Mol Biol Rep (2014) 41:1237–1245 DOI 10.1007/s11033-013-2968-6
Identification of Dmrt genes and their up-regulation during gonad transformation in the swamp eel (Monopterus albus) Yue Sheng • Bo Chen • Liao Zhang • Majing Luo • Hanhua Cheng • Rongjia Zhou
Received: 2 July 2013 / Accepted: 23 December 2013 / Published online: 5 January 2014 Ó Springer Science+Business Media Dordrecht 2014
Abstract The swamp eel is a teleost fish with a characteristic of natural sex reversal and an ideal model for vertebrate sexual development. However, underlying molecular mechanisms are poorly understood. We report the identification of five DM (doublesex and mab-3) domain genes in the swamp eel that include Dmrt2, Dmrt2b, Dmrt3, Dmrt4 and Dmrt5, which encode putative proteins of 527, 373, 471, 420 and 448 amino acids, respectively. Phylogenetic tree showed that these genes are clustered into corresponding branches of the DM genes in vertebrates. Southern blot analysis indicated that the Dmrt1–Dmrt3–Dmrt2 genes are tightly linked in a conserved gene cluster. Notably, these Dmrt genes are up-regulated during gonad transformation. Furthermore, mRNA in situ hybridisation showed that Dmrt2, Dmrt3, Dmrt4 and Dmrt5 are expressed in developing germ cells. These results are evidence that the DM genes are involved in sexual differentiation in the swamp eel. Keywords Sexual differentiation Sex reversal Development Fish
Introduction The swamp eel or the rice field eel (Monopterus albus) is a natural sex reversal fish. In their early stage of life, all
Y. Sheng B. Chen L. Zhang M. Luo H. Cheng (&) R. Zhou (&) Department of Genetics and Center for Developmental Biology, College of Life Sciences, Wuhan University, Wuhan 430072, People’s Republic of China e-mail:
[email protected] R. Zhou e-mail:
[email protected]
swamp eels are female. After spawning, they will go through a special stage of intersex and develop an ovotestis, and then their gonads will gradually transform into a testis. After completing this stage, swamp eels all become males [1, 2]. This developmental process provides an ideal model for studying sexual development and differentiation [3]. In mammals, SRY is a master male sex-determining gene located on the Y chromosome [4–6]. Additional autosomal genes also participate in sex determination or differentiation. A cluster of DM domain genes including DMRT1, which is located on the 9p critical region, is involved in sex reversal in humans [7, 8]. The deletion of Dmrt1 in mice leads to the failure of testes differentiation after determination [9]. In chickens, DMRT1 is located on the Z chromosome and required for male sex determination [10]. In Xenopus, a DM domain gene DM-W on the W chromosome is a critical gene that determines ovary development [11]. In fish, Dmy/Dmrt1Y, which is a duplicated copy of Dmrt1 on the Y chromosome, is required for male sex determination in the teleost fish, medaka [12, 13]. Recently, several novel master sex-determining genes (or candidate genes) have been identified in fish species, including amhy in the Patagonian pejerrey, Gsdf in Oryzias luzonensis, Amhr2 in fugu and sdY in rainbow trout [14–18]. It seems that sex determination and differentiation in fish are complex because of diverse range of species and underlying molecular mechanisms need to be studied. The Drosophila doublesex (dsx) and Caenorhabditis elegans mab-3 genes are evolutionarily conserved, and both play a similar role in sex determination [19]. They encode transcription factors containing a DM domain with DNAbinding ability [19, 20]. In invertebrates, Drosophila has four and C. elegans has eleven DM domain genes, whereas in mammals, mouse has seven and human has eight; six DM domain genes have been identified in the teleost fish [21–27].
123
1238
In addition to a role in sex determination, the members of the Dmrt family also exert their functions in the development of other non-gonadal tissues [28]. Dmrt2a is an essential factor for somite development and left–right patterning [29, 30]. Dmrt2b, a duplicated copy of the zebrafish Dmrt2a gene, is fish specific, but its function remains unknown [31]. Dmrt3 is expressed in the olfactory placode, the neural tube and germ cells in zebrafish [32]. Dmrt4 knockout mice show polyovular follicles in female mice and copulatory behaviour toward other males in mice [33]. The Dmrt4-deficient embryos in Xenopus show impaired neurogenesis in the olfactory epithelium [34]. Dmrt5 in zebrafish is expressed in the brain and developing germ cells in both the testis and ovary [35]. Dmrt5 is also required for neurogenesis in Xenopus, a similar role to Dmrt4 [36]. We have previously identified Dmrt1, Dmrt2b, Dmrt3 and Dmrt5 in zebrafish and characterised their expression [31, 32, 35, 37]. In the swamp eel, we have cloned four transcripts of Dmrt1 generated by alternative splicing, characterised their differential expression during gonad transformation from ovary via ovotestis to testis [38, 39]. To further examine the role of the DM domain genes in the swamp eel genome and their expression during sex reversal, we identified another five Dmrt genes, characterised their expression, and determined the linkage relationship of a cluster of the Dmrt1–Dmrt3–Dmrt2 genes.
Materials and methods Animals The swamp eels (M. albus) were obtained from markets in the Wuhan area of China. Their sexes were confirmed by microscopic analysis of gonad sections using a cryostat microtome (CM1850, Leica, Bensheim, Germany). RNA isolation and cDNA synthesis Total RNAs were isolated from adult tissues with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Total RNAs were digested by RNase-free DNase I and then purified by phenol/chloroform (1:1). The cDNAs were reverse transcribed from the RNAs using the MMLV system (Promega, Madison, WI, USA) with 0.5 lg of oligo (dT)18 and 5 lg of total RNAs in a 25 ll reaction. The RACE cDNAs were reverse transcribed from the testis RNAs using the MMLV system (Promega) with 0.5 lg of primer CDSIII and 5 lg of total RNAs in a 25 ll reaction. CDSIII sequence is as follows: 50 -ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)30N_1 N-30 (N = A/G/C/T, N_1 = A/G/C). The RACE cDNAs were
123
Mol Biol Rep (2014) 41:1237–1245
purified by phenol/chloroform (1:1), 100 % alcohol deposited, and then treated with dCTP using terminal deoxynucleotidyl transferase (TdT) (Promega) for 15 min. Degenerate PCR and RACE Degenerate PCR was used to amplify the conserved regions of the Dmrt genes using designed degenerate primers (all primers are from 50 to 30 ): Dmrt2-S1, 50 (C/T)T(C/G)ATCTCCTCCAA(T/C)GTCA GCGT30 ; Dmrt2-A1, 50 CTG(G/A)AAGGAGTTGA(G/A)TTTCA TGGA30 ; Dmrt2b-S1, 50 CTG(C/T) (A/C)G(A/G)AACCACGG CGTCG30 ; Dmrt2b-A1, 50 TT(C/G)CG(A/G)G(A/C) (A/G)GAGAA GGAGTA30 ; Dmrt3-S1, 50 TGCGC (A/C/G)(C/A)G(A/G)TGC(C/A) G(A/G)AACCACGG30 ; Dmrt3-A1, 50 GTATTCCACAGGGTCACGTC (G/A) TT30 ; Dmrt4-S1, 50 GCCACAAGCGCTTCTGCCG30 ; Dmrt4-A1, 50 (T/G)GGCAT(C/G)AGTCC(T/C/G)GAT GTC30 ; Dmrt5-S1, 50 GCATGGATTCTGAGACC (G/T)GAG(C/ A)T(C/T) 30 ; Dmrt5-A1, 50 CAAGTCGCTGAAGGCATAGTCCA30 . The PCR conditions were as follows: 94 °C for 5 min, 35 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 90 s. PCR products were cloned into the pGEM-T easy vector (Promega) and sequenced. Based on the above sequences, 30 RACEs of Dmrt genes were performed using a common CDSIII primer and gene specific primers: Dmrt2-S2, 50 ATCCTGACCGTGCTGATCCCAAAC30 ; Dmrt2b-S2, 50 AAGCTCAGAGCAAACCAGGG30 ; Dmrt3-S2, 50 GAGCCCCGCCGATGACAGAGGAG30 ; Dmrt4-S2, 50 GAAGGTCGCTTTCCTCCTCA30 ; Dmrt5-S2, 50 AACGAGTGATGGCGGCGCAAGT30 . The PCR conditions were as follows: 94 °C for 5 min, 35 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 90 s and a final 72 °C for 2 min. The 50 RACE of Dmrt genes was performed using a common 5MDP primer 50 -GGCCACGCGTCGACTAGTACGGGGGGGGGG-30 and gene specific primers: Dmrt2-A2, 50 GGCATTGAACAGGCACTGCTGATAG30 ; Dmrt2b-A2, 50 CAGCATGAGGAACTGCCTGG30 ; Dmrt3-A2, 50 CGGGGTGTAGCAGGAGTTTGGTTTG30 ; Dmrt4-A2, 50 GGCGTGTTTGGGTGGTTAGA30 ;
Mol Biol Rep (2014) 41:1237–1245
Dmrt5-A2, 50 CGAGGGAGCTAACGGACCCAGGAG30 . The PCR conditions were as follows: 94 °C for 5 min, 42 °C for 10 min, 72 °C for 15 min, 35 cycles of 94 °C for 30 s, 60 °C for 30 s and 72 °C for 90 s and a final 72 °C for 2 min. RT-PCR
1239
N? membrane (GE, Fairfield, CT, USA). Southern hybridisations were performed using alpha-32P dCTP-labelled probes following routine protocols. Hybridisation at 68 °C was performed using a routine method. Probes were PCR amplified from the 30 end of each Dmrt gene. The cycling conditions were as follows: 95 °C for 20 s, 60 °C for 20 s and 72 °C for 30 s for a total of 31 cycles. The primers used to amplify each end of the Dmrt genes were as follows:
The cDNA templates were prepared from adult tissues. PCRs were performed in a 20 ll reaction mix and cycling conditions were as follows: 95 °C for 20 s, 60 °C for 20 s and 72 °C for 30 s for a total of 31 cycles for the Dmrt genes, and 95 °C for 20 s, 62 °C for 20 s and 72 °C for 30 s for at total of 25 cycles for the Hprt (hypoxanthine– guanine phosphoribosyltransferase) gene. The primers flanking the intron were as follows: Dmrt2-S3, 50 GGCACATTCGCCCGTCCACCAT30 ; Dmrt2-A3, 50 GGCCACGCTGACATTGGAGGAGAT30 ; Dmrt2b-S2, 50 AAGCTCAGAGCAAACCAGGG30 ; Dmrt2b-A2, 50 CAGCATGAGGAACTGCCTGG30 ; Dmrt3-S3, 50 CCCCAGAGGGCTCCAAACCAAACT30 ; Dmrt3-A3, 50 GGGTGCGGGTCAGTGTGAGGTTGC30 ; Dmrt4-S3, 50 CGAGTCGGAAAAACCCAAGG30 ; Dmrt4-A3, 50 TACACCACCGTTTGCAGAGG30 ; Dmrt5-S3, 50 GGTGTCCATGGCCGGCAACCTACTG30 ; Dmrt5-A3, 50 TTGGGAATACTTGAATCTGAGTTGG30 ; Hprt-S, 50 GAACAGTGACCGCTCCATCC30 ; Hprt-A, 50 TTGTCAGGGACCTCGAATCCT30 . Sequence and phylogenetic analysis All sequences were analysed using the Vector NTI software. Dmrt protein sequences from human, mouse, frog, platyfish, takifugu, zebrafish, Atlantic salmon, Nile tilapia and crucian carp were downloaded from NCBI. These sequences together with those of the swamp eel were aligned using the ClustalW program. Phylogenetic analysis was performed using the neighbour-joining (NJ, 1,000 runs) and maximum-likelihood (ML, 1,000 runs) methods (Phylip, version 3.6). Southern blot hybridisation The BACs were previously screened in our laboratory [39]. For Southern blots, the BAC DNA (Clone 14G7) was digested with NdeI or SalI and transferred onto a Hybond
Fig. 1 Genomic structure sketch of the five Dmrt genes. Amino acid identities of conserved domains between the swamp eel and other species are shown below each Dmrt gene. Blocks represent exons. The conserved DM domain of all Dmrt members, the region a, b and c of Dmrt2/2b, the DMA and DMB domains of Dmrt3/4/5 are all indicated in shadow blocks. Numbers on each gene panel denote the nucleic acid (above) and amino acid (below) positions. Triangles denote start or stop codons
123
1240
Dmrt1SS, 50 CACCGTTGACTCCATTATCG30 ; Dmrt1SA, 50 AGTTTGATTCTGAAGAGTGCCCC30 ; Dmrt2SS, 50 (C/T)T(C/G)ATCTCCTCCAA(T/C)GTCA GCGT 30 ;
123
Mol Biol Rep (2014) 41:1237–1245
Dmrt2SA, 50 CTG (G/A)AAGGAGTTGA(G/A)TTTCA TGGA30 ; Dmrt3SS, 50 CGGCTCCATCAACCTGCCTTTC30 ; Dmrt3SA, 50 GTATTCCACAGGGTCACGTC(G/A)TT30 .
Mol Biol Rep (2014) 41:1237–1245 b Fig. 2 Phylogenetic tree depicting the Dmrt proteins. The numbers in
the branches represent the boot-strap values from 1,000 replicates obtained using the maximum-likelihood method (first value) and the neighbor-joining method (second value). The swamp eel genes are indicated in red circle. The GenBank accession numbers are as follows: NP_068770.2, AAF86293.1, NP_067063.1, NP_071443.2, and AAI36283.1 (human DMRT1, DMRT2, DMRT3, DMRT4 and DMRT5); NP_056641.2, NP_665830.1, NP_796334.2, NP_783578.1 and NP_758500.2 (Mouse Dmrt1, Dmrt2, Dmrt3, Dmrt4 and Dmrt5); BAF31129.1, BAF44084.1, BAF44085.1 and BAF44086.1 (Frog Rana rugosa Dmrt1, Dmrt2, Dmrt3 and Dmrt5); CAM16633.1, NP_571027.1, AAU89440.1, ABC33860.1 and AAU85258.1 (Zebrafish Dmrt1, Dmrt2, Dmrt2b, Dmrt3 and Dmrt5); BAE16952.1, CAC42780.1, BAE16954.1, BAE16955.1 and BAE16956.1 (Takifugu Dmrt1, Dmrt2, Dmrt3, Dmrt4 and Dmrt5); AAN65377.1, AAL83920.1, AAL83919.1, ABC60024.1 (platyfish Dmrt1, Dmrt2, Dmrt4 and Dmrt5); ABK27325.1 (Crucian carp Carassius carassius Dmrt2b); AAO74158.2 (Nile tilapia Oreochromis niloticus Dmrt2b); NP_001133069.1 (Atlantic salmon Salmo salar Dmrt2b); AAP80398.1, KC466082, KC466083, KC466084, KC466085 and ACU30591 (Swamp eel Dmrt1, Dmrt2, Dmrt2b, Dmrt3, Dmrt4 and Dmrt5)
PCR products were cloned into the T-easy vector (Promega). In situ hybridisation To make RNA probes for in situ hybridisation on gonad sections, partial coding region of each Dmrt gene was amplified from a plasmid containing the specific Dmrt gene. PCR conditions were as follows: 94 °C for 5 min, 35 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s and a final 72 °C for 2 min. The primers used were as follows: Dmrt2SS, 50 (C/T)T(C/G)ATCTCCTCCAA(T/C)GTCA GCGT 30 ; Dmrt2SA, 50 CTG (G/A)AAGGAGTTGA(G/A)TTTCA TGGA30 ; Dmrt3SS, 50 CGGCTCCATCAACCTGCCTTTC30 ; Dmrt3SA, 50 GTATTCCACAGGGTCACGTC (G/A)T T30 ; Dmrt4IS, 50 GAAGGTCGCTTTCCTCCTCA 30 ; Dmrt4IA, 50 TACACCACCGTTTGCAGAGG 30 ; Dmrt5IS, 50 GGGGAAACCTGCGTCCACCGAGAGT 30 ; Dmrt5IA, 50 GAGGATCTGCTCGATGGCTGGC 30 . PCR fragments were cloned into the plasmid that contains SP6 promoter, two independent clones were selected, which contain insert in either antisense or sense directions. The RNA probes were made from each plasmid using SP6 RNA polymerase (Roche, Basel, Swiss) and digoxigeninUTP. The gonad tissues were cryosectioned using a cryostat microtome (Leica). The sections were immediately hybridised in a humidified box at 42 °C overnight. Hybridisation signals were detected by NBT/BCIP reagents (Feiyi, Wuhan, China).
1241
Results Identification of the five Dmrt genes To identify other Dmrt genes in the swamp eel genome, conserved regions were first amplified using degenerate PCR and testis cDNAs as the template. Primers were designed based on the conserved sequence information of the Dmrt genes of other vertebrates. Full-length cDNAs of Dmrt2, Dmrt2b, Dmrt3, Dmrt4 and Dmrt5 were obtained using the RACE technique. In addition, genomic sequences were amplified using PCR from genomic DNAs for gene structure analysis, including two introns in Dmrt2/2b and one in Dmrt3, Dmrt4 and Dmrt5 (Fig. 1). The sequencing analysis showed that Dmrt2 and Dmrt2b have three conserved regions (region A, B and C). Dmrt3, Dmrt4 and Dmrt5 contain a conserved DMA domain, whereas Dmrt5 has another specific DMB domain, besides a highly conserved DM domain, in all Dmrt genes. Protein sequence prediction indicated that Dmrt2, Dmrt2b, Dmrt3, Dmrt4 and Dmrt5 encoded putative proteins of 527, 373, 471, 420 and 448 amino acids, respectively. The Dmrt genes of the swamp eel showed a high level of sequence similarities compared with other vertebrates, especially in the conserved domains. A phylogenetic tree was further constructed using the maximum-likelihood and the neighbour-joining methods, which showed that five Dmrt proteins of the swamp eel were clustered into relevant branches of Dmrt2, Dmrt2b, Dmrt3, Dmrt4 and Dmrt5 in vertebrates, especially within the teleost fish species (Fig. 2). A cluster of Dmrt1–Dmrt3–Dmrt2 genes To investigate the linkage relationship among the Dmrt1, Dmrt2 and Dmrt3 genes, Southern blot analysis was used to map the Dmrt genes on the Dmrt1-containing BAC clone 14G7. BAC DNA was digested with NdeI and SalI and hybridised with a specific probe designed from each Dmrt gene. Southern blot analysis showed that Dmrt1–Dmrt3 and Dmrt3–Dmrt2 were linked together and covered a range of *100 kb (the size of the BAC clone 14G7 is *105 kb), suggesting a linkage relationship between the Dmrt1– Dmrt3–Dmrt2 genes (Fig. 3a, b). In addition, these Dmrt genes showed the same transcriptional direction based on their domain directions and restriction enzyme sites. Expression patterns of the Dmrt genes RT-PCR was performed to determine the transcriptional profile of the swamp eel Dmrt genes in adult tissues. Comparison analysis of mRNA expression among individuals of three types of sexes showed that Dmrt genes
123
1242
Mol Biol Rep (2014) 41:1237–1245
were differentially expressed among gonads, although their expression in other somatic tissues exhibited no or some subtle difference among individuals of different sexes (Fig. 4a–c). These Dmrt genes were up-regulated during sex reversal from ovary to testis via ovotestis (Fig. 4d). In addition, the expression between Dmrt2 and Dmrt2b displayed a similar pattern, and both Dmrt3 and Dmrt5 were expressed at nearly the same level in the gonads. To further explore the location of Dmrt gene expression in three types of gonads, antisense RNAs of Dmrt2, Dmrt3, Dmrt4 and Dmrt5 were synthesised and in situ hybridised
onto sections of testis, ovotestis and ovary (Fig. 5). Both Dmrt2 and Dmrt3 were expressed in developing sperm cells in the testis (Fig. 5a, b); in the ovary, Dmrt2 was detected in developing and mature oocytes (Fig. 5i). Also in the ovary, Dmrt3 Dmrt4 and Dmrt5 were mainly expressed in developing oocytes (Fig. 5j–l). In the testis, Dmrt4 was found in the outer layer of the seminiferous epithelium, and Dmrt5 was mainly expressed in developing germ cells, especially in spermatogonia, spermatocytes and spermatids (Fig. 5c, d). In the ovotestis, the Dmrt genes were detected in both degraded ova and developing seminiferous epithelium (Fig. 5e–h).
Fig. 3 Dmrt1–Dmrt3–Dmrt2 linkage analysis. a Southern blot analysis using Dmrt1, Dmrt2 or Dmrt3 probes, respectively. BAC DNA is digested with NdeI (right) or SalI (left). Hybridisations are performed with probes indicated in black regions in the panel b (region A, B or C). The sizes (kb) of positive bands are denoted.
b Linkage relationship among the Dmrt1, Dmrt2 and Dmrt3 genes. The relative positions of these genes are deduced based on the restriction fragment lengths from the Southern blot analysis. Black triangles indicate the start and stop codons. The related position of last NdeI and SalI site is not determined yet
Fig. 4 Expression of the five Dmrt genes in adult tissues of male (a), intersex (b) and female (c) individuals detected by non-quantitative RT-PCR. Relative expressions of these Dmrt genes in three types of
gonads from five individuals are shown in panel d. Hprt expression is used as an internal control. PCR cycle numbers are shown in each panel
123
Mol Biol Rep (2014) 41:1237–1245
1243
Fig. 5 mRNA in situ hybridisation on gonad sections of the swamp eel. Gonad sections of testis (a–d), ovotestis (e–h) and ovary (i–l) are in situ hybridised using Dmrt2, Dmrt3, Dmrt4 or Dmrt5 as a probe, respectively. The specific antisense probe located in the nonconserved region at the 30 end of each gene is labelled using digoxigenin-dUTP. Positive signals of Dmrt gene expression are indicated in red arrows. Dmrt5 is mainly expressed in developing germ cells, especially in spermatogonia, spermatocytes and spermatids. In the ovary, its expression appears in the early developing oocytes. Dmrt4 is expressed in the early developing oocytes within
the ovary, but in the testis, it is expressed in the outer layer of the seminiferous epithelium. Both Dmrt3 and Dmrt2 are expressed in the developing sperm cells in the testis; in the ovary, Dmrt2 is detected in developing and mature oocytes, and Dmrt3 is mainly expressed in early developing oocytes. In the ovotestis, these genes are detected in both the degraded ova and developing seminiferous epithelium. Representative H&E staining images of ovary (m), ovotestis (n) and testis (p) are showed in the lower panel. O ova; Od degenerating ova; T testis tissue. Magnification, 20X
Discussion
of *100 kb in the swamp eel. This result further supports an evolutionary conservation of the gene cluster, Dmrt1– Dmrt3–Dmrt2, from the teleost fish species to mammals [23, 24, 40]. Another feature of the cluster is that these genes exhibit the same transcriptional direction. In humans, the three genes may synergistically exert their function during sexual development [7, 28]. The Dmrt genes tend to play a role in sexual development and differentiation. Dmrt1 is a major gene involved in sex determination and differentiation. Dmrt2a is involved in the process of somite development [41] and other Dmrt genes including Dmrt3, Dmrt4 and Dmrt5 might be implicated in the later processes leading to the proper development of germ cells (see review [42] ). The DM domain gene, Dmy/
In the teleost fish species, there are six Dmrt genes that include Dmrt1, Dmrt2, Dmrt2b, Dmrt3, Dmrt4 and Dmrt5. Dmrt2b is a duplicated copy of Dmrt2 [31]. In the swamp eel, Dmrt1 has previously been identified [38]. In the present study, we further identified another five Dmrt genes, including Dmrt2, Dmrt2b, Dmrt3, Dmrt4 and Dmrt5 in the swamp eel. As in zebrafish, there were two copies of Dmrt2 in the genome of the swamp eel. The identification of the Dmrt genes in the swamp eel provides basic data for in depth studies of function and evolution of the DM family of genes. The genes Dmrt1–Dmrt3–Dmrt2 are tightly linked together in a small chromosomal region and cover a range
123
1244
Mol Biol Rep (2014) 41:1237–1245
Dmrt1Y, is a typical example to explain DM gene’s role in sex determination. Dmy/Dmrt1Y becomes a master male sex-determining gene upon transposition onto the Y chromosome in the teleost fish, medaka [12, 13]. A W-linked DM-domain gene, DM-W, is crucial for primary ovary development in Xenopus laevis [11]. Molecular mechanisms of sex reversal in the swamp eel are poorly understood. Our previous study suggested that Dmrt1 may be involved in the gonadal transformation [38]. This report further identifies all other members of the DM family, especially characterizes their expression patterns of up-regulation during gonadal transformation, which suggest a role for these DM domain genes in gonad transformation. It seems that Dmrt family genes indeed have a common function in sexual differentiation. In many known cases, gonadal sex is determined by sex determining factors expressed in the gonadal somatic cells such as Sertoli cells. Indeed, Matsuda et al. [12] and Nanda et al. [13] reported that medaka fish Dmrt1Y is expressed in the Sertoli cells. It was also suggested that, while mouse Dmrt1 is expressed in both somatic and germ cells, the roles of Dmrt1 in somatic cells and germ cells may be different; Dmrt1 could play roles in maintenance of undifferentiated spermatogonia while it is associated with Sertoli cell differentiation [43]. These Dmrt genes of the swamp eel may play different roles in sexual differentiation and transformation, because they have a slight difference in expression patterns. Nevertheless, addition of the six members of Dmrt family to the list of candidate genes of sex reversal provides new data to study molecular mechanisms of the gonadal transformation. Further analysis of these Dmrt genes using the sex reversal characteristic of the swamp eel will provide comprehensive understanding of sex determination and differentiation in vertebrates. Acknowledgments This work was supported by the National Natural Science Foundation of China, the National Key Basic Research project, National Key Technologies R&D Program and Hubei Province Science and Technology project. Authors thank five reviewers for their comments and suggestions. Conflict of interest interest.
The authors declare that there is no conflict of
References 1. Liu CK (1944) Rudimentary hermaphroditism in the Symbranchoid eel, Monopterus javanesis. Sinensia 15:1–6 2. Bullough WS (1947) Hermaphroditism in the lower vertebrates. Nature 160:9–11 3. Cheng H, Guo Y, Yu Q, Zhou R (2003) The rice field eel as a model system for vertebrate sexual development. Cytogenet Genome Res 101:274–277 4. Koopman P, Gubbay J, Vivian N, Goodfellow P, Lovell-Badge R (1991) Male development of chromosomally female mice transgenic for Sry. Nature 351:117–121
123
5. Sinclair AH, Berta P, Palmer MS, Hawkins JR, Griffiths BL, Smith MJ, Foster JW, Frischauf AM, Lovell-Badge R, Goodfellow PN (1990) A gene from the human sex-determining region encodes a protein with homology to a conserved DNA-binding motif. Nature 346:240–244 6. Berta P, Hawkins JR, Sinclair AH, Taylor A, Griffiths BL, Goodfellow PN, Fellous M (1990) Genetic evidence equating SRY and the testis-determining factor. Nature 348:448–450 7. Yoshimoto S, Ikeda N, Izutsu Y, Shiba T, Takamatsu N, Ito M (2010) Opposite roles of DMRT1 and its W-linked paralogue, DM-W, in sexual dimorphism of Xenopus laevis: implications of a ZZ/ZW-type sex-determining system. Development 137:2519– 2526 8. Onesimo R, Orteschi D, Scalzone M, Rossodivita A, Nanni L, Zannoni GF, Marrocco G, Battaglia D, Fundaro C, Neri G (2012) Chromosome 9p deletion syndrome and sex reversal: novel findings and redefinition of the critically deleted regions. Am J Med Genet A 158A:2266–2271 9. Raymond CS, Murphy MW, O’Sullivan MG, Bardwell VJ, Zarkower D (2000) Dmrt1, a gene related to worm and fly sexual regulators, is required for mammalian testis differentiation. Genes Dev 14:2587–2595 10. Smith CA, Roeszler KN, Ohnesorg T, Cummins DM, Farlie PG, Doran TJ, Sinclair AH (2009) The avian Z-linked gene DMRT1 is required for male sex determination in the chicken. Nature 461:267–271 11. Yoshimoto S, Okada E, Umemoto H, Tamura K, Uno Y, NishidaUmehara C, Matsuda Y, Takamatsu N, Shiba T, Ito M (2008) A W-linked DM-domain gene, DM-W, participates in primary ovary development in Xenopus laevis. Proc Natl Acad Sci USA 105:2469–2474 12. Matsuda M, Nagahama Y, Shinomiya A, Sato T, Matsuda C, Kobayashi T, Morrey CE, Shibata N, Asakawa S, Shimizu N, Hori H, Hamaguchi S, Sakaizumi M (2002) DMY is a Y-specific DM-domain gene required for male development in the medaka fish. Nature 417:559–563 13. Nanda I, Kondo M, Hornung U, Asakawa S, Winkler C, Shimizu A, Shan Z, Haaf T, Shimizu N, Shima A, Schmid M, Schartl M (2002) A duplicated copy of DMRT1 in the sex-determining region of the Y chromosome of the medaka, Oryzias latipes. Proc Natl Acad Sci USA 99:11778–11783 14. Hattori RS, Murai Y, Oura M, Masuda S, Majhi SK, Sakamoto T, Fernandino JI, Somoza GM, Yokota M, Strussmann CA (2012) A Y-linked anti-Mullerian hormone duplication takes over a critical role in sex determination. Proc Natl Acad Sci USA 109:2955– 2959 15. Kamiya T, Kai W, Tasumi S, Oka A, Matsunaga T, Mizuno N, Fujita M, Suetake H, Suzuki S, Hosoya S, Tohari S, Brenner S, Miyadai T, Venkatesh B, Suzuki Y, Kikuchi K (2012) A transspecies missense SNP in Amhr2 is associated with sex determination in the tiger pufferfish, Takifugu rubripes (fugu). PLoS Genet 8:e1002798 16. Myosho T, Otake H, Masuyama H, Matsuda M, Kuroki Y, Fujiyama A, Naruse K, Hamaguchi S, Sakaizumi M (2012) Tracing the emergence of a novel sex-determining gene in medaka, Oryzias luzonensis. Genetics 191:163–170 17. Yano A, Guyomard R, Nicol B, Jouanno E, Quillet E, Klopp C, Cabau C, Bouchez O, Fostier A, Guiguen Y (2012) An immunerelated gene evolved into the master sex-determining gene in rainbow trout, Oncorhynchus mykiss. Curr Biol 22:1423–1428 18. Kikuchi K, Hamaguchi S (2013) Novel sex-determining genes in fish and sex chromosome evolution. Dev Dyn 242:339–353 19. Raymond CS, Shamu CE, Shen MM, Seifert KJ, Hirsch B, Hodgkin J, Zarkower D (1998) Evidence for evolutionary conservation of sex-determining genes. Nature 391:691–695
Mol Biol Rep (2014) 41:1237–1245 20. Hodgkin J (2002) The remarkable ubiquity of DM domain factors as regulators of sexual phenotype: ancestry or aptitude? Genes Dev 16:2322–2326 21. Kondo M, Froschauer A, Kitano A, Nanda I, Hornung U, Volff JN, Asakawa S, Mitani H, Naruse K, Tanaka M, Schmid M, Shimizu N, Schartl M, Shima A (2002) Molecular cloning and characterization of DMRT genes from the medaka Oryzias latipes and the platyfish Xiphophorus maculatus. Gene 295:213–222 22. Volff JN, Zarkower D, Bardwell VJ, Schartl M (2003) Evolutionary dynamics of the DM domain gene family in metazoans. J Mol Evol 57(Suppl 1):S241–S249 23. Brunner B, Hornung U, Shan Z, Nanda I, Kondo M, Zend-Ajusch E, Haaf T, Ropers HH, Shima A, Schmid M, Kalscheuer VM, Schartl M (2001) Genomic organization and expression of the doublesex-related gene cluster in vertebrates and detection of putative regulatory regions for DMRT1. Genomics 77:8–17 24. Ottolenghi C, Fellous M, Barbieri M, McElreavey K (2002) Novel paralogy relations among human chromosomes support a link between the phylogeny of doublesex-related genes and the evolution of sex determination. Genomics 79:333–343 25. Kim S, Kettlewell JR, Anderson RC, Bardwell VJ, Zarkower D (2003) Sexually dimorphic expression of multiple doublesexrelated genes in the embryonic mouse gonad. Gene Expr Patterns 3:77–82 26. Lints R, Emmons SW (2002) Regulation of sex-specific differentiation and mating behavior in C. elegans by a new member of the DM domain transcription factor family. Genes Dev 16:2390–2402 27. Johnsen H, Andersen O (2012) Sex dimorphic expression of five dmrt genes identified in the Atlantic cod genome. The fish-specific dmrt2b diverged from dmrt2a before the fish whole-genome duplication. Gene 505:221–232 28. Hong CS, Park BY, Saint-Jeannet JP (2007) The function of Dmrt genes in vertebrate development: it is not just about sex. Dev Biol 310:1–9 29. Seo KW, Wang Y, Kokubo H, Kettlewell JR, Zarkower DA, Johnson RL (2006) Targeted disruption of the DM domain containing transcription factor Dmrt2 reveals an essential role in somite patterning. Dev Biol 290:200–210 30. Lourenco R, Lopes SS, Saude L (2010) Left-right function of dmrt2 genes is not conserved between zebrafish and mouse. PLoS One 5:e14438 31. Zhou X, Li Q, Lu H, Chen H, Guo Y, Cheng H, Zhou R (2008) Fish specific duplication of Dmrt2: characterization of zebrafish Dmrt2b. Biochimie 90:878–887
1245 32. Li Q, Zhou X, Guo Y, Shang X, Chen H, Lu H, Cheng H, Zhou R (2008) Nuclear localization, DNA binding and restricted expression in neural and germ cells of zebrafish Dmrt3. Biol Cell 100:453–463 33. Balciuniene J, Bardwell VJ, Zarkower D (2006) Mice mutant in the DM domain gene Dmrt4 are viable and fertile but have polyovular follicles. Mol Cell Biol 26:8984–8991 34. Huang X, Hong CS, O’Donnell M, Saint-Jeannet JP (2005) The doublesex-related gene, XDmrt4, is required for neurogenesis in the olfactory system. Proc Natl Acad Sci USA 102:11349–11354 35. Guo Y, Li Q, Gao S, Zhou X, He Y, Shang X, Cheng H, Zhou R (2004) Molecular cloning, characterization, and expression in brain and gonad of Dmrt5 of zebrafish. Biochem Biophys Res Commun 324:569–575 36. Parlier D, Moers V, Van Campenhout C, Preillon J, Leclere L, Saulnier A, Sirakov M, Busengdal H, Kricha S, Marine JC, Rentzsch F, Bellefroid EJ (2013) The Xenopus doublesex-related gene Dmrt5 is required for olfactory placode neurogenesis. Dev Biol 373:39–52 37. Guo Y, Cheng H, Huang X, Gao S, Yu H, Zhou R (2005) Gene structure, multiple alternative splicing, and expression in gonads of zebrafish Dmrt1. Biochem Biophys Res Commun 330:950– 957 38. Huang X, Guo Y, Shui Y, Gao S, Yu H, Cheng H, Zhou R (2005) Multiple alternative splicing and differential expression of dmrt1 during gonad transformation of the rice field eel. Biol Reprod 73:1017–1024 39. Jang S, Zhou F, Xia L, Zhao W, Cheng H, Zhou R (2006) Construction of a BAC library and identification of Dmrt1 gene of the rice field eel, Monopterus albus. Biochem Biophys Res Commun 348:775–780 40. El-Mogharbel N, Wakefield M, Deakin JE, Tsend-Ayush E, Grutzner F, Alsop A, Ezaz T, Marshall Graves JA (2007) DMRT gene cluster analysis in the platypus: new insights into genomic organization and regulatory regions. Genomics 89:10–21 41. Meng A, Moore B, Tang H, Yuan B, Lin S (1999) A Drosophila doublesex-related gene, terra, is involved in somitogenesis in vertebrates. Development 126:1259–1268 42. Herpin A, Schartl M (2011) Dmrt1 genes at the crossroads: a widespread and central class of sexual development factors in fish. FEBS J 278:1010–1019 43. Lei N, Hornbaker KI, Rice DA, Karpova T, Agbor VA, Heckert LL (2007) Sex-specific differences in mouse DMRT1 expression are both cell type- and stage-dependent during gonad development. Biol Reprod 77:466–475
123
