Na⫹-K⫹-2Cl⫺ cotransporter mechanism (116). A few years later, Sun et al. (393) using isolated perfused mouse mTALH tubules observed that vasopressin (i.e., cAMP) shifts the mode of apical cotransport from Na⫹-Cl⫺ to Na⫹-K⫹-2Cl⫺. Taken together, these data indicate that in mTALH, when extracellular osmolarity is low (or cell swelling occurs by other means) and in the absence of vasopressin (or cAMP), transepithelial salt reabsorption is mainly due to an apical Na⫹-Cl⫺ cotransporter, encoded by the shorter carboxy-terminal domain isoform of SLC12A1 gene (323), whereas when extracellular osmolarity is increased and/or in the presence of vasopressin, the major salt transport pathway is the Na⫹K⫹-2Cl⫺ cotransporter, encoded by BSC1/NKCC2, the long carboxy-terminal domain isoform of SLC12A1 gene (325). C. Basolateral Bumetanide-Sensitive Naⴙ-Kⴙ-2Clⴚ Cotransporter The Na⫹-K⫹-2Cl⫺ cotransporter basolateral isoform BSC2/NKCC1 has been identified at the molecular level Physiol Rev • VOL

from several mammalian sources and from shark rectal gland (Table 1). However, functional expression analysis has been performed only from human (314) and shark orthologs (189, 440). In both cases, characterization was obtained in HEK-293 cells transfected with corresponding cDNA. Affinity constants for transported ion and inhibition by bumetanide observed in these studies are shown in Table 7. It is obvious from the data in Table 7 that human Na⫹-K⫹-2Cl⫺ cotransporter exhibits significantly higher affinity for Na⫹, K⫹, and Cl⫺ compared with shark ortholog. In addition, affinity for bumetanide inhibition is also higher in mammalian than in shark cotransporter. This situation is similar to that discussed previously for rat and flounder TSC, suggesting that electroneutral cation-chloride cotransporters from mammalian sources exhibit higher affinity for ions that do their fish orthologs. As discussed in detail in section IVA, differences in ion and bumetanide transport affinity and inhibition, respectively, between human and shark Na⫹-K⫹-2Cl⫺ cotransporter have been exploited by Isenring and Forbush (192) to define major affinity modifier regions within the cotransporter. Two alternative spliced isoforms of mouse BSC2 have been reported by Randall et al. (332), and two different genes encoding basolateral isoforms in eel were reported by Cutler and Cramb (69); however, functional consequences are still unknown. In addition to characterization of human and shark cDNA clones mentioned previously, endogenous basolateral Na⫹-K⫹-2Cl⫺ cotransporter has been extensively characterized in situ from many different cells and tissues. Discussion of this information is beyond the scope of this work and has been extensively reviewed recently in excellent manuscripts to which the reader is referred (164, 192, 351). D. Kⴙ-Clⴚ Cotransporter 1 Before molecular identification of four genes encoding isoforms of the K⫹-Cl⫺ cotransporter, the majority of functional characterization of this cotransport system was performed in red blood cells (235, 234). In this sec-

7. Ion transport kinetics and bumetanide affinity of the ubiquitously expressed Na⫹-K⫹-2Cl⫺ cotransporter isoform BSC2/NKCC1 TABLE

Sodium Km, mM

hNKCC1 hNKCC1 HEK-293 sNKCC1 sNKCC1 sNKCC1

Rubidium Km, mM

Chloride Km, mM

19.6 ⫾ 4.9 2.68 ⫾ 0.72 26.5 ⫾ 1.3 15.2 ⫾ 1.5 1.6–2.5 31 ⫾ 1.0 22 12 110 42 12 110 165 ⫾ 34 14 ⫾ 8.0 101 ⫾ 24 113 ⫾ 11 9.6–11.6 102 ⫾ 7

Bumetanide Ki, ␮M

Reference Nos.

0.16 0.044–0.079 0.054 0.54 0.57 0.22–0.30

314 189 440 440 314 189

hNKCC1, human NKCC1; sNKCC1, shark NKCC1.

85 • APRIL 2005 •

www.prv.org

443

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

tion, functional data obtained from each isoform by functional expression experiments are reviewed. To date, functional analysis of all four K⫹-Cl⫺ cotransporter (KCC) isoforms has revealed significant regulatory, kinetic, and pharmacological differences among KCC isoforms. As shown in Table 8, five studies have dealt with some aspects of the functional properties of KCC1. Functional characterization of KCC1 was initially obtained by Gillen et al. (142) when KCC1 cDNA was first identified from rabbit, rat, and human sources. Rabbit isoform (rbKCC1) was used for functional expression experiments in HEK-293 cells. It was shown that transfection of HEK-293 cells with rbKCC1 cDNA produced a significant increase of an 86Rb⫹ efflux mechanism that was activated by twofold when cells were exposed to hypotonicity. rbKCC1 activity assessed as Cl⫺-dependent 86Rb⫹ uptake was stimulated by NEM and inhibited by the presence of 2 mM furosemide, indicating that rbKCC1 indeed encoded a K⫹-Cl⫺ cotransporter with similar characteristics to those previously reported in erythrocytes (232, 233). Although ion transport kinetics for Cl⫺ and Rb⫹ dependency of 86Rb⫹ uptake were assessed, Km values were reported only as ⬎25 mM for Rb⫹ and as ⬎50 mM for extracellular Cl⫺. In contrast, Ki values for loop-diuretic inhibition of 86Rb⫹ uptake were more precisely measured as 59 ⫾ 9 ␮M for bumetanide and 40 ⫾ 4 ␮M for furosemide. Holtzman et al. (180) also used HEK-293 cells to study certain functional properties of KCC1 cloned from pig, human, and the nematode Caenorhabditis elegans. They showed that when transfected into HEK-293 cells all three KCC1 orthologs behaved as K⫹-Cl⫺ cotransporters that were twofold activated by hypotonicity. Functional properties of mouse and rabbit KCC1 have been also analyzed using X. laevis oocytes as heterTABLE

8.

ologous expression system (31, 275, 392). In these cells, hypotonicity activation of KCC1 activity was more apparent. Su et al. (392) using mouse KCC1 and Mercado et al. (275) using rabbit KCC1 observed that in X. laevis oocytes KCC1 is not functional in isotonicity. However, a 20-fold increase in Cl⫺-dependent 86Rb⫹ uptake was observed when oocytes were incubated in hypotonicity. As shown in Figure 8, this behavior of KCC1 is similar to that seen in KCC3 and KCC4 but different from KCC2. As shown in Table 8, both studies showed that hypotonicity-induced activation could be prevented by calyculin A, indicating that blocking protein phosphatases activity abrogated KCC1 activation, as previously demonstrated in the K⫹Cl⫺ cotransport pathway of rabbit and human red blood cells (40, 195, 200, 219, 382). Thus activation of KCC1 by cell swelling requires dephosphorylation of the cotransporter. To further discriminate between phosphatases in addition to calyculin A, the effects of okadaic acid at a concentration of 1 nM, which inhibits only protein phosphatase (PP) 2A, and cypermethrin, which inhibits only PP2B (37, 111), were tested. Because these two compounds did not affect activation of KCC1 in X. laevis oocytes (275), it was concluded that PP1 is the phosphatase involved in activation of KCCs during cell swelling. Apparent affinity for K⫹ and Cl⫺ varied among studies. As shown in Table 8, one study suggested that the Km value for extracellular K⫹ is ⬎50 mM, while the other study showed that the apparent K⫹ Km is around 17 mM. In a third study, Km for Rb⫹ transport of ⬃12 mM was obtained by Bergeron et al. (31), suggesting that a Km for K⫹ transport of 17 mM is probably real. The apparent Cl⫺ Km is also ⬃17 mM, suggesting that affinity is similar for both cotransported ions. One study showed that 86Rb⫹ uptake was possible in the presence of other anions,

Functional properties of K⫹-Cl⫺ cotransporter KCC1 by using heterologous expression systems Gillen and Forbush (142)

Holtzman et al. (180)

Su et al. (392)

Mercado et al. (275)

Bergeron et al. (31)

Expression system

HEK-293 cells

Xenopus laevis oocytes

Xenopus laevis oocytes

Xenopus laevis oocytes

Source of KCC1 cDNA

Rabbit

HEK-293 cells Pig Human

Mouse

Rabbit

Rabbit

No 20-fold ⫹ ⫹⫹⫹ No No Reduction by 25% 17.5 ⫾ 2.3 mM

No 4-fold

Caenorhabditis elegans Activity in isotonicity Activation by hypotonicity Activation by NEM Inhibition by calyculin Inhibition by okadaic acid Inhibition by cypermetrin Effect of barium K⫹ affinity (Km)* Rb⫹ affinity (Km) NH⫹ 4 affinity (Km) Cl⫺ affinity (Km)* Bumetanide affinity Anion series

Yes 2-fold ⫹

Yes 2-fold ⫹

No 20-fold ⫹ ⫹⫹⫹ ⫹

⬎50 mM ⬎25 mM 59 ⫾ 9 ␮M (Ki)

16.1 ⫾ 4.2 180 ␮M (IC50) Cl⫺ ⬎ SCN⫺ ⫽ Br⫺ ⬎ PO3⫺ ⬎ I⫺ ⬎ gluconate 4

* K⫹ and Cl⫺ Km in Figure 10 were 25.5 ⫾ 3.2 and 38.5 ⫾ 11 mM, respectively. Physiol Rev • VOL

85 • APRIL 2005 •

www.prv.org

12.4 ⫾ 3.1 22.9 ⫾ 13.5

444

GERARDO GAMBA

⫹ ⫺ FIG. 8. Functional expression of K -Cl cotransporter isoforms in Xenopus laevis oocytes microinjected with 10 –20 ng of in vitro-transcribed cRNA per oocytes. Uptakes were performed under hypotonic conditions, in the presence (open bars) or absence (black bars) of extracellular chloride. 86Rb⫹ uptake in all isoforms was Cl⫺ dependent and higher than uptake observed in waterinjected oocytes. In contrast, inset shows behavior of the same batch of oocytes when 86Rb⫹ uptake was performed under isotonic conditions. KCC2 was the sole cotransporter in which uptake was significantly different from water-injected oocytes.

specifically isethionate and bromide (275), with the profile shown in Table 8. As shown in Figure 9, an interesting observation made by Bergeron et al. (31), not only in KCC1 but also in KCC3 and KCC4, is that K⫹-Cl⫺ cotrans⫹ porters are capable of transporting NH⫹ 4 instead K . ⫹ When exposed to increased concentration of NH4 in the external medium, KCC-injected X. laevis oocytes developed significant intracellular acidification that was higher

than that observed in water-injected oocytes. In addition, 86 Rb⫹ uptake in the presence of NH⫹ 4 , but in the absence of extracellular K⫹ or cold Rb⫹, was similar to that shown in the presence of cold Rb⫹. Dependence of 86Rb⫹ influx on extracellular NH⫹ 4 concentrations in KCC1 (and also in KCC3 and KCC4) was best fitted with a one-binding-site model and exhibited an apparent Km similar to that shown for extracellular K⫹ (see Table 8). As was first shown in the red blood cell K⫹-Cl⫺ cotransporter (450), Bergeron et al. (31) also observed that K⫹-Cl⫺ cotransporter activity is regulated by intracellular pH. They observed that KCC1 and KCC3 exhibited lower activity at intracellular pH (pHi) ⬍7.0 or ⬎7.5, while in KCC2 lower activity was observed at pHi ⬍7.5, and KCC4 was less active at pHi ⬎7.5. These observations point to a role for the K⫹-Cl⫺ cotransporter in regulation of pHi. E. Kⴙ-Clⴚ Cotransporter 2

FIG. 9. Changes in intracellular pH after incubation of Xenopus laevis oocytes injected with cRNA encoding various K⫹-dependent cation-Cl⫺ cotransporters in media containing different concentrations of NH⫹ 4 . Acidification rates were recorded in noninjected oocytes or in oocytes expressing BSC1/NKCC2, KCC1, KCC3a, or KCC4, as stated. The recording in each panel is a representative example of a typical experiment from 4 –11 oocytes. [Modified from Bergeron et al. (31).]

Physiol Rev • VOL

There are three reports available concerning functional properties of KCC2. After initial cloning of rat KCC2, Payne (310) performed a careful analysis of several functional characteristics of rat KCC2 as expressed in HEK-293 cells. As shown in Table 9, he observed that KCC2 was functional in isotonic conditions and that treatment with 1 mM NEM further increased KCC2 activity by twofold, while cell swelling had no effect on cotransporter activity. Ion transport kinetic analysis revealed that apparent Km for K⫹ and Cl⫺ were ⬃6 and 101 mM, respectively, indicating that affinity for extracellular K⫹ was significantly higher than for extracellular Cl⫺. These observations, together with the high level of neuronal-specific expression previously shown for KCC2, allowed the investigator to propose the hypothesis that KCC2 could be an important membrane protein to move Cl⫺ out of the

85 • APRIL 2005 •

www.prv.org

445

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS TABLE

9.

Functional properties of K⫹-Cl⫺ cotransporter KCC2 by using heterologous expression systems Payne (310)

Expression system Source of KCC1 Activity in isotonicity Activation by hypotonicity Activation by NEM Inhibition by calyculin Inhibition by okadaic acid Inhibition by cypermetrin Effect of barium K⫹ affinity (Km)‡ Rb⫹ affinity (Km) Cl⫺ affinity (Km)‡ Furosemide affinity Bumetanide affinity Anion series

HEK-293 cells Rat Yes No ⫹

Strange et al. (390)

Song et al. (380)

Xenopus laevis oocytes Rat Yes 3.5-fold ⫹ ⫹⫹⫹*

Xenopus laevis oocytes Human Yes 20-fold ⫹ ⫹⫹⫹† No No

5.2 ⫾ 0.9 mM

9.3 ⫾ 1.8 mM 6.8 ⫾ 0.9 mM 50 ␮M (IC50) 80 ␮M (IC50) Cl⫺ ⬎ Br⫺ ⬎ I⫺ ⫽ SCN⫺ ⫽ PO3⫺ ⫽ 4 gluconate

101 mM 25 ⫾ 3 ␮M (Ki) 55 ⫾ 13 ␮M (Ki)

* Calyculin A inhibition of KCC2 activity was observed in isotonicity and also in hypotonicity. † Calyculin A inhibition of KCC2 activity was observed only in hypotonicity. ‡ K⫹ and Cl⫺ Km in Figure 10 of this work were 11.7 ⫾ 2.6 and 7.2 ⫾ 0.8 mM, respectively.

cell, regulating intraneuronal Cl⫺ concentration and thus the type of response to certain neurotransmitters such as GABA. This major role of KCC2 was later confirmed (250, 346) and will be discussed in section VE. A second proposed possibility, with regard to the high affinity for extracellular K⫹ in KCC2 that is not present in KCC1 (see Table 8), was that KCC2 could play a fundamental role in buffering extracellular K⫹ concentration in CNS. Specifically, KCC2 was proposed to be one of the pathways that participate in reuptake of K⫹ that leaves cells during neuronal activity. In this scenario, efflux of K⫹ that normally occurs during heavy neuronal activity or during pathophysiological processes such as ischemia or hypoxia, results in increased concentration of extracellular K⫹ that in turns activates K⫹ influx by the cotransporter. In addition to K⫹, it has been shown that similar to KCC1, KCC3, and KCC4 (31), KCC2 is also capable of transporting NH⫹ 4 (246, 432). Using heterologous expression system in X. laevis oocytes, Strange et al. (390) studied rat KCC2 cDNA and Song et al. (380) identified and cloned KCC2 cotransporter cDNA from human sources. Although there is 99% identity between rat and human KCC2, several interesting differences in their functional properties were observed, in particular with respect to those reported by Payne (310). As shown in Table 9, human or rat KCC2 was functional when oocytes were incubated in isotonicity but were further activated by cell swelling by ⬃3.5-fold in rat (390) and 20-fold in human KCC2 (380); this effect was not observed by Payne in rat KCC2 expressed in HEK-293 cells (310). Inhibition of PP1 with 1 ␮M calyculin A prevented swelling-induced increase in 86Rb⫹ influx in rat and human KCC2. Because K⫹-Cl⫺ cotransporters are known to be activated by cell swelling, the fact that KCC1 and KCC2 are not activated by cell swelling in HEK-293 Physiol Rev • VOL

cells but are remarkably stimulated in X. laevis oocytes suggests as one possible explanation that HEK-293 cells do not possess some regulatory pathways required for such activation. As shown in Figure 8, one interesting difference between KCC2 with other K⫹-Cl⫺ cotransporters, when X. laevis oocytes were used as expression system, is that KCC2 exhibited activity when oocytes were incubated in isotonicity during uptake. All four cotransporters were activated by hypotonicity. This observation suggests the intriguing possibility that amino acid sequences of KCC2 could contain a motif that endows this isoform with the ability to be active in isotonic conditions. In this regard, as previously mentioned, KCC2 contains a unique sequence of 73 amino acid residues in the carboxyterminal domain that are not present in KCC1, KCC3, or KCC4. Apparent Km for Rb⫹ transport that was observed by Song et al. (380) in 9.3 ⫾ 1.8 mM is consistent with Km observed for K⫹ influx by Payne (310); however, apparent Km for Cl⫺ transport is totally different. A Km value of ⬃7 mM was observed by Song et al. under both isotonic and hypotonic conditions, suggesting that the difference with regard to the Payne study is probably not due to the cell volume at which KCC2 was expressed. Because it is known that electroneutral cotransporters form homodimers (73, 284, 385) and due to the relatively low level of expression in HEK-293 cells, one potential explanation for this discrepancy is formation of heterodimers with an endogenously expressed K⫹-Cl⫺ cotransporter in HEK293 cells, producing mixed kinetics. When X. laevis oocytes were used as an expression system, this possibility was unlikely to occur because, on one hand, although it is known that these cells express an endogenous K⫹-Cl⫺ cotransporter (xKCC) (272), activity of exogenously expressed KCC2 protein was 20-fold, suggesting that in-

85 • APRIL 2005 •

www.prv.org

446

GERARDO GAMBA

creased uptake was due solely to the exogenous cotransporter. On the other hand, kinetic analysis of xKCC revealed an apparent Km for Cl⫺ influx of 15.4 ⫾ 4.7 mM (272). F. Kⴙ-Clⴚ Cotransporter 3 As discussed in section IIB, KCC3a and KCC3b differ in length and sequence of amino-terminal domain due to the existence of two alternative exons 1, denominated 1a and 1b (315). When expressed in the X. laevis oocyte system, both isoforms induced the appearance of robust Cl⫺-dependent 86Rb⫹ uptake mechanism that was present only when oocytes were incubated in hypotonicity (Fig. 8) (273). Functional consequences of two different exons 1 have not yet been established. Initial characterization of KCC3 was performed by Hiki et al. (178) in KCC3b. As shown in Table 10, similar to previous observations in KCC1 and KCC2, the investigators showed that when HEK-293 cells were used as the expression system, KCC3b was functional under isotonic conditions, slightly activated by NEM, but without further activation by cell swelling. Race et al. (331) also used HEK-293 cells to express KCC3a cloned from a human placenta cDNA library and observed slight activation under hypotonic conditions. They performed ion-transport kinetic analysis and obtained apparent Km values for extracellular K⫹ and Cl⫺ of 9.5 ⫾ 1.4 and 51 ⫾ 9 mM, respectively. Affinity for K⫹ was lower than that shown in KCC1 (Table 8) and similar to KCC2 (Table 9), while affinity for Cl⫺ was significantly different from previous values in both KCC1 and KCC2. Real Km values are difficult to define because investigators made it clear on one hand that kinetics were carried out in cells with a low level of KCC3 expression because it was impossible to obtain kinetic analysis in cells pretreated with NEM, and

TABLE

on the other hand that different numbers were obtained in each experiment. For instance, they mention that in 12 different experiments Km observed for Cl⫺ varied from 6 to 60 mM with mean of 32 ⫾ 4 mM, suggesting again that a low level of expression could be producing different types of heterodimers with an endogenous cotransporter. As shown in Table 10, using X. laevis oocytes as the expression system, Mercado et al. (273) observed robust activity of KCC3a and KCC3b during cell swelling, resulting in apparent Km values for K⫹ and Cl⫺ that were ⬃10 mM, suggesting high affinity for cotransported ions, similar to that shown for KCC2. Another source of variability is that kinetic analysis was performed by different groups or by the same group but using different batch of oocytes, and different solutions. To define differences in kinetic properties of K⫹-Cl⫺ cotransporter isoforms in my laboratory, we have recently performed ion transport kinetics analysis of KCC1, KCC2, KCC3a, and KCC4 simultaneously, in the same experiment, using the same batch of oocytes and solutions. Uptakes were done under hypotonic conditions. Results from this analysis are shown in Figure 10. K⫹ and Cl⫺ transport kinetics were very similar among KCC2, KCC3a, and KCC4. Only KCC1 appears to be different, exhibiting a significantly lower affinity for both transported ions. Km values for K⫹ transport in KCC1, KCC2, KCC3a, and KCC4 were 25.5 ⫾ 3.2, 11.7 ⫾ 2.76, 14.9 ⫾ 2.68, and 10.2 ⫾ 2.4 mM, respectively, whereas Km values for Cl⫺ transport in the same order were 38.5 ⫾ 11, 7.23 ⫾ 0.8, 9.41 ⫾ 1.9, and 5.6 ⫾ 1.1 mM, respectively. Thus affinity profile for extracellular K⫹ and Cl⫺ among KCCs is KCC2 ⫽ KCC4 ⫽ KCC3 ⬎ KCC1. Finally, KCC3 was shown as the only variant in which 86 Rb⫹ uptake is better in the presence of an anion, different from Cl⫺. Uptake in the presence of Br⫺ was slightly but significantly better than in the presence of Cl⫺.

10. Functional properties of the K⫹-Cl⫺ cotransporter KCC3 by using heterologous expression systems Hiki et al. (178) KCC3b

Expression system Source of KCC1 Activity in isotonicity Activation by hypotonicity Activation by NEM Inhibition by calyculin Inhibition by okadaic acid Inhibition by cypermetrin K⫹ affinity (Km)* Rb⫹ affinity (Km) NH⫹ 4 affinity (Km) Cl⫺ affinity (Km)* Furosemide affinity Bumetanide affinity Anion series

HEK-293 cells Human Yes No ⫹

Race et al. (331) KCC3a

HEK-293 cells Human Yes ⫹ ⫹⫹

9.5 ⫾ 1.4 mM

10 ␮M (Ki) 40 ␮M (Ki)

51 ⫾ 9 mM 50 ␮M (IC50) 100 ␮M (IC50)

Bergeron et al. (31) KCC3a

Mercado et al. (273) KCC3a

Xenopus laevis oocytes Human No 11-fold

Xenopus laevis oocytes Human No 20-fold ⫹ ⫹⫹⫹ No No 11.8 ⫾ 0.9 mM 10.7 ⫾ 2.5 mM

17.2 ⫾ 3.0 mM 17.3 ⫾ 2.2 mM

7.6 ⫾ 1.2 mM 180 ␮M (IC50) Br⫺ ⬎ Cl⫺

* K⫹ and Cl⫺ affinity in KCC3a and KCC3b are similar. K⫹ and Cl⫺ Km for KCC3a in Figure 10 of this work were 14.9 ⫾ 2.6 and 9.4 ⫾ 1.9 mM, respectively. Physiol Rev • VOL

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

447

KCCs, activation of KCC4 during cell swelling is also prevented by calyculin A, but not by okadaic acid and cypermethrin, suggesting a major role for PP1 in activating the cotransporter. Apparent Km values for extracellular K⫹ and Cl⫺ were 17.5 ⫾ 2.7 and 16.2 ⫾ 4.2 mM, respectively, although more recent values obtained in my laboratory (Fig. 10) are somewhat lower. As shown in Figure 9, Bergeron et al. (31) demonstrated that KCC4 is ⫹ also capable of transporting NH⫹ 4 instead K . The Km ⫹ value for Rb uptake in the presence of extracellular Rb⫹ was 12.3 ⫾ 5.5 mM, while the Km value for Rb⫹ uptake in the presence of NH⫹ 4 was 13.5 ⫾ 5.5 mM. These values revealed an affinity for NH⫹ 4 similar to that shown for extracellular K⫹. Interestingly, Bergeron et al. (31) also showed that KCC4 is pH regulated. Maximal activity is reached at extracellular pH ⬍7.0, and the cotransporter becomes inactive at pH ⬎7.8. This is an important observation given the expression of KCC4 in intercalated cells of renal collecting duct, suggesting a role for this cotransporter in acid-base metabolism (see sect. VG). Affinity for furosemide and bumetanide in KCC4 is the lowest of all isoforms. The IC50 observed by Mercado et al. (275) for both furosemide or bumetanide was ⬃900 ␮M. Figure 11 is composed of dose-response curves for furosemide observed at my laboratory using X. laevis oocytes as the expression system for all four K⫹-Cl⫺ cotransporters. Data for each cotransporter were published separately for KCC1 and KCC4 by Mercado et al. (275), for KCC2 by Song et al. (380), and for KCC3a by

⫹ ⫺ FIG. 10. Apparent Km values for K (A) and Cl (B) in Xenopus laevis oocytes microinjected with 10 –20 ng/oocytes cRNA in vitro transcribed from rabbit KCC1 (black), human KCC2 (green), human KCC3 (blue), or mouse KCC4 (red). 86Rb⫹ uptake experiments for each ion kinetic analysis (K⫹ or Cl⫺) were performed for all cotransporters in the same assay, using oocytes from the same frog, injected the same day and using the same hypotonic solutions. At the end of the uptake period, oocytes were dissolved in 10% sodium dodecyl sulfate, and tracer activity was determined for each oocyte by ␤-scintillation counting.

G. Kⴙ-Clⴚ Cotransporter 4 There are only two reports that have addressed functional characteristics of KCC4. Initial characterization by Mount et al. (292) using X. laevis oocytes demonstrated that KCC4 cDNA encodes a K⫹-Cl⫺ cotransport mechanism that was not functional when oocytes were incubated under isotonic conditions, but that exhibited a ⬎200-fold activation during cell swelling. Later Mercado et al. (275) performed a detailed characterization of KCC4 properties. It was shown in this study that similar to other Physiol Rev • VOL

⫹ ⫺ FIG. 11. Kinetics of furosemide inhibition of the different K -Cl cotransporter isoforms expressed in Xenopus laevis oocytes. cRNA in vitro transcribed from KCC1 cDNA (shown in black), KCC2 cDNA (shown in green), KCC3 cDNA (shown in blue), or KCC4 cDNA (shown in red) was injected at ⬃12.5 ng/oocytes 4 days before the influx assays. 86 Rb⫹ uptake was performed for 60 min in hypotonic solutions containing 20 mM K⫹, 50 mM Cl⫺, and 2 ␮Ci/ml 86Rb⫹. Each KCC activity is expressed as percent of control 86Rb⫹ uptake in the absence of loop diuretic.

85 • APRIL 2005 •

www.prv.org

448

GERARDO GAMBA

Mercado et al. (273), but I wished to show this in the same figure to illustrate a clear difference in a functional property among K⫹-Cl⫺ cotransporters. In all cases, uptakes were performed for 1 h under hypotonic conditions, in the absence of extracellular Na⫹ and in the presence of 2 ␮Ci 86 Rb⫹. Uptake observed in the absence of loop diuretic was taken as 100%. As Figure 11 shows, the affinity profile for furosemide in K⫹-Cl⫺ cotransporter isoforms is KCC2 ⬎ KCC1 ⫽ KCC3 ⬎ KCC4. It is intriguing that KCC2 and KCC4, which belong to the same subfamily of KCCs (Fig. 5), exhibit opposite affinity for the diuretics. The studies mentioned previously have also shown that K⫹Cl⫺ cotransporter can be inhibited by ⬎75% with 100 ␮M concentration of DIOA and DIDS, and by 20 –30% with thiazide diuretics at a high concentration (2 mM). H. Orphan Members Two orphan members of the electroneutral cationchloride cotransporter family have been described. Caron et al. (49) identified an mRNA encoding a protein of 915 amino acid residues that exhibit 25% identity with K⫹-Cl⫺, Na⫹-K⫹-2Cl⫺, and Na⫹-Cl⫺ cotransporters, but with a topology that remains K⫹-Cl⫺ cotransporters because the large extracellular glycosylated loop is located between transmembrane segments 5 and 6 (Fig. 1). The function of this protein is not known because its properties as a cotransporter have not been defined. Microinjections of X. laevis oocytes with a sufficient amount of good-quality cRNA resulted in no increase in 22Na⫹, 86Rb⫹, or 36Cl⫺ uptake under several experimental conditions that included the following: 1) preincubation in hypertonic, isotonic and hypotonic medium; 2) changing uptake medium pH with NaOH or HCl; 3) replacing Rb⫹ with NH⫹ 4, SO42⫺, PO42⫺, and Cl⫺ with gluconate, or Na⫹, Rb⫹, Ca2⫹, or Mg2⫹ with N-methylglucamine; 4) by increasing concentrations of either SO42⫺, PO42⫺, Ca2⫹, or Mg2⫹ severalfold; and 5) by adding amino acids at 1 mM. HEK293 cells were also not useful for functional expression of this protein. Because functional interaction among other members of the family was shown as possible (325), interaction of CIP with KCC1, BSC1/NKCC2, and BSC2/ NKCC1 was tested in X. laevis oocytes coinjected with CIP in addition to one of these cotransporter’s cRNAs. Results showed that CIP had no effect on BSC1/NKCC2 or KCC1 activity, but consistently inhibited activity of BSC2/ NKCC1 protein. Coimmunoprecipitation analysis suggested that the functional connection between CIP and BSC2/NKCC1 is a physical association between the two proteins. The last member of the family to be identified is currently known as CCC9. It is a protein of 714 amino acid residues that exhibits the most distinct topology (Fig. 1). Functional expression in X. laevis oocytes under several Physiol Rev • VOL

experimental conditions has been unsuccessful (289); thus no functional properties for this membrane protein are known. IV. STRUCTURE-FUNCTION RELATIONSHIPS Interest of researchers in analysis of structure-function relationships in cation-chloride cotransporters began before molecular identification of each cotransporter. The first studies were performed by analyzing kinetics of ion binding with regard to the cotransporter in different cell types and kinetics of interactions between ions and inhibitors. Later, behavior of tracer 3H-inhibitor binding to membrane preparations from several cells was used as an index of cotransporter activity and thus was employed to propose some structure-function relationships. In these studies, observation that reduction in Cl⫺ concentration was associated with an increase in bumetanide affinity (165), together with the fact that increasing extracellular Cl⫺ concentration (but not Na⫹ or K⫹) resulted in decrease of [3H]bumetanide binding to membranes isolated from dog kidney outer medulla (128), suggested that Cl⫺ and bumetanide compete for the same site in the Na⫹-K⫹2Cl⫺ cotransporter. Because a similar observation was done by Tran et al. (404) between [3H]metolazone and extracellular Cl⫺ in rat renal cortex-membrane preparations, it was also proposed that in TSC chloride and metolazone compete for the same site. Cloning of cotransporter cDNAs increased the possibility to perform structure-function relationship studies, first by providing a topologic model of each cotransporter and second, because the possibility of designing chimeras between cotransporters and point-mutated clones became feasible. As shown in Figure 1 and Table 4, predicted topology is different between cotransporters using Na⫹ (with or without K⫹) or K⫹ (without Na⫹). Degree of identity between these two branches is not ⬎25%. In contrast, within the Na⫹-coupled branch of the family, i.e., among Na⫹-Cl⫺ and Na⫹-K⫹-2Cl⫺ cotransporters, degree of identity is ⬎50%. Thus differences in cation coupled with chloride (sodium vs. potassium) seems to be based on a slightly different structure, although several key functional properties are common among members in both branches of the family, such as coupling cations with chloride following an electroneutral fashion, sensitivity to similar inhibitors, and regulation by changes in cell volume. A. Naⴙ-Coupled Chloride Cotransporters As previously discussed, the sole study in which proposed topology in one member of SLC12 family has been carefully analyzed was performed by Gerelsaikhan and Turner (140) in BSC2/NKCC1. It was concluded, as

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

predicted by the Kyte-Doolittle algorithm, that BSC2/ NKCC1 is composed by 12 membrane-spanning segments that are flanked by amino- and carboxy-terminal domains located within the cell. Transmembrane (TM) segments 1– 8 exhibit the classical ⬃20 residue ␣-helices and TMs 9 –10 and 11–12 are ⬃36 residues in length, forming a hairpin-like structure in the membrane or making up either a nonhelical or a partial-helical structure. With degree of identity in central transmembrane domain of at least 60% between Na⫹-K⫹-2Cl⫺ and Na⫹-Cl⫺ cotransporters, it is reasonable to suggest that topology in BSC1/ NKCC2 and TSC is similar to that in BSC2/NKCC1. 1. The Na⫹-coupled chloride cotransporter forms homodimers Evidence has been obtained for Na⫹-K⫹-2Cl⫺ and Na -Cl⫺ cotransporters that these proteins form homodimers in plasma membrane. Moore-Hoon and Turner (285) used rat parotid plasma membrane to analyze the basolateral Na⫹-K⫹-2Cl⫺ cotransporter BSC2/NKCC1 using the reversible chemical cross-linker 3,3⬘-dithiobis-(sulfosuccinimidyl propionate) (DTSSP). They observed that BSC2/NKCC1 migrates at ⬃335 kDa. After denaturation with a high concentration of Triton X-100, single monomers of ⬃170 kDa were obtained, in which the investigators were unable to detect the presence of any other protein. Further evidence of homodimer formation by BSC2/NKCC1 was provided by quantitative analysis of molecular sizes of oligomers formed by combinations of full-length BSC2/NKCC1 and amino-terminal truncated peptides of BSC2/NKCC1 expressed in HEK-293 cells; thus authors concluded that BSC2/NKCC1 in plasma membrane forms homodimers. Similar results were later observed on apical BSC1/NKCC2 by Starremans et al. (385) and TSC by De Jong et al. (73). In these studies, different strategies were used to assess dimeric conformation of cotransporters when X. laevis oocytes were injected with in vitro-transcribed cRNA from different FLAG- or HA-tagged wild-type cotransporters and concatamer constructions. Strategies used included chemical cross-linking experiments that revealed shifts in proteinband sizes from monomeric to multimeric compositions and coimmunoprecipitation assays in cotransporters previously tagged with FLAG and HA epitopes in the aminoterminal domain. These experiments revealed that FLAGBSC1/NKCC2 and HA-BSC1/NKCC2 (385), as well as FLAG-TSC and HA-TSC (73), are physically linked. Sucrose gradient centrifugation in both cotransporters demonstrated that high molecular complexes have a molecular weight equivalent to a dimeric configuration. Finally, concatamer cotransporters were constructed by combining, in tandem, two wild-type monomers or a wild-type monomer with a mutant monomer containing one of the naturally occurring mutations in Bartter’s or Gitelman’s ⫹

Physiol Rev • VOL

449

disease. In both cotransporters, when expressed in oocytes, concatamers containing wild-type monomers in tandem exhibited significant activity as bumetanide-sensitive Na⫹-K⫹-2Cl⫺ cotransporter (385) or thiazide-sensitive Na⫹-Cl⫺ cotransporter (73). A concatamer was constructed with a wild-type BSC1/NKCC2 monomer and a mutant monomer containing the Bartter type I mutation G319R. This mutation was selected because it was previously shown by the same group (384) that it affects Na⫹K⫹-2Cl⫺ cotransporter activity, without reducing its insertion into plasma membrane. Results showed that concatamer protein was present in plasma membrane, but that activity was reduced by 50% when compared with double wild-type concatamer. Using a similar strategy, concatamers containing two wild-type TSC monomer or one wild-type monomers and a mutant G741R Gitelmantype monomer were constructed. The mutation selected was previously shown to produce a TSC protein not processed in oocytes, and thus mutant protein does not reach the plasma membrane (72). Functional expression experiments revealed that concatamer constructed with two wild-type monomers was functional, while concatamer containing a wild-type monomer and a mutant monomer was not active, because the protein did not reach the plasma membrane. Therefore, it was suggested that BSC1/ NKCC2 and TSC function as homodimers in which both monomers interact with each other, because mutation in one monomer affected the function of both. It is possible, in addition, that members of the SLC12 family can build heterocomplexes among different members of the family. For instance, CIP does not appear to transport ions itself, but does appear to inhibit transport activity of BSC2/ NKCC1 without any effect on BSC1/NKCC2 or KCC1, raising the possibility that CIP may form a heterocomplex specifically with BSC2/NKCC1 (49). 2. Affinity modifier domains or residues in the Na⫹-K⫹-2Cl⫺ cotransporter The most extensive attempt to begin to understand structure-function relationship issues within the branch of Na⫹-coupled chloride cotransporters has been conducted by Isenring and Forbush (for review, see Ref. 192) in BSC2/NKCC1. These authors took advantage of kinetic differences in apparent affinity for ions and for bumetanide between shark and human BSC2/NKCC1 orthologs that exhibit 74% degree of identity. They first observed during their cloning effort of the human cotransporter (314) a higher affinity for ions and bumetanide inhibition in human BSC2/NKCC1, which is approximately sixfold higher than in shark ortholog. Subsequently, by means of single-point mutagenesis strategy to create a series of silent restriction sites along cDNA of both cotransporters, six chimera proteins between human and shark BSC2/

85 • APRIL 2005 •

www.prv.org

450

GERARDO GAMBA

NKCC1 were constructed in which amino-terminal, carboxy-terminal, or both domains were switched, one for the other (189). HEK-293 cells were transfected with corresponding cDNAs for functional characterization. Thus chimeras in which central hydrophobic transmembrane domain of human BSC1/NKCC2 was flanked by aminoterminal domain, carboxy-terminal domain, or both from shark ortholog, and vice versa, were analyzed. As shown in Figure 12, human and shark BSC2/NKCC1 exhibit significant differences in apparent Km for Na⫹, K⫹, and Cl⫺ transport, as well as Ki for bumetanide inhibition, indicating that affinity for ions and bumetanide is higher in human cotransporter. As shown also in Figure 12, behavior of ion-transport and bumetanide-inhibition kinetics in all chimeric clones were determined by the source of central transmembrane domain, regardless of the source of both amino- and carboxy-terminal domains. These observations demonstrated the importance of central hydrophobic domain in defining affinity for cotransported ions and for inhibition by bumetanide. In their next study, knowing that TM1 and TM3 are identical between shark and human BSC2/NKCC1, while TM2 is different, the investigators’ chimera construction approach was extended to include the first three TMs, assuming that differences observed in functional properties would be due to diverging sequences within TM2. Consequently, two chimeras were constructed in which amino-terminal domain and the first three TM segments

were switched between human and shark BSC2/NKCC1 (191). Functional analysis in HEK-293 cells demonstrated significant changes in affinity for Na⫹ and K⫹ in these chimeras, with no change in Cl⫺ affinity, suggesting that sequences within second TM segments affect transport affinity for cations, but not for Cl⫺. Furthermore, specific mutagenesis in pairs of residues in second transmembrane domain revealed that two residues are involved in defining Na⫹ affinity, and another pair in K⫹ affinity. Although no changes in Cl⫺-transport affinity were observed, a clear change in bumetanide affinity occurred. Chimera with shark TM2 segment transplanted into human cotransporter exhibited bumetanide-affinity constant similar to that of the shark Na⫹-K⫹-2Cl⫺ cotransporter (0.76 vs. 1.04 ␮M, respectively), while chimera with human TM2 segment switched into shark cotransporter exhibited similar constant to human cotransporter (0.34 vs. 0.28 ␮M), suggesting that bumetanide affinity follows the second TM segment. Previous studies in which binding kinetics of tracer [3H]bumetanide to dog kidney outer medulla membrane preparation were assessed (128) and careful kinetic analysis of bumetanide and chloride interaction in duck red blood cells were determined (165) strongly suggested that bumetanide binds at one of the chloride sites of the cotransporter. Thus this observation was surprising because it was shown that TM2 chimeras exhibited no change in chloride-transport kinetics, together with an important switch in bumetanide affinity,

⫹ FIG. 12. Apparent Km values for Na , Rb⫹, and Cl⫺ expressed in mM and Ki, as stated. Ion transport and bumetanide inhibitory kinetic analyses were performed in HEK-293 cells transfected with wildtype human or shark BSC2/NKCC1 cDNA (HHH and SSS, respectively) or with each of the chimeric proteins depicted in each graph. Black bars represent clones in which central transmembrane domain belongs to human cotransporter, whereas open bars represent clones in which this domain belongs to shark cotransporter. All clones are named with three letters. H, human; S, shark. The first letter indicates to whom the amino-terminal domain belongs (human or shark), the second letter indicates origin of central transmembrane domain, and the third letter indicates the origin of carboxy-terminal domain. For instance, the clone SHS is a chimera with central transmembrane domain from human BSC2/NKCC1 and both amino- and carboxy-terminal domains from shark. [Modified from Isenring and Forbush (189).]

Physiol Rev • VOL

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

suggesting that chloride- and bumetanide-binding sites are different. Further construction of chimera clones between shark and human BSC2/NKCC1 demonstrated that switching TM 8 –12 does not confer a difference in ion affinities between human and shark cotransporters (190). A chimera in which only TM7 was changed resulted in a cotransporter showing Km for Na⫹, K⫹, and Cl⫺ with values that were intermediate between human and shark. Then, chimeras and point mutations in TM4 and TM5 demonstrated that some residues in TM4 affect Km values for K⫹ and Cl⫺ but not for Na⫹. As shown in Figure 13, with all these results in which similarities and differences in structure and functional properties conferred by each TM segment were taken together (189 –191), it was proposed that three TM segments play an important role in defining ion-transport kinetics in BSC2/NKCC1. Accordingly, TM2 is involved in Na⫹ and Rb⫹ kinetics, TM4 in Rb⫹ and Cl⫺ kinetics, and TM7 in Na⫹, Rb⫹, and Cl⫺ kinetics. Interestingly, as mentioned previously, behavior of several chimeric proteins in terms of bumetanide inhibition was completely different from behavior observed in ion-transport kinetics. Evidence was obtained that even TM 2– 6 and 10 –12 play a role in defining affinity for loop diuretics. Because several chimeras in which the same TM segments were switched from human to shark and vice versa did not exhibit mirror image behavior, authors were not able to develop models to explain their results, and it was proposed that bumetanide binding probably requires conformational interaction between TM and extracellular domains.

FIG. 13. Schematic representation of the proposed contribution of each transmembrane segment of BSC2/NKCC1 to fractional changes in apparent affinity for Na⫹, K⫹, and Cl⫺ in chimeric proteins from human and shark BSC2/NKCC1. [Modified from Isenring and Forbush (192)].

Physiol Rev • VOL

451

Functional analysis of three spliced isoforms of apical BSC1/NKCC2 also revealed a role of TM2 in iontransport kinetics (144, 324). As discussed in previous sections (see Figs. 3, 6, and 7), existence of three mutually exclusive cassette exons in SLC12A1 gene produce three cotransporter proteins that differ in key residues within TM2 and in the interconnecting segment between TM2 and TM3. As shown in Table 6, functional expression of the three isoforms in X. laevis oocytes demonstrated significant differences in ion-transport and bumetanide affinities. Higher and lower affinities were observed in isoforms B and F, respectively. Thus, in apical Na⫹-K⫹2Cl⫺ cotransporter isoforms, differences in sequences within TM2 and in the interconnecting segment between TM2 and TM3 are accompanied by changes in affinity for cotransporter ions, suggesting that TM2 is not only implicated in cation affinity, but also in defining Cl⫺ affinity. In this regard, Gagnon et al. (134) identified that BSC1/ NKCC2 isoforms A and F are present in shark kidney. The investigators first observed that isoforms A and F were functional when expressed in X. laevis oocytes. Then, kinetic analysis revealed that A isoform exhibited significantly lower Km values for Na⫹, K⫹, and Cl⫺ than the F isoform, indicating that the former is the high-affinity variant (133). These observations confirmed that exon 4 affects ion-transport affinity for Na⫹, K⫹, and Cl⫺. In this study, two chimera proteins between A and F isoforms were produced by switching cotransporters at the middle of the exon 4 sequence, and thus to be able to switch only the region of exon 4 that is part of TM2 or only the region that is part of the interconnecting segment between TM2 and TM3. Thus chimera A/F contained TM2 sequence of variant A followed by interconnecting sequence of variant F, and vice versa, occurred with chimera F/A. When kinetic analysis of these two chimeric proteins was compared with isoforms A and F, it was shown that affinity for cations (Na⫹ and K⫹) in chimeras A/F and F/A were similar to A, suggesting that residues on both sides of exon 4 were important to define higher and lower cation affinity of isoforms A and F, respectively. Behavior in Cl⫺ affinity was different. Apparent Km value for extracellular Cl⫺ was similar between variant A (⬃6.9 mM) and chimera F/A (⬃8.6 mM) and between F variant (⬃69.1 mM) and chimera A/F (⬃70 mM). These observations suggest that the majority of differences in Cl⫺-transport affinity between isoforms A and F were conveyed by variant residues of the interconnecting segment between TM2 and TM3. Thus sequences not located within a TM segment affect affinity for chloride. Although it is expected that amino acid residues conforming translocation pockets in the cotransporter will be located within TM domains, these observations suggest that amino acids outside membrane-domain helices can also behave as affinity-modifier residues. Interestingly, chimera behavior in terms of bumetanide affinity was completely the opposite.

85 • APRIL 2005 •

www.prv.org

452

GERARDO GAMBA

Bumetanide-affinity constant was similar in variant A (0.30 ␮M) and chimera A/F (0.39 ␮M) and between variant F (0.8 ␮M) and chimera F/A (1.4 ␮M), suggesting that residues located within TM2 and not within the TM2-TM3 interconnecting segment play a role in defining bumetanide affinity. This observation is also against the possibility that bumetanide and chloride compete for the same site in the cotransporter. Because these structure-function studies in Na⫹-K⫹⫺ 2Cl cotransporter were performed using spliced isoforms of BSC1/NKCC2 (133, 144, 324) or chimeras between orthologs of BSC2/NKCC1 (192), all constructs were anticipated to perform as Na⫹-K⫹-2Cl⫺ cotransporters. Therefore, although valuable information was obtained regarding structural requirements to define kinetic properties in both isoforms, it is possible that no information was obtained concerning structural requirements to define specificity for ions or diuretics. It has been shown, for instance, in glucose transporters that domains defining kinetic properties are not necessarily the same as those defining transport-process specificity or binding of a particular inhibitor (15, 299). In this regard, as shown in section IIIB, a carboxy-terminal domain of SLC12A1 in mouse behaves as a K⫹-independent but loop diureticsensitive, thiazide-resistant Na⫹-Cl⫺ cotransporter (323), suggesting that carboxy-terminal domain could be important to endow BSC1/NKCC2 with K⫹ transport ability. For this reason, Tovar-Palacio et al. (403) have recently taken advantage of homology between TSC and BSC1/NKCC2 to design chimeric proteins in which both amino- and carboxy-terminal domains were switched between cotransporters. Interestingly, the majority of chimeras were functional. Figure 14 shows the chimera TBT in which the central hydrophobic domain of the Na⫹-K⫹-2Cl⫺ cotransporter BSC1/NKCC2 is flanked by amino- and carboxyterminal domains of the Na⫹-Cl⫺ cotransporter TSC. The graph below shows that 86Rb⫹ uptake was Cl⫺ dependent, and bumetanide sensitive but metolazone resistant. This is a behavior identical to BSC1/NKCC2, indicating that residues that endow BSC1/NKCC2 with these functional properties are located within the central hydrophobic domain. Although overall identity between rat BSC1/ NKCC2 and TSC is 52% (136), degree of identity varies along the central hydrophobic domain in such a way that ⬎85% is present in 6 of 12 transmembrane helices (1, 2, 3, 6, 8, and 10), 55–75% in two helices (4 and 9) as well as in interconnecting segments facing intracellular side, and ⬍50% in four transmembrane domains (5, 7, 11, and 12) and interconnecting segments facing the extracellular side of the cotransporters, pointing out to these divergent sequences within the central TM as the more likely regions of the cotransporters to contain the specificitydefining residues for both ion transport and diuretic sensitivity. Physiol Rev • VOL

FIG. 14. Functional properties of TBT chimera (A) in which central hydrophobic domain belongs to BSC1/NKCC2 (in red) while both aminoand carboxy-terminal domains belong to TSC (in blue). Black region represents the sequence encoded by BSC1/NKCC2 exon 4 that generates alternative splicing isoforms A, B, and F. The injection of TBT cRNA into Xenopus laevis oocytes (B) induced the appearance of an 86Rb⫹ uptake mechanism that is evident in the presence of Na⫹, K⫹, and Cl⫺ (open bars). Increased uptake is reduced in the absence of extracellular Cl⫺ (black bar), or in the presence of 10⫺4 M bumetanide (red bar), but is not affected by 10⫺4 M metolazone (blue bar). [Modified from Tovar-Palacio et al. (403).]

3. Cysteine scanning mutagenesis in Na⫹-K⫹-2Cl⫺ cotransporter In an attempt to analyze functional roles of certain selected residues in BSC2/NKCC1, Dehaye et al. (76) used the substituted cysteine accessibility method in which potential residues in BSC2/NKCC1 are replaced by cysteines and then the effect of cysteine-specific reagents, such as 2-aminoethylmethanethiosulfonate (MTSEA) or 2-(trimethylammonium) ethyl methanethiosulfonate (MTSET), on functional properties of the cotransporter was assessed. If certain residues play a role in defining functional properties, it is expected that cysteine substituting for a particular residue will interact with MTSEA or MTSET, resulting in a change of that particular property for which the residue under study is responsible, whereas if the cysteine substitute is a noncritical residue, interaction with MTSEA or MTSET will have no functional consequence. In this study, Dehaye et al. (76) mutated several

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

residues to cysteine (S311, Val-312, Ala-316, Ala-405, Ala528, and Ser-530) that were previously suggested, mainly by the Isenring and Forbush studies discussed previously, to be at or near binding sites for sodium, potassium, or chloride on BSC2/NKCC1. None of these mutations, however, rendered BSC2/NKCC1 sensitive to cysteine specific reagents, suggesting that mutated residues could be inaccessible to sulfhydryl reagents. It was observed, however, that mutating the amino acid A483 to cysteine, a residue located in TM6, rendered the cotransporter sensitive to MTSEA or MTSET, indicating that A483 plays an important functional role. Further functional analysis revealed that A483C substitution had no effect on ion-transport affinity but resulted in a remarkable sixfold increase in bumetanide affinity, suggesting that TM6 is associated with bumetanide binding. 4. Regulatory motifs in BSC2/NKCC1 amino-terminal domain It is well known that activity of the Na⫹-K⫹-2Cl⫺ cotransporter is tightly regulated because activity of this cotransporter should be coordinated with chloride-extrusion mechanisms. On one hand, in its basolateral version BSC2/NKCC1 represents an important pathway to provide cells with chloride ions that will be secreted in the apical membrane, mainly through a cystic fibrosis transmembrane conductance regulator (CFTR)-related mechanism. On the other hand, in TALH cells chloride ions reabsorbed through the apical version of the cotransporter BSC1/ NKCC2 are transported out of the cell into renal interstitium by chloride channels known as CLC-KB. The basolateral isoform may remain inactive until stimuli such as cell shrinkage or secretagogues acting by means of Gscoupled receptors activate the cotransporter by a process that requires phosphorylation. In contrast, the apical isoform is usually active, but activity level is under tight control by hormones acting also through Gs-coupled receptors, such as vasopressin, parathyroid hormone, and isoproterenol. It has been firmly established that Na⫹-K⫹-2Cl⫺ cotransporter regulation is associated with phosphorylation/dephosphorylation of the cotransporter protein. When BSC2/NKCC1 is activated by several different stimuli, the protein becomes phosphorylated, while inhibition of the cotransporter function is associated with dephosphorylation. In addition, cell treatment with the protein phosphatase 1 inhibitor calyculin A prevents cotransporter dephosphorylation, hence increasing its activity. Although BSC2/NKCC1 is activated when cells are exposed to hormones acting through Gs-coupled receptor producing cAMP (e.g., isoproterenol), the cotransporter does not appear to be phosphorylated by a PKA-dependent mechanism (222, 223). Several lines of evidence strongly suggest that intracellular chloride concentration Physiol Rev • VOL

453

is the common pathway to regulate the cotransporter. When intracellular chloride concentration falls, the cotransporter becomes phosphorylated; in contrast, when chloride concentration rises, the cotransporter is dephosphorylated and therefore inhibited. For instance, it has been postulated that increase of intracellular cAMP levels is responsible for increasing chloride extraction in apical membrane by activating CFTR, a well-known PKA substrate, and that consequential decrease in intracellular chloride due to improved secretion is what triggers activation of BSC2/NKCC1 (255). A similar situation was proposed several years ago by Greger and Schlatter (155) regarding the mechanisms by which vasopressin activates salt reabsorption in TALH. A critical review of studies regarding regulation of Na⫹-K⫹-2Cl⫺ cotransporter function by shrinkage or intracellular chloride is beyond the scope of this work. Interested readers are referred to several excellent reviews published specifically in this subject in recent years (124, 164, 351). What I want to present here is recent information regarding structurefunction studies revealing that at least part of the regulatory phosphorylation/dephosphorylation of BSC2/NKCC1 occurs in threonine residues located within amino-terminal domain, together with protein motifs known to be associated with binding of kinases or phosphatases, indicating that this domain plays an important role in defining regulatory properties of the cotransporter. The first study that presented evidence suggesting that activation of BSC2/NKCC1 cotransporter was associated with phosphorylation of a threonine residue was reported by Lytle and Forbush (254), who used suspensions of shark rectal gland tubules in which they demonstrated that maneuvers such as addition of cAMP or cell shrinking were associated with activation of the cotransporter, assessed as an increment of [3H]benzmetanide binding. Then, by immunoprecipitation with specific monoclonal antibodies against BSC2/NKCC1, they were able to show that activation was associated with cotransporter phosphorylation. Extensive protein digestion together with two-dimensional, thin-layer electrophoresis on cellulose plates allowed them to show that the phosphorylation pattern was similar among different stimuli, and to isolate the peptide FGHNTIDAVP that became phosphorylated in the threonine residue. A few years later, when shark BSC2/NKCC1 cDNA was identified at the molecular level (440), it was shown that this peptide corresponds to amino acid residues 184 –194 that are located within the amino-terminal domain. Supporting this observation, Kurihara et al. (222) demonstrated that BSC2/NKCC1 from rat parotid gland is phosphorylated in the amino-terminal domain when activated by isoproterenol. Because it is known that no putative PKA phosphorylation sites are present in BSC2/NKCC1 amino-terminal domain, the same group in a follow-up study (223) observed that although PKA is involved in isoproterenol

85 • APRIL 2005 •

www.prv.org

454

GERARDO GAMBA

activation of BSC2/NKCC1, another unknown factor located beyond PKA activation must be present. This other factor can be another kinase cascade that phosphorylates the cotransporter in a threonine residue that is not part of a PKA-putative site. In this regard, it has been demonstrated in avian erythrocyte Na⫹-K⫹-2Cl⫺ cotransporter that all tested activators of BSC2/NKCC1 resulted in cotransporter phosphorylation with a similar pattern in phosphoamino acid analysis (252), suggesting use of a common final pathway to activate the cotransporter. In this study, however, phosphorylation was observed to occur in both amino- and carboxy-terminal domains because phosphorylated cotransporter was immunoprecipitated with monoclonal antibodies and chemically fragmented with N-chlorosuccinimide to produce two major 32 P-labeled fragments of 82 and 41 kDa, respectively, from which the smaller one was recognized with specific monoclonal antibody raised against the BSC2/NKCC1 carboxyterminal domain, suggesting that serines or threonines in the carboxy-terminal domain also become phosphorylated during cotransporter activation. Careful phosphopeptide analysis and phosphorylation stoichiometry measurements performed by Darman and Forbush (71) in shark rectal gland BSC2/NKCC1 after maximal stimulation with a combination of calyculin A, to prevent PP1 activity and hence dephosphorylation, and forskolin, to stimulate Gs-coupled receptor mechanisms, demonstrated that an average of 3.0 ⫾ 0.4 phosphates/mol of cotransporter was incorporated, suggesting that at least three sites on the cotransporter are phosphorylated after exposure to these agents. Exhaustive trypsin digestion and separation of peptides by HPLC followed by matrix-assisted, laser desorption ionized mass spectrometry were used to identify three phosphoacceptor amino acid sites within the cotransporter amino-terminal domain. These residues were all threonines located at amino acid numbers 184, 189, and 202. Functional significance of these sites was tested by eliminating each one by means of point mutations. Mutant clones were expressed in HEK-293 cells. This analysis revealed that the most important site is threonine-189 because substitution of this residue with alanine resulted in complete inhibition of cotransporter, suggesting that phosphorylation of this residue is required to achieve constitutive activity. Interestingly, it was observed that BSC2/NKCC1 activity in HEK293 cells transfected with the mutant T189A was lower than in nontransfected cells, suggesting that nonactive T189A cotransporter applies a dominant negative effect on the endogenous cotransporter, similar to what has been shown to occur with nonactive variants in BSC1/ NKCC2 (325), KCC1 (50), and CIP (49). Elimination of threonine-184 or -202 resulted in normally active cotransporters. However, in-depth analysis revealed that threonine-184 is a residue required to achieve a response to intracellular chloride similar to that observed in wild type, Physiol Rev • VOL

because mutant T184A becomes activated only when exposed in preincubation to the lowest chloride-containing media. Finally, threonine-202 was also shown as required for activation of BSC2/NKCC1 by low intracellular chloride, but the difference with wild type was less pronounced. In addition, the same group performed studies in vivo using a specific antiphospho-BSC2/NKCC1 antibody denominated R5, which was raised against a synthetic peptide of amino-terminal domain containing threonine-212 and -217 of human BSC2/NKCC1 (corresponding to threonine-184 and -189 of shark BSC2/NKCC1). Results demonstrated that phosphorylation correlates with functional activation of the cotransporter by isoproterenol in rat parotid gland and respiratory epithelium (126). Finally, supporting the conclusion that threonine residues in the amino-terminal domain play a key role in regulation of BSC2/NKCC1 activity by several different effectors (cell shrinkage, intracellular chloride, isoproterenol, forskolin), Darman et al. (70) showed that BSC2/ NKCC1 contains a PP1-binding site in the amino-terminal domain near the phosphorylation sites. It is known that to perform its specific action on particular serine or threonine residues, PP1 must bind to a motif that should be adjacent to the residues that will be dephosphorylated, thus preventing indiscriminate effects of PP1 in several phosphoproteins (60). The binding motif for PP1 catalytic subunit is known as RVxF, although highly conserved variations of the consensus are also functional, allowing a more broad motif to be (R/K)(V/I)xF. Darman et al. (70) observed that the amino-terminal domain of human BSC2/ NKCC1 contains the sequence RVNFVD and demonstrated that mutagenesis designed to eliminate the motif resulted in cotransporters that exhibited higher activity than wild-type control at any chloride concentration in preincubation media. Furthermore, improving the binding capacity of the motif by adding acidic residues to obtain KRVRFED resulted in a BSC2/NKCC1 protein nearly impossible to activate at any chloride concentration. These observations are consistent with higher levels of phosphorylation in mutant BSC2/NKCC1; in other words, elimination of the PP1c motif seems to decrease the ability of PP1 to dephosphorylate the cotransporter. Finally, it was also shown that BSC2/NKCC1 is specifically coprecipitated with PP1c, suggesting that interaction between cotransporter and PP1 takes place. Another regulatory motif recently shown as present in BSC2/NKCC1, as well as in other members of the cation chloride cotransporter family, is a motif that serves as a recognition site for two regulatory proteins known as Ste20-related proline-alanine-rich kinase (SPAK) and oxidative stress response 1 (OSR1). These are closely related serine/threonine kinases exhibiting amino acid identity of 67%. SPAK was originally cloned from rat brain (SPAK) and is located in human chromosome 2q31.1 (407). SPAK’s physiological role or substrate has not been elu-

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

cidated, but its expression has been localized to neurons and to transport epithelial cells that are rich in Na⫹-K⫹ATPase. OSR1 was identified by means of large-scale DNA sequencing of a genomic region on chromosome 3p22p21.3 (399). Association between SPAK and members of the electroneutral cation chloride cotransporter family was evidenced by Piechotta et al. (322) following a yeast two-hybrid screen designed to search for proteins that interact with K⫹-Cl⫺ cotransporter isoform KCC3a. Using the same system, they showed that SPAK and OSR1 were able to interact with other members of the family including KCC3b, BSC1/NKCC2, and BSC2/NKCC1, but not with KCC1 or KCC4, despite high conservation on the minimal requirement for SPAK binding domain determined in KCC3a (see Fig. 15). KCC2 and TSC were not included in the analysis because these cotransporters lack the minimal SPAK-binding motif (R/K)FX(V/I). This motif was shown to be present at the amino-terminal domain: once in KCC3a, KCC3b, and BSC1/NKCC2 and twice in BSC2/ NKCC1. In this last cotransporter, the motif RFQVDPESV is located 76 residues downstream of the first methionine, and a second motif RFRVNFDPA is located 48 amino acid residues after the first and overlaps with the PP1 motif discussed previously (RVxF) (Fig. 16). Piechotta et al. (321) raised a polyclonal antibody against SPAK that together with anti-BSC2/NKCC1 antibodies were used to demonstrate that both proteins can be coimmunoprecipitated from brain tissue, indicating its physical interaction. Finally, immunohistochemical studies of choroid plexus and salivary gland revealed that both BSC2/NKCC1 and SPAK were coexpressed in the apical membrane of choroid plexus and basolateral membrane of salivary gland, suggesting their functional association. Furthermore, in the choroid plexus of BSC2/NKCC1 knockout mice, the SPAK signal was found solely in the cytoplasm. Conflicting results have been obtained recently by two groups regarding the functional significance and molecular mechanisms by which SPAK regulates the BSC2/ NKCC1 cotransporter. Dowd and Forbush (92) studied regulation of BSC2/NKCC1 by SPAK in HEK-293 cells transfected with human or shark BSC2/NKCC1 alone, or together with either SPAK or a dominant-negative SPAK mutant K101R (DNSPAK) known to lack kinase activity.

455

FIG. 16. Proposed model of amino-terminal domain and the first two transmembrane segments of BSC2/NKCC1 based on human sequence. Each circle represents an amino acid residue, and all red circles depict residues identical between human and shark BSC2/NKCC1. Shown in blue are the three threonines suggested as phosphorylation sites, in black a single PP1-binding motif, and in green two SPAK-binding motifs. All proposed motifs are located in highly conserved areas.

Although investigators were unable to show that SPAK cotransfection clearly increases the sensitivity of BSC2/ NKCC1 to changes in intracellular chloride, it was demonstrated that DNSPAK drastically inhibits activation of shark or human BSC2/NKCC1 by exposing cells to hypertonicity or lowering intracellular chloride. With the use of previously mentioned R5 antibody, directed against a peptide containing threonines 184 and 189, it was observed that DNSPAK cotransfection resulted in a significant decrease of BSC2/NKCC1 phosphorylation when intracellular chloride was lowered. Because the inhibitory effect of

FIG. 15. Conservation of phenylalanine and valine in the amino-terminal domain of several members of the cation chloride cotransporters family, in which the first five (in blue and picture at right) physically interact with SPAK. In contrast, KCC1 and KCC4 (in red and picture at right) do not interact with SPAK. Note the presence of the motif (R/K)FX(V/I) in the first five members, not present in KCC1 and KCC4. [Modified from Piechotta et al. (322)].

Physiol Rev • VOL

85 • APRIL 2005 •

www.prv.org

456

GERARDO GAMBA

DNSPAK was abrogated by the protein phosphatase inhibitor calyculin A, it was concluded that it is related to alterations in phosphorylation/dephosphorylation of BSC2/NKCC1. As previously shown by Piechotta et al. (322), reciprocal coimmunoprecipitation was obtained between SPAK and BSC2/NKCC1, demonstrating their coassociation. Because Dowd and Forbush (92) also showed that phosphorylation of PASK increased by 5.5fold when cells were exposed to low intracellular Cl⫺ concentration, it was suggested that PASK could be the cotransporter kinase that has been postulated to be autophosphorylated by changes in cell volume or low intracellular Cl⫺ concentration (5, 253, 255). In contrast to these observations, Piechotta et al. in a recent study (321) used site-directed mutagenesis to eliminate one or both SPAK-OSR1 motifs in BSC2/NKCC1 and X. laevis oocytes as the expression system. They observed that response to hypertonicity or low intracellular chloride was indistinguishable between mutants and wild-type BSC2/NKCC1. Using yeast two-hybrid system, they also demonstrated that elimination of both motifs completely prevents interaction between BSC2/NKCC1 and SPAK. Thus they concluded that preventing binding between both proteins does not eliminate the modulatory effect of SPAK on the Na⫹-K⫹-2Cl⫺ cotransporter. With the hypothesis that other binding partners of these novel kinases could be required to reconstitute their activity, a yeast two-hybrid screen of a brain mouse library using SPAK binding domain as bait allowed them to identify at least six proteins, of which one is WNK4, a novel kinase associated with hereditary hypertension and that has been recently shown to inhibit BSC2/NKCC1 activity (198). Thus additional studies are required to understand the nature and modulation of BSC2/NKCC1 or other members of the family by SPAK or OSR1. Meanwhile, based on the information discussed previously, Figure 16 depicts the regulatory motifs shown to be present in the amino-terminal domain of BSC2/NKCC1, which suggest that the amino-terminal domain is endowed with important regulatory properties. 5. The thiazide-sensitive Na⫹-Cl⫺ cotransporter The thiazide-sensitive Na⫹-Cl⫺ cotransporter TSC has also been subjected to studies designed to reveal some aspects of structure-function relationship in this cotransporter. These studies, however, have been based on guided/point mutations to show the role of specific amino acid residues, rather than on working with big fragments of cotransporters to expose functional roles of a particular domain. Some of these studies were carried out by searching for functional effects of certain amino acid residues found to be mutated in patients with Gitelman’s disease (72, 221, 352). Information from these studies with Gitelman’s disease mutations will be discussed in detail in section VIA. Physiol Rev • VOL

Hoover et al. (181) demonstrated that glycosylation is essential to normal TSC function. As discussed in section IIA, mammalian TSC contains two putative N-glyscosylation sites within the extracellular loop located between TM7 and TM8 (136). Flounder TSC, in contrast, contains three putative sites, one of which is conserved with mammalian TSC (137). Hoover et al. (181) first demonstrated that TSC is glycosylated in vivo because molecular weight of TSC protein from rat kidney is reduced after enzymatic deglycosylation with protein N-glycosidase F, from a broad band of 135–150 kDa to a sharp band of 113 kDa, corresponding to TSC core molecular weight. Then, point mutations that eliminate each or both glycosylation sites revealed that TSC activity is reduced when glycosylation is prevented. Elimination of one site (either N204 or N242) resulted in a 50% reduction of TSC activity, while elimination of both sites was associated with a ⬎95% reduction. Western blot analysis, however, showed that nonglycosylated proteins of the expected core size for TSC (⬃113 kDa) were produced, suggesting that absence of glycosylation is associated with cotransporter-aberrant processing, thus reducing its expression in plasma membrane. Supporting this hypothesis, confocal image analysis of EGFP-wild-type and EGFP-mutant TSC demonstrated significant reduction in mutant EGFP-TSC protein in plasma membranes when glycosylation was prevented. An interesting observation made in this study is that prevention of glycosylation was associated with increased affinity for extracellular Cl⫺ and metolazone; no increase in affinity for extracellular Na⫹ was observed. As shown in Figure 17A, single glycosylation mutants exhibited a rise in metolazone affinity that was further increased in the double mutant, suggesting that sugar moieties in native TSC inhibit access of diuretics to its binding site. This effect was accompanied by an increase in Cl⫺ affinity, supporting the proposal of Tran et al. (404) that thiazide-type diuretics and chloride bind to the same site on the cotransporter. Analysis of functional consequences of single-nucleotide polymorphism that changes glycine-264 for an alanine (G264A) performed by Moreno et al. (288) revealed that TSC activity is reduced by 50%, without affecting its synthesis, glycosylation, and trafficking to plasma membrane, suggesting that substitution of residue G264 for an alanine resulted in a cotransporter with lower intrinsic activity. Glycine-264 is located within TM4 and is conserved not only in TSC from all species, but also in all members of the electroneutral cotransporter family. In addition to its effect on TSC intrinsic activity, G264A polymorphism also affects TSC affinity for Cl⫺ and thiazides. Ion-transport kinetics revealed that Na⫹ affinity was similar between wild-type and G264A TSC, but that Cl⫺ affinity was significantly higher in G264A TSC; in addition, affinity for metolazone was also increased. Figure 17B depicts the concentration response for inhibition

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

457

in three different locations along TSC that include two glycosylation sites, a single nucleotide polymorphism a G264A polymorphism, and a Gitelman-type mutation. In all cases, increased affinity for extracellular Cl⫺ and metolazone was observed, with no effect on Na⫹ affinity. B. Kⴙ-Coupled Chloride Cotransporters

FIG. 17. Metolazone affinity of rat TSC. A: effect of prevention of glycosylation on metolazone affinity in rat TSC. Uptakes were performed in oocytes injected with wild-type TSC (black), single mutant N404Q TSC (blue), single mutant N424Q (green), and double mutant N404,424Q (red). Uptake was normalized taking as 100% of each group that was incubated in the absence of metolazone. [Modified from Hoover et al. (181).] B: effect of extracellular Cl⫺ concentration and single nucleotide polymorphism G264A on thiazide affinity in rat TSC. Uptakes were performed in oocytes injected with wild-type TSC (blue) and G264A TSC (red) by using uptake solutions containing extracellular Cl⫺ concentration of 96 mM (continuous lines and solid symbols) or around apparent Km for each clone that was 6 mM in wild-type and 1 mM in G264A (discontinuous lines and open symbols). [Modified from Moreno et al. (287).]

of wild-type TSC and G264A by metolazone. When uptakes were performed in the presence of 96 mM NaCl, the IC50 for metolazone inhibition was similar between wildtype and G264A TSC. In contrast, when extracellular Cl⫺ concentration was fixed to about the apparent Km value for Cl⫺, it was apparent that IC50 in G264A was shifted to the left. Functional analysis of Gitelman-type mutations that reduce, but do not completely inhibit, TSC function revealed that one mutation (G627V) located at the beginning of the carboxy-terminal domain exhibits an increase in both Cl⫺ and metolazone affinity (352). Thus, to date, the possibility that thiazide-type diuretics and Cl⫺ bind to the same site in the cotransporter in a competitive fashion is supported by mutation or substitution of single residues Physiol Rev • VOL

There is basically no information at present regarding structure-function relationship in K⫹-Cl⫺ cotransporters. On one hand, no specific inhibitor is known to be able to prepare tracer 3H-inhibitor, as was accomplished with [3H]bumetanide (163) and [3H]metolazone (26) for Na⫹K⫹-2Cl⫺ and Na⫹-Cl⫺ cotransporters, respectively, to assess binding behavior on cell membrane preparations and the effect that physiological or pathophysiological maneuvers may have on binding properties. Even if this were possible, it would probably produce confounding results because we know that the majority of tissues express two, three, or even four K⫹-Cl⫺ cotransporter isoforms. On the other hand, molecular identification of K⫹-Cl⫺ cotransporters came several years after Na⫹-Cl⫺ and Na⫹-K⫹-2Cl⫺ cotransporters cDNA were cloned. Thus molecular tools for studying K⫹-Cl⫺ cotransporters have been available for a few years. Furthermore, the unexpected finding of four different genes coding for similar cotransporters has persuaded investigators to define fundamental questions such as physiological role that each isoform may have at both cellular and individual organ levels. Thus several publications regarding functional properties, tissue distribution, and immunohistochemical analysis on several tissues and production of knockout mice of each cotransporter have been reported. The only study dealing specifically with a structurefunction relationship to date was done by Strange et al. (390). It is well known that regulation of K⫹-Cl⫺ cotransporter activity by phosphorylation follows a mirror image as do those of the Na⫹-K⫹-2Cl⫺ cotransporter, i.e., phosphorylation of the K⫹-Cl⫺ cotransporter is associated with inactivation of the protein, whereas dephosphorylation is associated with increased cotransporter function. For instance, the PP1 inhibitor calyculin A, by preventing dephosphorylation of these proteins, increases activity of the Na⫹-K⫹-2Cl⫺ cotransporter but reduces the function of the K⫹-Cl⫺ cotransporter (for review, see Refs. 62, 125, 235, 291); according to these observations, when expressed in X. laevis oocytes, activation of KCC cotransporters by hypotonicity is prevented by calyculin A (275, 390). Because it has been suggested that tyrosine kinase is involved in regulation of K⫹-Cl⫺ cotransporter activity (125), Strange et al. (390) studied the role of a conserved tyrosine residue located in the carboxy-terminal domain of all four KCCs, corresponding to Y1087 in KCC2. They observed that substitution of this tyrosine with aspartate, a mutation that mimics phosphorylation, reduced basal

85 • APRIL 2005 •

www.prv.org

458

GERARDO GAMBA

activity of KCC2 in isotonic conditions by 80% and completely blocked further activation of the cotransporter by cell swelling. The effect was not associated with reduction in the immunofluorescence signal in plasma membranes of oocytes expressing Y1087D, compared with wild-type KCC2, indicating that traffic of mutant protein to cell surface was not affected. However, further experiments using selective tyrosine phosphatase inhibitors failed to show any effect on KCC2 cotransporter function. The authors concluded that Y1087 plays an important role in normal cotransporter function, but that it does not regulate cotransporter activity by functioning as a residue for tyrosine phosphorylation. V. PHYSIOLOGICAL ROLES Electroneutral cation-chloride cotransporters are membrane proteins that translocate Cl⫺ together with a cation that can be Na⫹, K⫹, or both, maintaining the requirement of electroneutrality by using Na⫹-Cl⫺, K⫹Cl⫺, or Na⫹-K⫹-2Cl⫺ stoichiometry. As with other solute cotransporters, all ions must be present to allow conformational changes to occur that are required to move ions from one side of the membrane to the other. Each cotransporter can potentially move ions from inside to outside, or from outside to inside, the cell. Because these are secondary transporters, however, movement of ions will depend on preestablished gradients sustained by primary transporters, of which the most important is Na⫹-K⫹ATPase; in doing so, it is the cation gradient that dictates the direction in which Cl⫺ are moved. Therefore, cotransporters that utilize Na⫹ as the driving force translocate cotransported ions from outside the cell to inside, because Na⫹ concentration is higher in the extracellular space. In contrast, cotransporters that use K⫹ as the driving force translocate K⫹-Cl⫺ from inside the cell to the extracellular space, due to the higher concentration of K⫹ within the intracellular compartment. Because Na⫹ and K⫹ are quickly returned to the extracellular or intracellular space, respectively, by Na⫹-K⫹-ATPase, the activity of these cotransporters usually changes the intracellular Cl⫺ concentration. Thus the SLC12 family is made up of membrane transporters capable of setting intracellular chloride concentration below or above equilibrium. Therefore, this is one of the major functions of these cotransporters at the cell physiology level (for a recent and excellent review of intracellular Cl⫺ regulation, see Ref. 7). Another major function of electroneutral cation-chloride cotransporters is their well-known role as membrane proteins that participate in cell volume regulation. Because these cotransporters possess an important ion efflux or influx capacity, and some are ubiquitously expressed, their activation is one of the mechanisms that Physiol Rev • VOL

diverse cells use to adjust their internal osmolarity when they are exposed to changes in extracellular osmolarity. When cells are exposed to increased osmolarity in the extracellular medium, water content of the cell is reduced because water molecules move toward the space in which water is less concentrated; this is followed by a significant reduction in cell volume. To compensate for osmolarity differences between intra- and extracellular space, several mechanisms are activated to increase intracellular ion concentration, thus reducing the gradient for movement of water molecules outside the cell. One of these pathways is the Na⫹-K⫹-2Cl⫺ cotransporter, particularly the basolateral and ubiquitously expressed isoform BSC2/ NKCC1, which by concentrating Na⫹, K⫹, and Cl⫺ into cells promotes recovery of the original cell volume. Thus Na⫹-K⫹-2Cl⫺ cotransporter is a membrane protein activated during regulatory volume increase (RVI) (for a complete and recent review, see Ref. 351). In contrast, when cells are exposed to a decrease in extracellular osmolarity, the gradient now favors movement of water molecules into the cell, resulting in cell swelling. Under these circumstances, membrane proteins that allow efflux of ions are activated to release effective osmolytes from the cell, and thus reduce the gradient for water movement. K⫹-Cl⫺ cotransporters are some of the pathways activated under these circumstances. By extruding ions, KCCs help to decrease intracellular osmolarity, thus K⫹-Cl⫺ cotransporters are membrane proteins that are activated during regulatory volume decrease (RVD) (for an excellent review of mechanisms involved in RVI and RVD, see Ref. 230). A third universal role for electroneutral cotransporters is their important participation in transepithelial movement of ions. The only member of the family not involved in this activity is KCC2, because its expression is neuron specific. When expressed in epithelial cells, electroneutral cotransporters are polarized to the apical or basolateral membrane. Two genes of the family encode for cotransporters that are currently believe to be expressed only in the apical membrane of particular regions of the nephron. These are TSC, which is present only in DCT (20, 48, 106, 248, 301, 327, 400, 447), and BSC1/ NKCC2, which is only expressed in TALH (98, 203, 290, 297). The major role of these isoforms is translocation of ions from the lumen into cells to promote transepithelial transport, thus playing a key role in reabsorption of salt in the kidney. In contrast, in epithelial cells BSC2/NKCC1 is only expressed in basolateral membrane [except in choroid plexus, which exhibits expression in apical membrane (326, 438)], the major function of which is to provide Cl⫺ that are required for secretion in the apical membrane. K⫹-Cl⫺ cotransporters KCC1, KCC3, and KCC4 are all expressed in several epithelial cells, but precise localization of each isoform is not completely known (see below). However, it is highly likely that these

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

cotransporters are also involved in transepithelial ion transport. Finally, a fourth and emerging role of electroneutral cotransporters is their participation in clamping intraneuronal chloride concentration either above or below its electrical potential equilibrium (6). This role in neuronal physiology is critical to define type and magnitude of response to neurotransmitters such as GABA. Family members involved in this activity are those expressed in the CNS, with particular importance on BSC2/NKCC1, KCC2, and KCC3 (274, 312). Soon after discovery of electroneutral cotransport processes, much information was produced regarding potential roles of Na⫹-K⫹-2Cl⫺ and K⫹-Cl⫺ cotransporters in cell volume regulation, particularly in nonepithelial cells such as erythrocytes, as well as in epithelial salt secretion and renal reabsorption. The majority of these studies were produced before cotransporter genes were identified at the molecular level; this information will not be reviewed here. There are several excellent and extensive reviews that present comprehensive information concerning the manner in which this knowledge evolved, to which readers are referred (104, 151, 161, 164, 235, 236, 302, 348, 351, 427). In this section, what I present is a review of information generated since cloning of the cotransporter’s cDNAs that is helping us to obtain better understanding of previously known roles or that has revealed new roles for each cotransporter that were either suspected or unsuspected. My focus in this section is toward understanding physiological roles of each cotransporter, not only at the cellular physiology level, but also at the levels of the physiology of different organs and systems. A. Thiazide-Sensitive Naⴙ-Clⴚ Cotransporter The thiazide-sensitive Na⫹-Cl⫺ cotransporter is the major NaCl transport pathway in the apical membrane of the mammalian distal convoluted tubule (DCT) (63, 109, 220, 327, 412), a nephron region that mediates reabsorption of 5–10% of glomerular filtrate. The molecular mechanism of salt reabsorption in DCT is shown in Figure 18A. In the kidney, DCT begins few cells after macula densa and is divided into “early” and “late” segments (337). The majority of studies in human, rabbit, mouse, and rat kidney agree that TSC is the major sodium reabsorption pathway along the entire DCT. While in early DCT TSC is the only Na⫹ transport pathway, during the late portion its expression overlaps with the epithelial sodium channel known as ENaC (48, 109, 247, 248, 301, 337). The sodium gradient that drives transport from lumen to interstitium is generated and maintained by very intense activity of Na⫹-K⫹-ATPase that is polarized to the basolateral membrane (91). Potassium that enters the cell through Na⫹K⫹-ATPase is secreted at the luminal membrane by Physiol Rev • VOL

459

⫹ FIG. 18. Schematic representation of Na -coupled chloride cotransporters in transepithelial ion transport. A: ion transport pathways in distal convoluted tubule. Salt is transported in apical membrane by the Na⫹-Cl⫺ cotransporter encoded by the SLC12A3 gene. B: ion transport pathways in TALH. Salt is transported in the apical membrane by the Na⫹-K⫹-2Cl⫺ cotransporter encoded by SLC12A1 gene. C: ion transport pathways in secretory epithelial cell from any secretory epithelium such as trachea, gills, intestine, salivary gland, etc. Salt is transported from interstitial space into the cell by means of the Na⫹-K⫹-2Cl⫺ cotransporter encoded by the SLC12A2 gene.

ROMK K⫹ channels (441) and by an apical K⫹-Cl⫺ cotransporter (14). Thus rate of Na⫹-Cl⫺ reabsorption determines in part the rate of K⫹ secretion. TSC also modulates magnesium and calcium reabsorption, the latter in an inversely related fashion. Blocking activity of the Na⫹-Cl⫺ cotransporter increases Ca2⫹ reabsorption, while increased expression or activity of Na⫹-Cl⫺ cotransporter reduces Ca2⫹ reabsorption (63). The mechanism by which thiazide diuretics increase calcium reabsorption is still unclear. Thiazides reduce NaCl entry at apical membrane, while intracellular Na⫹ is continuously pumped out of the cell by Na⫹-K⫹-ATPase at the basolateral membrane, reducing the concentration of this cation within the cell. As a result, electrical gradient for Ca2⫹ entry at apical membrane is increased, opening the rate of Ca2⫹ transport through calcium channels (141). In a recent study, however, it was observed that preventing

85 • APRIL 2005 •

www.prv.org

460

GERARDO GAMBA

extracellular volume contraction in rats treated with hydrochlorothiazide prevented the reduction in urinary calcium excretion (298). Because it was also observed that expression of calcium transport proteins such as calcium channel TRPV5 and calbindin-D28K was reduced, it was concluded that another potential explanation is that hypocalciuric effects of thiazides are due to extracellular volume contraction. This secondary effect of thiazides constitutes the basis for their use in treatment of calcium stone disease and may also explain protective effects of thiazides in osteoporosis (333, 361, 428). In addition, TSC indirectly modulates potassium and acid-base metabolism because secretion of these ions in renal collecting tubule is affected by NaCl delivery to this region of nephron. The fundamental role of the TSC Na⫹-Cl⫺ cotransporter encoded by the SLC12A3 gene in preserving extracellular fluid volume and divalent cation homeostasis has been firmly established by identification of inactivating mutations of this gene as the cause of Gitelman’s disease (see sect. VIA) (221, 264, 265, 377). TSC also plays a key role in renal and cardiovascular pharmacology. As shown in Figure 18A, the apical Na⫹-Cl⫺ cotransporter in DCT is the major target for thiazide-type diuretics (chlorthalidone, hydrochlorothiazide, bendroflumethiazide, metolazone) (109, 136, 389). Chlorothiazide was the first effective antihypertensive agent available for clinical use, and its launch into clinical medicine in 1957 (300) was considered the greatest breakthrough in the history of drug treatment of hypertension (105, 129). Diuretics are currently used in treatment of high blood pressure, edematous states such as chronic cardiac failure, chronic renal failure, chronic liver failure, and nephrotic syndrome, as well as derangements of calcium metabolism such as renal stone disease and osteoporosis (130). Results from the recently published Antihypertensive and Lipid-Lowering Treatment to Prevent Heart Attack Trial (ALLHAT) study (401) showed that thiazides are not only effective in lowering blood pressure levels in hypertensive patients, but also help to prevent chronic cardiovascular complications. Thus the seventh report of the Joint National Committee on Prevention, Detection, and Evaluation of High Blood Pressure (57) recommends thiazides as the drug of choice for treatment of hypertension, either as a single agent or in combination with other antihypertensive drugs. With the availability of cDNA probes, cDNA primers, and high-quality polyclonal antibodies to the majority of transporters expressed along the nephron, several techniques have been implemented to study patterns of Na⫹ transporter abundance changes under several physiological and pathophysiological circumstances (for review, see Refs. 213–215). These studies have revealed that TSC expression is highly regulated by multiple factors known to modulate renal excretion of sodium and hence arterial

Physiol Rev • VOL

blood pressure. TSC is regulated by the mineralocorticoid aldosterone. Micropuncture studies in adrenalectomized rats showed several years ago that increase in sodium tubule fluid-to-plasma concentration ratio in DCT (177) was decreased to control levels by aldosterone, and microperfusion investigations showed that aldosterone increases thiazide-sensitive salt transport in DCT (411). In addition, aldosterone has been shown to increase [3H]metolazone binding in membrane fractions from renal cortex, a measure of TSC abundance (117), and by immunoblotting with specific anti-TSC antibodies, it has been demonstrated that elevated plasma aldosterone concentration is associated with an increase in TSC abundance in renal cortex when plasma aldosterone was increased by either dietary sodium restriction (262) or aldosterone infusion (210). Another study in which aldosterone was infused in dexamethasone-replaced adrenalectomized rats increased TSC abundance in renal cortex, and this effect was completely prevented by spironolactone (296). Additionally, it was demonstrated that loop and thiazide diuretic administrations are associated with increased expression of TSC (294) and that increased expression can be abrogated with spironolactone (1). All this information together suggests that aldosterone regulation of TSC protein is mediated through classical mineralocorticoid receptors. Interestingly, however, existing evidence indicates that TSC regulation by mineralocorticoids must be indirect, i.e., unrelated to TSC gene transcription, because there has been consistent failure to detect changes in TSC mRNA levels in response to dietary salt restriction (288, 436) or furosemide administration (1, 288). In this regard, a study in which TSC mRNA and protein levels were assessed simultaneously showed that increase in TSC protein induced by dietary NaCl restriction was not accompanied by detectable changes in TSC mRNA levels (263). Despite positive regulation by aldosterone, TSC is the only transport protein that is decreased during the aldosterone escape phenomenon (424). This observation suggests that one of the principal targets of pressure natriuresis is TSC; a similar conclusion was drawn by Majid and Navar based on measurements of pressure natriuresis in intact dogs (258). Abundance of TSC protein in kidney is not regulated by aldosterone alone. TSC is a target for other hormones and regulators. For instance, TSC abundance is moderately increased by vasopressin administration (dDAVP) (100). However, when the kidney undergoes escape from vasopressin-induced water retention after development of hyponatremia, TSC abundance is more markedly increased (101). It was proposed that increase in TSC abundance in response to water retention may be associated with inappropriate secretion of antidiuretic hormone. TSC abundance is also increased under hyperinsulinemic conditions such as obesity (38), streptozotocin adminis-

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

tration (426), or insulin infusions (99), suggesting that increased sodium reabsorption by TSC could be implicated in development of hypertension under these conditions. There are other regulators of TSC expression: gonadectomy in female rats is associated with decrease in TSC expression, which was corrected when estradiol was administered (416). Metabolic acidosis induces a decrease in TSC abundance, while metabolic alkalosis increases it (211). Potassium depletion reduces expression of TSC by a mechanism that includes a decrease in TSC mRNA levels (13). Therefore, regulation of TSC expression appears to be an important cog in overall mechanisms by which renal sodium excretion is regulated. In winter flounder, transcripts encoding a shorter, truncated TSC isoform have been observed in several tissues including gonads, brain, skeletal muscle, intestine, heart, and eye (Table 1) (137). In mammals, however, the thiazide-sensitive Na⫹-Cl⫺ cotransporter is considered to be a kidney-specific gene, although several reports suggested its presence in many other tissues. Existence of a thiazide-sensitive Na⫹-Cl⫺ cotransporter has been suggested in brain (82), blood vessels (58), pancreas (32), peripheral blood mononuclear cells (2), bone (22), gallbladder (65), and heart (93); however, the molecular nature of a putative thiazide-sensitive mechanism in these tissues has not been properly defined. Although some studies exhibit RT-PCR amplification of a TSC cDNA fragment, the existence of the protein has not been demonstrated by Western blot or other means. The only exception seems to be bone, in which a preliminary report revealed that TSC presence in bone cells has been observed by immunohistochemistry (97). In some tissues such as brain and blood vessels, the thiazide effect is due to interaction with other proteins such as AMPA receptors (120), carbonic anhydrase (319), potassium channels (320), or nitric oxide production (61). Thus it is possible that expression of TSC is not specific for kidney, as it was initially thought (136), but confirmation of protein expression elsewhere is still pending. B. Apical Bumetanide-Sensitive Naⴙ-Kⴙ-2Clⴚ Cotransporter Apical bumetanide-sensitive Na⫹-K⫹-2Cl⫺ cotransporter BSC1/NKCC2 is the major salt transport pathway in mammalian TALH, which is in charge of reabsorbing ⬃15–20% of glomerular filtrate. Function of this cotransporter in TALH is not only critical for salt reabsorption, but also for production and maintenance of countercurrent multiplication mechanism, and thus in renal ability to produce urine that can be more diluted or concentrated than plasma, a functional capacity essential for survival of land mammals, including humans. In addition, TALH

Physiol Rev • VOL

461

plays an important role in divalent cations (Ca2⫹ and Mg2⫹) and ammonium (NH⫹ 4 ) reabsorption. Transcellular salt reabsorption by TALH promotes paracellular reabsorption of divalent cations (168), and NH⫹ 4 can substitute for K⫹ in BSC1/NKCC2 cotransporter to behave as a ⫺ Na⫹-NH⫹ cotransporter. As I mentioned at the be4 -2Cl ginning of this section, basic demonstrations of major roles that Na⫹-K⫹-2Cl⫺ cotransport plays in salt reabsorption in TALH were produced many years before identification of cotransporters at the molecular level and have been extensively reviewed in excellent manuscripts to which interested readers are referred (151, 152, 159, 167, 169, 174, 279, 348, 435). Thus here we will first review the general mechanism of salt reabsorption in TALH that will be of help in understanding the roles of the Na⫹-K⫹-2Cl⫺ cotransporter BSC1/NKCC2 in renal physiology, pharmacology, and pathophysiology, and then we will review new information regarding the physiology of this cotransporter in kidney that has been produced since identification of the SLC12A1 gene. 1. Molecular physiology of salt reabsorption by TALH Molecular mechanisms of salt reabsorption by TALH are shown in Figure 18B. Na⫹-K⫹-ATPase polarized to basolateral membrane produces continuous efflux of sodium ions into interstitial space, generating a gradient for sodium transport on the apical side (155). The major pathway for sodium reabsorption in apical membrane of TALH is Na⫹-K⫹-2Cl⫺ cotransporter BSC1/NKCC2 (149, 153, 154, 156, 170). As shown in Figure 18B, salt reabsorption in TALH requires simultaneous operation of several transport proteins. Entrance of salt together with K⫹ occurs through the Na⫹-K⫹-2Cl⫺ cotransporter BSC1/ NKCC2. Sodium and chloride ions leave the cell in basolateral membrane through Na⫹-K⫹-ATPase and Cl⫺ channels (CLC-Kb), respectively. Both Na⫹-K⫹-ATPase and CLC-Kb channels are composed of two subunits: one that carries out the transport function and another that is required for successful targeting of Na⫹-K⫹-ATPase or CLC-Kb complex to plasma membrane (139, 208, 268, 335, 371, 372, 421). These subunits in Na⫹-K⫹-ATPase or CLC-Kb are ␤-subunit and Barttin, respectively. Basically all potassium ions entering across the apical plasma membrane are returned to tubular lumen via an inwardly rectifying K⫹ channel known as ROMK. Potassium concentration in the glomerular ultrafiltrate (4 meq/l) is much lower than that of sodium (145 meq/l) or chloride (110 meq/l). Thus K⫹ concentration in the lumen of TALH would be rapidly reduced below the minimum required for transport, stopping the function of the Na⫹K⫹-2Cl⫺ cotransporter. K⫹ recycling, however, ensures that potassium concentration within TALH lumen will be enough to allow proper function of the cotransporter.

85 • APRIL 2005 •

www.prv.org

462

GERARDO GAMBA

Moreover, positive voltage within TALH that resulted from K⫹ recycling together with movement of sodium and chloride to interstitial space drives reabsorption of a second cation through paracellular pathway. Because tight junctions are permeable to sodium, magnesium, and calcium, all three ions are reabsorbed at rates dependent on their luminal concentrations. Thus coordinated function between Na⫹-K⫹-2Cl⫺ cotransporter, apical K⫹ channels, and basolateral Cl⫺ channels renders TALH epithelial cells thermodynamically more efficient because two cations are reabsorbed at the expense of ATP needed to pump one (393). The fundamental role of apical Na⫹-K⫹-2Cl⫺ cotransporter in salt reabsorption in TALH has been firmly established by demonstration that mutations in SLCA12A1 are associated with the development of Bartter’s disease and by BSC1/NKCC2 knockout mice that reproduced a clinical picture that is similar to this illness. In this study, Takahashi et al. (397) developed a mouse with targeted disruption of SLC12A1 gene resulting in mice that were born normally but developed a clear dehydration state by day 1 of life. Then, all mice failed to thrive and by day 7 presented with severe renal failure, metabolic acidosis, hyperkalemia, high plasma renin activity, and hydronephrosis. Before the end of the second week all homozygous pups were dead. Interestingly, indomethacin treatment improved metabolic conditions of most pups by 7 days, although 90% died by 3 wk. However, the 10% that survived were able to reach adulthood without further treatment and at 10 mo exhibited the expected hypokalemia and metabolic alkalosis. In contrast to patients with Bartter’s disease, survival mice developed marked hydronephrosis probably due to excessive fluid that exceeded the maximum capacity of ureters resulting in increased pressure of the renal pelvis. Apical Na⫹-K⫹-2Cl⫺ cotransporter BSC1/NKCC2 also plays an important role in cardiovascular and renal pharmacology because this cotransporter is the main pharmacological target of loop diuretics (furosemide, bumetanide, ethacrynic acid, torasemide, and piretanide), the most potent natriuretic agent available for clinical use. The functional description on Figure 18B of salt reabsorption in TALH cells helps us to understand the mechanisms by which loop diuretics exert their potent effects in kidney. By blocking the Na⫹-K⫹-2Cl⫺ cotransporter, loop diuretics reduce salt reabsorption rate in TALH. Thus delivery of salt to the distal nephron is increased, producing significant natriuresis and diuresis. When macula densa at the end of TALH sense an increase in NaCl delivery, this will be usually compensated by decreasing glomerular filtration rate as a result of activation of the tubuloglomerular feedback mechanism (359). This compensation, however, does not occur when increased NaCl delivery is mediated by loop diuretics because the saltsensing protein in macula densa is also BSC1/NKCC2 Physiol Rev • VOL

(presumably isoform B), which is blocked by loop diuretic (297). Increased delivery of NaCl to connecting tubule and collecting duct results in greater Na⫹ reabsorption and K⫹ secretion by principal cells, causing a greater rate of H⫹ secretion by intercalated cells of connecting tubule and outer medullary collecting duct, thus producing hypokalemia and metabolic alkalosis, a major finding of Bartter’s disease (see sect. VIB). Finally, increased reabsorption of divalent cations, as a result of positive voltage in TALH lumen generated by Na⫹-K⫹2Cl⫺ cotransporter, explains the hypercalciuric effect of loop diuretics, which is highly valuable during management of life-threatening hypercalcemia. 2. Regulation of the Na⫹-K⫹-2Cl⫺ cotransporter Increasing net NaCl reabsorption in TALH by hormones generating cAMP via their respective Gs-coupled receptors such as vasopressin, glucagon, parathyroid hormone, ␤-adrenergic, and calcitonin is a fundamental mechanism for regulating salt transport in this nephron segment (171, 172). Of these hormones, the most important is the antidiuretic hormone vasopressin. As demonstrated in isolated perfused tubule studies mediated by cAMP, vasopressin increases NaCl absorption by TALH (166, 171, 356) following a mechanism that appears to involve trafficking of Na⫹-K⫹-2Cl⫺ cotransporter, BSC1/ NKCC2, from an intracellular vesicular pool to apical plasma membrane (143, 269, 325). In a recent study using a polyclonal antibody that recognizes BSC1/NKCC2 when phosphorylated at threonine residues located in the amino-terminal domain, Gimenez and Forbush (143) observed that vasopressin’s effect in mouse TALH may be dependent in part on phosphorylation of BSC1/NKCC2 and that vasopressin action in TALH induces phosphorylation of Na⫹-K⫹-2Cl⫺ cotransporter protein that is associated with migration of cotransporter containing vesicles to apical membrane (143). In addition, as discussed in section IIIB, in mice, the stimulatory effect of vasopressin on BSC1/NKCC2 trafficking appears to be related to inhibition by cAMP of a dominant-negative effect of the 770amino acid short isoform BSC1-S on trafficking of fulllength isoform BSC1/NKCC2 (269, 325). Other hormones that generate cAMP via their respective Gs-coupled receptors stimulate concomitant increases in NaCl absorption rate, such as parathyroid hormone, calcitonin, and glucagons, presumably using similar mechanisms to those demonstrated for vasopressin (89, 103, 286). Prostaglandin E2 has been demonstrated to have a short-term inhibitory effect on NaCl absorption in TALH (387), presumably via its ability to inhibit cAMP production in TALH cells (402). Another mediator that regulates TALH NaCl transport via effects in BSC1/NKCC2 is nitric oxide, which directly inhibits NaCl absorption in isolated perfused preparations (304).

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

In addition to the short-term effect of vasopressin on BSC1/NKCC2 trafficking or activity, long-term increases in vasopressin levels have been demonstrated to upregulate BSC1/NKCC2 protein expression in TALH cells (209). This action results in long-term potentiation of NaCl transport in TALH, as demonstrated by Besseghir et al. (33) in isolated perfused tubule studies in which the investigators observed that chronic in vivo administration of antidiuretic hormone to Brattleboro rats significantly increased basal voltage and chloride transport in TALH. In addition, long-term change in prostaglandin E2 levels appears to modulate BSC1/NKCC2 expression levels in TALH because the cyclooxygenase inhibitors indomethacin or diclofenac increased BSC1/NKCC2 abundance, an effect that was reversed by misoprostol, a prostaglandin E2 analog (122). Supporting this observation, Escalante et al. (112) previously showed in isolated rabbit mTALH cells that arachidonic acid metabolites produced a concentration-dependent inhibition of Na⫹-K⫹-2Cl⫺ cotransporter activity, an effect that was prevented by selective inhibition of cytochrome P-450 monooxygenases. In addition to actions of hormones that generate cAMP in TALH, regulatory mediators using other signal mechanisms also modulate BSC1/NKCC2 expression in TALH. Glucocorticoids increase BSC1/NKCC2 mRNA and protein expression by a mechanism that requires vasopressin, while aldosterone has no effect on BSC1/NKCC2 expression levels (18). By stimulating cGMP production, nitric oxide increases BSC1/NKCC2 expression, as observed by Turban et al. (405) as a marked decrease in this cotransporter abundance in response to inhibition of nitric oxide synthases by NG-nitro-L-arginine methyl ester (L-NAME). In addition, while angiotensin II infusion was found to increase BSC1/NKCC2 abundance in TALH (225), absence of AT1a receptors in mice (44) or blockade of angiotensin II AT1 receptors by candesartan (36) did not produce opposite effects, suggesting that the angiotensin II effect on BSC1/NKCC2 expression is indirect and related to local changes in nitric oxide or PGE2 levels. Finally, expression of BSC1/NKCC2 is also regulated by acid-base status. Chronic metabolic acidosis has been shown to enhance expression of BSC1/NKCC2 mRNA and protein in medullary TALH (17) by glucocorticoid-dependent and -independent mechanisms (18). In this regard, it has been recently found that what metabolic acidosis does is increase the stability of BSC1/NKCC2 mRNA, without affecting SLC12A1 transcription rate (206). Under physiological conditions, most of the ammonium produced in the proximal tubule is reabsorbed in TALH to be later secreted in medullary collecting ducts and excreted into urine (146, 216). Thus, during acidosis in which production of ammonium by proximal tubule is increased, enhancing of BSC1/NKCC2 expression arises as a compensatory mechanism to increase ammonium reabsorption. Physiol Rev • VOL

463

C. Basolateral Bumetanide-Sensitive Naⴙ-Kⴙ-2Clⴚ Cotransporter After the discovery of an electroneutral Na⫹-K⫹-2Cl⫺ cotransport mechanism by Geck et al. in Ehrlich cells (138), it was soon established that this salt-transport pathway was present in several epithelial and nonepithelial cells. As previously mentioned, at cellular physiology level a major role of the Na⫹-K⫹-2Cl⫺ cotransporter in epithelial and nonepithelial cells is in cell-volume regulation processes, mainly as one of the membrane transporters activated during cell shrinkage, as part of regulatory volume increase mechanisms (230). As shown in Figure 18C, in epithelial cells the Na⫹-K⫹-2Cl⫺ cotransporter is polarized to basolateral membrane and plays a critical role in providing cells with Cl⫺ that are secreted through the apical membrane. The driving force for Na⫹ transport maintained by Na⫹-K⫹-ATPase activity allows BSC2/ NKCC1 to transport Na⫹, K⫹, and Cl⫺ from interstitium into the cell. The majority of the Na⫹ and K⫹ recycle into interstitial fluid by Na⫹-K⫹-ATPase and conductive pathways, respectively, while Cl⫺ are secreted into the lumen by several conductive pathways, one of the most important being the CFTR (364). The existence of Na⫹-K⫹-2Cl⫺ cotransporter in secretory epithelium from several organs including respiratory epithelium, parotid gland, intestine, colon, eye, ear, mammary gland, and shark rectal gland, among others, was originally demonstrated by functional analysis and later by immunolocalization using specific antibodies. The sole exception is in the choroid plexus in the CNS in which BSC2/NKCC1 expression is polarized to the apical membrane, together with Na⫹-K⫹-ATPase (438). Most of this information has been recently reviewed. Interested readers are advised to consult these excellent manuscripts (164, 351). What I wish to review here are the physiological roles that have emerged for BSC2/NKCC1 at the organ or system level due in part to the observations done in knockout mice. As shown in Figure 19, several interesting phenotypes have arisen in mice harboring disrupted mutations on the SLC12A2 gene that include gastrointestinal, cardiovascular, auditory, salivary, testicular, and growth retardation phenotypes. Mice lacking basolateral Na⫹-K⫹-2Cl⫺ cotransporter expression were produced simultaneously by Flagella et al. (123) and Delpire et al. (78) by targeted disruption of exons 6 and 9, respectively. BSC2/NKCC1-null mice were normal at birth but exhibited growth retardation apparent from the first day of life. Body weight 10 wk after birth was ⬃25% lower than normal or heterozygous mice. A few days after birth, null mice exhibited several interesting phenotypes that are aiding in revealing the role of BSC2/ NKCC1 in several organs (Fig. 19). BSC2/NKCC1 knockout mice are deaf due to a sensorineural defect. These mice exhibit the characteristic

85 • APRIL 2005 •

www.prv.org

464

GERARDO GAMBA

FIG. 19. Several phenotypes result from targeted disruption of the SLC12A2 gene. Total absence of BSC2/NKCC1 is associated with azoospermia [modified from Pace et al. (306)]; growth retardation, deafness, and imbalance (78, 123); decreased pain perception (229, 394); impaired saliva production [modified from Evans et al. (114)]; decrease in blood pressure levels (123, 277), and gastrointestinal secretory problems ending in death due to cecum and colonic blockade (123, 157). Although BSC2/NKCC1 knockout mice exhibit a clear decrease in Cl⫺ influx in respiratory epithelium, the absence of a respiratory phenotype appears to be due to compensation by other anion transporters (158).

shaker/waltzer phenotype apparent in continuous circling and head movements accompanied by frequent loss of balance. This behavior is known to be due to inner-ear dysfunction. The existing mouse model of shaker-withsyndactylism is a radiation-induced mutant mouse exhibiting deafness and fusion of digits. This colony has produced the fused-phalanges mouse syFP that exhibits various degrees of digit fusion without deafness, and the no-syndactylism syNS that is deaf without syndactylism. Using a positional cloning approach, Dixon et al. (90) recently demonstrated that SLC12A2 is the gene defective in syNS mice. Thus three different disruptions in the SLC12A2 gene produced similar inner ear phenotype. BSC2/NKCC1-null mice exhibit histological evidence of dysfunction of epithelial secretion in labyrinth such as collapse of endolymphatic cavity and a Reissner’s membrane lying above on the top of stria vascularis, rather than in its normal position between scala media and scala vestibules; in addition, it is known that BSC2/NKCC1 is Physiol Rev • VOL

expressed in the basolateral membrane of stria vascularis and vestibular cells (78). Thus it is likely that BSC2/ NKCC1 plays an important role in providing epithelial cells with sufficient K⫹, which is secreted in the apical side into cochlear chamber (353). Absence of the Na⫹K⫹-2Cl⫺ cotransporter in basolateral membrane is then associated with significant reduction of K⫹ secretion into endolymph. Supporting this conclusion, a similar sensorineural-deafness phenotype is present in knockout mice of a subunit of the K⫹ channel (minK) present in apical membrane of stria vascularis, through which K⫹ are secreted (417). Therefore, two distinct disruptions of K⫹ handling by stria vascularis cells result in profound deafness. BSC2/NKCC1-null mice exhibit growth retardation, and ⬃30% spontaneously died between days 18 and 26 of life, due to cecum bleeding and severe blockade of colon. A similar situation occurs in CFTR knockout mice (379), suggesting that the basolateral Na⫹-K⫹-2Cl⫺ cotransporter plays indeed a very important role in providing

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

epithelial cells with ions secreted in the apical membrane. In this regard, cAMP-stimulated short-circuit current (Isc) in jejunum and cecum of BSC2/NKCC1 knockout mice was ⬃50% of that shown to be present in normal mice. These observations, however, have not been consistently observed because increased mortality due to intestinal problems was not present in BSC2/NKCC1-null mice done by other groups (78, 306). The difference appears to be adaptability of intestinal epithelium, which in the absence of Cl⫺ secretion exhibits an increase in HCO⫺ 3 secretion (157). Finally, within the gastrointestinal system, as revealed by Evans et al. (114) BSC2/NKCC1 knockout mice also exhibited severe salivation impairment (Fig. 19). In contrast to normal mice, null mice observed a complete absence of BSC2/NKCC1 expression in basolateral membrane of parotid acinal cells, which was accompanied by reduction of ⬃60% in the amount of saliva secreted in response to muscarinic agonist carbachol, with a total loss of bumetanide-sensitive Na⫹-K⫹-2Cl⫺ influx. The remaining saliva production is due to compensatory upregulation of AE2 Cl⫺/HCO3⫺ exchanger expression. A similar situation occurs with ion transport in airway epithelia. Normal mice exhibit robust bumetanide-sensitive ion transport in basolateral membrane of tracheal epithelium, which is absent in BSC2/NKCC1 null mice. However, spontaneous airway diseases are not developed in knockout mice. Experiments performed with ion substitutions and several drugs suggest that absence of Cl⫺ secretion by the Na⫹-K⫹-2Cl⫺ cotransporter in null mice is well compensated with HCO⫺ 3 secretion (158). Conflicting results were observed between two groups regarding blood pressure effects of BSC2/NKCC1 targeted disruption. Pace et al. (306) reported that arterial blood pressure measured in conscious mice using a tailcuff system revealed no significant difference between BSC2/NKCC1 wild-type and null mice. In addition, no difference in renal function and vasopressin response was observed; however, a decrease in blood pressure has been recorded by Flagella et al. (123). This group first reported that blood pressure levels measured by means of femoral artery catheter on anesthetized mice revealed a significant decrease in blood pressure in both heterozygous ⫹/⫺ (77 ⫾ 4.1 mmHg) and homozygous ⫺/⫺ (68 ⫾ 2.8 mmHg) mice, when compared with normal mice (92 ⫾ 4 mmHg). The blood pressure in this mouse model was reanalyzed in awake animals by means of tail-cuff system to assess systolic blood pressure, and a significant reduction was again observed in BSC2/NKCC1-null mice (114 ⫾ 2.2 mmHg in null vs. 131 ⫾ 2.5 mmHg in wild-type) (277). No changes in aldosterone and electrolytes in blood suggested that low blood pressure is not due to a decrease in extracellular fluid volume. Cardiac function was normal. A small but significant reduction in contractility of portal veins was observed, suggesting that hypotension could be Physiol Rev • VOL

465

due to a reduction in vascular tone; however, no further studies to verify this hypothesis have been performed. Male BSC2/NKCC1-null mice are infertile, whereas females exhibit successful pregnancies without reproductory impairment. Histological analysis revealed normal reproductive organs in females. In contrast, complete infertility of males was associated with deficit in spermatocyte production accompanied by architectural disruption of testis and epididymis (306). These observations suggest that the absence of a basolateral Na⫹-K⫹-2Cl⫺ cotransporter in seminiferous tubules has a similar consequence to that seen in inner ear, in which impairment in K⫹ secretion results in blockade of spermatocyte maturation. In addition, low levels of testosterone and luteinizing hormones in null mice suggested a deficit in hypothalamus/pituitary axis (79). The Na⫹-K⫹-2Cl⫺ cotransporter encoded by the SLC12A2 gene appears to have very important functional roles in primary sensory neurons of vertebrates by making possible presynaptic inhibition and nociception (10, 51, 229, 394). Functional expression of NKCC1 in these nerve cells was first shown by Alvarez-Leefmans et al. (8). Using double-barreled Cl⫺ selective microelectrodes, these investigators measured simultaneously transmembrane potential (Em) and intracellular free Cl⫺ concentration ([Cl⫺]i) in the cell bodies of frog sensory neurons (i.e., dorsal root ganglion cells). They showed that sensory neurons have a higher [Cl⫺]i than that predicted for a passive distribution, that the intracellular Cl⫺ accumulation in these cells is sensitive to bumetanide and dependent on the presence of extracellular Na⫹, K⫹, and Cl⫺. Their measurements directly showed that bumetanidesensitive Cl⫺ movements across the membrane occurred without concurrent changes in Em and therefore concluded that the mechanism that generates and maintains the outwardly directed Cl⫺ gradient across membrane was an electroneutral Na⫹-K⫹-2Cl⫺ cotransport system. They were the first to suggest that by keeping [Cl⫺]i above electrochemical equilibrium, the cotransporter function explained why GABA produces depolarization of primary sensory neurons, a critical factor in producing presynaptic inhibition between afferent terminals in the spinal cord (350). The prevailing idea regarding this issue is that GABA released from interneurons depolarizes primary afferent fibers via axo-axonic synapses. The depolarization inactivates Na⫹ channels sufficiently to decrease or block action potential invasion into primary afferent terminals, thereby inhibiting transmitter release and selectively channeling sensory information into spinal cord. GABA depolarizations result from an efflux of Cl⫺ through GABAA-gated anion channels. The key element for generation of the outward Cl⫺ current in terminals of primary afferents is equilibrium potential for chloride (ECl), which is kept at a more positive value than Em by BSC2/NKCC1. These observations suggest that intracellu-

85 • APRIL 2005 •

www.prv.org

466

GERARDO GAMBA

lar Cl⫺ accumulation by the BSC2/NKCC1 is a key component of GABA depolarization and modulation of sensory input to the spinal cord. Later on, using specific antibodies against BSC2/ NKCC1, the presence of this cotransporter was confirmed in the plasma membrane of dorsal root ganglion neurons from mice (326), and those from frogs, cats, and rats, including their afferent axons (9). GABA-induced currents in dorsal neurons of wild-type and BSC2/NKCC1-null mice were studied by Sung et al. (394) using gramicidin-perforated patch and whole cell recordings. In neurons from wild-type animals, intracellular Cl⫺ accumulation was suggested because GABA evoked inward currents at resting membrane potentials. In contrast, in neurons from BSC2/NKCC1-null animals, no current was observed at resting membrane potential, and GABA evoked reduced depolarizing or even hyperpolarizing currents. In this same study, it was shown that BSC2/NKCC1-null animals exhibited an impaired nocioceptive phenotype. Specifically, experiments with BSC2/NKCC1-null mice demonstrated impaired pain perception in the hot plate test, suggesting that Na⫹-K⫹-2Cl⫺ cotransporter is involved in pain perception. More recently, Laird et al. (229) examined the role of the cotransporter in generation of touchevoked pain (allodynia). BSC2/NKCC1-null animals showed an increase in tail flick latencies and a reduction in pain behavior induced by intradermal capsaicin compared with heterozygous and wild-type animals. The BSC2/NKCC1-null animals showed a reduction in stroking hyperalgesia (touch-evoked pain) compared with wildtype and heterozygous mice. As BSC2/NKCC1 is responsible for the generation of presynaptic inhibition between afferent terminals in the spinal cord, these results supported the notion that presynaptic interactions between low- and high-threshold afferents can underlie allodynia (51). Expression of NKCC1 is developmentally regulated in postnatal rat brain (59, 328). Consistent with this finding, in embryonic neurons, GABA has a widespread depolarizing action (30) that seems crucial in promoting Ca2⫹ influx, influencing important developmental events such as neuronal proliferation, differentiation, and migration and neurite extension and targeting. Again, depolarizing action of GABA is likely to result from an efflux of chloride through GABAA-gated anion channels, the driving force for Cl⫺ efflux being generated and maintained by BSC2/NKCC1 (443).

KCC1 mRNA transcripts are present in all tested tissues including brain, colon, heart, kidney, liver, lung, spleen, stomach, placenta, muscle, and pancreas. The expression in erythrocytes was later demonstrated by Pellegrino et al. (316). Therefore, KCC1 is a ubiquitously expressed isoform of K⫹-Cl⫺ cotransporters that appears to play a fundamental role in cell volume regulation. In this regard, it has been shown that KCC1 is activated by cell swelling (142, 275). The majority of K⫹-Cl⫺ cotransporter activity in red blood cells has been attributed to KCC1, with some contribution of KCC3 (238). It has been speculated that K⫹-Cl⫺ efflux in red blood cells is an important mechanism for cell size reduction with maturation and that activity of the K⫹-Cl⫺ cotransporter is increased in hemoglobinopathies such as sickle cell disease (235). Since four unexpected genes encoding K⫹-Cl⫺ cotransporters were identified following in silico cloning strategies, little is still known on the physiological roles of each K⫹-Cl⫺ cotransporter gene at the organ or system levels. Moreover, simultaneous expression of at least two or three KCCs in several organs is common. Absence of KCC1 knockout mice in world literature precludes clarification of KCC1 physiological roles at the organ level. As previously mentioned, KCC1 is widely expressed in cells and tissues, but its presence could be related to either its fundamental role in cell volume regulation or a certain role in physiological aspects of a particular tissue. For instance, KCC1 is expressed in the basolateral membrane of exocrine glands such as salivary, parotid, and pancreatic glands (349), but the physiological role of such expression remains to be clarified. The fact that KCC1 is expressed in basolateral membrane of colonic epithelium and K⫹ (but not Na⫹) depletion is associated with a significant increase in KCC1 mRNA and protein levels suggest that KCC1 in colon is involved into transepithelial transport of K⫹ (355). All four K⫹-Cl⫺ cotransporters are expressed in the CNS (29, 204, 313, 315) in which regulation of intracellular Cl⫺ concentration by electroneutral cotransporter plays an important role in defining type and magnitude of response to certain neurotransmitters. Specific roles of KCC1 in CNS, however, have not been defined. By in situ hybridization it was shown that expression of KCC1 mRNA is low and widespread, with higher expression within olfactory bulb, hippocampus, cerebellum, and choroid plexus (59, 202). However, the physiological role of KCC1 remains elusive.

D. Kⴙ-Clⴚ Cotransporter 1

E. Kⴙ-Clⴚ Cotransporter 2

The K⫹-Cl⫺ cotransporter KCC1 is a ubiquitously expressed protein. As discussed in section IIB, KCC1 was the first isoform of KCC cotransporters to be identified at the molecular level (142). In this study it was shown that

Initial cloning of KCC2 cDNA demonstrated that expression of this K⫹-Cl⫺ cotransporter is restricted to the CNS (313). Following in situ hybridization and immunohistochemical studies it was shown that KCC2 expression

Physiol Rev • VOL

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

is prominent in neurons throughout the CNS. KCC2 expression is high in pyramidal neurons of the hippocampus, granular cells, and Purkinje neurons of the cerebellum, retinal neurons, and neuronal groups throughout the brain stem (202). The neuronal restriction for KCC2 expression is probably due to negative transcriptional regulation in all other cells, since SLC12A5 genes possess a single neuronal-restrictive silencing element (NRSE) that is located just 3⬘ of exon 1. This restrictive element is present in both human and mouse genes (205, 380). In conjunction with NKCC1, KCC2 expression in neurons is extremely important in defining the type and magnitude of response to certain neurotransmitters such as glycine and GABA during development and maturation. In central neurons, binding of GABA to GABAA receptors in adult animals opens ligand-gated Cl⫺ channels, allowing inward movement of Cl⫺ into cells with the consequent hyperpolarization. Thus in adult animals, GABA has a hyperpolarizing inhibitory effect on neuronal excitability. In contrast, binding of GABA to GABAA receptors during early neuronal development produces an outward Cl⫺ current, resulting in membrane depolarization. The latter is in all similar to that already discussed for adult sensory neurons (see above). Several lines of evidence support the hypothesis that, in addition to NKCC1, [Cl⫺]i is regulated during ontogeny by KCC2, thereby explaining the perinatal differences in GABA response. KCC2 expression levels are very low at birth, with a marked increase during the first week of postnatal development (59, 250). Reduction of KCC2 expression in pyramidal cells from rat hippocampus using antisense oligonucleotides markedly shifted the reversal potential of GABA response (346). This is likely to be explained by releasing the action of KCC2 on NKCC1. The latter now works without the opposing thermodynamic force of KCC2. Depolarizing response to GABA early in development triggers Ca2⫹ influx via both voltage-dependent and NMDA-gated channels (131, 240), with significant neurodevelopmental consequences (47, 160, 212). In this regard, while GABA induced expression of KCC2 protein, thus limiting its brief window of neurotrophic effect (240), brain-derived neurotrophic factor (BDNF) and neurotrophin-4 decrease KCC2 expression, thus amplifying neuronal excitability in conditions associated with upregulation of BDNF (345). As discussed in section IIIE, KCC2 is the K⫹-Cl⫺ cotransporter with the higher affinity for both cotransported ions (310, 380), which is appropriate to the emerging role of KCC2 as a buffer of both external K⫹ and internal Cl⫺ that was suggested by Payne (310). Thus, if extracellular K⫹ is increased during neuronal activity to values as high as 10 –12 mM, a range wherein KCC2 is highly active, driving force for net K⫹-Cl⫺ cotransport will switch from efflux to influx. This reversibility of K⫹-Cl⫺ cotransport has been verified experimentally (75, 193, 201). Physiol Rev • VOL

467

The role of KCC2 in CNS physiology is so important that complete ablation of KCC2 expression in null mice results in early neonatal death that is basically secondary to apneic respiratory failure (184). Consistent with a role of KCC2 in switching GABA response from excitatory to inhibitory, it was observed in the same study that GABA and glycine were inhibitory in wild-type neurons but excitatory in KCC2-null mice neurons. KCC2 silencing by itself cannot explain the depolarizing shift of ECl. The latter requires active accumulation of Cl⫺, which is likely to act without the opposing force of KCC2. Development of a KCC2-null mice exhibiting modest residual expression of KCC2 provided Woo et al. (437) with knockout mice that survive some time after birth; this allowed the investigators to study effects of dramatic, but not absolute, reduction in KCC2 expression. The homozygous null mice exhibited continuous generalized seizures, because these mice are very easily triggered by modest stimuli. Constant epilepsy resulted in neuronal damage with postnatal death at ⬃17 days of age. Interestingly, heterozygous animals exhibited no particular phenotype but possessed a lower threshold for epileptic seizures induced by pentylenetetrazole. That reduced KCC2 expression resulted in animals with intractable epilepsy is another evidence for the role of this cotransporter in regulation of neuronal excitability and suggests a role for KCC2 in human epilepsy. As previously discussed, coordinated expression of electroneutral cation chloride cotransporters during development in certain neuronal groups is a primary event defining the type of response to neurotransmitters that interact with gated anion channels. The transition in the response to GABA from excitatory in prenatal period to inhibitory in postnatal life appears to be explained by intraneuronal Cl⫺ concentrations that are observed in developing versus in mature neurons (77). Developing neurons exhibit an [Cl⫺]i that is maintained above its electrochemical potential equilibrium, whereas mature neurons exhibit [Cl⫺]i below its potential equilibrium. As Figure 20 shows, change from excitatory in prenatal life to inhibitory in postnatal life is associated with BSC2/ NKCC1 downregulation together with KCC2 upregulation after birth (59, 243, 278, 328). In early development, BSC2/ NKCC1 appears to be the primary transporter responsible for high intraneuronal Cl⫺ concentration. Expression of this cotransporter, however, is downregulated after birth. In contrast, expression of KCC2 in neuronal groups like hipoccampal, cortical, and retinal neurons is absent during early development, but present after birth and during adult life (346, 420); thus it is currently believed that switching of intraneuronal Cl⫺ concentration in neurons from early development to postnatal life is due to changes in the type of electroneutral cotransporter that is expressed.

85 • APRIL 2005 •

www.prv.org

468

GERARDO GAMBA

FIG. 20. Schematic representation of relationship between maturation of neurons, type of response to GABA, and expression of electroneutral cotransporters. Right and left diagrams depict BSC2/ NKCC1 and KCC2 cotransporters expression and a representative whole cell voltageclamp analysis showing the type of responses to GABA. The left diagram shows prenatal situation in which KCC2 expression is minimal and BSC2/NKCC1 expression is robust. The response to GABA is excitatory. In contrast, the right panel shows the postnatal situation. BSC2/NKCC1 expression is reduced, whereas KCC2 expression is increased, resulting in a response to GABA that is inhibitory. [Modified from Delpire (77) and Mercado et al. (274).]

F. Kⴙ-Clⴚ Cotransporter 3 KCC3 cDNA was independently identified by three groups in 1999 (178, 178, 292, 331, 331). Since then, study of this K⫹-Cl⫺ cotransporter has begun to reveal interesting roles in cell growth and in CNS, inner ear, and vascular physiology. The role in cell growth will be discussed in section VIE. KCC3 protein is expressed in most brain areas, including hypothalamus, cerebellum, brain stem, cerebral cortex, and white matter (315). It is also abundant in spinal cord and is expressed at very low levels in dorsal root ganglia. A possible role of KCC3 protein in cerebrospinal fluid K⫹ reabsorption is suggested by its presence at the base of the choroid plexus. The neuronal groups expressing KCC3 are the large hippocampal neurons, cortical pyramidal neurons, and cerebellar Purkinje neurons, as well as in white matter tracts throughout the brain. Ontogeny of KCC3 correlates with development of myelin, because expression is low at birth and increases during postnatal development, similar to the pattern observed for myelin binding protein (29, 315). Mutations in KCC3 are the cause of a rare neurological illness known as Anderman’s disease, also known as hereditary motor and sensory neuropathy associated with agenesis of the corpus callosum (HMSN/ACC, OMIM 218000). This is an interesting disease because some of Physiol Rev • VOL

the clinical manifestations are due to developmental problems (in neurons), while others are due to neurodegeneration (particularly in white matter). In addition, the clinical picture includes deficiencies of both central and peripheral nervous system, as well as in cognitive activity. KCC3 central role in CNS development and function has been corroborated by reproduction of most of the neurological problems seen in Anderman’s disease in a KCC3 knockout mice model (42, 183). Mice homozygous for disruption of KCC3 were found to exhibit severe locomotor deficit, peripheral neuropathy, and sensorimotor gating deficit. Mice did not have agenesis or dysgenesis of the corpus callosum. Although these findings collectively reveal critical roles for KCC3 in development and maintenance of nervous system, it remains unknown how loss of KCC3-mediated K⫹-Cl⫺ cotransport causes various features of HMSN/ACC, and why absence of KCC3 cannot be compensated by other KCCs also present in neurons. Reduction in cell growth or cell volume regulation observed in KCC3-null mice neurons (42) could be implicated in progressive neurodegeneration. In addition to BSC2/NKCC1 (see above) and KCC4 (see below), KCC3 have an important role in development and function of inner ear (42). In normal conditions, KCC3 is expressed in supporting cells of inner and outer hair cells, in epithelial cells of the organ of Corti, and in type I and III fibrocytes of stria vascularis. In contrast to

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

observations on BSC2/NKCC1 (79) and KCC4 (41) knockout mice, deafness in KCC3 is not present at birth and develops during the first year of life, associated with the degenerative process of the cochlea. Arterial pressure is elevated in KCC3 knockout mice (42). This variable was not assessed in knockout animals from Howard et al. (183) and does not appears to be a major clinical problem in patients with HMSN/ACC (96); however, the average age of death in Anderman’s patients is 24 years, which could be an early stage for hypertension to be present. Boettger et al. (42) by means of chronic implanted catheters observed that arterial pressure in wild-type mice at 3–5 mo of age was 100 ⫾ 2 mmHg, whereas in KCC3 knockout mice it was 118 ⫾ 2 mmHg (P ⬍ 0.01). The mechanism is not known but could be related to expression and activity of KCC3 in vascular smooth muscle cells (178) or kidney (42, 293). In this regard, interesting studies have been produced revealing a role of nitric oxide and vasodilators in regulating KCC3 activity in vascular smooth muscle cells. First, it was observed in low potassium (LK) sheep red blood cells that activity of K⫹-Cl⫺ cotransporter was increased by nitric oxide (3). Because nitric oxide is a potent vasodilator, investigators hypothesized that activation of KCCs in vascular smooth muscle by nitric oxide could be implicated in vasodilation. Thus Adragna et al. (4) assessed the effect of several vasodilatory drugs such as hydralazine, sodium nitroprusside, isosorbide mononitrate, and pentaerythritol on K⫹-Cl⫺ cotransporter activity in LK red blood cells and vascular smooth muscle cells in primary cultures. All vasodilators activated K⫹-Cl⫺ cotransporter in both types of cells, and a specific inhibitor of protein kinase GKT5823 abolished the increase in K⫹-Cl⫺ cotransporter activity induced by sodium nitroprusside. In addition, inhibition of K⫹-Cl⫺ cotransporter decreased vasodilatory response magnitude to hydralazine; thus it was suggested that the K⫹-Cl⫺ cotransporter was activated by nitric oxide through a cGMP pathway and that this activation was involved in response to vasodilators. Molecular analysis of vascular smooth muscle cells revealed that among K⫹-Cl⫺ cotransporters, KCC1 and KCC3 are expressed, whereas KCC2 and KCC4 are not present. KCC1 abundance is higher than KCC3 by a 2:1 relation (87). mRNA expression of both cotransporters was analyzed under experimental conditions designed to activate protein kinase G (PKG). With the use of semiquantitative PCR strategy, it was observed that KCC3 mRNA expression was upregulated by the cell membranepermeable 8-bromo-cGMP. This effect was abrogated by the PKG inhibitor KT5823, indicating that activation of PKG is involved and was not affected by concomitant incubation with actinomycin D, suggesting that increased transcription of the SLC12A6 gene is not involved (87). Similar observations were obtained for KCC1 mRNA (84). In this study it was observed that the nitric oxide donor Physiol Rev • VOL

469

sodium nitroprusside and the nitric oxide-independent soluble guanylyl cyclase activator YC-1 induced upregulation of KCC1 mRNA expression. The soluble guanylyl cyclase inhibitor LY83583 abrogates positive effects of both sodium nitroprusside and YC-1, indicating that activation of guanylyl cyclase is involved. In addition, 8-bromo-cGMP also increased KCC1 mRNA expression by a mechanism that was partially abrogated by KT5823. Thus mRNA expression of both KCC1 and KCC3 is enhanced by activating the nitric oxide/cGMP pathway. A further study in primary cultures of rat vascular smooth muscle cells revealed that fast nitric oxide releasers NONOates such as NOC-5 and NOC-9, but not the slow releaser NOC-18, are able to upregulate KCC1 and KCC3 mRNA levels. NOC-5 and NOC-9 effects were prevented by the soluble guanylyl cyclase inhibitor LY83583, indicating again that activation required the classical pathway of nitric oxide-soluble guanylyl cyclase-cGMP-PKG (86). Finally, the most recent work related to this issue revealed that sodium nitroprusside, YC-1, and 8-bromo-cGMP increased mRNA levels of both KCC3a and KCC3b isoforms, with more apparent effect in KCC3b (85). All these data showing that powerful vasodilators induce activation of KCC3 cotransporter suggest that KCC3 activity could be associated with vasodilatation. If this turns out to be true, then derangement in KCC3 activity could be associated with decreased vasorelaxation, thus increasing peripheral vascular resistance. For this reason, the development of high blood pressure in KCC3-null mice (42) is an important observation that supports a role of KCC3 in arterial pressure regulation. G. Kⴙ-Clⴚ Cotransporter 4 KCC4 is the K⫹-Cl⫺ cotransporter isoform for which less information is available regarding its role in global physiology. This isoform was identified by Mount et al. (292), and its tissue distribution is basically ubiquitous, although in certain tissues expression is less apparent than that of KCC1. Northern blot analysis of KCC4 in nervous tissues suggested that no transcripts are present in the CNS; however, recent studies using RT-PCR and Western blot using specific antibodies have shown that KCC4 is present in both the central and peripheral nervous system, with higher expression in peripheral nerves (trigeminal, sciatic) and spinal cord than in whole brain (29, 204). Within the brain, expression of KCC4 is higher in the brain stem, followed by midbrain, with minimal to nonexpression in cerebral cortex and hippocampus. Thus there is a gradient of KCC4 expression in the nervous system that goes forebrain ⬍ midbrain ⬍ spinal cord ⬍ peripheral nerves. In addition, evidence was shown by Karadsheh et al. (204) that KCC4 is present not only in neurons, but also in oligodendrocytes and in the apical membrane of choroid plexus epithelial cells, suggesting a

85 • APRIL 2005 •

www.prv.org

470

GERARDO GAMBA

role for this K⫹-Cl⫺ cotransporter isoform in K⫹ reabsorption. Finally, KCC4 expression is downregulated after birth (243). Specific role of KCC4 in CNS physiology has not been elucidated. KCC4 knockout animals were normal at birth and exhibit no apparent malfunction of the nervous system. At an early age (14 days), hearing in KCC4-null mice is normal; however, it quickly deteriorates over the next 10 days, at the end of which the mice are completely deaf (41). This is associated with total loss of outer hair cells of basal cochlea by 21 days of age. Because immunohistochemical analysis of wild-type mice demonstrated that within the inner ear KCC4 is expressed in Deiters’ cells, which have been suggested to transport K⫹ from outer hair cells (and thus endolymph) to adjacent epithelial cells, thus recycling K⫹ via stria vascularis, it was postulated that absence of K⫹ transport in Deiters’ cells results in reduction of K⫹ absorption by outer hair cells and thus accumulation in endolymph. KCC4 plays an interesting role in acid-base metabolism. KCC4-null mice develop renal tubular acidosis. Urinary pH in knockout mice was observed to be significantly higher than in wild-type animals (7.3 ⫾ 0.1 vs. 6.4 ⫾ 0.1, P ⬍ 0.01) and thus null animals develop compensated metabolic acidosis (41). Intrarenal distribution analysis of KCC4 by means of polyclonal antibodies revealed abundant expression in basolateral membrane of several nephron segments, including proximal tubule, DCT, and CD. In this later part of the nephron, expression is heavy in ␣-intercalated cells that are in charge of proton secretion (41, 293, 414). Thus it has been postulated that KCC4 activity in intercalated cells could be required for basolateral Cl⫺ extraction, which in turn is necessary to keep the AE1 Cl⫺/HCO3⫺ exchanger fully active. In this regard, Boettger et al. (41) demonstrated high intracellular Cl⫺ concentration in KCC4 knockout mice ␣-intercalated cells. In addition, as previously discussed in section IIIG, K⫹-Cl⫺ cotransporters are able to transport ammonium instead of K⫹. Finally, expression of KCC4 in basolateral membrane of TALH could account for the proposed basolateral K⫹-Cl⫺ cotransport activity described by Greger et al. (155). Although KCC4 is expressed in many other tissues, physiological roles for its presence have not been reported. VI. PATHOPHYSIOLOGICAL ROLES Given the multiple physiological roles for electroneutral cation-coupled chloride cotransporters in the kidney, CNS, and other organs, it was expected that variations in function and/or expression of these genes played a role in human pathophysiology. To date, inactivating mutations of three members in this family have been shown to be linked with development of inherited conditions such as Physiol Rev • VOL

Gitelman’s, Bartter’s, and Anderman’s diseases. In addition, changes in functional regulation of TSC in Gordon’s disease have been suggested to be a key mechanism in the pathophysiology of this inherited disease in which genetic primary defect occurs in other genes. Finally, the known physiological role of cotransporters, together with their involvement in inherited diseases and observations performed in knockout mice with targeted disruption of each electroneutral cotransporter, indicate that members of this family are also potentially involved in some of the most important polygenic diseases, such as hypertension, epilepsy, cancer, and osteoporosis. In this section, we review each of the inherited diseases due to primary defects in members of cation-coupled chloride cotransporters and the evidence for their involvement in polygenic diseases. A. Gitelman’s Disease In 1966, Gitelman, Graham, and Welt (145) reported the metabolic study of three patients seen at the North Carolina Memorial Hospital (United States) featuring a syndrome characterized by hypokalemia, hypomagnesemia, and metabolic alkalosis who exhibited clear renal impairment for conservation of potassium and magnesium. Patients were not hypertensive and had normal urinary excretion of aldosterone, excluding primary aldosteronism. Two of the three patients were sisters, and their parents were distantly related through a common male ancestor. Since then, this rare inherited condition is known as Gitelman’s disease and features an autosomal recessive pattern of inheritance. The majority of affected patients began with the clinical picture in the second or third decade of life, clinically evidenced by hypokalemic metabolic alkalosis, accompanied with arterial hypotension, hypocalciuria, and hypomagnesemia. The clinical picture resembles that observed in patients intoxicated with thiazide-type diuretics and is similar to that present in Bartter’s disease; thus these two conditions are the major differential diagnosis. In 1992, Bettinelli et al. (34) studied a cohort of 34 pediatric patients with inherited hypokalemic metabolic alkalosis among whom Bartter’s disease was present in 18 and Gitelman’s disease was present in 16. Because children with Bartter’s disease exhibited hypercalciuria, while those with Gitelman’s disease exhibited hypocalciuria, the investigators concluded that both diseases are easily distinguishable on the basis of urinary calcium excretion. Due to resemblance of Gitelman’s disease with clinical and metabolic picture of chronic thiazide-type diuretic intoxication, TSC became a strong candidate for the cause of the disease. Thus, after molecular identification of TSC from fish and mammalian sources (136, 137), complete linkage between Gitelman’s disease and the

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

locus for TSC in human chromosome 16 was observed by several groups (242, 264, 329, 377). This information strongly suggested that inactivating mutations of SLC12A3 were the causative agent of Gitelman’s disease. Later, a phenotype resembling Gitelman’s disease was obtained in mice by targeted disruption of TSC gene (363), and heterologous expression in X. laevis oocytes of mouse or human TSC cRNA containing some point mutations reported in Gitleman’s kindreds revealed that mutant TSC proteins are nonfunctional (72, 221). Thus it is currently accepted that Gitelman’s disease is due to inactivating mutations of TSC. At present, ⬃65 independent kindreds with Gitelman’s disease have been studied, and the majority of reported mutations have been deposited in the Human Gene Mutation Database at the Institute of Medical Genetics in Cardiff, United Kingdom (http://archive.uwcm. ac.uk/uwcm/mg/hgmd0.html). There are ⬃100 different mutations spread throughout the SLC12A3 gene, from the

471

amino- to the carboxy-terminal domain of TSC, without preference for a particular location along the protein (55, 64, 67, 241, 245, 259, 264, 271, 281, 307, 339, 377, 395, 396, 398, 442, 449). Figure 21 illustrates the proposed TSC secondary structure and location of the majority of reported mutations. Up to 77% result from nucleotide substitutions producing missense or nonsense mutations or frame shifts that terminate in truncated proteins. In general, these substitutions occur in amino acid residues that are conserved among TSC from human, rat, mouse, rabbit, and flounder. Small deletions are responsible for 10.4% of mutations, whereas nucleotide substitutions affecting either donor or acceptor splice sites are responsible for 7.2%. The remainder is due to micro-lesions, such as small insertions or indels. Gitelman’s disease is an autosomal recessive disorder. Thus one would expect that the majority of patients would exhibit homozygous mutations inherited from both parents; however, this occurs only in 18% of cases. There

⫹ ⫺ FIG. 21. Mutations in human thiazide-sensitive Na -Cl cotransporter TSC reported in patients with Gitelman’s disease. Each circle represents one amino acid residue. All circles in red represent mutations. Mutations numbered 1–9 are the following: 1, W174; 2, S178L; 3, Y180K; 4, R261H; 5, P349L; 6, A464T; 7, F536L; 8, L542P; and 9, A569V. There is a blue circle every 25 residues. Every 100 residues are numbered. The black circle in transmembrane segment 4 depicts the position of a single nucleotide polymorphism G264A.

Physiol Rev • VOL

85 • APRIL 2005 •

www.prv.org

472

GERARDO GAMBA

is great variability in the mutation pattern in each kindred. In a review of all mutations reported up to 2002, Reissinger et al. (339) showed that ⬃45% of all patients are compound heterozygous, that is, inherited mutations from the father and the mother are different. That compound heterozygosis is the most common form of the disease is shown in most reports containing more than one kindred (for examples, see Refs. 67, 241, 245, 259, 377, 395). Surprisingly, the second most common finding is heterozygous patients, that is, when the mutation was found only in one allele and occurred in up to 30% of kindreds. Because inheritance of Gitelman’s disease is clearly recessive and heterozygous relatives of patients with Gitelman’s disease are clinically and metabolically asymptomatic, it is likely that there was a failure to detect the mutation in the other allele in heterozygous patients. The most common approach for study of mutations in the SLC12A3 gene has been the single-strand conformation polymorphism (SSCP) known to have limitations in resolution power. In addition, only exon and exon-boundary mutations have been studied; thus mutations in promoter regions, within regulatory elements at both 5⬘- and 3⬘UTRs, within poly(A) signal sequence and within introns have not been excluded. Only ⬃18% of patients exhibit the classical homozygous pattern in which the same mutation was inherited from both parents. Finally, in 7% of patients, three or more mutations occur. Only one study, in 20 patients from 12 different European families who were of Gypsy origin, revealed the same mutation in all patients (64). All these patients were homozygous for a substitution of G for T in the first position of intron 9, affecting consensus donor splice site motif and resulting in a nonsense protein. Identical mutation in Gypsy families from distinct European regions suggests an ancient mutation originating from a common ancestor. As shown in Figure 22, there are at least five potential

mechanisms by which mutations reduce or abolish transporter activity. A mutation could 1) impair protein synthesis, 2) impair protein processing, 3) impair insertion of an otherwise functional protein into plasma membrane, 4) impair functional properties of the cotransporter, and 5) accelerate protein removal or degradation. Although not studied, it is highly likely that mutations that introduce stop codons or produce frame shifts and those in which splicing is abolished resulting in nonsense proteins belong to group 1 (Fig. 22), in which synthesis of the complete protein is impaired (375, 395, 408). Using heterologous expression system in X. laevis oocytes, Kunchaparty et al. (221) analyzed functional consequences of several missense mutations reported along TSC protein in kindreds with Gitelman’s disease; they observed that proteins were synthesized but were not properly glycosylated and not expressed at the plasma membrane. These results indicated that the majority of Gitelman’s missense mutations pertain to the second possibility (Fig. 22) because they impair cotransporter function by interfering with protein processing. These conclusions are supported by results from Hoover et al. (181) indicating that glycosylation of TSC is required for proper folding and trafficking of cotransporter to plasma membrane. Later, functional properties and surface expression analysis performed by De Jong et al. (72) and Sabath et al. (352) revealed that Gitelman’s missense mutations resulting in partial functional proteins belong to the third possibility in Figure 22, in which missense mutation results in a cotransporter with apparently normal processing and normal functional and kinetic properties, but in which insertion into plasma membrane is partially impaired. Interestingly, as reviewed later, missense mutations of other members of the electroneutral cotransporter family, such as the Na⫹-K⫹-2Cl⫺ cotransporter in type I Bartter’s disease (384) and the KCC3 K⫹-Cl⫺ cotransporter in Anderman’s disease (183),

2) Defects in protein processing Bartter (384), Gitelman (72,221)

1) No protein synthesis Bartter (374,408), Gitelman (376)

3 1

3) Impaired protein insertion Gitelman (72,352)

2 4 5

5) Accelerate protein removal

4) Impaired functional properties Bartter syndrome-BSC1 (384) Anderman syndrome-KCC3 (184) Physiol Rev • VOL

85 • APRIL 2005 •

www.prv.org

FIG. 22. Molecular mechanisms explaining decreased activity of electroneutral cotransporters in inherited syndromes. [Modified from Sabath et al. (352).]

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

behave as the fourth possibility in Figure 22, because mutated proteins are normally produced and inserted into plasma membrane, implying a defect in functional properties or intrinsic activity of the cotransporter. Careful clinical study of several unrelated patients with Gitelman’s disease allowed Cruz et al. (67) to obtain an interesting record of clinical and metabolic consequences of diminished TSC activity in humans. Matched comparison of 50 unrelated patients with normal subjects revealed that although Gitelman’s disease is not clinically apparent until the third decade of life (age of diagnosis in this cohort was 28.3 ⫾ 2.1 yr), patients exhibited a significantly reduced quality of life due to the presence of several unspecific symptoms such as salt craving, thirst, dizziness, fatigue, muscle weakness, cramps, paresthesias, nocturia, polydipsia, and polyuria. As a consequence, patients with Gitleman’s disease have significantly lower scores in terms of limitations caused by physical health, emotions, energy level, and general health perception. Cruz et al. (68) also performed an analysis of a large family of 199 members, of whom 26 were patients with Gitelman’s disease (both alleles affected), 113 were heterozygous (one allele affected), and 60 were normal subjects. Of the 26 affected patients, 17 were homozygous for deletion of exons 1–7 and 9 patients were compound heterozygous, exhibiting one allele with exon 1–7 deletion and another allele with a missense mutation Gly642Ala in the carboxy-terminal domain. As expected, patients with Gitelman’s disease exhibit a significantly lower blood pressure. Interestingly, however, as shown in Figure 23, although blood pressure in heterozygous subjects was normal, 24-h sodium urine excretion was significantly higher, suggesting that heterozygous subjects have selfselected a higher sodium intake sufficient to compensate for a mild salt-wasting disorder, including low blood pressure. Thus one of the most important roles of TSC is participation as one of the gene products defining the normal blood pressure.

473

B. Bartter’s Disease Bartter’s disease was originally described in 1962 by Bartter et al. (23) as a salt-losing nephropathy accompanied by polyuria, hypokalemic metabolic alkalosis, and hypertrophy of the juxtaglomerular complex. It is now known that Bartter’s disease represents a group of autosomal-recessive disorders with common underlying pathophysiology due to absence or severe reduction in TALH ability for salt reabsorption. The majority of patients with this disease are seen in consanguineous families. This is a more severe nephropathy than Gitelman’s disease, because the clinical picture is usually apparent in the first year of life or even in antenatal period as excessive accumulation of amniotic fluid (polyhydramnios). The characteristic clinical picture includes a salt-wasting state with low blood pressure, metabolic alkalosis with hypokalemia, hypereninemia, and secondary aldosteronism (366). The majority of patients also exhibit hypercalciuria and some develop nephrocalcinosis. Elevated levels of prostaglandin E2 in blood and urine are common, particularly in patients with antenatal disease, and it is known that treatment with cyclooxygenase inhibitors such as indomethacin improves child development and facilitates salt and water-loss management. The fact that clinical and biochemical response to indomethacin and the specific cyclooxygenase-2 inhibitor Refecoxib are similar strongly supports that increased prostaglandin E2 is due to chronic activation of cyclooxygenase-2 activity in the macula densa (338). Bartter’s disease is a monogenic, but nevertheless heterogeneous, disease in which at least five different genes in the TALH are implicated. Three are directly involved in salt reabsorption, and two genes regulate salt transporters. Thus Bartter’s disease is classified into five types: the first four are due to inactivating mutations, whereas type V is the result of activating mutations. Although five different genes have been associated with

FIG. 23. Relationship between age- and sex-adjusted diastolic blood pressure (left) and urinary sodium excretion (right) in a large family with Gitelman’s disease including 26 patients with Gitelman’s disease (⫺/⫺), 113 heterozygous subjects (⫺/⫹), and 60 normal subjects (⫹/⫹). *Groups ⫺/⫹ and ⫹/⫹ are different from ⫺/⫺ group (P ⫽ 0.002). **Groups ⫺/⫺ and ⫺/⫹ are different from ⫹/⫹ group (P ⫽ 0.06). [Modified from Cruz et al. (68).]

Physiol Rev • VOL

85 • APRIL 2005 •

www.prv.org

474

GERARDO GAMBA

Bartter’s disease, not all kindreds have been shown as linked with the chromosomal regions in which these genes are located; that is, there remain kindreds in which the disease gene has not been found, indicating that there should be at least a sixth gene implicated in production of this monogenic disease. As shown in Figure 18B and discussed in section VB, three transport proteins are required for proper salt reabsorption in the TALH: the apical bumetanide-sensitive Na⫹-K⫹-2Cl⫺ cotransporter BSC1/NKCC2, the apical inward rectifying K⫹ channel ROMK, and the basolateral chloride channel CLC-KB. Inactivation of any of these transport proteins results in severe blockade of salt reabsorption in TALH and thus constitutes the first three types of Bartter’s diseases. Type I is due to inactivating mutations in BSC1/NKCC2 (35, 224, 318, 375, 408) because absence of a functional Na⫹-K⫹-2Cl⫺ cotransporter in apical membrane prevents salt transport in the TALH. Bartter syndrome type II is due to inactivating mutations in ROMK (83, 207, 376, 419). When apical K⫹ channels are not functional, absence of K⫹ recycling quickly depletes the luminal fluid of K⫹; hence, Na⫹-K⫹-2Cl⫺ cotransporter activity is prevented. Consistent with these two gene defects, mice knockout models of types I and II Bartter’s diseases have been produced by targeted disruption of BSC1/NKCC2 (397) and ROMK (249), respectively. Both models exhibit a salt-wasting syndrome with polyuria and progressive renal failure, with a high mortality rate in the first week of life (⬎95%). Bartter’s disease type III is the result of an inactivating mutation in CLC-KB (218, 373). Absence of an efficient chloride-extrusion mechanism in TALH prevents chloride efflux, with a consequent increase in intracellular chloride concentration that in turn reduces activity of both the Na⫹-K⫹-2Cl⫺ cotransporter and K⫹ channels. Bartter’s disease type IV is the result of inactivating mutations in a protein known as Barttin (BSND) (39). BSND is a regulatory subunit of chloride channels CLC-KA and CLC-KB (113) that is not required for channel activity itself, but that is necessary to drive chloride channels CLC-KA and CLC-KB to plasma membrane (421). Thus absence in CLC-KB activity is a consequence of inactivation of BSND. Children with Bartter’s disease type IV due to mutations in BSND also exhibit sensorineural deafness. The reason is that BSND is not only a subunit of CLC-KB, but also of CLC-KA, which is heavily expressed in the basolateral membrane of marginal cells of stria vascularis of the cochlea and dark cells localized at the base of crista ampullaris of vestibular organ (39). Here, CLC-KA, and thus BSND, is required for extrusion of intracellular chloride. In the absence of this efflux mechanism, accumulation of chloride within cells prevents the activity of the basolateral Na⫹-K⫹-2Cl⫺ cotransporter BSC2/NKCC1,

Physiol Rev • VOL

with the consequent depletion of intracellular K⫹, thus decreasing the driving force for K⫹ secretion into cochlear duct. Reduction in K⫹ concentration of endolymph in the cochlear duct is associated with deafness. Another possible mechanism for developing Bartter’s disease with sensorineural deafness is by inheriting inactivating mutations in both CLC-KA and CLC-KB (358), producing a type IV-like disease. Finally, two reports have shown that gain-of-function mutations in calcium-sensing receptor also produce a Bartter’s-like disease, now known as Bartter’s disease type V (409, 429). The calcium-sensing receptor is heavily expressed in the basolateral membrane of TALH (343, 344), and its activation by extracellular calcium reduces apical BSC1/NKCC2 and ROMK proteins activity (342). In other words, by activating the calcium-sensing receptor, extracellular calcium produces a furosemide-like effect in TALH. Mutations L125P, C131W, and A845E (409, 429) produce a shift to the left in calcium EC50, maintaining the calcium-sensing receptor fully activated at low calcium levels, thus behaving as activating mutations. Figure 24 depicts a panel with the proposed secondary structure of each protein responsible for Bartter’s disease types I-IV and the locations of missense mutations that have been deposited in the Human Gene Mutation Database at the Institute of Medical Genetics in Cardiff, United Kingdom (http://archive.uwcm.ac.uk/uwcm/mg/ hgmd0.html). With the exception of Barttin, mutations are distributed along BSC1/NKCC2, ROMK, or CLC-KB without preference within the protein. There are only five studies reporting mutations in Bartter’s type I patients (132, 224, 375, 384, 408). Figure 24 depicts all mutations described along the SLC12A1 gene. Missense mutations include G193R, R199G, G224D, G243E, A267S, V272F, R302Q, G319R, C436Y, del245Y, G478A, S507P, A508T, A510D, del526N, A555T, T625X, D648N, and Y998X. In addition, five different small deletions producing frame shifts, and thus truncated proteins, have been reported. Mutations in BSC1/NKCC2 are distributed through the cotransporter. In contrast to what is observed in Gitelman’s disease, in which compound heterozygosity is the most common genomic finding, 50% of patients with type I Bartter’s disease are homozygous for one mutation, 15% are compound heterozygous, and in 35% only a heterozygous mutation was observed. The most common defects are missense mutations, followed by truncated proteins due to either frame shifts or generation of stop codons. Functional expression analysis of BSC1/NKCC2 mutants G193R, A267S, G319R, A508T, del526N, and Y998X by Starremans et al. (384) revealed that the molecular mechanism of disease in these mutants is different from what has been observed in the Gitelman’s mutations discussed previously (see Fig. 22). Expression levels in X. laevis oocytes of BSC1/NKCC2 harboring these mutations were

85 • APRIL 2005 •

www.prv.org

475

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

FIG. 24. Inactivating mutations in four membrane proteins causing Bartter’s disease. Protein proposed topology and mutations are shown for Na⫹-K⫹-2Cl⫺ cotransporter BSC1/NKCC2 (132, 224, 375, 384, 408), K⫹ channel ROMK (194, 207, 362, 376, 383, 419), Cl⫺ channel CLC-CK (218, 373), and barttin (39), as stated. Mutations in this figure are those that have been deposited into Human Gene Mutation Database at Cardiff and reported in corresponding articles.

significantly lower than wild-type. The first three were properly glycosylated, whereas the latter three were not further processed; nevertheless, all these mutations were correctly routed to the plasma membrane, suggesting that studied mutations probably result from the fourth possibility in Figure 22, in which proteins are normally pro-

TABLE

cessed but exhibit a dramatic decrease in intrinsic cotransporter activity. Finally, as seen in Table 11, there are similarities and differences in clinical features of patients with Bartter’s disease, according to the gene causing the disease; thus there is a clinical-molecular correlation. All patients

11. Clinical features of patients with Bartter’s disease according to genomic classification in type I to IV

Affected gene Hypokalemia Metabolic alkalosis Age of onset Poliuria Nephrocalcinosis Polyhydramnios Sensorineural deafness End-stage renal disease

Type I

Type II

Type III

Type IV

SLC12A1 Severe Moderate Neonatal Yes Yes Yes Rare No

KCNJ1/ROMK Severe Moderate Neonatal Yes Yes Yes Rare No

C1CNKB Moderate Mild First decade Uncommon No No No No

BSND Severe Moderate Neonatal Yes Yes Yes Yes Yes

Physiol Rev • VOL

85 • APRIL 2005 •

www.prv.org

476

GERARDO GAMBA

present with hypokalemia and metabolic alkalosis, which are less severe in type III patients. Antenatal presentation and polyhydramnios are more often seen in Bartter’s type I, II, and IV, than in type III disease. In addition, patients with type III disease do not develop nephrocalcinosis. Type IV is associated with deafness and with development of chronic renal failure (168, 270). Therefore, age of clinical presentation and certain features such as nephrocalcinosis, deafness, and chronic renal failure help the clinician to orientate the molecular analysis to find out the diseased gene. C. Anderman’s Disease In 1972, Andermann and colleagues (96) reported an inherited disease described in patients with agenesis of corpus callosum with anterior horn cell disease. The majority of their patients showed clear evidence of central and peripheral neurologic disease with mental retardation, areflexia, and paraplegia (96). This complex disease is better known as hereditary motor and sensory neuropathy associated with agenesis of corpus callosum (HMSN/ ACC, OMIM 218000). It is a severe sensorimotor neuropathy transmitted in autosomal-recessive fashion and is found at high frequency in the French-Canadian population of Quebec, Canada in two northeastern regions of the country known as Saguenay-Lac-St-Jean region and Charlevoix County (183), due to a French founder effect. Patients with this defect exhibit clinical features of both developmental and neurodegenerative problems that involve both central and peripheral nervous system. An extensive study of 64 patients (266) revealed that in addition to several neurologic features such as pthosis, upper-gaze palsy, facial asymmetry, areflexia, and scoliosis, the majority of patients usually have some degree of mental retardation that ranges from mild to severe. Psychotic episodes are not uncommon; thus cognitive function is also affected. Radiologic examination shows no evidence of agenesis of the corpus callosum in 33% of cases, partial agenesis in 9%, and complete agenesis in 58%. It was first established by fine mapping that the gene responsible for HMNS/ACC was located in chromosome 15q (182); later within this region the SLC12A6 gene encoding K⫹-Cl⫺ cotransporter KCC3 was found to be linked with this syndrome (183). By SSCP, all 81 FrenchCanadian patients studied by Howard et al. (183) were homozygous for a guanidine deletion at exon 18 in nucleotide 2436 (delG2436). This deletion converts a GT-splice donor into TA, resulting in a splicing defect, thus generating a frame shift that produces a truncated protein at amino acid residue 813; the last 338 residues are removed. This truncation occurs in KCC3 ⬃94 residues after TM12. There is only one patient reported as compound heterozygous, with one allele having the typical delG2436 and the Physiol Rev • VOL

other allele, with a cytosine and thymine deleted, together with guanidine insertion in exon 11, resulting also in a truncated protein (183). The G2436 deletion results in a protein normally processed, glycosylated, and inserted into plasma membrane, but it is not functional, suggesting that absence of most of the KCC3 carboxy-terminal domain is not necessary for processing or trafficking of the cotransporter, but it is required to endow KCC3 with K⫹-Cl⫺ cotransporter capacity. Thus delG2436 mutation probably results in the fourth possibility in Figure 22, in which proteins are normally processed but exhibit a dramatic decrease in intrinsic cotransporter activity. Mutations in SLC12A6 in patients from other countries with a clinical picture similar to that of HMSN/ACC have also been found. Two children from Verona, Italy, are homozygous for a mutation in exon 15 in which arginine-675 is replaced by a stop codon (R675X), truncating the protein just after the beginning of the carboxy-terminal domain, while two boys from Turkey exhibit a nonsense mutation in exon 22, truncating the protein at residue 1011 (R1011X) (81, 96, 183). Thus, in contrast to that observed in Gitelman’s disease, in which ⬎100 mutations in TSC have been observed without preferences along the protein, nearly all studied patients with Anderman’s disease share the same deletion-mutation in nucleotide 2436 due to a clear founder effect or to the fact that they inherited another mutation that also truncates the protein in the carboxy-terminal domain. Supporting genetic association between SLC12A6 and HMSN/ACC as discussed previously, Howard et al. (183) also showed that mice homozygous for a deletion of exon 3 within the SLC12A6 gene developed severe locomotor deficit, peripheral neuropathy, and sensorimotor gating deficit; similar observations were obtained by Boettger et al. (42) also by deleting exon 3. Mice did not exhibit partial or complete agenesis of corpus callosum. It is known, however, that this is a variable feature in human disease, even within the same kindred. Interestingly, prepulse inhibition (PPI), a measure of sensorimotor gating, was defective in KCC3-null mice and reduced in heterozygous mice, suggesting a gene-dosage effect. This defect has potential relevance with regard to psychotic episodes often seen in HMSN/ACC patients. D. Gordon’s Disease A syndrome of salt-dependent hypertension with hyperkalemia and hyperchloremic metabolic acidosis accompanied by suppression of the renin angiotensin aldosterone axis was described in 1970 by Gordon et al. (147). The disease was later proposed for being named pseudohypoaldosteronism type II (PHAII) by Schambelan et al. (357), due to its resemblance with pseudohypoladoternism type I. The disease is today known as either PHAII or

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

Gordon’s disease. There are three case reports of this disease reported before 1970 by Paver and Pauline (309), Stokes et al. (386), and Arnold and Healy (16). At present, there are ⬃40 patients reported in 11 families and ⬃17 sporadic cases. Gordon’s disease is an autosomal-dominant illness featuring hypertension with hyperkalemia, despite normal glomerular filtration rate. Decrease in urinary H⫹ excretion produces hyperchloremic metabolic acidosis. Hypertension appears in all patients until adult life if untreated. Thus metabolic abnormalities develop first and hypertension develops later in life. This is the reason why some patients with this disease were reported under the eponymous of Spitzer-Weinstein syndrome (261, 381, 431), because this is the clinical presentation in childhood during which hypertension has not yet developed. After performing a careful metabolic study in a male patient aged 23 years, Schamberlan et al. (357) suggested that the primary abnormality was increase in reabsorptive capacity of distal nephron for chloride. Since that time, this proposal has been known as the chloride-shunt hypothesis. On the other hand, all clinical features are quite sensitive to treatment with low-dose, thiazide-type diuretics (148). Mayan et al. (267) observed in a single kindred that reduction of blood pressure with a small dose of hydrochlorothiazide was ⬃6 –7 times higher than that expected for the essential hypertensive population. In addition, they also observed that in contrast to nonaffected relatives, patients exhibited hypercalciuria and significant decrease in bone mineral density (BMD); thus Gordon’s syndrome is the accurate mirror image of Gitelman’s disease. While the first disease features hypertension, hyperkalemia, hyperchloremic metabolic acidosis, hypercalciuria, and decrease in BMD, all of which can be treated with low-dose thiazide diuretic, the second disease resembles a thiazideintoxication state featuring hypotension, hypokalemia, metabolic alkalosis, and hypocalciuria, with an increase in BMD. Chronic use of thiazide diuretics increases BMD and is useful to prevent osteoporosis (361). Thus it was hypothesized that Gordon’s disease could be due to gainof-function mutations in the SLC12A3 gene encoding TSC, inasmuch as inactivating mutations in this gene produce Gitelman’s disease. However, no significant linkage was found between PHAII and SLC12A3 locus on chromosome 16 (374). Instead, it was observed that families with Gordon’s disease exhibited significant linkage with three different loci along human genome located in chromosomes 1q31– 42 (260), 12p13 (88), and 17p11-q21 (260), indicating that at least three genes are capable of producing the disease. The gene responsible in families linked to chromosome 1 remains a mystery, but in chromosomes 12 and 17, it was found that Gordon’s disease is associated with mutation in two kinases known as WNK1 and WNK4, respectively (433). Physiol Rev • VOL

477

WNKs are a novel group of kinases discovered by Xu et al. (439) during their searching for novel members of the mitogen-activated protein (MAP)/extracellular signalregulated protein kinase (ERK) kinase (MEK) family. A novel 7.2-kb cDNA encoding a serine/threonine kinase of 2,126 amino acid residues was cloned from a rat brain cDNA library. A major characteristic was absence of catalytic lysine that is usually found in subdomain II in all known protein kinases. In WNK1, the residue in this position is a cysteine, and this new kinase was denoted WNK1 [with no lysine (k) kinase]. Three additional members of the family have been identified at the molecular level and denoted WNK2, WNK3, and WNK4 with corresponding genes located in human chromosomes 9, Xp11.22, and 17, respectively (179, 415, 433). Cellular and physiological functions of WNKs are not known, and a serine/threonine phosphorylation motif by these kinases has not been defined. However, the fact that mutations in both kinases are able to produce a saltdependent form of human hypertension has attracted the attention of several groups. It was first shown that WNK1 was ubiquitously expressed in several tissues (433), particularly in those known to be rich in chloride-transporting epithelial cells (56), whereas expression of WNK4 was shown as restricted to distal nephron structures such as DCT and CCD (433). In a more recent study using PCR and Western blot analysis, however, expression of WNK4 was shown to be present also in several other epithelial tissues (198). WNK4 has emerged as what appears to be a multi-regulator of transport proteins in distal nephron. Wilson et al. (434) and Yang et al. (446) demonstrated using the heterologous expression system in X. laevis oocytes that wild-type WNK4 reduces TSC activity, due at least in part to reduction in surface expression of TSC when WNK4 was coinjected. This negative effect of WNK4 on TSC expression was reduced or not observed when mutant WNK4 harboring certain point mutations described in PHAII kindreds were used. In addition, Yang et al. (446) also showed that negative effect of WNK4 on TSC was completely prevented in the presence of wild-type WNK1, suggesting that WNK1 regulates WNK4 activity. Thus it was proposed by both groups that under physiological conditions TSC activity is regulated by WNK4 kinase. When WNK4 is mutated, absence or reduction in its negative regulatory effect renders TSC constitutively active, thus increasing salt reabsorption by DCT. This hypothesis could explain Gordon’s disease as a disease resulting from overactivity of the renal Na⫹-Cl⫺ cotransporter and, hence, the high sensitivity of all clinical findings to small doses of thiazide diuretics. Supporting such a regulatory effect of WNK4 upon TSC, it has been shown that WNK4 also exerts a dominant-negative effect on other chloride-influx mechanisms (198). This hypothesis will require that mutations in WNK4 be of the inactivating type in which WNK4 loses its normal activity

85 • APRIL 2005 •

www.prv.org

478

GERARDO GAMBA

upon TSC. Although this is the rule of autosomal-recessive diseases, in which inactivating mutations in both alleles are required, there are several examples of autosomal-dominant diseases resulting from inactivating mutations only in one allele that nevertheless are sufficient to express the disease. Possible explanations are haploinsufficiency, when absolutely both functional alleles are required to sustain normal protein activity, such as in familial hypercholesterolemia, or dominant-negative effect, when products from both alleles interact to be functional and inactivating mutation of one allele renders the remaining allele also inactive; examples are some types of porphyrias and type I osteogenesis imperfecta (24). The consequence of mutations on WNK4 activity, however, is not clear because WNK4 has also been shown to have a regulatory effect on other transport proteins of distal nephron such as K⫹ channel ROMK (199) and claudins (444), but in both cases mutations behave as gain of function because the dominant-negative effect on ROMK or the phosphorylation effect on claudins is increased when mutant WNK4 are used instead of wild-type kinase. Thus it is possible that WNK4 mutations behave as lossof-function mutations for TSC and gain-of-function mutations when it comes to ROMK channel and claudins. One limitation to understanding WNK4 kinase biochemical properties is that no activity of WNK4 has been obtained in vitro or in HEK-293 cells (425). E. Potential Role in Polygenic Diseases

descendents of hypertensive subjects than in those of normotensive parents, and arterial blood pressure levels exhibit a higher degree of correlation within members of the family than within unrelated members of the same community. Furthermore, blood pressure level correlation is higher between consanguineous than between adopted siblings (185). However, primary hypertension is not a monogenic disease with a dominant or recessive pattern of inheritance. Thus the current paradigm is that hypertension results from a polygenic inherited susceptibility toward environmental factors (i.e., salt consumption) that when exposed properly induces increase in blood pressure levels. Several members of the electroneutral cotransporter gene family are potentially implicated in polygenetic predisposition toward hypertension; the most important one appears to be the SLC12A3 gene. Evidence supporting this statement includes the following: 1) TSC is one of the genes that is clearly a part of the gene pool that working together defines normal blood pressure levels. Inactivating mutations of TSC are the cause of Gitelman’s disease, which among other clinical and metabolic manifestations features arterial hypotension (68), and recent evidence strongly suggests that TSC activity is implicated in the mechanism of arterial hypertension in Gordon’s disease (434, 446). Thus a decrease in TSC activity is associated with hypotension, while an increase in TSC activity accompanies hypertension. As shown in Figure 25, it is noteworthy that both situations are similar in time required to express a change in blood pressures. In this

Known and emerging physiological roles of electroneutral cotransporter family members, their involvement in monogenic diseases, and their locations within certain regions in human genome suggest that electroneutral cation-chloride cotransporters can be potentially implicated in development of complex polygenic diseases, as well as in defining type and magnitude of response to pharmacological treatment. 1. Arterial hypertension High blood pressure is one of the most common diseases in adults living in industrialized cities. Presence of hypertension in the majority of studies is defined as having sustained increase in diastolic blood pressure with values ⬎90 mmHg, usually accompanied with systolic blood pressure levels ⬎140 mmHg. Several studies in different countries have shown that prevalence of hypertension in adult population is ⬎20%. People with increased blood pressure levels are at higher risk for developing acute myocardial infraction, stroke, chronic renal failure, and congestive cardiac failure. The cause of primary arterial hypertension is not known, but it is clear that hypertension is a disease with an important genetic component, because hypertension is more common in Physiol Rev • VOL

FIG. 25. Gene defects in TSC or WNK kinases and development of changes in blood pressure levels. Gitelman’s disease is due to inactivating mutations that decrease activity of TSC. Although this is present since birth, patients are usually hypotensive until the second or third decade of life. A similar situation occurs with Gordon’s disease. In this disease, mutations that appear to activate WNK1 and inactivate WNK4 have been proposed to result in increased TSC activity. These defects are also present since birth; however, hypertension is evident until the second or third decade of life. Thus, in two inherited diseases in which mutation of one gene is sufficient to produce increase or decrease in blood pressure levels, it takes several years to reach the abnormal change in blood pressure.

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

regard, both conditions are also similar to primary hypertension, which usually takes longer to be established. That is, although Gitelman’s and Gordon’s diseases are due to gene defects present since birth, decrease or increase in blood pressure, respectively, is not developed until the second or third decade of life, i.e., defective regulation of blood pressure can be compensated by years and/or salt loss/retention is so slow that several years are required to express a change in blood pressure levels. 2) TSC is the protein target of thiazide-type diuretics, which have been recommended for years as the first-line drug in the pharmacological treatment of hypertension (57). 3) Physiological evidence shows that TSC is an important effector in defining natriuresis pressure curve because Majid and Navar (258) showed that TSC is one of the sodium-entry pathways in the distal nephron that is involved in mediating arterial pressure-induced changes in sodium excretion occurring when mean arterial pressure rises ⬎100 mmHg; in addition, Wang et al. (424) revealed that during aldosterone escape TSC is the only nephron transporter that is downregulated, suggesting that decreasing TSC expression is required for increased blood pressure to restore natriuresis despite the continuous presence of a high concentration of aldosterone. Thus pressure-natriuresis is defined at least in part by TSC. Therefore, all these clinical, genomic, pharmacological, and physiological data together strongly suggest that TSC can potentially be implicated in primary hypertension. Other members of the electroneutral cation-chloride cotransporters are also potentially implicated in arterial hypertension. BSC1/NKCC2 causing Bartter’s disease type I is another good candidate because inactivating mutations of SLC12A1 result in arterial hypotension; this effect was reproduced in BSC1/NKCC2 knockout mice (397). Therefore, this cotransporter is also potentially implicated in primary arterial hypertension. Other candidates are BSC2/NKCC1 and KCC3. Numerous studies have suggested that increased activity of several transport proteins, including BSC2/NKCC1 in red blood cells and vascular smooth muscle cells, is associated with arterial hypertension (for an extensive review, see Ref. 303). Apparently there is no genetic disease as a result of inactivating or gain-of-function mutations in SLC12A2 gene; therefore, there is no human disease that helps to reveal the role of BSC2/NKCC1 in regulating blood pressure. In addition, results from knockout mice are conflicting because two different observations have been made. Flagella et al. (123) reported a significant reduction in blood pressure level in BSC2/NKCC1-null mice, whereas this was not observed by Pace et al. (306) (see sect. VC). KCC3 is the K⫹-Cl⫺ cotransporter isoform suggested to play a role in blood pressure regulation and that can be potentially implicated in hypertension. Several studies have shown that regulation of vascular smooth muscle constriction/relaxation by nitric oxide and vasodilators is Physiol Rev • VOL

479

associated with modulation of KCC3 expression (see sect In addition, recent characterization of KCC3-null mice in which blood pressure was assessed in awake animals by using chronic intra-arterial catheters reported that absence of KCC3 activity is associated with hypertension (42).

VF).

2. Epilepsy There are several causes of epilepsy in humans that range from inherited rare disorders to the most common neurologic diseases such as stroke, metabolic encephalopathy, and trauma. In most cases, seizures are accompanied by several other neurologic symptoms and signs. However, the most common presentation of seizures, as a single and isolated neurologic event in humans, is in the form of an idiopathic disease known as epilepsy, which like arterial hypertension, diabetes, and many forms of cancer displays a complex pattern of inheritance; thus it belongs to the so-called polygenic complex diseases. Several candidate regions along human chromosomes have been shown as linked with families expressing several subtypes of idiopathic epilepsy. Two examples are the finding that juvenile myoclonic epilepsy and centrotemporal spikes in families with rolandic epilepsy are linked with a region located in chromosome 15q14 (110, 295). This is exactly the region in which the SLC12A6 gene encoding KCC3 is located. However, a preliminary report found no evidence of mutations in KCC3 in these syndromes, and Dupre et al. (96) reported that seizures are rarely seen in patients with HMSN/ACC. Another cotransporter that is potentially implicated in human epilepsy is KCC2. As discussed in section VE, KCC2 is a key protein implicated in defining intracellular chloride concentration in several neurons. In doing so, KCC2 is critical for defining type and intensity of response to GABA. The greater the activity of KCC2, the lower the intraneuronal chloride; thus when GABA activates its Cl⫺ channel-associated receptor, the large gradient for chloride created by KCC2 will be the driving force facilitating Cl⫺ entry into neurons, thus producing hyperpolarization. Under these circumstances, GABA behaves as an inhibitory stimulus. If KCC2 is not active or absent, then intraneuronal chloride concentration will be above its potential equilibrium, and the result of interaction between GABA and its Cl⫺ channel-associated receptor will be to open a pathway for Cl⫺ efflux, producing depolarization. In this instance, GABA behaves as an excitatory neurotransmitter; thus absence of KCC2 should render certain neurons hyperexcitable. This hypothesis was indeed shown to be true by KCC2 knockout mice studied by Woo et al. (437) in which KCC2 expression was dramatically reduced but still present at ⬃5% of normal. KCC2-null mice presented with marked spasticity and generalized seizures. In addition, although heterozygous mice showed

85 • APRIL 2005 •

www.prv.org

480

GERARDO GAMBA

no particular phenotype, they exhibited high susceptibility for epileptic seizures. Thus, although no Mendelian causes of epilepsy map to locus for human SLC12A5 gene on chromosome 20, it remains a possibility that genetic variability in this gene might affect multiple aspects of human epilepsy (380). 3. Cancer A series of elegant studies performed in cervical cancer cell lines have recently drawn our attention to the potential role that electroneutral cation-chloride cotransporters may have on cell growth regulation as well as proliferation and invasiveness of malignant neoplasias. Cancer cells undergo very fast proliferation with an increased rate of mitosis and metabolism and are capable of adjacent-tissue migration and invasion. All these activities are expected to have profound consequences on cellvolume homeostasis. For these reasons, Shen et al. (367) first analyzed K⫹-Cl⫺ cotransporter activity and expression in normal cervical cells and human cervical-cancer cell lines. They observed that cells from a normal cervix exhibited cell swelling-induced activation of a Cl⫺-dependent Rb⫹ efflux mechanism that was compatible with K⫹-Cl⫺ cotransporter activity. The magnitude of K⫹-Cl⫺ cotransporter activation, however, was significantly higher in cervical cancer cell lines such as SiHA and CasKi than in normal human cervical cells. Moreover, evidence was shown that KCC1, KCC3, and KCC4 mRNA can be detected from cervical cells, but that level of mRNA expression, particularly of KCC3 mRNA, was higher in SiHA and CasKi cells than in normal cervix, indicating that KCC mRNA expression is upregulated in cervical cancer and that process of cervical malignancy is associated with increasing activity of K⫹-Cl⫺ cotransporters. The central role of K⫹-Cl⫺ cotransporter during RVD was suggested by the observation that DIOA prevented RVD in cervical cancer cells. Then, to study cellular and molecular mechanisms of KCC3 regulation and function in neoplastic cells, Shen et al. (369) developed a stable KCC3-transfected, NIH/3T3 7– 4 cell line. KCC3 was chosen for study because, on one hand, it was shown that it is the K⫹-Cl⫺ cotransporter with highest expression in cervical cancer cells (367), and on the other hand, in vascular endothelial cells KCC3 mRNA expression is upregulated by vascular endothelial growth factors (178). They observed that KCC3 transfection enhanced cell growth, an effect that was prevented by DIOA. While 33% of KCC3-transfected cells were shown to be in G2/M phase of cell cycle, only 15% were in this phase after 3 days of treatment with DIOA. This effect of KCC3 was accompanied by phosphorylation/dephosphorylation events in Rb and cdc2 kinases. These are key proteins that regulate progression from G1 to S phase and G2 to M phase, respectively. In KCC3-transfected cells, phosphorylation was increased in Physiol Rev • VOL

Rb but decreased in cdc2, a situation reversed by DIOA. Thus it was concluded that KCC3 plays an important role in cell growth regulation. Finally, in a more recent study, Shen et al. (368) showed that K⫹-Cl⫺ cotransport is indeed an important modulator of cell growth and invasiveness in human cervical cancer cells. First, they showed by immunofluorescence analysis of surgical specimens of cervical cancer using polyclonal antibody raised against human KCC1, which also recognized KCC4, a remarkable overexpression of K⫹-Cl⫺ cotransporter in cancer cells when compared with normal cervix. Then, they developed a cervical cancer cell line that was transfected with the ⌬N117 mutant KCC1, previously shown by Casula et al. (50) to exert a dominant-negative effect on KCC activity. Transfection of a ⌬N117 mutant into neoplastic cells completely abolished cell swelling, NEM, and starurosporine-induced increase in KCC activity in neoplastic cells. In addition, the ⌬N117 mutant also reduced RVD, not only by reducing K⫹-Cl⫺ cotransporter activity, but also by decreasing activity of volume-sensitive organic osmolyte/ anion channel, which leads to chloride and taurine efflux. As shown in Figure 26, these effects of ⌬N117 mutant into KCCs and cell-volume regulation are associated with a significant decrease in cellular growth of cervical cancer cells (368). ⌬N117 mutant transfection into cervical cancer cells also produces a decrease in invasion capacity together with a series of biochemical effects that are in agreement with the observed reduction in growth and invasion, which include, decrease in phosphorylation of Rb and increase in phosphorylation of cdc2, decrease in expression and activity of MMP2 and MMP9, known to be implicated in integrin-induced dissolution of extracellular matrix, and decrease in expression of integrins ␣6␤4 and

FIG. 26. Transfection of cervical cancer cells with KCC mutant ⌬N117 inhibits growth of malignant cells. Cell number was counted every day by means of a hemocytometer. Trypan blue exclusion was used to assess viability that was 100% in all groups along the days. Groups studied were wild-type cells (solid circles), Mock-transfected cells (open circles), and ⌬N117 transfected cells (open triangles). *P ⬍ 0.05 compared with wild-type or Mock transfected groups. [Modified from Shen et al. (368).]

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

␣v␤3, known to play a critical role in cervical cancer invasion. Finally, when SCID mice were inoculated with wild-type or ⌬N117 mutant-transfected cervical cancer cells, it was observed that ⌬N117 mutant significantly reduced the rate of tumor growth. All this information strongly suggests that cell volume regulatory mechanisms can be critical in defining the ability of a malignant tumor to grow and invade neighboring tissues, and that electroneutral cotransporters appear to be implicated in these mechanisms in cancer cells. In addition, it also opens a potential source of new antineoplastic therapies to be explored. 4. Osteoporosis Osteoporosis is another polygenic disease that represents a major health care problem in the industrialized world. It is a systemic disease of the skeleton characterized by reduction in BMD and deterioration of bone microarchitecture, increasing as a consequence the risk of fractures. Due to functional interaction of TSC with calcium-transport mechanisms, TSC is involved in renal calcium absorption, and thiazide-type diuretics are also useful in treatment of kidney stone disease. In addition, a preliminary report strongly suggests the presence of TSC in bone (97). Inactivating mutations of TSC in patients with Gitelman’s disease are associated with high BMD (66), while patients with Gordon’s disease in whom increased activity of TSC appears to be implicated exhibit lower BMD than nonaffected members of the family (267). These findings, together with evidence that hypertensive patients treated with thiazides are at lower risk for osteoporosis (196, 333, 336, 361, 365), underlie the importance of TSC in bone metabolism, making TSC a potential target for development of bone-sparing drugs in the elderly and suggesting that genetic variations of TSC could be implicated in defining risk for developing osteoporosis.

481

phan members are still waiting to be defined. Molecular identification and functional characterization of cotransporter orthologs in several species such as avian, amphibian, fish, bacteria, and plants that will help to understand structure-function-regulation relationships and evolutionary issues are still pending. Our understanding of structure-function relationship is in its very beginning. Amino acid residues or domains critically involved in Na⫹, K⫹, and Cl⫺ translocation, as well as those required for inhibitor binding, are completely unknown. Structural biology of each cotransporter is unknown due to the almost complete impossibility to date to obtain crystals of membrane proteins. Little is known about regulatory properties and pathways of each cotransporter. Physiological roles in several organs for the majority of members in the family need to be defined, as well as their involvement in complex polygenic disease. Thus, although a lot of progress has been made in understanding electroneutral cation-Cl⫺ coupled cotransporters, and we have seen two decades of intense research in this field, it is clear that another 20 years of even more exciting research and discoveries are ahead of us. I thank Drs. Norma A. Bobadilla and Francisco J. AlvarezLeefmans for critical reading of the manuscript and all the members of the Molecular Physiology Unit (past and present) for stimulating work and discussions over the years. I also express my gratitude to Dr. Steven C. Hebert for more than a decade of invaluable help and collaboration. Experimental work performed in the author’s laboratory has been supported by the Mexican Council of Science and Technology, Direccio´n General de Asuntos del Personal Acade´mico of the National University of Mexico, Fundacio´n Miguel Alema´n, the Howard Hughes Medical Institute, National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-36803 and DK-064635, and the Wellcome Trust. Address for reprint requests and other correspondence: G. Gamba, Molecular Physiology Unit, Vasco de Quiroga No. 15, Tlalpan 14000, Mexico City, Mexico (E-mail: [email protected]).

VII. CONCLUSIONS AND PERSPECTIVE REFERENCES Major advances have been made in our understanding of electroneutral cation-Cl⫺ coupled cotransporter family. One decade after molecular identification of the first members of the family, nine genes have been identified, from which seven encode for the cotransporter and two remain orphans. A lot of information has been produced for each gene in several areas including molecular biology, functional properties of the cloned cotransporters as expressed in transfected cells, structure-function relationship studies, physiological roles at both cellular and organ levels, and pathophysiology and involvement in human disease. The majority of data produced since cloning of each cotransporter cDNA in these areas have been reviewed in the present work. There is still a lot of work that needs to be done. Functional properties of two orPhysiol Rev • VOL

1. Abdallah JG, Schrier RW, Edelstein C, Jennings SD, Wyse B, and Ellison DH. Loop diuretic infusion increases thiazide-sensitive Na⫹/Cl⫺ cotransporter abundance: role of aldosterone. J Am Soc Nephrol 12: 1335–1341, 2001. 2. Abuladze N, Yanagawa N, Lee I, Jo OD, Newman D, Hwang J, Uyemura K, Pushkin A, Modlin RL, and Kurtz I. Peripheral blood mononuclear cells express mutated NCCT mRNA in Gitelman’s syndrome: evidence for abnormal thiazide-sensitive NaCl cotransport. J Am Soc Nephrol 9: 819 – 826, 1998. 3. Adragna NC and Lauf PK. Role of nitrite, a nitric oxide derivative, in K-Cl cotransport activation of low-potassium sheep red blood cells. J Membr Biol 166: 157–167, 1998. 4. Adragna NC, White RE, Orlov SN, and Lauf PK. K-Cl cotransport in vascular smooth muscle and erythrocytes: possible implication in vasodilation. Am J Physiol Cell Physiol 278: C381–C390, 2000. 5. Altamirano AA, Breitwieser GE, and Russell JM. Effects of okadaic acid and intracellular Cl⫺ on Na⫹-K⫹-Cl⫺ cotransport. Am J Physiol Cell Physiol 269: C878 –C883, 1995.

85 • APRIL 2005 •

www.prv.org

482

GERARDO GAMBA

6. Alvarez-Leefmans FJ. Intracellular Cl⫺ regulation and synaptic inhibition in vertebrate and invertebrate neurons. In: Chloride Channels and Carriers in Nerve Muscle and Glial Cells, edited by Alvarez-Leefmans FJ and Russell JM. New York: Plenum, 1990, p. 109 –158. 7. Alvarez-Leefmans FJ. Intracellular chloride regulation. In: Cell Physiology Source Book. A Molecular Approach, edited by Sperelakis N. San Diego, CA: Academic, 2001, p. 301–318. 8. Alvarez-Leefmans FJ, Gamin˜o SM, Giraldez F, and Noguero´n I. Intracellular chloride regulation in amphibian dorsal root ganglion neurons studied with nonselective microelectrodes. J Physiol 406: 225–246, 1988. 9. Alvarez-Leefmans FJ, Leon-Olea M, Mendoza-Sotelo J, Alvarez FJ, Anton B, and Garduno R. Immunolocalization of the Na(⫹)-K(⫹)-2Cl(⫺) cotransporter in peripheral nervous tissue of vertebrates. Neuroscience 104: 569 –582, 2001. 10. Alvarez-Leefmans FJ, Nani A, and Ma´rquez S. Chloride transport, osmotic balance and presynaptic inhibition. In: Presynaptic Inhibition and Neural Control, edited by Rudomin P, Romo R, and Mendell LM. New York: Oxford Univ. Press, 1998, p. 50 –79. 11. Alvo M, Calamia J, and Eveloff J. Lack of potassium effect on Na-Cl cotransport in the medullary thick ascending limb. Am J Physiol Renal Fluid Electrolyte Physiol 249: F34 –F39, 1985. 12. Amlal H, Paillard M, and Bichara M. Cl(⫺)-dependent NH⫹ 4 transport mechanisms in medullary thick ascending limb cells. Am J Physiol Cell Physiol 267: C1607–C1615, 1994. 13. Amlal H, Wang Z, and Soleimani M. Potassium depletion downregulates chloride-absorbing transporters in rat kidney. J Clin Invest 101: 1045–1054, 1998. 14. Amorim JB, Bailey MA, Musa-Aziz R, Giebisch G, and Malnic G. Role of luminal anion and pH in distal tubule potassium secretion. Am J Physiol Renal Physiol 284: F381–F388, 2003. 15. Arbuckle MI, Kane S, Porter LM, Seatter MJ, and Gould GW. Structure-function analysis of liver-type (GLUT2) and brain-type (GLUT3) glucose transporters: expression of chimeric transporters in Xenopus oocytes suggests an important role for putative transmembrane helix 7 in determining substrate selectivity. Biochemistry 35: 16519 –16527, 1996. 16. Arnold JE and Healy JK. Hyperkalemia, hypertension and systemic acidosis without renal failure associated with a tubular defect in potassium excretion. Am J Med 47: 461– 472, 1969. 17. Attmane-Elakeb A, Mount DB, Sibella V, Vernimmen C, Hebert SC, and Bichara M. Stimulation by in vivo and in vitro metabolic acidosis of expression of rBSC-1, the Na⫹-K⫹(NH⫹ 4 )2Cl⫺ cotransporter of the rat medullary thick ascending limb. J Biol Chem 273: 33681–33691, 1998. 18. Attmane-Elakeb A, Sibella V, Vernimmen C, Belenfant X, Hebert SC, and Bichara M. Regulation by glucocorticoids of ⫺ expression and activity of rBSC1, the Na⫹-K⫹(NH⫹ 4 )-2Cl cotransporter of medullary thick ascending limb. J Biol Chem 275: 33548 – 33553, 2000. 19. Bachmann S, Bostanjoglo M, Schmitt R, and Ellison DH. Sodium transport-related proteins in the mammalian distal nephron: distribution, ontogeny and functional aspects. Anat Embryol 200: 447– 468, 1999. 20. Bachmann S, Vela´zquez H, Obermuller N, Reily RF, Moser D, and Ellison DH. Expression of the thiazide-sensitive Na-Cl cotransporter by rabbit distal convoluted tubule cells. J Clin Invest 96: 2510 –2514, 1995. 21. Bai Y, Pontoglio M, Hiesberger T, Sinclair AM, and Igarashi P. Regulation of kidney-specific Ksp-cadherin gene promoter by hepatocyte nuclear factor-1beta. Am J Physiol Renal Physiol 283: F839 –F851, 2002. 22. Barry ELR, Gesek FA, Kaplan MR, Hebert SC, and Friedman PA. Expression of the sodium-chloride cotransporter in osteoblastlike cells: effects of thiazide diuretics. Am J Physiol Cell Physiol 272: C109 –C116, 1997. 23. Bartter FC, Pronove P, Gill JR Jr, and MacCardle RC. Hyperplasia of the juxtaglomerular complex with hyperaldosteronism and hypokalemic alkalosis. A new syndrome 1962. J Am Soc Nephrol 9: 516 –528, 1998. 24. Beaudet AL, Scriver CR, Sly WS, and Valle D. Genetics, biochemistry, and molecular basis of variant human phenotypes. In: Physiol Rev • VOL

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

The Metabolic and Molecular Basis of Inherited Disease, edited by Scriver CR, Beaudet AL, Sly WS, and Valle D. New York: McGraw Hill, 2001, p. 3– 45. Beaumont K, Vaughn DA, Casto R, Printz MP, and Fanestil DD. Thiazide diuretic receptors in spontaneously hypertensive rats and 2-kidney 1-clip hypertensive rats. Clin Exp Hypertens A12: 215–226, 1990. Beaumont K, Vaughn DA, and Fanestil DD. Thiazide diuretic receptors in rat kidney: identification with [3H]metolazone. Proc Natl Acad Sci USA 85: 2311–2314, 1988. Beaumont K, Vaughn DA, and Healy DP. Thiazide diuretic receptors: autoradiographic localization in rat kidney with [3H]metolazone. J Pharmacol Exp Ther 250: 414 – 419, 1989. Beaumont K, Vaughn DA, Maciejewski AR, and Fanestil DD. Reversible downregulation of thiazide diuretic receptor by acute renal ischemia. Am J Physiol Renal Fluid Electrolyte Physiol 256: F329 –F334, 1989. Becker M, Nothwang HG, and Friauf E. Differential expression pattern of chloride transporters NCC, NKCC2, KCC1, KCC3, KCC4, and AE3 in the developing rat auditory brainstem. Cell Tissue Res 312: 155–165, 2003. Ben Ari Y, Tseeb V, Raggozzino D, Khazipov R, and Gaiarsa JL. gamma-Aminobutyric acid (GABA): a fast excitatory transmitter which may regulate the development of hippocampal neurones in early postnatal life. Prog Brain Res 102: 261–273, 1994. Bergeron MJ, Gagnon E, Wallendorff B, Lapointe JY, and Isenring P. Ammonium transport and pH regulation by K⫹-Cl⫺ cotransporters. Am J Physiol Renal Physiol 285: F68 –F78, 2003. Bernstein PL, Zawalach W, Bartiss A, Reilly R, Palcso M, and Ellison DH. The thiazide-sensitive Na-Cl cotransporter is expressed in rat endocrine pancreas (Abstract). J Am Soc Nephrol 6: 732, 1995. Besseghir K, Trimble ME, and Stoner L. Action of ADH on isolated medullary thick ascending limb of the Brattleboro rat. Am J Physiol Renal Fluid Electrolyte Physiol 251: F271–F277, 1986. Bettinelli A, Bianchetti MG, Girardin E, Caringella A, Cecconi M, Appiani AC, Pavanello L, Gastaldi R, Isimbaldi C, and Lama G. Use of calcium excretion values to distinguish two forms of primary renal tubular hypokalemic alkalosis: Bartter and Gitelman syndromes. J Pediatr 120: 38 – 43, 1992. Bettinelli A, Ciarmatori S, Cesareo L, Tedeschi S, Ruffa G, Appiani AC, Rosini A, Grumieri G, Mercuri B, Sacco M, Leozappa G, Binda S, Cecconi M, Navone C, Curcio C, Syren ML, and Casari G. Phenotypic variability in Bartter syndrome type I. Pediatr Nephrol 14: 940 –945, 2000. Beutler KT, Masilamani S, Turban S, Nielsen J, Brooks HL, Ageloff S, Fenton RA, Packer RK, and Knepper MA. Long-term regulation of ENaC expression in kidney by angiotensin II. Hypertension 41: 1143–1150, 2003. Bialojan C and Takai A. Inhibitory effect of a marine-sponge toxin, okadaic acid, on protein phosphatases. Specificity and kinetics. Biochem J 256: 283–290, 1988. Bickel CA, Verbalis JG, Knepper MA, and Ecelbarger CA. Increased renal Na-K-ATPase, NCC, and beta-ENaC abundance in obese Zucker rats. Am J Physiol Renal Physiol 281: F639 –F648, 2001. Birkenhager R, Otto E, Schurmann MJ, Vollmer M, Ruf EM, Maier-Lutz I, Beekmann F, Fekete A, Omran H, Feldmann D, Milford DV, Jeck N, Konrad M, Landau D, Knoers NV, Antignac C, Sudbrak R, Kispert A, and Hildebrandt F. Mutation of BSND causes Bartter syndrome with sensorineural deafness and kidney failure. Nat Genet 29: 310 –314, 2001. Bize I, Munoz P, Canessa M, and Dunham PB. Stimulation of membrane serine-threonine phosphatase in erythrocytes by hydrogen peroxide and staurosporine. Am J Physiol Cell Physiol 274: C440 –C446, 1998. Boettger T, Hubner CA, Maier H, Rust MB, Beck FX, and Jentsch TJ. Deafness and renal tubular acidosis in mice lacking the K-Cl co-transporter Kcc4. Nature 416: 874 – 878, 2002. Boettger T, Rust MB, Maier H, Seidenbecher T, Schweizer M, Keating DJ, Faulhaber J, Ehmke H, Pfeffer C, Scheel O, Lemcke B, Horst J, Leuwer R, Pape HC, Volkl H, Hubner CA,

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS

43.

44.

45. 46.

47.

48.

49.

50.

51.

52.

53.

54.

55.

56.

57.

58.

59.

60. 61.

and Jentsch TJ. Loss of K-Cl co-transporter KCC3 causes deafness, neurodegeneration and reduced seizure threshold. EMBO J 22: 5422–5434, 2003. Bostanjoglo M, Reeves WB, Reilly RF, Velazquez H, Robertson N, Litwack G, Morsing P, Dorup J, Bachmann S, Ellison DH, and Bostonjoglo M. 11Beta-hydroxysteroid dehydrogenase, mineralocorticoid receptor, and thiazide-sensitive Na-Cl cotransporter expression by distal tubules. J Am Soc Nephrol 9: 1347–1358, 1998. Brooks HL, Allred AJ, Beutler KT, Coffman TM, and Knepper MA. Targeted proteomic profiling of renal Na(⫹) transporter and channel abundances in angiotensin II type 1a receptor knockout mice. Hypertension 39: 470 – 473, 2002. Burg MB. Thick ascending limb of Henle’s loop. Kidney Int 22: 454 – 464, 1982. Burnham C, Karlish SJ, and Jorgensen PL. Identification and reconstitution of a Na⫹/K⫹/Cl⫺ cotransporter and K⫹ channel from luminal membranes of renal red outer medulla. Biochim Biophys Acta 821: 461– 469, 1985. Caillard O, Ben Ari Y, and Gaiarsa JL. Long-term potentiation of GABAergic synaptic transmission in neonatal rat hippocampus. J Physiol 518: 109 –119, 1999. Campean V, Kricke J, Ellison D, Luft FC, and Bachmann S. Localization of thiazide-sensitive Na⫹-Cl⫺ cotransport and associated gene products in mouse DCT. Am J Physiol Renal Physiol 281: F1028 –F1035, 2001. Caron L, Rousseau F, Gagnon E, and Isenring P. Cloning and functional characterization of a cation Cl⫺ cotransporter interacting protein. J Biol Chem 275: 32027–32036, 2000. Casula S, Shmukler BE, Wilhelm S, Stuart-Tilley AK, Su W, Chernova MN, Brugnara C, and Alper SL. A dominant negative mutant of the KCC1 K-Cl cotransporter: both N- and C-terminal cytoplasmic domains are required for K-Cl cotransport activity. J Biol Chem 276: 41870 – 41878, 2001. Cervero F, Laird JM, and Garcia-Nicas E. Secondary hyperalgesia and presynaptic inhibition: an update. Eur J Pain 7: 345–351, 2003. Chang H and Fujita T. A kinetic model of the thaizide-sensitive Na-Cl cotransporter. Am J Physiol Renal Physiol 276: F952–F959, 1999. Chen Z, Vaughn DA, Beaumont K, and Fanestil DD. Effects of diuretic treatment and of dietary sodium on renal binding of 3Hmetolazone. J Am Soc Nephrol 1: 91–98, 1990. Chen Z, Vaughn DA, and Fanestil DD. Influence of gender on renal thiazide diuretic receptor density and response. J Am Soc Nephrol 5: 1112–1119, 1994. Cheng NL, Kao MC, Hsu YD, and Lin SH. Novel thiazide-sensitive Na-Cl cotransporter mutation in a Chinese patient with Gitelman’s syndrome presenting as hypokalaemic paralysis. Nephrol Dial Transplant 18: 1005–1008, 2003. Choate KA, Kahle KT, Wilson FH, Nelson-Williams C, and Lifton RP. WNK1, a kinase mutated in inherited hypertension with hyperkalemia, localizes to diverse Cl⫺-transporting epithelia. Proc Natl Acad Sci USA 100: 663– 668, 2003. Chobanian AV, Bakris GL, Black HR, Cushman WC, Green LA, Izzo JL Jr, Jones DW, Materson BJ, Oparil S, Wright JT Jr, and Roccella EJ. The Seventh Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure: The JNC 7 Report. JAMA 289: 2560 –2571, 2003. Clader JA, Schacheter M, and Sever PS. Direct vascular actions of hydrochlorothaizide and indapamide in isolated small vessels. Eur J Pharmacol 220: 19 –26, 1992. Clayton GH, Owens GC, Wolff JS, and Smith RL. Ontogeny of cation-Cl⫺ cotransporter expression in rat neocortex. Brain Res 109: 281–292, 1998. Cohen PT. Protein phosphatase 1—targeted in many directions. J Cell Sci 115: 241–256, 2002. Colas B, Slama M, Collin T, Safar M, and Andrejak M. Mechanisms of methyclothiazide-induced inhibition of contractile responses in rat aorta. Eur J Pharmacol 408: 63– 67, 2000. Physiol Rev • VOL

483

62. Cossins AR and Gibson JS. Volume-sensitive transport systems and volume homeostasis in vertebrate red blood cells. J Exp Biol 200: 343–352, 1997. 63. Costanzo LS. Localization of diuretic action in microperfused rat distal tubules: Ca and Na transport. Am J Physiol Renal Fluid Electrolyte Physiol 248: F527–F535, 1985. 64. Coto E, Rodriguez J, Jeck N, Alvarez V, Stone R, Loris C, Rodriguez LM, Fischbach M, Seyberth HW, and Santos F. A new mutation (intron 9 ⫹1 G⬎T) in the SLC12A3 gene is linked to Gitelman syndrome in gypsies. Kidney Int 65: 25–29, 2004. 65. Cremaschi D, Porta C, Botta G, Bazzini C, Baroni MD, and Garavaglia M. Apical Na(⫹)-Cl(⫺) symport in rabbit gallbladder epithelium: a thiazide-sensitive cotransporter (TSC). J Membr Biol 176: 53– 65, 2000. 66. Cruz D, Simon D, and Lifto RP. An inactivating mutation of the thiazide sensitive NaCl co-transporter is associated with high bone mineral density in humans (Abstract). J Bone Miner Res 14: S109, 1999. 67. Cruz DN, Shaer AJ, Bia MJ, Lifton RP, and Simon DB. Gitelman’s syndrome revisited: an evaluation of symptoms and healthrelated quality of life. Kidney Int 59: 710 –717, 2001. 68. Cruz DN, Simon DB, Nelson-Williams C, Farhi A, Finberg K, Burleson L, Gill JR, and Lifton RP. Mutations in the Na-Cl cotransporter reduce blood pressure in humans. Hypertension 37: 1458 –1464, 2001. 69. Cutler CP and Cramb G. Two isoforms of the Na⫹/K⫹/2Cl⫺ cotransporter are expressed in the European eel (Anguilla anguilla). Biochim Biophys Acta 1566: 92–103, 2002. 70. Darman RB, Flemmer A, and Forbush B. Modulation of ion transport by direct targeting of protein phosphatase type 1 to the Na-K-Cl cotransporter. J Biol Chem 276: 34359 –34362, 2001. 71. Darman RB and Forbush B. A regulatory locus of phosphorylation in the N terminus of the Na-K-Cl cotransporter, NKCC1. J Biol Chem 277: 37542–37550, 2002. 72. De Jong JC, Van Der Vliet WA, van den Heuvel LP, Willems PH, Knoers NV, and Bindels RJ. Functional expression of mutations in the human NaCl cotransporter: evidence for impaired routing mechanisms in Gitelman’s syndrome. J Am Soc Nephrol 13: 1442–1448, 2002. 73. De Jong JC, Willems PH, Mooren FJ, van den Heuvel LP, Knoers NV, and Bindels RJ. The structural unit of the thiazidesensitive NaCl cotransporter is a homodimer. J Biol Chem 278: 24302–24307, 2003. 74. De Jong JC, Willems PH, van den Heuvel LP, Knoers NV, and Bindels RJ. Functional expression of the human thiazide-sensitive NaCl cotransporter in Madin-Darby canine kidney cells. J Am Soc Nephrol 14: 2428 –2435, 2003. 75. DeFazio RA, Keros S, Quick MW, and Hablitz JJ. Potassiumcoupled chloride cotransport controls intracellular chloride in rat neocortical pyramidal neurons. J Neurosci 20: 8069 – 8076, 2000. 76. Dehaye JP, Nagy A, Premkumar A, and Turner RJ. Identification of a functionally important conformation-sensitive region of the secretory Na⫹-K⫹-2Cl⫺ cotransporter (NKCC1). J Biol Chem 278: 11811–11817, 2003. 77. Delpire E, Rauchman MI, Beier DR, Hebert SC, and Gullans SR. Molecular cloning and chromosome localization of a putative basolateral Na⫹-K⫹-2Cl⫺ cotransporter from mouse inner medullary collecting duct (mIMCD-3) cells. J Biol Chem 269: 25677– 25683, 1994. 78. Delpire E. Cation-chloride cotransporters in neuronal communication. News Physiol Sci 15: 309 –312, 2000. 79. Delpire E, Lu J, England R, Dull C, and Thorne T. Deafness and imbalance associated with inactivation of the secretory Na-K-2Cl co-transporter. Nat Genet 22: 192–195, 1999. 80. Delpire E and Mount DB. Human and murine phenotypes associated with defects in cation-chloride cotransport. Annu Rev Physiol 64: 803– 843, 2002. 81. Demir E, Irobi J, Erdem S, Demirci M, Tan E, Timmerman V, De Jonghe P, and Topaloglu H. Andermann syndrome in a Turkish patient. J Child Neurol 18: 76 –79, 2003. 82. Deng L and Chen G. Cyclothiazide potently inhibits gamma-aminobutyric acid type A receptors in addition to enhancing glutamate responses. Proc Natl Acad Sci USA 100: 13025–13029, 2003.

85 • APRIL 2005 •

www.prv.org

484

GERARDO GAMBA

83. Derst C, Konrad M, Kockerling A, Karolyi L, Deschenes G, Daut J, Karschin A, and Seyberth HW. Mutations in the ROMK gene in antenatal Bartter syndrome are associated with impaired K⫹ channel function. Biochem Biophys Res Commun 230: 641– 645, 1997. 84. Di Fulvio M, Lauf PK, and Adragna NC. Nitric oxide signaling pathway regulates potassium chloride cotransporter-1 mRNA expression in vascular smooth muscle cells. J Biol Chem 276: 44534 – 44540, 2001. 85. Di Fulvio M, Lauf PK, and Adragna NC. The NO signaling pathway differentially regulates KCC3a and KCC3b mRNA expression. Nitric Oxide 9: 165–171, 2003. 86. Di Fulvio M, Lauf PK, Shah S, and Adragna NC. NONOates regulate KCl cotransporter-1 and -3 mRNA expression in vascular smooth muscle cells. Am J Physiol Heart Circ Physiol 284: H1686 – H1692, 2003. 87. Di Fulvio M, Lincoln TM, Lauf PK, and Adragna NC. Protein kinase G regulates potassium chloride cotransporter-3 expression in primary cultures of rat vascular smooth muscle cells. J Biol Chem 276: 21046 –21052, 2001. 88. Disse-Nicodeme S, Achard JM, Desitter I, Houot AM, Fournier A, Corvol P, and Jeunemaitre X. A new locus on chromosome 12p13.3 for pseudohypoaldosteronism type II, an autosomal dominant form of hypertension. Am J Hum Genet 67: 302–310, 2000. 89. Di Stefano A, Wittner M, Nitschke R, Braitsh R, Greger R, Bailly C, Amiel C, Roinel N, and de Rouffignac C. Effects of parathyroid hormone and calcitonin on Na⫹, Cl⫺, K⫹, Mg2⫹ and Ca2⫹ transport in cortrical and medullary thick ascending limbs of mouse kidney. Pflu¨gers Arch 417: 161–167, 1990. 90. Dixon MJ, Gazzard J, Chaudhry SS, Sampson N, Schulte BA, and Steel KP. Mutation of the Na-K-Cl co-transporter gene Slc12a2 results in deafness in mice. Hum Mol Genet 8: 1579 –1584, 1999. 91. Doucet A. Function and control of Na-K-ATPase in single nephron segments of the mammalian kidney. Kidney Int 34: 749 –760, 1988. 92. Dowd BF and Forbush B. PASK (proline-alanine-rich STE20related kinase), a regulatory kinase of the Na-K-Cl cotransporter (NKCC1). J Biol Chem 278: 27347–27353, 2003. 93. Drewnowska K and Baumgarten CM. Regulation of cellular volume in rabbit ventricular myocytes: bumetanide, chlorthiazide, and ouabain. Am J Physiol Cell Physiol 260: C122–C131, 1991. 94. Dunham P, Jessen F, and Hoffman EK. Inhibition of Na-K-Cl cotransport in Ehrlich ascites cells by antiserum against purified proteins of the cotransporter. Proc Natl Acad Sci USA 87: 6828 – 6823, 1990. 95. Dunham PB and Ellory JC. Passive potassium transport in low potassium sheep red cells: dependence upon cell volume and chloride. J Physiol 318: 511–530, 1981. 96. Dupre N, Howard HC, Mathieu J, Karpati G, Vanasse M, Bouchard JP, Carpenter S, and Rouleau GA. Hereditary motor and sensory neuropathy with agenesis of the corpus callosum. Ann Neurol 54: 9 –18, 2003. 97. Dvorak MM, Carter H, and Riccardi D. Thiazide-sensitive sodium chloride co-transporter (NCC) in cryosections of rat and human bone (Abstract). J Bone Miner Res 17: S246, 2002. 98. Ecelbarger C, Wade JB, Terris J, Marples D, Nielsen S, and Knepper MA. Localization and regulation of bumetanide-sensitive cotransporter protein in rat kidney (Abstract). J Am Soc Nephrol 6: 335, 1995. 99. Ecelbarger CA, Bickel CA, Verbalis JG, and Knepper MA. Regulation of Na-dependent cotransporter and Na channel abundance by insulin (Abstract). J Am Soc Nephrol 11: 27A, 2002. 100. Ecelbarger CA, Kim GH, Wade JB, and Knepper MA. Regulation of the abundance of renal sodium transporters and channels by vasopressin. Exp Neurol 171: 227–234, 2001. 101. Ecelbarger CA, Knepper MA, and Verbalis JG. Increased abundance of distal sodium transporters in rat kidney during vasopressin escape. J Am Soc Nephrol 12: 207–217, 2001. 102. Ehringer MA, Thompson J, Conroy O, Xu Y, Yang F, Canniff J, Beeson M, Gordon L, Bennett B, Johnson TE, and Sikela JM. High-throughput sequence identification of gene coding variants within alcohol-related QTLs. Mamm Genome 12: 657– 663, 2001. Physiol Rev • VOL

103. Elalouf JM, Roinel N, and de Rouffignac C. Effects of glucagon and PTH on the loop of Henle of rat juxtamedullary nephrons. Kidney Int 29: 807– 813, 1986. 104. Ellison DH. The physiologic basis of diuretic synergism: its role in treating diuretic resistance. Ann Intern Med 114: 886 – 894, 1991. 105. Ellison DH. The thiazide-sensitive Na-Cl cotransporter and human disease: reemergence of an old player. J Am Soc Nephrol 14: 538 –540, 2003. 106. Ellison DH, Biemesderfer D, Morrisey J, Lauring J, and Desir GV. Immunocytochemical characterization of the high-affinity thiazide diuretic receptor in rabbit renal cortex. Am J Physiol Renal Fluid Electrolyte Physiol 264: F141–F148, 1993. 107. Ellison DH, Morrisey J, and Desir GV. Rabbit thiazide diuretic receptors: solubilization, chracterization and purification. J Am Soc Nephrol 1: 683, 1990. 108. Ellison DH, Velazquez H, and Wright FS. Stimulation of distal potassium secretion by low lumen chloride in the presence of barium. Am J Physiol Renal Fluid Electrolyte Physiol 248: F638 – F649, 1985. 109. Ellison DH, Velazquez H, and Wright FS. Thiazide-sensitive sodium chloride cotransport in early distal tubule. Am J Physiol Renal Fluid Electrolyte Physiol 253: F546 –F554, 1987. 110. Elmslie FV, Rees M, Williamson MP, Kerr M, Kjeldsen MJ, Pang KA, Sundqvist A, Friis ML, Chadwick D, Richens A, Covanis A, Santos M, Arzimanoglou A, Panayiotopoulos CP, Curtis D, Whitehouse WP, and Gardiner RM. Genetic mapping of a major susceptibility locus for juvenile myoclonic epilepsy on chromosome 15q. Hum Mol Genet 6: 1329 –1334, 1997. 111. Enan E and Matsumura F. Specific inhibition of calcineurin by type II synthetic pyrethroid insecticides. Biochem Pharmacol 43: 1777–1784, 1992. 112. Escalante B, Erlij D, Falck JR, and McGiff JC. Effect of cytochrome P450 arachidonate metabolites on ion transport in rabbit kidney loop of Henle. Science 251: 799 – 802, 1991. 113. Estevez R, Boettger T, Stein V, Birkenhager R, Otto E, Hildebrandt F, and Jentsch TJ. Barttin is a Cl⫺ channel beta-subunit crucial for renal Cl⫺ reabsorption and inner ear K⫹ secretion. Nature 414: 558 –561, 2001. 114. Evans RL, Park K, Turner RJ, Watson GE, Nguyen HV, Dennett MR, Hand AR, Flagella M, Shull GE, and Melvin JE. Severe impairment of salivation in Na⫹/K⫹/2Cl⫺ cotransporter (NKCC1)-deficient mice. J Biol Chem 275: 26720 –26726, 2000. 115. Eveloff J, Bayerdorffer E, Silva P, and Kinne R. Sodiumchloride transport in the thick ascending limb of Henle’s loop. Oxygen consumption studies in isolated cells. Pflu¨gers Arch 389: 263–270, 1981. 116. Eveloff J and Calamia J. Effect of osmolarity on cation fluxes in medullary thick ascending limb cells. Am J Physiol Renal Fluid Electrolyte Physiol 250: F176 –F180, 1986. 117. Fanestil DD. Steroid regulation of thiazide-sensitive transport. Semin Nephrol 12: 18 –23, 1992. 118. Fanestil DD, Tran JM, Vaughn DA, Maciejewski AR, and Beaumont K. Investigation of the metolazone receptor. In: Diuretics III: Chemistry, Pharmacology and Clinical Applications, edited by Puschett JB and Greenberg A. New York: Elsevier Science, 1990, p. 195–204. 119. Fanestil DD, Vaughan DA, and Blakely P. Metabolic acid-base influences on renal thiazide receptor density. Am J Physiol Regul Integr Comp Physiol 272: R2004 –R2008, 1997. 120. Fedele E, Conti A, and Raiteri M. The glutamate receptor/NO/ cyclic GMP pathway in the hippocampus of freely moving rats: modulation by cyclothiazide, interaction with GABA and the behavioural consequences. Neuropharmacology 36: 1393–1403, 1997. 121. Feit PW, Hoffman EK, Schiodt M, Kristensen P, Jessen F, and Dunham PB. Purification of proteins of the Na/Cl cotransporter from membranes of Ehrlich ascites cells using a bumetanide-sepharose affinity column. J Membr Biol 103: 135–147, 1988. 122. Fernandez-Llama P, Ecelbarger CA, Ware JA, Andrews P, Lee AJ, Turner R, Nielsen S, and Knepper MA. Cyclooxygenase inhibitors increase Na-K-2Cl cotransporter abundance in thick ascending limb of Henle’s loop. Am J Physiol Renal Physiol 277: F219 –F226, 1999.

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS 123. Flagella M, Clarke LL, Miller ML, Erway LC, Giannella RA, Andringa A, Gawenis LR, Kramer J, Duffy JJ, Doetschman T, Lorenz JN, Yamoah EN, Cardell EL, and Shull GE. Mice lacking the basolateral Na-K-2Cl cotransporter have impaired epithelial chloride secretion and are profoundly deaf. J Biol Chem 274: 26946 –26955, 1999. 124. Flatman PW. Regulation of Na-K-2Cl cotransport by phosphorylation and protein-protein interactions. Biochim Biophys Acta 1566: 140 –151, 2002. 125. Flatman PW, Adragna NC, and Lauf PK. Role of protein kinases in regulating sheep erythrocyte K-Cl cotransport. Am J Physiol Cell Physiol 271: C255–C263, 1996. 126. Flemmer AW, Gimenez I, Dowd BF, Darman RB, and Forbush B. Activation of the Na-K-Cl cotransporter NKCC1 detected with a phospho-specific antibody. J Biol Chem 277: 37551–37558, 2002. 127. Forbush B III, Haas M, and Lytle C. Na-K-Cl cotransport in the shark rectal gland. I. Regulation in the intact perfused gland. Am J Physiol Cell Physiol 262: C1000 –C1008, 1992. 128. Forbush B III and Palfrey HC. [3H]bumetanide binding to membranes isolated from dog kidney outer medulla. Relationship to the Na,K,Cl co-transport system. J Biol Chem 258: 11787–11792, 1983. 129. Freis ED. Origins and development of antihypertensive drug treatment. In: Hypertension: Pathophysioloy, Diagnosis and Managment, edited by Laragh JH and Brenner BM. New York: Raven, 1990, p. 2093–2106. 130. Friedman PA and Bushinsky DA. Diuretic effects on calcium metabolism. Semin Nephrol 19: 551–556, 1999. 131. Fukuda A, Muramatsu K, Okabe A, Shimano Y, Hida H, Fujimoto I, and Nishino H. Changes in intracellular Ca2⫹ induced by GABAA receptor activation and reduction in Cl⫺ gradient in neonatal rat neocortex. J Neurophysiol 79: 439 – 446, 1998. 132. Fukuyama S, Okudaira S, Yamazato S, Yamazato M, and Ohta T. Analysis of renal tubular electrolyte transporter genes in seven patients with hypokalemic metabolic alkalosis. Kidney Int 64: 808 – 816, 2003. 133. Gagnon E, Bergeron MJ, Brunet GM, Daigle ND, Simard CF, and Isenring P. Molecular mechanisms of Cl transport by the renal Na-K-Cl cotransporter: identification of an intracellular locus that may form part of a high affinity Cl-binding site. J Biol Chem 279: 5648 –5654, 2003. 134. Gagnon E, Forbush B, Flemmer AW, Gimenez I, Caron L, and Isenring P. Functional and molecular characterization of the shark renal Na-K-Cl cotransporter: novel aspects. Am J Physiol Renal Physiol 283: F1046 –F1055, 2002. 135. Gamba G. Alternative splicing and diversity of renal transporters. Am J Physiol Renal Physiol 281: F781–F794, 2001. 136. Gamba G, Miyanoshita A, Lombardi M, Lytton J, Lee WS, Hediger MA, and Hebert SC. Molecular cloning, primary structure and characterization of two members of the mammalian electroneutral sodium-(potassium)-chloride cotransporter family expressed in kidney. J Biol Chem 269: 17713–17722, 1994. 137. Gamba G, Saltzberg SN, Lombardi M, Miyanoshita A, Lytton J, Hediger MA, Brenner BM, and Hebert SC. Primary structure and functional expression of a cDNA encoding the thiazide-sensitive, electroneutral sodium-chloride cotransporter. Proc Natl Acad Sci USA 90: 2749 –2753, 1993. 138. Geck P, Pietrzyk C, Burckhardt BC, Pfeiffer B, and Heinz E. Electrically silent cotransport of Na⫹, K⫹ and Cl⫺ in Ehrlich cells. Biochim Biophys Acta 600: 432– 447, 1980. 139. Geering K, Theulaz F, Verrey M, Hauptle T, and Rossier BC. A role for the beta-subunit in the expression of functional Na⫹-K⫹ATPase in Xenopus oocytes. Am J Physiol Cell Physiol 257: C851– C858, 1989. 140. Gerelsaikhan T and Turner RJ. Transmembrane topology of the secretory Na⫹-K⫹-2Cl⫺ cotransporter (NKCC1) studied by in vitro translation. J Biol Chem 275: 40471– 40477, 2000. 141. Gesek FA and Friedman PA. Mechanism of calcium transport stimulated by chlorothiazide in mouse distal convoluted tubule cells. J Clin Invest 90: 429 – 438, 1992. 142. Gillen CM, Brill S, Payne JA, and Forbush B III. Molecular cloning and functional expression of the K-Cl cotransporter from rabbit, rat and human. A new member of the cation-chloride cotransporter family. J Biol Chem 271: 16237–16244, 1996. Physiol Rev • VOL

485

143. Gimenez I and Forbush B. Short-term stimulation of the renal Na-K-Cl cotransporter (NKCC2) by vasopressin involves phosphorylation and membrane translocation of the protein. J Biol Chem 278: 26946 –26951, 2003. 144. Gimenez I, Isenring P, and Forbush B III. Spatially distributed alternative splice variants of the renal Na-K-Cl cotransporter exhibit dramatically different affinities for the transported ions. J Biol Chem 277: 8767– 8770, 2002. 145. Gitelman HJ, Graham JB, and Welt LG. A new family disorder characterized by hypokalemia and hypomagnesemia. Trans Assoc Am Physicians 79: 221–235, 1966. 146. Good DW. Ammonium transport by the thick ascending limb of Henle’s loop. Annu Rev Physiol 56: 623– 647, 1994. 147. Gordon RD. Syndrome of hypertension and hyperkalemia with normal glomerular filtration rate. Hypertension 8: 93–102, 1986. 148. Gordon RD and Hodsman GP. The syndrome of hypertension and hyperkalaemia without renal failure: long term correction by thiazide diuretic. Scott Med J 31: 43– 44, 1986. 149. Greger R. Chloride reabsorption in the rabbit cortical thick ascending limb of the loop of Henle. A sodium dependent process. Pflu¨gers Arch 390: 38 – 43, 1981. 150. Greger R. Coupled transport of Na⫹ and Cl⫺ in the thick ascending limb of Henle’s loop of rabbit nephron. Scand Audiol Suppl 14: 1–15, 1981. 151. Greger R. Ion transport mechanisms in thick ascending limb of Henle’s loop of mammalian nephron. Physiol Rev 65: 760 –797, 1985. 152. Greger R. Physiology of renal sodium transport. Am J Med Sci 319: 51– 62, 2000. 153. Greger R and Schlatter E. Presence of luminal K⫹, a prerequisite for active NaCl transport in the cortical thick ascending limb of Henlen’s loop of rabbit kidney. Pflu¨gers Arch 392: 92–94, 1981. 154. Greger R and Schlatter E. Properties of the lumen membrane of the cortical thick ascending limb of Henle’s loop of rabbit kidney. Pflu¨gers Arch 396: 315–324, 1983. 155. Greger R and Schlatter E. Properties of the basolateral membrane on the cortical thick ascending limb of Henle’s loop of rabbit kidney. A model for secondary active chloride transport. Pflu¨gers Arch 396: 325–334, 1983. 156. Greger R, Schlatter E, and Lang F. Evidence for electroneutral sodium chloride cotransport in the cortical thick ascending limb of Henle’s loop of rabbit kidney. Pflu¨gers Arch 396: 308 –314, 1983. 157. Grubb BR, Lee E, Pace AJ, Koller BH, and Boucher RC. Intestinal ion transport in NKCC1-deficient mice. Am J Physiol Gastrointest Liver Physiol 279: G707–G718, 2000. 158. Grubb BR, Pace AJ, Lee E, Koller BH, and Boucher RC. Alterations in airway ion transport in NKCC1-deficient mice. Am J Physiol Cell Physiol 281: C615–C623, 2001. 159. Guggino WB, Oberleithner H, and Giebisch G. The amphibian diluting segment. Am J Physiol Renal Fluid Electrolyte Physiol 254: F615–F627, 1988. 160. Guo X and Wecker L. Identification of three cAMP-dependent protein kinase (PKA) phosphorylation sites within the major intracellular domain of neuronal nicotinic receptor alpha4 subunits. J Neurochem 82: 439 – 447, 2002. 161. Haas M. Properties and diversity of (Na-K-Cl) cotransporters. Annu Rev Physiol 51: 443– 457, 1989. 162. Haas M. The Na-K-Cl cotransporters. Am J Physiol Cell Physiol 267: C869 –C885, 1994. 163. Haas M and Forbush B III. Na,K,Cl cotransport system: characterization by bumetanide binding and photolabelling. Kidney Int 32 Suppl: S134 –S140, 1987. 164. Haas M and Forbush B III. The Na-K-Cl cotransporter of secretory epithelia. Annu Rev Physiol 62: 515–534, 2000. 165. Haas M and McManus TJ. Bumetanide inhibits (Na⫹K⫹Cl) cotransport at a chloride site. Am J Physiol Cell Physiol 245: C235– C240, 1983. 166. Hall DA and Varney DM. Effect of vasopressin on electrical potential difference and chloride transport in mouse medullary thick ascending limb of Henle’s loop. J Clin Invest 66: 792– 802, 1980.

85 • APRIL 2005 •

www.prv.org

486

GERARDO GAMBA

167. Hebert SC. Nephron heterogeneity. In: Handbook of Physiology. Renal Physiology. Bethesda, MD: Am. Physiol. Soc., 1992, sect. 8, vol. I, chapt. 20, p. 875–925. 168. Hebert SC. Bartter syndrome. Curr Opin Nephrol Hypertens 12: 527–532, 2003. 169. Hebert SC and Andreoli TE. Control of NaCl transport in the thick ascending limb. Am J Physiol Renal Fluid Electrolyte Physiol 246: F745–F756, 1984. 170. Hebert SC, Culpepper RM, and Andreoli TE. NaCl transport in mouse medullary thick ascending limbs. I. Functional nephron heterogeneity and ADH-stimulated NaCl cotransport. Am J Physiol Renal Fluid Electrolyte Physiol 241: F412–F431, 1981. 171. Hebert SC, Culpepper RM, and Andreoli TE. NaCl transport in mouse medullary thick ascending limbs. II. ADH enhancement of transcellular NaCl cotrasport; origin of transepithelial voltage. Am J Physiol Renal Fluid Electrolyte Physiol 241: F432–F442, 1981. 172. Hebert SC, Culpepper RM, and Andreoli TE. NaCl transport in mouse medullary thick ascending limbs. III. Modulation of ADH effect by peritubular osmolality. Am J Physiol Renal Fluid Electrolyte Physiol 241: F443–F451, 1981. 173. Hebert SC, Mount DB, and Gamba G. Molecular physiology of cation-coupled Cl⫺ cotransport: the SLC12 family. Pflu¨gers Arch 447: 580 –593, 2004. 174. Hebert SC, Reeves WB, Molony DA, and Andreoli TE. The medullary thick limb: function and modulation of the single-effect multiplier. Kidney Int 31: 580 –588, 1987. 175. Hediger MA, Romero MF, Peng JB, Rolfs A, Takanaga H, and Bruford EA. The ABCs of solute carriers: physiological, pathological and therapeutic implications of human membrane transport proteins—introduction. Pflu¨gers Arch 447: 465– 468, 2004. 176. Hewett D, Samuelsson L, Polding J, Enlund F, Smart D, Cantone K, See CG, Chadha S, Inerot A, Enerback C, Montgomery D, Christodolou C, Robinson P, Matthews P, Plumpton M, Wahlstrom J, Swanbeck G, Martinsson T, Roses A, Riley J, and Purvis I. Identification of a psoriasis susceptibility candidate gene by linkage disequilibrium mapping with a localized single nucleotide polymorphism map. Genomics 79: 305–314, 2002. 177. Hierholzer K, Wiederholt M, and Stolte H. The impairment of sodium resorption in the proximal and distal convolution of adrenalectomized rats. Pflu¨gers Arch Gesamte Physiol Menschen Tiere 291: 43– 62, 1966. 178. Hiki K, D’Andrea RJ, Furze J, Crawford J, Woollatt E, Sutherland GR, Vadas MA, and Gamble JR. Cloning, characterization, and chromosomal location of a novel human K⫹-Cl⫺ cotransporter. J Biol Chem 274: 10661–10667, 1999. 179. Holden S, Cox J, and Raymond FL. Cloning, genomic organization, alternative splicing and expression analysis of the human gene WNK3 (PRKWNK3). Gene 335: 109 –119, 2004. 180. Holtzman EJ, Kumar S, Faaland CA, Warner F, Louge PJ, Erickson SJ, Ricken G, Waldman J, and Dunham PB. Cloning, characterization, and gene organization of K-Cl cotransporter from pig and human kidney and C. elegans. Am J Physiol Renal Physiol 275: F550 –F564, 1998. 181. Hoover RS, Poch E, Monroy A, Vazquez N, Nishio T, Gamba G, and Hebert SC. N-glycosylation at two sites critically alters thiazide binding and activity of the rat thiazide-sensitive Na(⫹):Cl(⫺) cotransporter. J Am Soc Nephrol 14: 271–282, 2003. 182. Howard HC, Dube MP, Prevost C, Bouchard JP, Mathieu J, and Rouleau GA. Fine mapping the candidate region for peripheral neuropathy with or without agenesis of the corpus callosum in the French Canadian population. Eur J Hum Genet 10: 406 – 412, 2002. 183. Howard HC, Mount DB, Rochefort D, Byun N, Dupre N, Lu J, Fan X, Song L, Riviere JB, Prevost C, Horst J, Simonati A, Lemcke B, Welch R, England R, Zhan FQ, Mercado A, Siesser WB, George AL Jr, McDonald MP, Bouchard JP, Mathieu J, Delpire E, and Rouleau GA. The K-Cl cotransporter KCC3 is mutant in a severe peripheral neuropathy associated with agenesis of the corpus callosum. Nat Genet 32: 384 –392, 2002. 184. Hubner CA, Stein V, Hermans-Borgmeyer I, Meyer T, Ballanyi K, and Jentsch TJ. Disruption of KCC2 reveals an essential role of Physiol Rev • VOL

185.

186.

187.

188.

189.

190.

191.

192.

193.

194.

195.

196.

197.

198.

199.

200.

201.

202.

203.

204.

K-Cl cotransport already in early synaptic inhibition. Neuron 30: 515–524, 2001. Hunt SC and Williams RR. Gentic factors in human hypertension. In: Texbook of Hypertension, edited by Swales JD. London: Blackwell Scientific, 1994, p. 519 –538. Hus-Citharel A and Morel F. Coupling of metabolic CO2 production to ion transport in isolated rat thick ascending limbs and collecting tubules. Pflu¨gers Arch 407: 421– 427, 1986. Igarashi P, Vanden Heuver GB, Payne JA, and Forbush B III. Cloning, embryonic expression, and alternative splicing of a murine kidney-specific Na-K-Cl cotransporter. Am J Physiol Renal Fluid Electrolyte Physiol 269: F406 –F418, 1995. Igarashi P, Whyte DA, Kui L, and Nagami GT. Cloning and kidney cell-specific activity of the promoter of the murine renal Na-K-Cl cotransporter gene. J Biol Chem 271: 9666 –9674, 1996. Isenring P and Forbush B III. Ion and bumetanide binding by the Na-K-Cl cotransporter. Importance of transmembrane domains. J Biol Chem 272: 24556 –24562, 1997. Isenring P, Jacoby SC, Chang J, and Forbush B III. Mutagenic mapping of the Na-K-Cl cotransporter for domains involved in ion transport and bumetanide binding. J Gen Physiol 112: 549 –558, 1998. Isenring P, Jacoby SC, and Forbush B III. The role of transmembrane domain 2 in cation transport by the Na-K-Cl cotransporter. Proc Natl Acad Sci USA 95: 7179 –7184, 1998. Isenring P and Forbush B. Ion transport and ligand binding by the Na-K-Cl cotransporter, structure-function studies. Comp Biochem Physiol A Physiol 130: 487– 497, 2001. Jarolimek W, Lewen A, and Misgeld U. A furosemide-sensitive K⫹-Cl⫺ cotransporter counteracts intracellular Cl⫺ accumulation and depletion in cultured rat midbrain neurons. J Neurosci 19: 4695– 4704, 1999. Jeck N, Derst C, Wischmeyer E, Ott H, Weber S, Rudin C, Seyberth HW, Daut J, Karschin A, and Konrad M. Functional heterogeneity of ROMK mutations linked to hyperprostaglandin E syndrome. Kidney Int 59: 1803–1811, 2001. Jennings ML and Schulz RK. Okadaic acid inhibition of KCl cotransport. Evidence that protein dephosphorylation is necessary for activation of transport by either cell swelling or N-ethylmaleimide. J Gen Physiol 97: 799 – 817, 1991. Jones G, Nguyen T, Sambrook PN, and Eisman JA. Thiazide diuretics and fractures: can meta-analysis help? J Bone Miner Res 10: 106 –111, 1995. Jorgensen PL, Petersen J, and Rees WD. Identification of a Na⫹, K⫹, Cl⫺ cotransport protein of Mr 34000 from kidney by photolabeling with [3H]bumetanide. Biochim Biophys Acta 775: 105–110, 1984. Kahle KT, Gimenez I, Hassan H, Wilson FH, Wong RD, Forbush B, Aronson PS, and Lifton RP. WNK4 regulates apical and basolateral Cl⫺ flux in extrarenal epithelia. Proc Natl Acad Sci USA 101: 2064 –2069, 2004. Kahle KT, Wilson FH, Leng Q, Lalioti MD, O’Connell AD, Dong K, Rapson AK, MacGregor GG, Giebisch G, Hebert SC, and Lifton RP. WNK4 regulates the balance between renal NaCl reabsorption and K⫹ secretion. Nat Genet 35: 372–376, 2003. Kaji DM and Tsukitani Y. Role of protein phosphatase in activation of KCl cotransport in human erythrocytes. Am J Physiol Cell Physiol 260: C176 –C180, 1991. Kakazu Y, Uchida S, Nakagawa T, Akaike N, and Nabekura J. Reversibility and cation selectivity of the K(⫹)-Cl(⫺) cotransport in rat central neurons. J Neurophysiol 84: 281–288, 2000. Kanaka C, Ohno K, Okabe A, Kuriyama K, Itoh T, Fukuda A, and Sato K. The differential expression patterns of messenger RNAs encoding K-Cl cotransporters (KCC1,2) and Na-K-2Cl cotransporter (NKCC1) in the rat nervous system. Neuroscience 104: 933–946, 2001. Kaplan MR, Plotkin MD, Lee WS, Xu ZC, Lytton J, and Hebert SC. Apical localization of the Na-K-Cl cotransporter, rBSC1, on rat thick ascending limbs. Kidney Int 49: 40 – 47, 1996. Karadsheh MF, Byun N, Mount DB, and Delpire E. Localization of the kcc4 potassium-chloride cotransporter in the nervous system. Neuroscience 123: 381–391, 2004.

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS 205. Karadsheh MF and Delpire E. Neuronal restrictive silencing element is found in the KCC2 gene: molecular basis for KCC2specific expression in neurons. J Neurophysiol 85: 995–997, 2001. 206. Karim Z, Attmane-Elakeb A, Sibella V, and Bichara M. Acid pH increases the stability of BSC1/NKCC2 mRNA in the medullary thick ascending limb. J Am Soc Nephrol 14: 2229 –2236, 2003. 207. Karolyi L, Conrad M, Ko¨ckerling A, Ziegler A, Zimmermann D, Roth B, Wieg C, Grzeschik K, Koch M, Seyberth H, Vargas R, Forestier L, Jean G, Deschaux N, Rizzoni GF, Niaudet P, Antignac C, Feldmann D, Lorridon F, Cougoureux E, Laroze F, Alessandri JL, David L, Saunier P, Deschenes G, Hildebrandt F, Vollmer M, Proesmans W, Brandes M, van Den Heuvel LJ, Lemmink HH, Nillesen W, Monnens L, Knoers NVAM, Guay-Woodford LM, Wright CJ, Madrigal G, and Hebert SC. Mutations in the gene encoding the inwardly-rectifying renal potassium channel, ROMK, cause the antenatal variant of Bartter syndrome: evidence for genetic heterogeneity. International Collaborative Study Group for Bartter-like Syndromes. Hum Mol Genet 6: 17–26, 1997. 208. Kawakami K, Noguchi S, Noda M, Takahashi H, Ohta T, Kawamura M, Nojima H, Nagano K, Hirose T, Inayama S, Hayashida H, Miyata T, and Numa S. Primary structure of the alpha-subunit of Torpedo californica (Na⫹⫹K⫹)ATPase deduced from cDNA sequence. Nature 316: 733–736, 1985. 209. Kim GH, Ecelbarger CA, Mitchell C, Packer RK, Wade JB, and Knepper MA. Vasopressin increases Na-K-2Cl cotransporter expression in thick ascending limb of Henle’s loop. Am J Physiol Renal Physiol 276: F96 –F103, 1999. 210. Kim GH, Masilamani S, Turner R, Mitchell C, Wade JB, and Knepper MA. The thiazide-sensitive Na-Cl cotransporter is an aldosterone-induced protein. Proc Natl Acad Sci USA 95: 14552– 14557, 1998. 211. Kim GH, Martin SW, Fernandez-Llama P, Masilamani S, Packer RK, and Knepper MA. Long-term regulation of renal Na-dependent cotransporters and ENaC: response to altered acidbase intake. Am J Physiol Renal Physiol 279: F459 –F467, 2000. 212. Kirsch J and Betz H. Glycine-receptor activation is required for receptor clustering in spinal neurons. Nature 392: 717–720, 1998. 213. Knepper MA. Proteomics and the kidney. J Am Soc Nephrol 13: 1398 –1408, 2002. 214. Knepper MA and Brooks HL. Regulation of the sodium transporters NHE3, NKCC2 and NCC in the kidney. Curr Opin Nephrol Hypertens 10: 655– 659, 2001. 215. Knepper MA and Masilamani S. Targeted proteomics in the kidney using ensembles of antibodies. Acta Physiol Scand 173: 11–21, 2001. 216. Knepper MA, Packer R, and Good DW. Ammonium transport in the kidney. Physiol Rev 69: 179 –249, 1989. 217. Koenig B, Ricapito S, and Kinne R. Chloride transport in the thick ascending limb of Henle’s loop: potassium dependence and stoichiometry of the NaCl cotransport system in plasma membrane vesicles. Pflu¨gers Arch 399: 173–179, 1983. 218. Konrad M, Vollmer M, Lemmink HH, van den Heuvel LP, Jeck N, Vargas-Poussou R, Lakings A, Ruf R, Deschenes G, Antignac C, Guay-Woodford L, Knoers NV, Seyberth HW, Feldmann D, and Hildebrandt F. Mutations in the chloride channel gene CLCNKB as a cause of classic Bartter syndrome. J Am Soc Nephrol 11: 1449 –1459, 2000. 219. Krarup T and Dunham PB. Reconstitution of calyculin-inhibited K-Cl cotransport in dog erythrocyte ghosts by exogenous PP-1. Am J Physiol Cell Physiol 270: C898 –C902, 1996. 220. Kunau RT, Weller DR, and Webb HL. Clarification of the site of action of chlorothiazide in the rat nephron. J Clin Invest 56: 401– 407, 1975. 221. Kunchaparty S, Palcso M, Berkman J, zquez H, Desir GV, Bernstein P, Reilly RF, and Ellison DH. Defective processing and expression of thiazide-sensitive Na-Cl cotransporter as a cause of Gitelman’s syndrome. Am J Physiol Renal Physiol 277: F643– F649, 1999. 222. Kurihara K, Moore-Hoon ML, Saitoh M, and Turner RJ. Characterization of a phosphorylation event resulting in upregulation of the salivary Na(⫹)-K(⫹)-2Cl(⫺) cotransporter. Am J Physiol Cell Physiol 277: C1184 –C1193, 1999. Physiol Rev • VOL

487

223. Kurihara K, Nakanishi N, Moore-Hoon ML, and Turner RJ. Phosphorylation of the salivary Na(⫹)-K(⫹)-2Cl(⫺) cotransporter. Am J Physiol Cell Physiol 282: C817–C823, 2002. 224. Kurtz CL, Karolyi L, Seyberth HW, Koch MC, Vargas R, Feldmann D, Vollmer M, Knoers NV, Madrigal G, and Guay-Woodford LM. A common NKCC2 mutation in Costa Rican Bartter’s syndrome patients: evidence for a founder effect. J Am Soc Nephrol 8: 1706 –1711, 1997. 225. Kwon TH, Nielsen J, Kim YH, Knepper MA, Frokiaer J, and Nielsen S. Regulation of sodium transporters in the thick ascending limb of rat kidney: response to angiotensin II. Am J Physiol Renal Physiol 285: F152–F165, 2003. 226. Kyte J and Doolittle RF. A simple method for displaying the hydropathic character of a protein. J Mol Biol 157: 105–132, 1982. 227. Lagler KF, Bardach JE, and Miller RR. Icthyology. New York: Wiley, 1962. 228. Lai E, Clark KL, Burley SK, and Darnell JE Jr. Hepatocyte nuclear factor 3/fork head or “winged helix” proteins: a family of transcription factors of diverse biologic function. Proc Natl Acad Sci USA 90: 10421–10423, 1993. 229. Laird JM, Garcia-Nicas E, Delpire EJ, and Cervero F. Presynaptic inhibition and spinal pain processing in mice: a possible role of the NKCC1 cation-chloride co-transporter in hyperalgesia. Neurosci Lett 361: 200 –203, 2004. 230. Lang F, Busch GL, Ritter M, Volkl H, Waldegger S, Gulbins E, and Haussinger D. Functional significance of cell volume regulatory mechanisms. Physiol Rev 78: 247–306, 1998. 231. Larsen F, Solheim J, Kristensen T, Kolsto AB, and Prydz H. A tight cluster of five unrelated human genes on chromosome 16q22.1. Hum Mol Genet 2: 1589 –1595, 1993. 232. Lauf PK. Thiol-dependent passive K/Cl transport in sheep red cells. I. Dependence on chloride and external ions. J Membr Biol 73: 237–246, 1983. 233. Lauf PK. Thiol-dependent passive K/Cl transport in sheep red cells. IV. Furosemide inhibition as a function of external Rb⫹, Na⫹, and Cl⫺. J Membr Biol 77: 57– 62, 1984. 234. Lauf PK and Adragna NC. K-Cl cotransport: properties and molecular mechanism. Cell Physiol Biochem 10: 341–354, 2000. 235. Lauf PK, Bauer J, Adragna NC, Fujise H, Zade-Oppen AMM, Ryu KH, and Delpire E. Erythrocyte K-Cl cotransport: properties and regulation. Am J Physiol Cell Physiol 263: C917–C932, 1992. 236. Lauf PK, McManus TJ, Haas M, Forbush B III, Duhm J, Flatman PW, Saier MH, and Russell JM. Physiology and biophysics of chloride and cation cotransport across cell membranes. Federation Proc 46: 2377–2394, 1987. 237. Lauf PK and Theg BE. A chloride dependent K⫹ flux induced by N-ethylmaleimide in genetically low K⫹ sheep and goat erythrocytes. Biochem Biophys Res Commun 92: 1422–1428, 1980. 238. Lauf PK, Zhang J, Delpire E, Fyffe RE, Mount DB, and Adragna NC. K-Cl co-transport: immunocytochemical and functional evidence for more than one KCC isoform in high K and low K sheep erythrocytes. Comp Biochem Physiol A Physiol 130: 499 –509, 2001. 239. Lazzaro D, De SV, De Magistris L, Lehtonen E, and Cortese R. LFB1 and LFB3 homeoproteins are sequentially expressed during kidney development. Development 114: 469 – 479, 1992. 240. Leinekugel X, Medina I, Khalilov I, Ben Ari Y, and Khazipov R. Ca2⫹ oscillations mediated by the synergistic excitatory actions of GABA(A) and NMDA receptors in the neonatal hippocampus. Neuron 18: 243–255, 1997. 241. Lemmink HH, Knoers NV, Karolyi L, van Dijk H, Niaudet P, Antignac C, Guay-Woodford LM, Goodyer PR, Carel JC, Hermes A, Seyberth HW, Monnens LA, and van den Heuvel LP. Novel mutations in the thiazide-sensitive NaCl cotransporter gene in patients with Gitelman syndrome with predominant localization to the C-terminal domain. Kidney Int 54: 720 –730, 1998. 242. Lemmink HH, van den Heuvel LP, van Dijk HA, Merkx GF, Smilde TJ, Taschner PE, Monnens LA, Hebert SC, and Knoers NV. Linkage of Gitelman syndrome to the thiazide-sensitive sodium-chloride cotransporter gene with identification of mutations in Dutch families. Pediatr Nephrol 10: 403– 407, 1996. 243. Li H, Tornberg J, Kaila K, Airaksinen MS, and Rivera C. Patterns of cation-chloride cotransporter expression during embryonic rodent CNS development. Eur J Neurosci 16: 2358 –2370, 2002.

85 • APRIL 2005 •

www.prv.org

488

GERARDO GAMBA

244. Li JH, Zuzack JS, and Kau ST. Winter flounder urinary bladder as a model tissue for assessing the potency of thiazide diuretics. In: Diuretics III: Chemistry, Pharmacology and Clinical Applications, edited by Puschett JB and Greenberg A. New York: Elsevier Science, 1990, p. 107–110. 245. Lin SH, Cheng NL, Hsu YJ, and Halperin ML. Intrafamilial phenotype variability in patients with Gitelman syndrome having the same mutations in their thiazide-sensitive sodium/chloride cotransporter. Am J Kidney Dis 43: 304 –312, 2004. 246. Liu X, Titz S, Lewen A, and Misgeld U. KCC2 mediates NH⫹ 4 uptake in cultured rat brain neurons. J Neurophysiol 90: 2785– 2790, 2003. 247. Loffing J and Kaissling B. Sodium and calcium transport pathways along the mammalian distal nephron: from rabbit to human. Am J Physiol Renal Physiol 284: F628 –F643, 2003. 248. Loffing J, Loffing-Cueni D, Valderrabano V, Klausli L, Hebert SC, Rossier BC, Hoenderop JG, Bindels RJ, and Kaissling B. Distribution of transcellular calcium and sodium transport pathways along mouse distal nephron. Am J Physiol Renal Physiol 281: F1021–F1027, 2001. 249. Lorenz JN, Baird NR, Judd LM, Noonan WT, Andringa A, Doetschman T, Manning PA, Liu LH, Miller ML, and Shull GE. Impaired renal NaCl absorption in mice lacking the ROMK potassium channel, a model for type II Bartter’s syndrome. J Biol Chem 277: 37871–37880, 2002. 250. Lu J, Karadsheh M, and Delpire E. Developmental regulation of the neuronal-specific isoform of K-Cl cotransporter KCC2 in postnatal rat brains. J Neurobiol 39: 558 –568, 1999. 251. Luo H, Beaumont K, Vaughn DA, and Fanestil DD. Solubilization of thiazide diuretic receptors from rat kidney membranes. Biochim Biophys Acta 1052: 119 –122, 1990. 252. Lytle C. Activation of the avian erythrocyte Na-K-Cl cotransport protein by cell shrinkage, cAMP, fluoride, and calyculin-A involves phosphorylation at common sites. J Biol Chem 272: 15069 –15077, 1997. 253. Lytle C. A volume sensitive protein kinase regulates the Na-K-2Cl cotransporter in duck red blood cells. Am J Physiol Cell Physiol 274: C1002–C1010, 1998. 254. Lytle C and Forbush B III. The Na-K-Cl cotransport protein of shark rectal gland. II. Regulation by direct phosphorylation. J Biol Chem 267: 25438 –25443, 1992. 255. Lytle C and Forbush B III. Regulatory phosphorylation of the secretory Na-K-Cl cotransporter: modulation by cytoplasmic Cl. Am J Physiol Cell Physiol 270: C437–C448, 1996. 256. Lytle C, Xu J, Biemesderfer D, Haas M, and Forbush B III. The Na-K-Cl cotransport protein of shark rectal gland. I. Development of monoclonal antibodies, immunoaffinity purification, and partial biochemical characterization. J Biol Chem 267: 25428 –25437, 1992. 257. MacKenzie S, Vaitkevicius H, and Lockette W. Sequencing and characterization of the human thiazide-sensitive Na-Cl cotransporter (SLC12A3) gene promoter. Biochem Biophys Res Commun 282: 991–1000, 2001. 258. Majid DSA and Navar GL. Blockade of distal nephron sodium transport attenuates pressure natriuresis in dogs. Hypertension 23: 1040 –1045, 1994. 259. Maki N, Komatsuda A, Wakui H, Ohtani H, Kigawa A, Aiba N, Hamai K, Motegi M, Yamaguchi A, Imai H, and Sawada KI. Four novel mutations in the thiazide-sensitive Na-Cl co-transporter gene in Japanese patients with Gitelman’s syndrome. Nephrol Dial Transplant. In press. 260. Mansfield TA, Simon DB, Farfel Z, Bia M, Tucci JR, Lebel M, Gutkin M, Vialettes B, Christofilis MA, Kauppinen-Makelin R, Mayan H, Risch N, and Lifton RP. Multilocus linkage of familial hyperkalaemia and hypertension, pseudohypoaldosteronism type II, to chromosomes 1q31– 42 and 17p11-q21. Nat Genet 16: 202–205, 1997. 261. Margolis BL and Lifschitz MD. The Spitzer-Weinstein syndrome: one form of type IV renal tubular acidosis and its response to hydrochlorothiazide. Am J Kidney Dis 7: 241–244, 1986. 262. Masilamani S, Kim GH, Mitchell C, Wade JB, and Knepper MA. Aldosterone-mediated regulation of ENaC alpha, beta, and gamma subunit proteins in rat kidney. J Clin Invest 104: R19 –R23, 1999. Physiol Rev • VOL

263. Masilamani S, Wang X, Kim GH, Brooks H, Nielsen J, Nielsen S, Nakamura K, Stokes JB, and Knepper MA. Time course of renal Na-K-ATPase, NHE3, NKCC2, NCC, and ENaC abundance changes with dietary NaCl restriction. Am J Physiol Renal Physiol 283: F648 –F657, 2002. 264. Mastroianni N, Bettinelli A, Bianchetti M, Colussi G, de Fusco M, Sereni F, Ballabio A, and Casari G. Novel molecular variants of the Na-Cl cotransporter gene are responsible for Gitelman syndrome. Am J Hum Genet 59: 1019 –1026, 1996. 265. Mastroianni N, DeFusco M, Zollo M, Arrigo G, Zuffardi O, Bettinelli A, Ballabio A, and Casari G. Molecular cloning, expression pattern, and chromosomal localization of the human Na-Cl thiazide-sensitive cotransporter (SLC12A3). Genomics 35: 486 – 493, 1996. 266. Mathieu J, Bedard F, Prevost C, and Langevin P. Motor and sensory neuropathies with or without agenesis of the corpus callosum: a radiological study of 64 cases. Can J Neurol Sci 17: 103–108, 1990. 267. Mayan H, Vered I, Mouallem M, Tzadok-Witkon M, Pauzner R, and Farfel Z. Pseudohypoaldosteronism type II: marked sensitivity to thiazides, hypercalciuria, normomagnesemia, and low bone mineral density. J Clin Endocrinol Metab 87: 3248 –3254, 2002. 268. McDonough AA, Geering K, and Farley RA. The sodium pump needs its beta subunit. FASEB J 4: 1598 –1605, 1990. 269. Meade P, Hoover RS, Plata C, Vazquez N, Bobadilla NA, Gamba G, and Hebert SC. cAMP-dependent activation of the renal-specific Na⫹-K⫹-2Cl⫺ cotransporter is mediated by regulation of cotransporter trafficking. Am J Physiol Renal Physiol 284: F1145–F1154, 2003. 270. Meade P, Sabath E, and Gamba G. Fisiopatologı´a molecular del sindrome de Bartter. Rev Invest Clin 55: 74 – 83, 2003. 271. Melander O, Orho-Melander M, Bengtsson K, Lindblad U, Rastam L, Groop L, and Hulthen UL. Genetic variants of thiazide-sensitive NaCl-cotransporter in Gitelman’s syndrome and primary hypertension. Hypertension 36: 389 –394, 2000. 272. Mercado A, de los Heros P, Vazquez N, Meade P, Mount DB, and Gamba G. Functional and molecular characterization of the K-Cl cotransporter of Xenopus laevis oocytes. Am J Physiol Cell Physiol 281: C670 –C680, 2001. 273. Mercado A, Mount DB, Cortes R, Vazquez N, and Gamba G. Functional characterization of two alternative isoforms of the KCC3 K-Cl cotransporter (Abstract). FASEB J 16: A58, 2002. 274. Mercado A, Mount DB, and Gamba G. Electroneutral cationchloride cotransporters in the central nervous system. Neurochem Res 29: 17–25, 2004. 275. Mercado A, Song L, Vazquez N, Mount DB, and Gamba G. Functional comparison of the K⫹-Cl⫺ cotransporters KCC1 and KCC4. J Biol Chem 275: 30326 –30334, 2000. 276. Merino A, Hebert SC, and Gamba G. Correlation between water salinity and tissue expression of the thiazide-sensitive cotransporter (TSC) in teleost (Abstract). J Am Soc Nephrol 10: 39A, 1999. 277. Meyer JW, Flagella M, Sutliff RL, Lorenz JN, Nieman ML, Weber CS, Paul RJ, and Shull GE. Decreased blood pressure and vascular smooth muscle tone in mice lacking basolateral Na(⫹)K(⫹)-2Cl(⫺) cotransporter. Am J Physiol Heart Circ Physiol 283: H1846 –H1855, 2002. 278. Mikawa S, Wang C, Shu F, Wang T, Fukuda A, and Sato K. Developmental changes in KCC1, KCC2 and NKCC1 mRNAs in the rat cerebellum. Brain Res 136: 93–100, 2002. 279. Molony DA, Reeves WB, and Andreoli TE. Na⫹:K⫹:2Cl⫺ cotransport and the thick ascending limb. Kidney Int 36: 418 – 426, 1989. 280. Molony DA, Reeves WB, Hebert SC, and Andreoli TE. ADH increases apical Na⫹,K⫹,2Cl⫺ entry in mouse medullary thick ascending limbs of Henle. Am J Physiol Renal Fluid Electrolyte Physiol 252: F177–F187, 1987. 281. Monkawa T, Kurihara I, Kobayashi K, Hayashi M, and Saruta T. Novel mutations in thiazide-sensitive Na-Cl cotransporter gene of patients with Gitelman’s syndrome. J Am Soc Nephrol 11: 65–70, 2000. 282. Monne M, Hermansson M, and von Heijne G. A turn propensity scale for transmembrane helices. J Mol Biol 288: 141–145, 1999.

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS 283. Monroy A, Plata C, Hebert SC, and Gamba G. Characterization of the thiazide-sensitive Na(⫹)-Cl(⫺) cotransporter: a new model for ions and diuretics interaction. Am J Physiol Renal Physiol 279: F161–F169, 2000. 284. Moore-Hoon ML and Turner RJ. Molecular and topological characterization of the rat parotid Na⫹-K⫹-2Cl⫺ cotransporter1. Biochim Biophys Acta 1373: 261–269, 1998. 285. Moore-Hoon ML and Turner RJ. The structural unit of the secretory Na⫹-K⫹-2Cl⫺ cotransporter (NKCC1) is a homodimer. Biochemistry 39: 3718 –3724, 2000. 286. Morel F, Chabardes D, Imbert-Teboul M, Le Bouffant F, HusCitharel A, and Montegut M. Multiple hormonal control of adenylate cyclase in distal segments of the rat kidney. Kidney Int Suppl 11: S55–S62, 1982. 287. Moreno E, Tovar-Palacio C, De Los HP, Guzman B, Bobadilla NA, Vazquez N, Riccardi D, Poch E, and Gamba G. A single nucleotide polymorphism alters the activity of the renal Na⫹:Cl⫺ cotransporter and reveals a role for transmembrane segment 4 in chloride and thiazide affinity. J Biol Chem 279: 16553–16560, 2004. 288. Moreno G, Merino A, Mercado A, Herrera JP, Gonza´lezSalazar J, Correa-Rotter R, Hebert SC, and Gamba G. Electronuetral Na-coupled cotransporter expression in the kidney during variations of NaCl and water metabolism. Hypertension 31: 1002–1006, 1998. 289. Mount DB, Arias I, Xie Q, Mercado A, and Gamba G. Cloning and characterization of SLC12A9, a new member of the cationchloride cotransporter gene family (Abstract). FASEB J 16: A807, 2002. 290. Mount DB, Baekgard A, Hall AE, Plata C, Xu J, Beier DR, Gamba G, and Hebert SC. Isoforms of the Na-K-2Cl transporter in murine TAL. I. Molecular characterization and intrarenal localization. Am J Physiol Renal Physiol 276: F347–F358, 1999. 291. Mount DB and Gamba G. Renal potassium-chloride cotransporters. Curr Opin Nephrol Hypertens 10: 685– 691, 2001. 292. Mount DB, Mercado A, Song L, Xu J, Geroge AL Jr, Delpire E, and Gamba G. Cloning and characterization of KCC3 and KCC4, new members of the cation-chloride cotransporter gene family. J Biol Chem 274: 16355–16362, 1999. 293. Mount DB, Song L, Mercado A, Gamba G, and Delpire E. Basolateral localization of renal tubular K-Cl cotransporters (Abstract). J Am Soc Nephrol 11: 35A, 2000. 294. Na KY, Oh YK, Han JS, Joo KW, Lee JS, Earm JH, Knepper MA, and Kim GH. Upregulation of Na⫹ transporter abundances in response to chronic thiazide or loop diuretic treatment in rats. Am J Physiol Renal Physiol 284: F133–F143, 2003. 295. Neubauer BA, Fiedler B, Himmelein B, Kampfer F, Lassker U, Schwabe G, Spanier I, Tams D, Bretscher C, Moldenhauer K, Kurlemann G, Weise S, Tedroff K, Eeg-Olofsson O, Wadelius C, and Stephani U. Centrotemporal spikes in families with rolandic epilepsy: linkage to chromosome 15q14. Neurology 51: 1608 – 1612, 1998. 296. Nielsen J, Kwon TH, Masilamani S, Beutler K, Hager H, Nielsen S, and Knepper MA. Sodium transporter abundance profiling in the kidney: effect of spironolactone. Am J Physiol Renal Physiol 283: F923–F933, 2002. 297. Nielsen S, Maunsbach AB, Ecelbarger CA, and Knepper MA. Ultrastructural localization of Na-K-2Cl cotransporter in thick ascending limb and macula densa of rat kidney. Am J Physiol Renal Physiol 275: F885–F893, 1998. 298. Nijenhuis T, Hoenderop JG, Loffing J, van der Kemp AW, van Os CH, and Bindels RJ. Thiazide-induced hypocalciuria is accompanied by a decreased expression of Ca2⫹ transport proteins in kidney. Kidney Int 64: 555–564, 2003. 299. Noel LE and Newgard CB. Structural domains that contribute to substrate specificity in facilitated glucose transporters are distinct from those involved in kinetic function: studies with GLUT-1/ GLUT-2 chimeras. Biochemistry 36: 5465–5475, 1997. 300. Novello FC and Sprague JM. Benzothiadiazine dioxides as novel diuretics. J Am Chem Soc 79: 2028 –2029, 1957. 301. Obermuller N, Bernstein P, Vela´zquez H, Reilly R, Moser D, Ellison DH, and Bachman S. Expression of the thiazide-sensitive Na-Cl cotransporter in rat and human kidney. Am J Physiol Renal Fluid Electrolyte Physiol 269: F900 –F910, 1995. Physiol Rev • VOL

489

302. O’Grady SM, Palfrey HC, and Field M. Characteristics and function of Na-K-Cl cotransport in epithelial tissues. Am J Physiol Cell Physiol 253: C177–C192, 1987. 303. Orlov SN, Adragna NC, Adarichev VA, and Hamet P. Genetic and biochemical determinants of abnormal monovalent ion transport in primary hypertension. Am J Physiol Cell Physiol 276: C511–C536, 1999. 304. Ortiz PA, Hong NJ, and Garvin JL. NO decreases thick ascending limb chloride absorption by reducing Na(⫹)- K(⫹)-2Cl(⫺) cotransporter activity. Am J Physiol Renal Physiol 281: F819 –F825, 2001. 305. Overdier DG, Ye H, Peterson RS, Clevidence DE, and Costa RH. The winged helix transcriptional activator HFH-3 is expressed in the distal tubules of embryonic and adult mouse kidney. J Biol Chem 272: 13725–13730, 1997. 306. Pace AJ, Lee E, Athirakul K, Coffman TM, O’Brien DA, and Koller BH. Failure of spermatogenesis in mouse lines deficient in the Na(⫹)-K(⫹)- 2Cl(⫺) cotransporter. J Clin Invest 105: 441– 450, 2000. 307. Pantanetti P, Arnaldi G, Balercia G, Mantero F, and Giacchetti G. Severe hypomagnesaemia-induced hypocalcaemia in a patient with Gitelman’s syndrome. Clin Endocrinol 56: 413– 418, 2002. 308. Pathak BG, Shaughnessy JD Jr, Meneton P, Greeb J, Shull GE, Jenkins NA and Copeland NG. Mouse chromosomal location of three epithelial sodium channel subunit genes and an apical sodium chloride cotransporter gene. Genomics 33: 124 –127, 1996. 309. Paver WK and Paulilne GJ. Hypertension and hyperpotassaemia without renal disease in a young male. Med J Aust 35: 305–306, 1964. 310. Payne JA. Functional characterization of the neuronal-specific K-Cl cotransporter: implications for [K⫹]o regulation. Am J Physiol Cell Physiol 273: C1516 –C1525, 1997. 311. Payne JA and Forbush B III. Alternatively spliced isoforms of the putative renal Na-K-Cl cotransporter are differentially distributed within the rabbit kidney. Proc Natl Acad Sci USA 91: 4544 – 4548, 1994. 312. Payne JA, Rivera C, Voipio J, and Kaila K. Cation-chloride co-transporters in neuronal communication, development and trauma. Trends Neurosci 26: 199 –206, 2003. 313. Payne JA, Stevenson TJ, and Donaldson LF. Molecular characterization of a putative K-Cl cotransporter in rat brain. A neuronal-specific isoform. J Biol Chem 271: 16245–16252, 1996. 314. Payne JA, Xu JC, Haas M, Lytle CY, Ward D, and Forbush B III. Primary structure, functional expression, and chromosomal localization of the bumetanide-sensitive Na-K-Cl cotransporter in human colon. J Biol Chem 270: 17977–17985, 1995. 315. Pearson MM, Lu J, Mount DB, and Delpire E. Localization of the K(⫹)-Cl(⫺) cotransporter, KCC3, in the central and peripheral nervous systems: expression in the choroid plexus, large neurons and white matter tracts. Neuroscience 103: 481– 491, 2001. 316. Pellegrino CM, Rybicki AC, Musto S, Nagel RL, and Schwartz RS. Molecular identification and expression of erythroid K:Cl cotransporter in human and mouse erythroleukemic cells. Blood Cells Mol Dis 24: 31– 40, 1998. 317. Perry PB and O’Neill WC. Swelling-activated K fluxes in vascular endothelial cells: volume regulation via K-Cl cotransport and K channels. Am J Physiol Cell Physiol 265: C763–C769, 1993. 318. Peters M, Jeck N, Reinalter S, Leonhardt A, Tonshoff B, Klaus GG, Konrad M, and Seyberth HW. Clinical presentation of genetically defined patients with hypokalemic salt-losing tubulopathies. Am J Med 112: 183–190, 2002. 319. Pickkers P, Garcha RS, Schachter M, Smits P, and Hughes AD. Inhibition of carbonic anhydrase accounts for the direct vascular effects of hydrochlorothiazide. Hypertension 33: 1043–1048, 1999. 320. Pickkers P, Hughes AD, Russei FGM, Thien T, and Smits P. Thiazide-induced vasodilation in humans is mediated by potassium channel activation. Hypertension 32: 1071–1076, 1998. 321. Piechotta K, Garbarini N, England R, and Delpire E. Characterization of the interaction of the stress kinase SPAK with the Na⫹-K⫹-2Cl⫺ cotransporter in the nervous system: evidence for a scaffolding role of the kinase. J Biol Chem 278: 52848 –52856, 2003.

85 • APRIL 2005 •

www.prv.org

490

GERARDO GAMBA

322. Piechotta K, Lu J, and Delpire E. Cation chloride cotransporters interact with the stress-related kinases Ste20-related proline-alanine-rich kinase (SPAK) and oxidative stress response 1 (OSR1). J Biol Chem 277: 50812–50819, 2002. 323. Plata C, Meade P, Hall AE, Welch RC, Vazquez N, Hebert SC, and Gamba G. Alternatively spliced isoform of the apical Na-K-Cl cotransporter gene encodes a furosemide sensitive Na-Cl cotransporter. Am J Physiol Renal Physiol 280: F574 –F582, 2001. 324. Plata C, Meade P, Vazquez N, Hebert SC, and Gamba G. Functional properties of the apical Na⫹-K⫹-2Cl⫺ cotransporter isoforms. J Biol Chem 277: 11004 –11012, 2002. 325. Plata C, Mount DB, Rubio V, Hebert SC, and Gamba G. Isoforms of the Na-K-2Cl cotransporter in murine TAL. II. Functional characterization and activation by cAMP. Am J Physiol Renal Physiol 276: F359 –F366, 1999. 326. Plotkin MD, Kaplan MR, Peterson LN, Gullans SR, Hebert SC, and Delpire E. Expression of the Na⫹-K⫹-2Cl⫺ cotransporter BSC2 in the nervous system. Am J Physiol Cell Physiol 272: C173– C183, 1997. 327. Plotkin MD, Kaplan MR, Verlander JM, Lee WS, Brown D, Poch E, Gullans SR, and Hebert SC. Localization of the thiazide sensitive Na-Cl cotransporter, rTSC1, in the rat kidney. Kidney Int 50: 174 –183, 1996. 328. Plotkin MD, Snyder EY, Hebert SC, and Delpire E. Expression of the Na-K-2Cl cotransporter is developmentally regulated in postnatal rat brains: a possible mechanism underlying GABA’s excitatory role in immature brain. J Neurobiol 33: 781–795, 1997. 329. Pollak MR, Delaney VB, Graham RM, and Hebert SC. Gitelman’s syndrome (Bartter’s variant) maps to the thiazide-sensitive cotransporter gene locus on chromosome 16q13 in a large kindred. J Am Soc Nephrol 7: 2244 –2248, 1996. 330. Quaggin SE, Payne JA, Forbush B III, and Igarashi P. Localization of the renal Na-K-Cl cotransporter gene (Slc12a1) on mouse chromosome 2. Mamm Genome 6: 557–558, 1995. 331. Race JE, Makhlouf FN, Logue PJ, Wilson FH, Dunham PB, and Holtzman EJ. Molecular cloning and functional characterization of KCC3, a new K-Cl cotransporter. Am J Physiol Cell Physiol 277: C1210 –C1219, 1999. 332. Randall J, Thorne T, and Delpire E. Partial cloning and characterization of Slc12a2: the gene encoding the secretory Na⫹-K⫹-2Cl⫺ cotransporter. Am J Physiol Cell Physiol 273: C1267–C1277, 1997. 333. Ray WA, Griffin MR, Downey W, and Melton LJ III. Long-term use of thiazide diuretics and risk of hip fracture. Lancet I: 687– 690, 1989. 334. Reeves WB, Molony DA, and Andreoli TE. Diluting power of thick limbs of Henle. III. Modulation of in vitro diluting power. Am J Physiol Renal Fluid Electrolyte Physiol 255: F1145–F1154, 1988. 335. Reeves WB, Winters CJ, and Andreoli TE. Chloride channels in the loop of Henle. Annu Rev Physiol 63: 631– 645, 2001. 336. Reid IR, Ames RW, Orr-Walker BJ, Clearwater JM, Horne AM, Evans MC, Murray MA, McNeil AR, and Gamble GD. Hydrochlorothiazide reduces loss of cortical bone in normal postmenopausal women: a randomized controlled trial. Am J Med 109: 362–370, 2000. 337. Reilly RF and Ellison DH. Mammalian distal tubule: physiology, pathophysiology, and molecular anatomy. Physiol Rev 80: 277–313, 2000. 338. Reinalter SC, Jeck N, Brochhausen C, Watzer B, Nusing RM, Seyberth HW, and Komhoff M. Role of cyclooxygenase-2 in hyperprostaglandin E syndrome/antenatal Bartter syndrome. Kidney Int 62: 253–260, 2002. 339. Reissinger A, Ludwig M, Utsch B, Promse A, Baulmann J, Weisser B, Vetter H, Kramer HJ, and Bokemeyer D. Novel NCCT gene mutations as a cause of Gitelman’s syndrome and a systematic review of mutant and polymorphic NCCT alleles. Kidney Blood Press Res 25: 354 –362, 2002. 340. Renfro JL. Water and ion transport by the urinary bladder of the teleost Pseudopleuronectus americanus. Am J Physiol 228: 52– 61, 1975. 341. Renfro JL. Interdependence of active Na⫹ and Cl⫺ transport by the isolated urinary bladder of the teleost, Pseudopleuronectes americanus. J Exp Zool 199: 383–390, 1977. Physiol Rev • VOL

342. Riccardi D and Gamba G. The many roles of the calcium-sensing receptor in health and disease. Arch Med Res 30: 436 – 448, 1999. 343. Riccardi D, Hall AE, Chattopadhyay N, Xu JZ, Brown EM, and Hebert SC. Localization of the extracellular Ca2⫹/polyvalent cation-sensing protein in rat kidney. Am J Physiol Renal Physiol 274: F611–F622, 1998. 344. Riccardi D, Lee WS, Lee K, Segre GV, Brown EM, and Hebert SC. Localization of the extracellular Ca2⫹-sensing receptor and PTH/PTHrP receptor in rat kidney. Am J Physiol Renal Fluid Electrolyte Physiol 271: F951–F956, 1996. 345. Rivera C, Li H, Thomas-Crusells J, Lahtinen H, Viitanen T, Nanobashvili A, Kokaia Z, Airaksinen MS, Voipio J, Kaila K, and Saarma M. BDNF-induced TrkB activation down-regulates the K⫹-Cl⫺ cotransporter KCC2 and impairs neuronal Cl⫺ extrusion. J Cell Biol 159: 747–752, 2002. 346. Rivera C, Voipio J, Payne JA, Ruusuvuori E, Lahtinen H, Lamsa K, Pirvola U, Saarma M, and Kaila K. The K⫹/Cl⫺ cotransporter KCC2 renders GABA hyperpolarizing during neuronal maturation. Nature 397: 251–255, 1999. 347. Rocha AS and Kokko JP. Sodium chloride and water transport in the medullary thick ascending limb of Henle. Evidence for active chloride transport. J Clin Invest 52: 612– 623, 1973. 348. Rose BD. Diuretics. Kidney Int 39: 336 –352, 1991. 349. Roussa E, Shmukler BE, Wilhelm S, Casula S, Stuart-Tilley AK, Thevenod F, and Alper SL. Immunolocalization of potassium-chloride cotransporter polypeptides in rat exocrine glands. Histochem Cell Biol 117: 335–344, 2002. 350. Rudomin P and Schmidt RF. Presynaptic inhibition in the vertebrate spinal cord revisited. Exp Brain Res 129: 1–37, 1999. 351. Russell JM. Sodium-potassium-chloride cotransport. Physiol Rev 80: 211–276, 2000. 352. Sabath E, Meade P, Berkman J, De Los HP, Moreno E, Bobadilla NA, Vazquez N, Ellison DH, and Gamba G. Pathophysiology of functional mutations of the thiazide-sensitive Na-Cl cotransporter in Gitelman disease. Am J Physiol Renal Physiol 287: F195– F203, 2004. 353. Sakaguchi N, Crouch JJ, Lytle C, and Schulte BA. Na-K-Cl cotransporter expression in the developing and senescent gerbil cochlea. Hear Res 118: 114 –122, 1998. 354. Sallinen R, Tornberg J, Putkiranta M, Horelli-Kuitunen N, Airaksinen MS, and Wessman M. Chromosomal localization of SLC12A5/Slc12a5, the human and mouse genes for the neuronspecific K(⫹)-Cl(⫺) cotransporter (KCC2) defines a new region of conserved homology. Cytogenet Cell Genet 94: 67–70, 2001. 355. Sangan P, Brill SR, Sangan S, Forbush B III, and Binder HJ. Basolateral K-Cl cotransporter regulates colonic potassium absorption in potassium depletion. J Biol Chem 275: 30813–30816, 2000. 356. Sasaki S and Imai M. Effects of vasopressin on water and NaCl transport across the in vitro perfused medullary thick ascending limb of Henle’s loop of mouse, rat, and rabbit kidneys. Pflu¨gers Arch 383: 215–221, 1980. 357. Schambelan M, Sebastian A, and Rector FC Jr. Mineralocorticoid-resistant renal hyperkalemia without salt wasting (type II pseudohypoaldosteronism): role of increased renal chloride reabsorption. Kidney Int 19: 716 –727, 1981. 358. Schlingmann KP, Konrad M, Jeck N, Waldegger P, Reinalter SC, Holder M, Seyberth HW, and Waldegger S. Salt wasting and deafness resulting from mutations in two chloride channels. N Engl J Med 350: 1314 –1319, 2004. 359. Schnermann J. Juxtaglomerular cell complex in the regulation of renal salt excretion. Am J Physiol Regul Integr Comp Physiol 274: R263–R279, 1998. 360. Schoenherr CJ, Paquette AJ, and Anderson DJ. Identification of potential target genes for the neuron-restrictive silencer factor. Proc Natl Acad Sci USA 93: 9881–9886, 1996. 361. Schoofs MW, Van der KM, Hofman A, de Laet CE, Herings RM, Stijnen T, Pols HA, and Stricker BH. Thiazide diuretics and the risk for hip fracture. Ann Intern Med 139: 476 – 482, 2003. 362. Schulte U, Hahn H, Konrad M, Jeck N, Derst C, Wild K, Weidemann S, Ruppersberg JP, Fakler B, and Ludwig J. pH gating of ROMK [K(ir)1.1] channels: control by an Arg-Lys-Arg triad disrupted in antenatal Bartter syndrome. Proc Natl Acad Sci USA 96: 15298 –15303, 1999.

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS 363. Schultheis PJ, Lorenz JN, Meneton P, Nieman ML, Riddle TM, Flagella M, Duffy JJ, Doetschman T, Miller ML, and Shull GE. Phenotype resembling Gitelman’s syndrome in mice lacking the apical Na⫹-Cl⫺ cotransporter of the distal convoluted tubule. J Biol Chem 273: 29450 –29155, 1998. 364. Schwiebert EM, Morales MM, Devidas S, Egan ME, and Guggino WB. Chloride channel and chloride conductance regulator domains of CFTR, the cystic fibrosis transmembrane conductance regulator. Proc Natl Acad Sci USA 95: 2674 –2679, 1998. 365. Sebastian A. Thiazides and bone. Am J Med 109: 429 – 430, 2000. 366. Shaer AJ. Inherited primary renal tubular hypokalemic alkalosis: a review of Gitelman and Bartter syndromes. Am J Med Sci 322: 316 –332, 2001. 367. Shen MR, Chou CY, and Ellory JC. Volume-sensitive KCl cotransport associated with human cervical carcinogenesis. Pflu¨gers Arch 440: 751–760, 2000. 368. Shen MR, Chou CY, Hsu KF, Hsu YM, Chiu WT, Tang MJ, Alper SL, and Ellory JC. KCl cotransport is an important modulator of human cervical cancer growth and invasion. J Biol Chem 278: 39941–39950, 2003. 369. Shen MR, Chou CY, Hsu KF, Liu HS, Dunham PB, Holtzman EJ, and Ellory JC. The KCl cotransporter isoform KCC3 can play an important role in cell growth regulation. Proc Natl Acad Sci USA 98: 14714 –14719, 2001. 370. Shmukler BE, Brugnara C, and Alper SL. Structure and genetic polymorphism of the mouse KCC1 gene. Biochim Biophys Acta 1492: 353–361, 2000. 371. Shull GE, Lane LK, and Lingrel JB. Amino-acid sequence of the beta-subunit of the (Na⫹⫹K⫹)ATPase deduced from a cDNA. Nature 321: 429 – 431, 1986. 372. Shull GE, Schwartz A, and Lingrel JB. Amino-acid sequence of the catalytic subunit of the (Na⫹K⫹)ATPase deduced from a complementary DNA. Nature 316: 691– 695, 1985. 373. Simon DB, Bindra RS, Mansfield TA, Nelson-Williamns C, Mendonca E, Stone R, Schurman S, Nayir A, Alpay H, Bakkaloglu A, Rodriguez-Soriano J, Morales JM, Sanjad SA, Taylor CM, Pilz D, Brem A, Trachtman H, Griswold W, Richard GA, John E, and Lifton RP. Mutations in the chloride channel gene, CLCNKB, cause Bartter’s syndrome type III. Nature Genet 17: 171–178, 1997. 374. Simon DB, Farfel Z, Ellison D, Bia M, Tucci J, and Lifton RP. Examination of the thiazide-sensitive Na-Cl cotransporter as a candidate gene in Gordon’s syndrome (Abstract). J Am Soc Nephrol 6: 632, 1995. 375. Simon DB, Karet FE, Hamdan JM, Di Pietro A, Sanjad SA, and Lifton RP. Bartter’s syndrome, hypokalaemic alkalosis with hypercalciuria, is caused by mutations in the Na-K-2Cl cotransporter NKCC2. Nature Genet 13: 183–188, 1996. 376. Simon DB, Karet FE, Rodriguez-Soriano J, Hamdan JH, DiPietro A, Trachtman H, Sanjad SA, and Lifton RP. Genetic heterogeneity of Bartter’s syndrome revealed by mutations in the K⫹ channel, ROMK. Nature Genet 14: 152–156, 1996. 377. Simon DB, Nelson-Williams C, Johnson-Bia M, Ellison D, Karet FE, Morey-Molina A, Vaara I, Iwata F, Cushner HM, Koolen M, Gainza FJ, Gitelman HJ, and Lifton RP. Gitelman’s variant of Bartter’s syndrome, inherited hypokalaemic alkalosis, is caused by mutations in the thiazide-sensitive Na-Cl cotransporter. Nature Genet 12: 24 –30, 1996. 378. Smith HW. From Fish to Philosopher. Boston, MA: Little Brown, 1953. 379. Snouwaert JN, Brigman KK, Latour AM, Malouf NN, Boucher RC, Smithies O, and Koller BH. An animal model for cystic fibrosis made by gene targeting. Science 257: 1083–1088, 1992. 380. Song L, Mercado A, Vazquez N, Xie Q, Desai R, George AL, Gamba G, and Mount DB. Molecular, functional, and genomic characterization of human KCC2, the neuronal K-Cl cotransporter. Brain Res 103: 91–105, 2002. 381. Spitzer A, Edelmann CM Jr, Goldberg LD, and Henneman PH. Short stature, hyperkalemia and acidosis: a defect in renal transport of potassium. Kidney Int 3: 251–257, 1973. 382. Starke LC and Jennings ML. K-Cl cotransport in rabbit red cells: further evidence for regulation by protein phosphatase type 1. Am J Physiol Cell Physiol 264: C118 –C124, 1993. Physiol Rev • VOL

491

383. Starremans PF, Der Kemp AM, Knoers NM, van Den Heuvel LJ, and Bindels RM. Functional implications of mutations in the human renal outer medullary potassium channel (ROMK2) identified in Bartter syndrome. Pflu¨gers Arch 443: 466 – 472, 2002. 384. Starremans PG, Kersten FF, Knoers NV, van den Heuvel LP, and Bindels RJ. Mutations in the human Na-K-2Cl cotransporter (NKCC2) identified in Bartter syndrome type I consistently result in nonfunctional transporters. J Am Soc Nephrol 14: 1419 –1426, 2003. 385. Starremans PG, Kersten FF, van den Heuvel LP, Knoers NV, and Bindels RJ. Dimeric architecture of the human bumetanidesensitive Na-K-Cl co-transporter. J Am Soc Nephrol 14: 3039 –3046, 2003. 386. Stokes GS, Gentle JL, Edwards KD, and Stewart JH. Syndrome of idiopathic hyperkalaemia and hypertension with decreased plasma renin activity: effects on plasma renin and aldosterone of reducing the serum potassium level. Med J Aust 2: 1050 – 1054, 1968. 387. Stokes JB. Effect of prostaglandin E2 on chloride transport across the rabbit thick ascending limb of Henle. Selective inhibitions of the medullary portion. J Clin Invest 64: 495–502, 1979. 388. Stokes JB. Passive NaCl transport in the flounder urinary bladder: predominance of a cellular pathway. Am J Physiol Renal Fluid Electrolyte Physiol 255: F229 –F236, 1988. 389. Stokes JB, Lee I, and D’Amico M. Sodium chloride absorption by the urinary bladder of the winter flounder. A thiazide-sensitive, electrically neutral transport system. J Clin Invest 74: 7–16, 1984. 390. Strange K, Singer TD, Morrison R, and Delpire E. Dependence of KCC2 K-Cl cotransporter activity on a conserved carboxy terminus tyrosine residue. Am J Physiol Cell Physiol 279: C860 –C867, 2000. 391. Strausberg RL, Feingold EA, Grouse LH, Derge JG, Klausner RD, Collins FS, Wagner L, Shenmen CM, Schuler GD, Altschul SF, Zeeberg B, Buetow KH, Schaefer CF, Bhat NK, Hopkins RF, Jordan H, Moore T, Max SI, Wang J, Hsieh F, Diatchenko L, Marusina K, Farmer AA, Rubin GM, Hong L, Stapleton M, Soares MB, Bonaldo MF, Casavant TL, Scheetz TE, Brownstein MJ, Usdin TB, Toshiyuki S, Carninci P, Prange C, Raha SS, Loquellano NA, Peters GJ, Abramson RD, Mullahy SJ, Bosak SA, McEwan PJ, McKernan KJ, Malek JA, Gunaratne PH, Richards S, Worley KC, Hale S, Garcia AM, Gay LJ, Hulyk SW, Villalon DK, Muzny DM, Sodergren EJ, Lu X, Gibbs RA, Fahey J, Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M, Madan A, Young AC, Shevchenko Y, Bouffard GG, Blakesley RW, Touchman JW, Green ED, Dickson MC, Rodriguez AC, Grimwood J, Schmutz J, Myers RM, Butterfield YS, Krzywinski MI, Skalska U, Smailus DE, Schnerch A, Schein JE, Jones SJ, and Marra MA. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci USA 99: 16899 –16903, 2002. 392. Su W, Shmukler BE, Chernova MN, Stuart-Tilley AK, de Franceschi L, Brugnara C, and Alper SL. Mouse K-Cl cotransporter KCC1: cloning, mapping, pathological expression, and functional regulation. Am J Physiol Cell Physiol 277: C899 –C912, 1999. 393. Sun A, Grossman EB, Lombardi M, and Hebert SC. Vasopressin alters the mechanism of apical Cl⫺ entry from Na⫹:Cl⫺ to Na⫹:K⫹: 2Cl⫺ cotransport in mouse medullary thick ascending limb. J Membr Biol 120: 83–94, 1991. 394. Sung KW, Kirby M, McDonald MP, Lovinger DM, and Delpire E. Abnormal GABAA receptor-mediated currents in dorsal root ganglion neurons isolated from Na-K-2Cl cotransporter null mice. J Neurosci 20: 7531–7538, 2000. 395. Syren ML, Tedeschi S, Cesareo L, Bellantuono R, Colussi G, Procaccio M, Ali A, Domenici R, Malberti F, Sprocati M, Sacco M, Miglietti N, Edefonti A, Sereni F, Casari G, Coviello DA, and Bettinelli A. Identification of fifteen novel mutations in the SLC12A3 gene encoding the Na-Cl Co-transporter in Italian patients with Gitelman syndrome. Hum Mutat 20: 78, 2002. 396. Tajima T, Kobayashi Y, Abe S, Takahashi M, Konno M, Nakae J, Okuhara K, Satoh K, Ishikawa T, Imai T, and Fujieda K. Two novel mutations of thiazide-sensitive Na-Cl cotransporter

85 • APRIL 2005 •

www.prv.org

492

397.

398.

399.

400.

401.

402.

403.

404.

405.

406.

407.

408.

409.

410.

411.

412.

413.

GERARDO GAMBA (TSC) gene in two sporadic Japanese patients with Gitelman syndrome. Endocr J 49: 91–96, 2002. Takahashi N, Chernavvsky DR, Gomez RA, Igarashi P, Gitelman HJ, and Smithies O. Uncompensated polyuria in a mouse model of Bartter’s syndrome. Proc Natl Acad Sci USA 97: 5434 – 5439, 2000. Takeuchi K, Kure S, Kato T, Taniyama Y, Takahashi N, Ikeda Y, Abe T, Narisawa K, Muramatsu Y, and Abe K. Association of a mutation in thiazide-sensitive Na-Cl cotransporter with familial Gitelman’s syndrome. J Clin Endocrinol Metab 81: 4496 – 4499, 1996. Tamari M, Daigo Y, and Nakamura Y. Isolation and characterization of a novel serine threonine kinase gene on chromosome 3p22–21.3. J Hum Genet 44: 116 –120, 1999. Taniyama Y, Sato K, Sugawara A, Uruno A, Ikeda Y, Kudo M, Ito S, and Takeuchi K. Renal tubule-specific transcription and chromosomal localization of rat thiazide-sensitive Na-Cl cotransporter gene. J Biol Chem 276: 26260 –26268, 2001. The ALLHAT Officers and Coordinators for the ALLHAT Collaborative Research Group. Major outcomes in high-risk hypertensive patients randomized to angiotensin-converting enzyme inhibitor or calcium channel blocker vs diuretic: the Antihypertensive and Lipid-Lowering Treatment to Prevent Heart Attack Trial (ALLHAT). JAMA 288: 2981–2997, 2002. Torikai S and Kurokawa K. Effect of PGE2 on vasopressindependent cell cAMP in isolated single nephron segments. Am J Physiol Renal Fluid Electrolyte Physiol 245: F58 –F66, 1983. Tovar-Palacio C, Bobadilla NA, Cortes P, Plata C, De los Heros P, Vazquez N, and Gamba G. Ion and diuretic specificity of chimeric proteins between apical Na⫹:K⫹:2Cl⫺ and Na⫹:Cl⫺ cotransporters. Am J Physiol Renal Physiol 287: F570 –F577, 2004. Tran JM, Farrell MA, and Fanestil DD. Effect of ions on binding of the thiazide-type diuretic metolazone to kidney membrane. Am J Physiol Renal Fluid Electrolyte Physiol 258: F908 –F915, 1990. Turban S, Wang XY, and Knepper MA. Regulation of NHE3, NKCC2 and NCC abundance in kidney during aldosterone-escape phenomenon: role of NO. Am J Physiol Renal Physiol 285: F843– F841, 2003. Turner RJ and Geroge JN. Solubilization and partial purification of the rabbit parotid Na/K/Cl-dependent bumetanide binding site. J Membr Biol 113: 203–210, 1990. Ushiro H, Tsutsumi T, Suzuki K, Kayahara T, and Nakano K. Molecular cloning and characterization of a novel Ste20-related protein kinase enriched in neurons and transporting epithelia. Arch Biochem Biophys 355: 233–240, 1998. Vargas-Poussou R, Feldman D, Vollmer M, Konrad M, Kelly L, Van der Heuvel LPWJ, Tebouri L, Brandis M, Karolyi L, Hebert SC, Lemmink HH, Descheˆnes G, Hildebrandt F, Seyberth HW, Guay-Woodford LM, Knoers NVAM, and Antignac C. Novel molecular variants of the Na-K-2Cl cotransporter gene are responsible for atenatal Bartter syndrome. Am J Hum Genet 62: 1332–1340, 1998. Vargas-Poussou R, Huang C, Hulin P, Houillier P, Jeunemaitre X, Paillard M, Planelles G, Dechaux M, Miller RT, and Antignac C. Functional characterization of a calcium-sensing receptor mutation in severe autosomal dominant hypocalcemia with a Bartter-like syndrome. J Am Soc Nephrol 13: 2259 –2266, 2002. Vazquez N, Monroy A, Dorantes E, Munoz-Clares RA, and Gamba G. Functional differences between flounder and rat thiazide-sensitive Na-Cl cotransporter. Am J Physiol Renal Physiol 282: F599 –F607, 2002. Velazquez H, Bartiss A, Bernstein P, and Ellison DH. Adrenal steroids stimulate thiazide-sensitive NaCl transport by rat renal distal tubules. Am J Physiol Renal Fluid Electrolyte Physiol 270: F211–F219, 1996. Velazquez H, Good DW, and Wright FS. Mutual dependence of sodium and chloride absorption by renal distal tubule. Am J Physiol Renal Fluid Electrolyte Physiol 247: F904 –F911, 1984. Velazquez H, Naray-Fejes-Toth A, Silva T, Andujar E, Reilly RF, Desir GV, and Ellison DH. Rabbit distal convoluted tubule coexpresses NaCl cotransporter and 11 beta-hydroxysteroid dehydrogenase II mRNA. Kidney Int 54: 464 – 472, 1998. Physiol Rev • VOL

414. Velazquez H and Silva T. Cloning and localization of KCC4 in rabbit kidney: expression in distal convoluted tubule. Am J Physiol Renal Physiol 285: F49 –F58, 2003. 415. Verissimo F and Jordan P. WNK kinases, a novel protein kinase subfamily in multi-cellular organisms. Oncogene 20: 5562–5569, 2001. 416. Verlander JM, Tran TM, Zhang L, Kaplan MR, and Hebert SC. Estradiol enhances thiazide-sensitive NaCl cotransporter density in the apical plasma membrane of the distal convoluted tubule in ovariectomized rats. J Clin Invest 101: 1661–1669, 1998. 417. Vetter DE, Mann JR, Wangemann P, Liu J, McLaughlin KJ, Lesage F, Marcus DC, Lazdunski M, Heinemann SF, and Barhanin J. Inner ear defects induced by null mutation of the isk gene. Neuron 17: 1251–1264, 1996. 418. Vibat CR, Holland MJ, Kang JJ, Putney LK, and O’Donnell ME. Quantitation of Na⫹-K⫹-2Cl⫺ cotransport splice variants in human tissues using kinetic polymerase chain reaction. Anal Biochem 298: 218 –230, 2001. 419. Vollmer M, Koehrer M, Topaloglu R, Strahm B, Omran H, and Hildebrandt F. Two novel mutations of the gene for Kir 1.1 (ROMK) in neonatal Bartter syndrome. Pediatr Nephrol 12: 69 –71, 1998. 420. Vu TQ, Payne JA, and Copenhagen DR. Localization and developmental expression patterns of the neuronal K-Cl cotransporter (KCC2) in the rat retina. J Neurosci 20: 1414 –1423, 2000. 421. Waldegger S, Jeck N, Barth P, Peters M, Vitzthum H, Wolf K, Kurtz A, Konrad M, and Seyberth HW. Barttin increases surface expression and changes current properties of ClC-K channels. Pflu¨gers Arch 444: 411– 418, 2002. 423. Wang J, Pravenec M, Kren V, and Kurtz TW. Linkage mapping of the Na-K-2Cl cotransporter gene (Slc12a1) to rat chromosome 3. Mamm Genome 8: 379, 1997. 424. Wang XY, Masilamani S, Nielsen J, Kwon TH, Brooks HL, Nielsen S, and Knepper MA. The renal thiazide-sensitive Na-Cl cotransporter as mediator of the aldosterone-escape phenomenon. J Clin Invest 108: 215–222, 2001. 425. Wang Z, Yang CL, and Ellison DH. Comparison of WNK4 and WNK1 kinase and inhibiting activities. Biochem Biophys Res Commun 317: 939 –944, 2004. 426. Ward DT, Yau SK, Mee AP, Mawer EB, Miller CA, Garland HO, and Riccardi D. Functional, molecular, and biochemical characterization of streptozotocin-induced diabetes. J Am Soc Nephrol 12: 779 –790, 2001. 427. Warnock DG and Eveloff J. K-Cl cotransport systems. Kidney Int 36: 412– 417, 1989. 428. Wasnich R, Davis J, Ross P, and Vogel J. Effect of thiazide on rates of bone mineral loss: a longitudinal study. Br Med J 301: 1303–1305, 1990. 429. Watanabe S, Fukumoto S, Chang H, Takeuchi Y, Hasegawa Y, Okazaki R, Chikatsu N, and Fujita T. Association between activating mutations of calcium-sensing receptor and Bartter’s syndrome. Lancet 360: 692– 694, 2002. 430. Weil-Maslansky E, Gutman Y, and Sasson S. Insulin activates furosemide-sensitive K⫹ and Cl⫺ uptake system in BC3H1 cells. Am J Physiol Cell Physiol 267: C932–C939, 1994. 431. Weinstein SF, Allan DM, and Mendoza SA. Hyperkalemia, acidosis, and short stature associated with a defect in renal potassium excretion. J Pediatr 85: 355–358, 1974. 432. Williams JR and Payne JA. Cation transport by the neuronal K-Cl cotransporter, KCC2: thermodynamics and kinetics of alternate transport modes. Am J Physiol Cell Physiol 2004. 433. Wilson FH, Disse-Nicodeme S, Choate KA, Ishikawa K, Nelson-Williams C, Desitter I, Gunel M, Milford DV, Lipkin GW, Achard JM, Feely MP, Dussol B, Berland Y, Unwin RJ, Mayan H, Simon DB, Farfel Z, Jeunemaitre X, and Lifton RP. Human hypertension caused by mutations in WNK kinases. Science 293: 1107–1112, 2001. 434. Wilson FH, Kahle KT, Sabath E, Lalioti MD, Rapson AK, Hoover RS, Hebert SC, Gamba G, and Lifton RP. Molecular pathogenesis of inherited hypertension with hyperkalemia: the Na-Cl cotransporter is inhibited by wild-type but not mutant WNK4. Proc Natl Acad Sci USA 100: 680 – 684, 2003.

85 • APRIL 2005 •

www.prv.org

ELECTRONEUTRAL CATION-CHLORIDE COTRANSPORTERS 435. Winters CJ, Reeves WB, and Andreoli TE. A survey of transport properties of the thick ascending limb. Semin Nephrol 11: 236 –247, 1991. 436. Wolf K, Castrop H, Riegger GA, Kurtz A, and Kramer BK. Differential gene regulation of renal salt entry pathways by salt load in the distal nephron of the rat. Pflu¨gers Arch 442: 498 –504, 2001. 437. Woo NS, Lu J, England R, McClellan R, Dufour S, Mount DB, Deutch AY, Lovinger DM, and Delpire E. Hyperexcitability and epilepsy associated with disruption of the mouse neuronal-specific K-Cl cotransporter gene. Hippocampus 12: 258 –268, 2002. 438. Wu Q, Delpire E, Hebert SC, and Strange K. Functional demonstration of Na⫹-K⫹-2Cl⫺ cotransporter activity in isolated, polarized choroid plexus cells. Am J Physiol Cell Physiol 275: C1565– C1572, 1998. 439. Xu B, English JM, Wilsbacher JL, Stippec S, Goldsmith EJ, and Cobb MH. WNK1, a novel mammalian serine/threonine protein kinase lacking the catalytic lysine in subdomain II. J Biol Chem 275: 16795–16801, 2000. 440. Xu JC, Lytle C, Zhu TT, Payne JA, Benz E Jr, and Forbush B III. Molecular cloning and functional expression of the bumetanide-sensitive Na-K-Cl cotransporter. Proc Natl Acad Sci USA 91: 2201–2205, 1994. 441. Xu JZ, Hall AE, Peterson LN, Bienkowski MJ, Eessalu TE, and Hebert SC. Localization of the ROMK protein on apical membranes of rat kidney nephron segments. Am J Physiol Renal Physiol 273: F739 –F749, 1997. 442. Yahata K, Tanaka I, Kotani M, Mukoyama M, Ogawa Y, Goto M, Nakagawa M, Sugawara A, Tanaka K, Shimatsu A, and Nakao K. Identification of a novel R642C mutation in Na/Cl cotransporter with Gitelman’s syndrome. Am J Kidney Dis 34: 845– 853, 1999. 443. Yamada J, Okabe A, Toyoda H, Kilb W, Luhmann HJ, and Fukuda A. Cl⫺ uptake promoting depolarizing GABA actions in immature rat neocortical neurones is mediated by NKCC1. J Physiol 557: 829 – 841, 2004.

Physiol Rev • VOL

493

444. Yamauchi K, Rai T, Kobayashi K, Sohara E, Suzuki T, Itoh T, Suda S, Hayama A, Sasaki S, and Uchida S. Disease-causing mutant WNK4 increases paracellular chloride permeability and phosphorylates claudins. Proc Natl Acad Sci USA 101: 4690 – 4694, 2004. 445. Yan GX, Chen J, Yamada KA, Kleber AG, and Corr PB. Contribution of shrinkage of extracellular space to extracellular K⫹ accumulation in myocardial ischaemia of the rabbit. J Physiol 490: 215–228, 1996. 446. Yang CL, Angell J, Mitchell R, and Ellison DH. WNK kinases regulate thiazide-sensitive Na-Cl cotransport. J Clin Invest 111: 1039 –1045, 2003. 447. Yang T, Huang YG, Singh I, Schnermann J, and Briggs JP. Localization of bumetanide- and thiazide-sensitive Na-K-Cl cotransporters along the rat nephron. Am J Physiol Renal Fluid Electrolyte Physiol 271: F931–F939, 1996. 448. Yerby TR, Vibat CRT, Sun D, Payne JA, and O’Donnell ME. Molecular characterization of the Na-K-Cl cotransporter of bovine aortic endothelial cells. Am J Physiol Cell Physiol 273: C188 –C197, 1997. 449. Yoo TH, Lee SH, Yoon K, Baek H, Chung JH, Lee T, Ihm C, and Kim M. Identification of novel mutations in Na-Cl cotransporter gene in a Korean patient with atypical Gitelman’s syndrome. Am J Kidney Dis 42: E11–E16, 2003. 450. Zade-Oppen AM and Lauf PK. Thiol-dependent passive K:Cl transport in sheep red blood cells. IX. Modulation by pH in the presence and absence of DIDS and the effect of NEM. J Membr Biol 118: 143–151, 1990. 451. Zhou GP, Wong C, Su R, Crable SC, Anderson KP, and Gallagher PG. Human potassium chloride cotransporter 1 (SLC12A4) promoter is regulated by AP-2 and contains a functional downstream promoter element. Blood 103: 4302– 4309, 2004. 452. Ziyadeh FN, Kelepouris E, and Agus ZS. Thiazides stimulate calcium absorption in urinary bladder of winter flounder. Biochim Biophys Acta 897: 52–56, 1987.

85 • APRIL 2005 •

www.prv.org