Multifunctional properties of Lactobacillus plantarum strains ... - Core

Journal of Functional Foods 17 (2015) 621–631

Available online at www.sciencedirect.com

ScienceDirect j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / j ff

Multifunctional properties of Lactobacillus plantarum strains isolated from fermented cereal foods Folarin A. Oguntoyinbo a,b,*, Arjan Narbad b a

Department of Microbiology, Faculty of Science, University of Lagos, Akoka, Lagos, Nigeria Gut Health and Food Safety Programme, Institute of Food Research Norwich Research Park, Conley Lane, Norwich, UK b

A R T I C L E

I N F O

A B S T R A C T

Article history:

Strains of Lactobacillus plantarum were studied for starter cultures and probiotic functions

Received 1 April 2015

with the overall aim of selecting multifunctional cultures that could bring about fermen-

Received in revised form 13 June

tation of cereals as well as rendering health benefits. Two L. plantarum strains previously

2015

isolated from West African fermented cereals were sub-typed using RAPD-PCR; these strains

Accepted 16 June 2015

carried different plasmid profiles ranging from 2 to 50 kb and showed variation in carbo-

Available online 29 June 2015

hydrate fermentation patterns. RT-PCR analysis showed that the gene coding for rhamnosidase was expressed by both strains, but the amylase gene was only expressed by L. plantarum

Keywords:

ULAG11. L. plantarum ULAG24 demonstrated antagonism to food borne pathogens and ex-

Probiotics

pressed all nine genes associated with plantaricin biosynthesis while only 3 genes of the

Fermentation

plantaricin operon were identified in the strain ULAG11. Both L. plantarum strains were similar

Cytokines

in their resistance to acid (pH 2.0) and were tolerant to bile salt concentration of 0.3% (w/

Lactobacillus plantarum

v) and were able to grow under anaerobic environment. Adhesion assays indicated that L. plantarum ULAG24 adhered to HT29 cell line and competitively excluded Salmonella enterica LT2. In vivo analysis showed limited colonisation of BALB/c mice gut, but stimulation of IFNγ (1.2 ng/ml) and IL10 (3.4 ng/ml) by L. plantarum ULAG24 was observed. This shows that L. plantarum ULAG24 possesses probiotic functions as well as plantaricin production potential, while expression of amylase enzyme was detected in L. plantarum ULAG11. The identified diverse functional attributes among L. plantarum strains showed that these two strains could be used for industrial processing of fermented cereals in W. Africa with added benefits of the strains having probiotic potential for human health. © 2015 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

1.

Introduction

L. plantarum was isolated from different vegetable materials and used as starter cultures for fermentation of silage, cabbage, cucumber, olive, cereal and cassava. This bacterium has also been

previously isolated from different African cereals fermented foods, such as Ogi and kunu zaki (Gaffa, Jideani, & Nkama, 2002; Oguntoyinbo & Narbad, 2012), koko (Lei & Jakobsen, 2004), kenkey (Halm, Lillie, Sorensen, & Jakobsen, 1993), togwa (Mugula, Nnko, Narvhus, & Sørhaug, 2003) and ben-saalga (Tou et al., 2006). These important fermented cereals are consumed as

* Corresponding author. Department of Microbiology, Faculty of Science, University of Lagos, Akoka, Lagos, Nigeria. Tel.: +2348054748166; fax: +23414932667. E-mail address: [email protected] (F.A. Oguntoyinbo). http://dx.doi.org/10.1016/j.jff.2015.06.022 1756-4646/© 2015 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http:// creativecommons.org/licenses/by-nc-nd/4.0/).

622


complementary infant foods as well as non-alcoholic cereal beverages (Lartey, Manu, Brown, Peerson, & Dewey, 1999; Nnam, 2000; Ojofeitimi, Abiose, Ijadunola, Pedro, & Jinadu, 2001). During industrial fermentation of non-malted cereal by lactic acid bacteria (LAB), there is insufficient availability of fermentable sugar to support rapid production of lactic acid (Nout, 2009). In addition, fermented cereals provide limited level of amino acids, such as lysine and methionine, needed to support the nutritional requirement of human consumer (Teniola & Odunfa, 2001). To ameliorate these deficiencies, microbial fermentation using carefully selected starter cultures with defined technological properties and added nutritional benefits with promising health advantages has been consistently proposed (Holzapfel, 2002; Turpin, Humblot, & Guyot, 2011). In our recent study, the dominance of Lactobacillus species during cereal fermentation and the presence of other bacteria with safety challenges were identified (Oguntoyinbo & Narbad, 2012; Oguntoyinbo, Tourlomousis, Gasson, & Narbad, 2011). Therefore, harnessing many functional properties of these beneficial bacteria may significantly contribute to strategies that can improve nutritional quality and safety and promote health status of consumers of traditional fermented cereals, particularly in developing countries. Amylase activity is an essential prerequisite during starchy food fermentation; it enhances hydrolysis of amylose and amylopectin to release fermentable maltose. Amylolytic bacterial strains are therefore desirable and could be readily applied as starter cultures during traditional cereal fermentation. L. plantarum A6, an amylolytic strain, has previously been isolated from fermented cereals in Africa, and its α-amylase gene was cloned and sequenced (Giraud, Brauman, Keleke, Lelong, & Raimbault, 1991; Giraud & Cuny, 1997), and the expression of this gene was also identified during in situ fermentation (Humblot et al., 2014; Oguntoyinbo & Narbad, 2012). Efforts have also been made to produce recombinant L. plantarum strains with amylolytic activity, but these clones are not particularly attractive to large-scale fermentation due to the requirement for the associated technologies that are not always available in developing countries. Also, it was recently shown that antioxidant properties of certain cereals were affected during fermentation by food grade bacteria (Wang, Wu, & Shyu, 2014). Plant foods are rich in rhamnose sugars, and α-L-rhamnosidase producing Lactobacillus strains can catalyse hydrolysis of rhamnose containing phenolic conjugates to bring about increase in free polyphenols as well as flavonoid antioxidants (Beekwilder et al., 2009). The expression of this characteristic in L. plantarum used as starter culture could be relevant to the improvement of nutritional quality of fermented foods; this is also related to recent study that showed nutritional relevance of probiotic-riboflavinoverproducing L. plantarum (Arena et al., 2014). Post processing contamination due to poor handling and sanitation constitutes safety challenges, with many unreported cases of diarrhoea especially among infants and immune compromised adults, leading to high morbidity and mortality. Bacterial strains that can dominate the fermentation process and produce antimicrobials are particularly attractive and desirable for pathogen control and improvement in safety and quality of traditional foods in Africa (Abriouel, Maqueda, Galvez,

Martinez-Bueno, & Valdivia, 2002; Franz et al., 2014; Todorov, Ho, Vaz-Velho, & Dicks, 2010). Application of probiotic starter cultures for control of infantile diarrhoea showed promise, with some studies justifying their relevance in functional foods (Cebrián et al., 2012). Most probiotics LAB are obtained from gut, and their functionality in health improvement has been consistently reported (Xia et al., 2011). They are mainly selected because of their long time association, adaptation and ability to survive in the gut (Anderson, Cookson, McNabb, Kelly, & Roy, 2010; Wang, Lin, Ng, & Shyu, 2010). Many LAB isolated from food has been poorly investigated for probiotic characteristics when compared to strains derived from faecal or virginal origin. Field studies on diarrhoea control in Ghana involving feeding of infant with kenkey produced using bacteria isolated from koko lowered the prevalence of infantile diarrhoea (Halm et al., 1996; Lei, Friis, & Michaelsen, 2006; Lei & Jakobsen, 2004). Similar observation was reported in young children fed with togwa, a lactic acid fermented cereal gruel in Tanzania (Svanberg, Sjögren, Lorri, Svennerholm, & Kaijser, 1992). There is a need for more information on functional attributes of wild strains of L. plantarum isolated from fermented vegetal cereals substrates for African food applications. Strains of this species often differ in their phenotypic traits; some capable of adhering to GI tract; others are amylolytic, rhamnosidase and bacteriocin producers; some also have divergent immune stimulation properties (Meijerink et al., 2010). Important strains such as L. plantarum WCFS1 have been adequately studied for genome and probiotic functions (Kleerebezem et al., 2003; Meijerink et al., 2010). It has also been suggested that individual strains from different regions could be more adaptable and should be studied for their inherent beneficial properties, especially in Africa where they can be applicable as probiotic starter cultures (Franz et al., 2014). Such strains with fermentation and health improvement advantages will be more relevant during industrial processing and guarantee improved safety and quality of fermented cereal foods. In this study, we used genomic methods to determine strain divergence among L. plantarum and their multifunctional properties that can facilitate fermentation, gut survival, colonisation and in vivo immune stimulation.

2.

Materials and methods

2.1.

Bacterial culture

L. plantarum ULAG11 and ULAG24 (accession numbers KT008121 and KT008122 respectively) were previously isolated from fermented kunu-zaki and ogi in Nigeria (Oguntoyinbo & Narbad, 2012); L. plantarum subsp. plantarum DSM20174, L. plantarum subsp. argentoratensis DSM16365 and L. amylovorus DSM20531 were obtained from Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) (Inhoffenstraße, Braunschweig, Germany). All lactobacilli and Enterococcus faecalis were maintained on MRS (Basingstoke, Hampshire, Oxoid, UK). L. johnsonii F19785, E. coli K12 and S. enterica LT2 were obtained from IFR’s in-house culture collection and were cultured in MRS (Oxoid, UK) and LB (Oxoid, UK) respectively.

623


2.2.

Sugar fermentation

API 50CHL (bioMérieux, Basingstoke, Hampshire, UK) was used to determine the sugars fermented by L. plantarum strains following the manufacturer’s instructions.

2.3.

DNA and RNA extraction

Genomic DNA and plasmids of Lactobacillus strains were extracted using the genomic DNA extraction and mini prep kits (Qiagen, Manchester, UK), respectively, following manufacturer’s instructions, with modification that cell lysis was performed using 5 mg/ml lysozyme and 10,000 U/ml mutanolysin and incubated at 37 °C for 30 min. Total RNA was extracted using the RNA isolation kit (Promega, Southampton, Hampshire, UK) with ca. 1 × 108 L. plantarum cells grown in MRS broth at 37 °C to the end of logarithmic growth phase (ca. 5 h) The concentration of RNA was determined using Nanodrop at 260 nm (Thermofisher Scientific, Loughborough, UK).

2.4.

Genomic characterisation

Genomic DNA of L. plantarum typed, reference and isolated strains were used to characterise the strains using 16S rDNA sequencing, MLSA and RAPD-PCR as previously described (Oguntoyinbo & Narbad, 2012).

2.5.

Screening for starter cultures functional properties

The rate of acid production was determined following the method described previously (Mathara et al., 2008). L. plantarum strains were screened for amylase activity using the method described by Ampe, Sirvent, and Zakhia (2001). Bacteriocin production was determined by demonstration of antagonism against indicator organisms (E. coli K12, S. enterica LT2, Enterococcus faecalis, L. casei) following the spot-on-lawn protocol (acid removed by neutralisation with NaOH) (Olasupo, Schillinger, Narbad, Dodd, & Holzapfel, 1999). Second screening by repeated plating using MRS agar was supplemented with bromocresol purple acidic pH indicator and 20 mg/l NaHCO3 for neutralisation.

2.6.

Expression studies using by RT-PCR

Expression of genes coding for amylase, rhamnosidase and bacteriocin in L. plantarum strains was determined in vitro using cDNA generated from RNA extracted from the L. plantarum by

reverse transcriptase (Stratagene now Agilent Technology, Stockport, Cheshire, UK) following manufacturer’s instructions. PCR amplification of conserved region of amylase and rhamnosidase gene cluster was carried out using the primer pairs Amy 10F and 10R; ram 1 and ram 2 whose sequences are shown in Table 1 and for bacteriocin pln A, B, C, D, E, G, J, K, L, N; plantaricin structural gene NC8, S, W primers used were adapted from Ben Omar et al. (2006). Expression of mannose-specific adhesion gene (msa) was determined with RT-PCR as described above using MsaF and MsaR primer set listed in Table 1. PCR condition was set at 95 °C for 1 min, 33 cycles of 95 °C for 35 s, 57 °C for 1.15 s, and 65 °C for 1.15 min and 65 °C for 5 min final extension. The PCR products were separated on 1.6% (w/v) agarose gels at 48 V for 17 h. Band patterns were visualised by ethidium bromide staining and photographed under UV illumination.

2.7.

In vitro tolerance assays

Acid and bile tolerance of the Lactobacillus strains was determined as previously described (Hyronimus, Le Marrec, Hadj Sassi, & Deschamps, 2000). L. plantarum were grown in MRS broth with pH regime 2, 4, 5 and 6, and observed turbidity OD measured at 600 nm. Also, the strains overnight cultures were adjusted to pH 6 and a solution of bile salts (Oxoid) was added to a final concentration of 0.3% (v/v). In the control tube the addition of bile salt was omitted. Samples were incubated for 6 h at 37 °C, and aliquots were taken before adding bile salts subsequently at times 0, 1, 3 and 6 h for determination of cell count by plating in triplicate onto MRS agar.

2.8.

In vitro adhesion and pathogens exclusion studies

Human intestinal cell lines, HT29 cells, obtained from European Tissue Culture Collection (Dorset, UK), were routinely cultured in growth media, supplemented with glutamax (Invitrogen, Inchinnan, Renfrew, UK), 10% v/v foetal calf serum (FCS, Sigma), 2% (v/v) penicillin-streptomycin (Invitrogen) and incubated at 37 °C overnight under 5% CO2 and 95% atmospheric air at constant humidity. The medium was changed every two days, and the cells were sub-cultured by treatment with trypsin-EDTA (Invitrogen) for 5 min at 37 °C, and the cells were counted using haemocytometer (Pinto, Kafatos, & Michel, 2008). HT29 cells (1 × 106 cells/well) were allowed to attach and grow in 6-well tissue culture plates for 48 h. The resulting confluent mono-layers were washed twice with phosphatebuffered saline (PBS) in order to remove cellular debris, FCS and

Table 1 – List of PCR primers used for different genes amplifications in this study. Primer name

Sequence (5’- 3’)

Position

Reference

MasF MasR Amy10F Amy10R AmyPBF AmyPBR M13 Ram1 Ram 2

TATGATGCCAAGACGGGAAT GCCTGCGACTCTCCTGTATC GTTGCTCAAGCGGATAGTGA GACGCGCTATTTCCAACTTT CTCAAAATTCTCAAGTTCAGACG TGCAAAGTACTTGCGGTAAAA GAG GGT GGC GGT TCT TATATAGATCTCATGTCGAAAGAGGCTGTTTGG TATAATCTCGAGTCACACTGGGACCACCGCAGTTG

262 719 361 541 901 1201

This study This study This study This study This study This study Oguntoyinbo et al. (2011) Beekwilder et al. (2009) Beekwilder et al. (2009)

624


antibiotics. Overnight grown cultures of L. plantarum ULAG11, L. plantarum ULAG24 and L. johnsonii F19785 were washed three times in sterile PBS and centrifuged at 8000 × g and resuspended in sterile RPMI medium (without antibiotic) to give a final concentration of 1 × 108 CFU/ml. Adhesion potential of LAB strains and S. enterica LT2 was individually tested by adding 1 ml of prepared cell suspension to the washed confluent monolayer and incubated at 37 °C for 2 h under humidified atmosphere containing 5% CO2. Cell monolayers were washed thrice with sterile PBS to remove unattached bacteria, 1 ml of 1:100 Triton X-100 diluted with PBS was added to each well, and a magnetic flee was added and the tissue culture plate was placed on the magnetic stirrer for 10 min to dislodge the monolayer. The adhered bacteria in the cell suspension were enumerated by serial dilution in PBS and plating on MRS agar. Colonies were counted after incubation at 37 °C for 24 h. Adhesion was expressed as the percentage of recovered viable bacteria compared to the initial population added to the monolayer.

2.9.

In vitro pathogen exclusion assay

HT29 cells were prepared as for the adhesion assays described above. Competition of individual lactobacilli with pathogen was determined by inoculating confluent mono layer with mixed cultures (1 ml) containing 500 µl, 5 × 108 CFU/ml individual Lactobacillus stains and equal volume of S. enterica LT2 ca. 108 and incubated at 37 °C for 2 h. Cells in the plates were washed twice with PBS to remove non-adhered bacteria and lysed with 1 ml of 1:100 Triton X-100 diluted with PBS in each well of the tissue culture plate. A magnetic flee was added into each well and stirred for 10 min. The cells in the plates were washed, stirred, diluted and plated (lactobacilli on MRS, S. enterica LT2 on LB agar) and then incubated at 37 °C overnight to obtain CFU value.

2.10.

In vivo colonisation of mice gut

Antibiogram tests were conducted on both lactobacilli, and it was established that both strains were resistant to neomycin and streptomycin. During in vivo colonisation study, the use of these antibiotics allowed selection of these bacteria from the mice faecal pellets. Cells were grown and diluted to obtain 109 CFU/ml in sterile PBS; 0.1 ml of cell suspension was gavaged once to group of five BALB/c mice. All mice were of the same age and sex (male). Mice gut colonisation was monitored by plating 0.1 ml of serially diluted mice faecal samples on MRS agar containing neomycin 10 µg/ml and streptomycin 25 µg/ml.

2.11.

Cytokine assays

Small intestines of the four sets of mice pre-dosed with lactobacilli were removed, and RNA was extracted as described above. Two step QuantiTect Reverse Transcription Qiagen was used first for gDNA wipe-out, followed by reverse transcription of 0.5 µg RNA to synthesise cDNA using Quantitect Reverse Transcription kit (Qiagen) following the manufacturer’s instructions. Quantitative RT-PCR was performed using mouse Mm_IL10_1_SG QuantiTect Primer Assay (200) (QT00106169) for IL10 (Entrez gene ID 16153) and Mm_ IFNγ _1_SG QuantiTect

Primer Assay (200) (QT01038821) for IFNγ (Entrez gene ID15978) and GAPDH (glyceraldehyde-3-phoshate dehydrogenase) with the SYBER Green PCR master mix (Thermofisher, UK) in the Applied Biosystems 7500 PCR system (Applied Biosystems, Bishop Meadow Road, Loughborough, UK). Real-time PCR expression was performed in triplicate on each cDNA sample. The threshold (CT) value was determined for each measurement and results calculated as comparative threshold as previously described by Capozzi et al. (2010).

2.12.

Statistical analysis

Analyses were performed in triplicates and data represent mean values with standard deviation. RAPD cluster was generated using TotalLab software.

3.

Results

3.1. Genomic diversity and plasmid profile of L. plantarum strains RAPD-PCR indicated polymorphism among L. plantarum ULAG11 and ULAG24 (Fig. 1a). In this analysis L. plantarum ULAG24 was found to be totally divergent from L. plantarum ULAG11. The strains were different from L. plantarum subsp. argentoratensis DSM16365 isolated from fermented cassava in W. Africa and typed strain L. plantarum subspecies plantarum DSM20174. The two strains were originally isolated from ogi and kunu-zaki, respectively, and harboured different plasmids profiles. Plasmids in L. plantarum ULAG24 ranged from >2 kb to 50 kb compared to L. plantarum ULAG11 where ca. 45–50 kb plasmids were detected (Fig. 1b). Variation in sugar fermentation pattern among L. plantarum strains was also detected (Table 2). The results shows that only strain ULAG24 fermented L-rhamnose, while glycogen and starch fermentation was observed in ULAG11. Rate of acid production by the two strains grown in MRS broth was similar, with final pH decreasing to 4 after 24 h growth. The results of RAPD strains diversity analysis justified the need for further probing of possible distribution of functional characteristics among the L. plantarum strains.

3.2.

Starter cultures functions

3.2.1.

Expression of rhamnosidase and amylase genes

Expression of conserved domain of amylase gene designated as amy10 was only observed in L. plantarum ULAG11 (Fig. 2a). Lack of expression of this domain in L. plantarum ULAG24 indicated that strain may not have the same potentials for cell bound or extra cellular amylase production. Amylase and rhamnosidase expression was determined by RT-PCR. Expression of rhamnosidase by both strains was detected in the RT-PCR analysis as shown in Fig. 2b.

3.2.2. Antimicrobial activities and bacteriocin gene expression Antibacterial activity was only demonstrated in L. plantarum ULAG24 against S. enterica LT2 in the spot-on-lawn assay. The screening agar medium used in this assay neutralised the acid

625


Band size (kbp) M

2

1

50 40 30 20

L. plantarum ULAG24 L. plantarum subsp. plantarum DSM20174 L. plantarum subsp. argentoratensis DSM16365

10

L. plantarum F108597

6

L. plantarum ULAG11 L. plantarum FI08596

4

L. plantarum FI08595

2

L. plantarum FI10138 L. amylovorus DSM20531

(a)

(b)

Fig. 1 – RAPD-PCR and plasmid profile of L. plantarum strains isolated from ogi and kunu-zaki, and reference strains. (a) RAPD-PCR fingerprint pattern obtained from M13 clustered using Pearson product moment correlation coefficient and the Unweighted Pair Group Method using arithmetic averages (UPGMA). L. amylovorus DSM20531 was used as an outcast. (b) Plasmid profile of L. plantarum. Lanes: M. Ladder; 1. L. plantarum ULAG11; 2. ULAG24. Data represent replicate of two determinations (n =2).

and H2O2, not generally produced by homofermenters like L. plantarum; hence, the antibacterial substance in the cell free medium was suspected to be a bacteriocin. Proteinaceous nature of the antimicrobial compound was confirmed by the loss of activity after proteinase K treatment. Expression of pln B C D E G J L NC8 S representing the entire plantaricin operon was detected in L. plantarum ULAG24, while only pln B J W were expressed by strain ULAG11 (Table 3).

L. plantarum ULAG24 adhered better than other lactobacilli, while S. enterica LT2 had the highest adhesion capacity (Fig. 3a). In vitro adhesion potential of L. plantarum strains was also confirmed by expression of Msa gene in ULAG24 grown in MRS broth for 6 h (Fig. 3b). This is an essential gene previously described to be responsible for adhesion of L. plantarum strains (Pretzer et al., 2005).

3.2.5. 3.2.3.

Tolerance to acid and bile salts

L. plantarum strains ULAG11 and ULAG24 showed similar gastric juice resistance, and both strains were tolerant to bile concentration at 0.3% (w/v). Similar growth pattern was observed by the strains under anaerobic incubation as well as in MRS broth adjusted to pH 2.0.

3.2.4.

In vitro adhesion

The adhesion of L. plantarum to HT 29 cell line in comparison with L. johnsonii F19785 and S. enterica LT2 showed that

Colonisation and competitive exclusion

The pattern of the in vivo colonisation of mice gut by the lactobacilli varied among the lactobacilli strains. Administration of a single dose of 108 cells showed that lactobacilli were detected in the faeces of the mice at day 1; the values subsequently decreased over time (Fig. 4a). The ability of lactobacilli strains to competitively exclude pathogen was also determined using tissue HT29 cell culture. S. enterica LT2 was competitively excluded in this assay by L. plantarum ULAG24 (Fig. 4b). In contrast L. plantarum ULAG11 or L. johnsonii F19785 could not competitively exclude this pathogen.

Table 2 – Summarised API 50CHL showing divergent sugar fermentation profiles of L. plantarum strains isolated from cereal food.

L-Arabinose L-Rhamnose Amidon(Starch) Glycogen D-Turanose D-Arabitol

L. plantarum ULAG24

L. plantarum ULAG11

L. plantarum subsp. argentoratensis DSM16365

L. plantarum subsp. plantarum DSM20174

+ + − − + +

+ − + + − −

− − + − − +

+ − − − + +

626


a 1

2

3

4

5

6 7

1

2

b 3

4

5

Fig. 2 – Expression of fermentation functional genes. (a) RTPCR amplified amylase genes. Lane: 1. AmyP L. plantarum ULAG24; 2. AmyP L. plantarum ULAG11; 3. AmyPB L. plantarum ULAG24; 4. AmyPB L. plantarum ULAG11; 5. Amy10 L. plantarum ULAG24; 6. Amy10 L. plantarum ULAG11; 7. Hyper ladder. (b) RT-PCR amplified rhamnosidase genes. Lanes 1. L. plantarum ULAG24; 2. L. plantarum ULAG11. Data represent replicate of two determinations (n = 2).

3.3.

In vivo stimulation of cytokines

Expression of both IFNγ and IL10 was observed in mice’s small intestine previously gavaged with L. plantarum ULAG24. L. plantarum ULAG24 stimulated IFNγ (1.2 ng/ml) and IL10 (3.4 ng/ ml) per expression of GAPDH in the small intestine (Fig. 5a). In contrast, L. plantarum ULAG11 or L johnsonii F19785 stains did not induce detectable cytokines (Fig. 5b).

4.

Discussion

L. plantarum strains isolated from ogi and kunu-zaki were examined for their functional properties with the aim of generating information that can be useful for the develop-

Table 3 – PCR amplification of plantaricin genes among L. plantarum strains isolated from ogi and kunu-zaki. Plantaricin genes

plnA plnB plnC plnD plnE plnG plnJ plnK PlnL PlnN Plantaricin NC8 structural gene Plantaricin S structural gene Plantaricin W structural gene

Strain L. plantarum ULAG11

L. plantarum ULAG24

− + − − − − + − − − − − +

− + + + + + + − + − + + −

ment of predictable fermentation as well as potential health benefits to consumers of these traditional fermented cereal foods. We have previously shown that L. plantarum strains grew in cereal mensrum, reached ca. 108 from 106 inoculum, with a corresponding reduction of pH from 6.4 to 3.5 within 12 h (Oguntoyinbo & Narbad, 2012). In this study, the results of phenotypic and genomic analysis showed diversity among the two L. plantarum strains, and they were shown to possess different plasmids as extra chromosomal elements. Although specific functions were not tagged to the plasmids in this study, divergence in extra chromosomal elements among LAB has been previously described and may confer specific functional advantages that can be maximised during large-scale food fermentation (Olasupo, Olukoya, & Odunfa, 1994; Rathore, Salmerón, & Pandiella, 2007). Rapid hydrolysis of starch is essential for adequate fermentation of cereals and tubers that are consumed in Africa (Songre-Ouattara et al., 2009). Bacterial strains with extracellular amylase production during fermentation have been reported to facilitate such fermentation by providing metabolisable carbohydrates that aid rapid hydrolysis, an important prequisite for industrial fermentation process (Songré-Ouattara, Mouquet-Rivier, Humblot, & Rochette, 2010). Lactobacilli with amylase production will thus be more desirable due to their ability to simultaniously bring about acid production that improves preservation and safety of fermented foods. L. plantarum ULAG11 was identified as a strain that produces amylase, previously demonstrated by Oguntoyinbo and Narbad (2012), and the results here also showed the expressed extracelluar amylase gene. Similar amylolytic L. plantarum A6 was isolated from Congo, L. manihotivorans from cassava in Colombia and L. amylovorus from beer malt in Germany (Bohak et al., 1998; Giraud et al., 1991). Many plant-based substrates that are fermented by lactobacilli have been reported to contain high percentages of rhamnose sugars; these can serve as a substrate for Lactobacillus metabolism and bring about release of B-group vitamins, polyphenols and antioxidants during fermention of cereals for production of healthier foods, an important applicable strategy to combact nutritional deficiency in African vegetal diets (Beekwilder et al., 2009; Capozzi, Russo, Dueñas, López, & Spano, 2012; Waters, Mauch, Coffey, Arendt, & Zannini, 2015). This process is brought about by the activity of α-L-rhamnosidases, which catalyse hydrolysis of the rhamnose sugar from conjugates. Phenotypic analysis using API 50CHL identified L. plantarum ULAG24 as a strain that fermented L-rhamnose. Total genomic sequence of three L. plantarum strains available in NCBI genome database was used to design primers to screen for presence of putative rhanmosidase genes using RTPCR. The expression data for the ram gene are consistent with the API 50CHL phenotypic profile of the two L. plantarum strains. Bacteriocin production is a common feature among lactobacilli isolated from a variety of sources. L. plantarum ULAG24 inhibited Salmonella in the spot-on-lawn experiment. Furthermore, expression of the entire plantaricin operon is an indication for likelihood of this antimicrobial being plantaricin, although the exact identity of the peptide will require physical evidence by MS or peptide sequence analysis. This result is in agreement with previous studies of L. plantarum that identified the bacteriocin as plantaricin (Ben Omar et al., 2006, 2008).

627


a

b I

Log CFU/ml

8.5

II

III

I

8 7.5 7 6.5 6 Salmonella enterica

L.plantarum ULAG24

L.plantarum ULAG11

L. Johnsonii F19785

Fig. 3 – In vitro determination of L. plantarum probiotic functional properties. (a) Comparative adhesion assay of lactobacilli and S. enterica LT2 to HT-29 cells. Data are expressed as the number of adherent bacteria relative to the number of seeded bacteria (% adhesion). Values represent the mean and SD of three independent experiments. (b) RT-PCR of mannose-specific adhesion gene. Lanes: I. DNA ladder; II. Undetectable expression of mannose adhesion gene in L. plantarum ULAG11; III. Expressed mannose adhesion gene by L. plantarum ULAG24.

Use of bacteriocinogenic lactobacilli to improve shelf life and safety of fermented food has been suggested previously (Bogovic-Matijasic, Rogelj, Nes, & Holo, 1998; Nielsen et al., 2010). This is particulary attractive especially for control and inhibition of acid-resistant pathogens in acidified fermented foods (Adams & Nicolaides, 2008; Tetteh, Sefa-Dedeh, Phillips, & Beuchat, 2004). Consumption of fermented cereal foods that retain viable microbial population has been identified as a safe and cheap method for delivery of probiotic strains. These strains

a

have the ability to ferment the substrate and impact health benefits via colonisation of the gastrointestinal tract. Many microbes used to achieve this objectives were previously isolated from the gut and faeces of human and animals (Audisio & Benítez-Ahrendts, 2011). African fermented foods have been shown to possess health benefits; for instance, Lei and Jakobsen (2004) showed that spent water from koko fermentation prevented diarrhoea in Ghana. Mathara et al. (2008) demonstrated cytokine stimulation among

b 8 7.8

Day 1 Day 6

LogCFU/ml

LogCfu/g

8.2 10 9 8 7 6 5 4 3 2 1 0

7.6 7.4 Salmonella enterica growth

7.2 7

lactobacilli growth

6.8 L. Johnsonii F19785

L. plantarum ULAG24

L. plantarum ULAG11

L. johnsonii FI9785

L. plantarum ULAG11

L planatrum ULAG24

Fig. 4 – L. plantarum colonisation and competitive exclusion. (a) Mice gut colonisation by lactobacilli species from day 1 to 6. (b) Competitive exclusion of S. enterica LT2 by lactobacilli strains on HT-29 cells. Data are expressed as the number of Lactobacillus cells relative to the number of S. enterica LT2 seeded (% adhesion). Value represents the mean and SD of three independent experiments.

628


a

b 4

1.4

3.5

1.2 Gavage

Ungavage

IL10/GAPDH

IFNγ/GAPDH

Gavage

3

1 0.8 0.6 0.4

Ungavage

2.5 2 1.5 1

0.2

0.5 0

0

Expression

Expression

Fig. 5 – Cytokine expression in the mice small intestine, 6 days after administration of L. plantarum ULAG24. (a) Quantitative PCR demonstrating IFN-γ in levels in mice gut. Each bar represents mean copies and SD of IFN-γ normalised to mean copies of GAPDH three independent experiments. (b) Quantitative PCR demonstrating IL10 level in mice given the lactobacilli. Each bar represents mean copies and SD of IL10 normalised to mean copies of GAPDH by quantitative PCR of three independent experiments.

strains isolated from kule naoto, a Masai dairy product in Kenya. The fear of transferable genetic elements coding for antimicrobial resistance is of safety challenge to application of probiotics (Gueimonde, Sánchez, de Los Reyes-Gavilán, & Margolles, 2013). The two L. plantarum strains studied were resistant to aminoglycoside (neomycin and streptomycin); the gene cassette for resistance to aminoglycoside is chromosomal bond, previously shown to be common and stable among food grade LAB (Ouoba, Lei, & Jensen, 2008). Results from this study indicated that L. plantarum ULAG24 also possesses tolerance to stomatch acidity and bile salts, gut colonisation, and in vitro pathogen competitive exclusion and in vivo immune stimulation characteristics. Of the two isolated L. plantarum strains, ULAG24 was demonstrated to possess the most promising probiotic functions since it competitively excluded S. enetrica, adhered well to gut epithelia cells and expressed mannose-specific adhesin gene (msa). This result is in agreement with previous reports where L. plantarum was shown to bind to mannose residues, a property that facilitates inhibition of colonisation of pathogen by competitive exclusion and therefore prevent gut infection (Gross, Snel, Boekhorst, Smits, & Kleerebezem, 2010; Pretzer et al., 2005). L. plantarum ULAG24 also stimulated synthesis of cytokines IL10 in mice gut which is known to be anti-inflamatory, and IFNγ which has antiviral, immunoregulatory, and anti-tumour properties. These cytokines play important role as gut immunoregulators, and their induction during persistence and chronic diarrohea associated with rotaviruse and enteropthogenic E. coli in developing counties has been well documented (Azim et al, 1999; Flores et al., 2008; Oguntoyinbo, 2014). Therefore, this strain can be referred to as probiotic starter cultures with health improvement properties that include gut colonisation, pathogens inhibition and induction of immune response.

5.

Conclusion

Lactobacilli are consumed in large numbers via many fermented cereals in W. Africa. Their use as starter cultures with probiotic properties referred to as multifunctional strains in this study can bring about delivery of functional food with added health benefits, as well as improve food safety in developing countries. This study showed genetic diversity of L. plantarum and distribution of functional properties in different strains. Only very few lactobacilli have been shown to be amylolytic; this study supports the existing knowledge by demonstrating that L. plantraum ULAG11 is amylolytic, expressed conserved region of amylase gene, and indicated strong ability for in situ production of amylase in cereal fermentation menstrum. This property could be annexed for rapid hydrolysis of starch to aid acidity, pH reduction needed for pathogen control and flavour development. The two L. plantarum strains expressed gene coding for rhamnosidase; rhamnosidase is an important enzyme for hydrolysis of rhamnose in cereals for functional benefits. The strains also survived bile 0.3% (w/ v) and acid up to pH 2.0; this justified their ability to withstand and adapt to GI conditions, a prerequisite for probiotic candidate selection, previously under-investigated in food grade microbes. In addition, L. plantarum ULAG24 showed very relevant probiotic properties; it adhered to HT29 cells and BALB/C gut, stimulated gut cytokines (IL10 and IFN-γ), produced bacteriocin by expression of planatricin genes and competitively excluded pathogen. Multifunctional strains such as L. plantraum ULAG11 and ULAG24 in African fermented cereal foods have merits; their important technological properties could be further investigated and developed for application for both small- and large-scale industrial cereal food production with enhanced health benefits.


Acknowledgements Funding from the Newton International Fellowship of the Royal Society, UK (NF080223) and study leave granted by the University of Lagos, Nigeria, that facilitated FAO collaboration with IFR are gratefully acknowledged.

REFERENCES

Abriouel, H., Maqueda, M., Galvez, A., Martinez-Bueno, M., & Valdivia, E. (2002). Inhibition of bacterial growth, enterotoxin production, and spore outgrowth in strains of Bacillus cereus by bacteriocin AS-48. Applied and Environmental Microbiology, 68, 1473–1477. Adams, M. R., & Nicolaides, L. (2008). Review of the sensitivity of different foodborne pathogens to fermentation. Food Control, 8, 227–239. Ampe, F., Sirvent, A., & Zakhia, N. (2001). Dynamics of the microbial community responsible for traditional sour cassava starch fermentation studied by denaturing gradient gel electrophoresis and quantitative rRNA hybridization. International Journal of Food Microbiology, 65, 45–54. Anderson, R. C., Cookson, A. L., McNabb, W. C., Kelly, W. J., & Roy, N. C. (2010). Lactobacillus plantarum DSM 2648 is a potential probiotic that enhances intestinal barrier function. FEMS Microbiology Letters, 309, 184–192. Arena, M. P., Pasquale Russo, P., Capozzi, V., López, P., Fiocco, D., & Spano, G. (2014). Probiotic abilities of riboflavin-overproducing Lactobacillus strains: A novel promising application of probiotics. Applied Microbiology and Biotechnology, 98(17), 7569– 7581. Audisio, M. C., & Benítez-Ahrendts, M. R. (2011). Lactobacillus johnsonii CRL1647, isolated from Apis mellifera L. bee-gut, exhibited a beneficial effect on honeybee colonies. Beneficial Microbes, 2, 29–34. Azim, T., Ahmad, S. M., Sefat-E-Khuda, Sarker, M. S., Unicomb, L. E., De, S., Hamadani, J. D., Salam, M. A., Wahed, M. A., & Albert, M. J. (1999). Immune response of children who develop persistent diarrhoea following rotavirus infection. Clinical and Diagnostic Laboratory Immunology, 6, 690–695. Beekwilder, J., Marcozzi, D., Vecchi, S., de Vos, R., Janssen, P., Francke, C., van Hylckama Vlieg, J., & Hall, R. D. (2009). Characterization of rhamnosidases from Lactobacillus plantarum and Lactobacillus acidophilus. Applied and Environmental Microbiology, 75, 3447–3454. Ben Omar, N., Abriouel, H., Keleke, S., Sánchez Valenzuela, A., Martínez-Cañamero, M., Lucas López, R., Ortega, E., & Gálvez, A. (2008). Bacteriocin-producing Lactobacillus strains isolated from poto poto, a Congolese fermented maize product, and genetic fingerprinting of their plantaricin operons. International Journal of Food Microbiology, 30, 18–25. Ben Omar, N., Abriouel, H., Lucas, R., Martínez-Cañamero, M., Guyot, J. P., & Gálvez, A. (2006). Isolation of bacteriocinogenic Lactobacillus plantarum strains from ben saalga, a traditional fermented gruel from Burkina Faso. International Journal of Food Microbiology, 112, 44–50. Bogovic-Matijasic, B., Rogelj, I., Nes, I. F., & Holo, H. (1998). Isolation and characterization of two bacteriocins of Lactobacillus acidophilus LF221. Applied Microbiology and Biotechnology, 49, 606–612. Bohak, I., Back, W., Richter, L., Ehrmann, M., Ludwig, W., & Schleifer, K. H. (1998). Lactobacillus amylolyticus sp. nov., isolated from beer malt and beer wort. Systematic and Applied Microbiology, 21, 360–364.

629

Capozzi, V., Russo, P., Beneduce, L., Weidmann, S., Grieco, F., Guzzo, J., & Spano, G. (2010). Technological properties of Oenococcus oeni strains isolated from typical southern Italian wines. Letters in Applied Microbiology, 50(3), 327– 334. Capozzi, V., Russo, P., Dueñas, M. T., López, P., & Spano, G. (2012). Lactic acid bacteria producing B-group vitamins: A great potential for functional cereals products. Applied Microbiology and Biotechnology, 96, 1383–1394. Cebrián, R., Baños, A., Valdivia, E., Pérez-Pulido, R., MartínezBueno, M., & Maqueda, M. (2012). Characterization of functional, safety, and probiotic properties of Enterococcus faecalis UGRA10, a new AS-48-producer strain. Food Microbiology, 30, 59–67. Flores, J., DuPont, H. L., Lee, S. A., Belkind-Gerson, J., Paredes, M. J., Mohamed, J. A., Lisa, Y., Armitige, L. Y., Guo, D., & Okhuysen, P. C. (2008). Influence of host interleukin-10 polymorphisms on development of traveler’s diarrhoea due to heat-labile enterotoxin-producing Escherichia coli in travelers from the United States who are visiting Mexico. Clinical and Vaccine Immunology, 15, 1194–1198. Franz, C. M., Huch, M., Mathara, J. M., Abriouel, H., Benomar, N., Reid, G., Galvez, A., & Holzapfel, W. H. (2014). African fermented foods and probiotics. International Journal of Food Microbiology, 190, 84–96. Gaffa, T., Jideani, I. A., & Nkama, I. (2002). Traditional production, consumption and storage of Kunu–a non alcoholic cereal beverage. Plant Foods for Human Nutrition, 57, 73–81. Giraud, E., Brauman, A., Keleke, S., Lelong, B., & Raimbault, M. (1991). Isolation and physiological study of an amylolytic strain of Lactobacillus plantarum. Applied Microbiology and Biotechnology, 36, 379–383. Giraud, E., & Cuny, G. (1997). Molecular characterization of the alpha amylase genes of Lactobacillus plantarum A6 and lactobacillus amylovorus reveals an unusual 3’ end structure with direct tandem repeats and suggests a common evolutionary origin. Gene, 198, 149–157. Gross, G., Snel, J., Boekhorst, J., Smits, M. A., & Kleerebezem, M. (2010). Biodiversity of mannose-specific adhesion in Lactobacillus plantarum revisited: Strain-specific domain composition of the mannose-adhesin. Beneficial Microbes, 1, 61–66. Gueimonde, M., Sánchez, B., de Los Reyes-Gavilán, C. G., & Margolles, A. (2013). Antibiotic resistance in probiotic bacteria. Frontiers in Microbiology, 4, 202. Halm, M., Lillie, A., Sorensen, A. K., & Jakobsen, M. (1993). Microbiological and aromatic characteristics of fermented maize doughs for kenkey production in Ghana. International Journal of Food Microbiology, 19, 135–143. Halm, M., Osei-Yaw, V., Hayford, A., Kpodo, K. A., & Amoa-Awua, W. K. A. (1996). Experiences with the use of a starter culture in the fermentation of maize for ‘kenkey’ production in Ghana. World Journal of Microbiology and Biotechnology, 12, 531– 536. Holzapfel, W. H. (2002). Appropriate starter culture technologies for small-scale fermentation in developing countries. International Journal of Food Microbiology, 75, 197–212. Humblot, C., Turpin, W., Chevalier, F., Picq, C., Rochette, I., & Guyot, J. P. (2014). Determination of expression and activity of genes involved in starch metabolism in Lactobacillus plantarum A6 during fermentation of a cereal-based gruel. International Journal of Food Microbiology, 185, 103–111. Hyronimus, B., Le Marrec, C., Hadj Sassi, A., & Deschamps, A. (2000). Acid and bile tolerance of spore-forming lactic acid bacteria. International Journal of Food Microbiology, 61, 193–197. Kleerebezem, M., Boekhorst, J., van Kranenburg, R., Molenaar, D., Kuipers, O. P., Leer, R., Tarchini, R., Peters, S. A., Sandbrink, H. M., Fiers, M. W., Stiekema, W., Lankhorst, R. M., Bron, P. A.,

630


Hoffer, S. M., Groot, M. N., Kerkhoven, R., de Vries, M., Ursing, B., de Vos, W. M., & Siezen, R. J. (2003). Complete genome sequence of Lactobacillus plantarum WCFS1. Proceedings of the National Academy of Sciences of the United States of America, 100(4), 1990–1995. Lartey, A., Manu, A., Brown, K. H., Peerson, J. M., & Dewey, K. G. (1999). A randomized, community-based trial of the effects of improved, centrally processed complementary foods on growth and micronutrient status of Ghanaian infants from 6 to 12 mo of age. The American Journal of Clinical Nutrition, 70, 391–404. Lei, V., Friis, H., & Michaelsen, K. F. (2006). Spontaneously fermented millet product as a natural probiotic treatment for diarrhoea in young children: An intervention study in Northern Ghana. International Journal of Food Microbiology, 110, 246–253. Lei, V., & Jakobsen, M. (2004). Microbiological characterization and probiotic potential of koko and koko sour water, African spontaneously fermented millet porridge and drink. Journal of Applied Microbiology, 96, 384–397. Mathara, J. M., Schillinger, U., Guigas, C., Franz, C., Kutima, P. M., Mbugua, S. K., Shin, H. K., & Holzapfel, W. H. (2008). Functional characteristics of Lactobacillus spp. from traditional Maasai fermented milk products in Kenya. International Journal of Food Microbiology, 126, 57–64. Meijerink, M., van Hemert, S., Taverne, N., Wels, M., de Vos, P., Bron, P. A., Savelkoul, H. F., Bilsen, J., Kleerebezem, M., & Wells, J. M. (2010). Identification of genetic loci in Lactobacillus plantarum that modulate the immune response of dendritic cells using comparative genome hybridization. PLoS ONE, 5(5), e10632. Mugula, J. K., Nnko, S. A., Narvhus, J. A., & Sørhaug, T. (2003). Microbiological and fermentation characteristics of togwa, a Tanzanian fermented food. International Journal of Food Microbiology, 80, 187–199. Nielsen, D. S., Cho, G. S., Hanak, A., Huch, M., Franz, C. M., & Arneborg, N. (2010). The effect of bacteriocin-producing Lactobacillus plantarum strains on the intracellular pH of sessile and planktonic Listeria monocytogenes single cells. International Journal of Food Microbiology, 141(Suppl. 1), S53–S59. Nnam, N. M. (2000). Chemical evaluation of multimixes formulated from some local staples for use as complementary foods in Nigeria. Plant Foods for Human Nutrition, 55, 255–263. Nout, M. J. (2009). Rich nutrition from the poorest – Cereal fermentations in Africa and Asia. Food Microbiology, 26, 685– 692. Oguntoyinbo, F. A. (2014). Safety challenges associated with traditional foods of West Africa. Food Reviews International, 30, 338–358. Oguntoyinbo, F. A., & Narbad, A. (2012). Molecular characterization of lactic acid bacteria and in situ amylase expression during traditional fermentation of cereal foods. Food Microbiology, 31, 254–262. Oguntoyinbo, F. A., Tourlomousis, P., Gasson, M. J., & Narbad, A. (2011). Analysis of bacterial communities of traditional fermented West African cereal foods using culture independent methods. International Journal of Food Microbiology, 145, 205–210. Ojofeitimi, E. O., Abiose, S., Ijadunola, K. T., Pedro, T., & Jinadu, M. K. (2001). Modification and improvement of nutritive quality of cornpap “Ogi” with cowpea and groundnut milk. Nutrition and Health, 15, 47–53. Olasupo, N. A., Olukoya, D. K., & Odunfa, S. A. (1994). Plasmid profiles of bacteriocin-producing Lactobacillus isolates from African fermented foods. Folia Microbiologica, 39, 181–186. Olasupo, N. A., Schillinger, U., Narbad, A., Dodd, H., & Holzapfel, W. H. (1999). Occurrence of nisin Z production in Lactococcus

lactis BFE 1500 isolated from wara, a traditional Nigerian cheese product. International Journal of Food Microbiology, 5, 141–152. Ouoba, L. I., Lei, V., & Jensen, L. B. (2008). Resistance of potential probiotic lactic acid bacteria and bifidobacteria of African and European origin to antimicrobials: Determination and transferability of the resistance genes to other bacteria. International Journal of Food Microbiology, 121, 217–224. Pinto, S. B., Kafatos, F. C., & Michel, K. (2008). The parasite invasion marker SRPN6 reduces sporozoite numbers in salivary glands of Anopheles gambiae. Cellular Microbiology, 10, 891–898. Pretzer, G., Snel, J., Molenaar, D., Wiersma, A., Bron, P. A., Lambert, J., de Vos, W. M., van der Meer, R., Smits, M. A., & Kleerebezem, M. (2005). Biodiversity-based identification and functional characterization of the mannose-specific adhesin of Lactobacillus plantarum. Journal of Bacteriology, 187, 6128– 6136. Rathore, S., Salmerón, I., & Pandiella, S. S. (2007). Production of potentially probiotic beverages using single and mixed cereal substrates fermented with lactic acid bacteria cultures. Food Microbiology, 30, 239–244. Songré-Ouattara, L. T., Mouquet-Rivier, C., Humblot, C., & Rochette, I. (2010). Soybean slurry to produce gruels for complementary foods for young children. Journal of Food Science, 75, M261–M269. Songre-Ouattara, L. T., Mouquet-Rivier, C., Icard-Verniere, C., Rochette, I., Diawara, B., & Guyot, J. P. (2009). Potential of amylolytic lactic acid bacteria to replace the use of malt for partial starch hydrolysis to produce African fermented pearl millet gruel fortified with groundnut. International Journal of Food Microbiology, 130, 258–264. Svanberg, U., Sjögren, E., Lorri, W., Svennerholm, A. M., & Kaijser, B. (1992). Inhibited growth of common enteropathogenic bacteria in lactic-fermented cereal gruels. World Journal of Microbiology and Biotechnology, 8, 601– 606. Teniola, O., & Odunfa, S. A. (2001). The effects of processing methods on the levels of lysine, methionine and the general acceptability of ogi processed using starter cultures. International Journal of Food Microbiology, 63, 1–9. Tetteh, G. L., Sefa-Dedeh, S. K., Phillips, R. D., & Beuchat, L. R. (2004). Survival and growth of acid-adapted and unadapted Shigella flexneri in a traditional fermented Ghanaian weaning food as affected by fortification with cowpea. International Journal of Food Microbiology, 90(2), 189–195. Todorov, S. D., Ho, P., Vaz-Velho, M., & Dicks, L. M. (2010). Characterization of bacteriocins produced by two strains of Lactobacillus plantarum isolated from Beloura and Chourico, traditional pork products from Portugal. Meat Science, 84, 334– 343. Tou, E. H., Guyot, J. P., Mouquet-Rivier, C., Rochette, I., Counil, E., Traore, A. S., & Treche, S. (2006). Study through surveys and fermentation kinetics of the traditional processing of pearl millet (Pennisetum glaucum) into ben-saalga, a fermented gruel from Burkina Faso. International Journal of Food Microbiology, 106, 52–60. Turpin, W., Humblot, C., & Guyot, J. P. (2011). Genetic screening of functional properties of lactic acid bacteria in a fermented pearl millet slurry and in the metagenome of fermented starchy foods. Applied and Environmental Microbiology, 77, 8722– 8734. Wang, C. Y., Lin, P. R., Ng, C. C., & Shyu, Y. T. (2010). Probiotic properties of Lactobacillus strains isolated from the feces of breast-fed infants and Taiwanese pickled cabbage. Anaerobe, 16, 578–585.


Wang, C. Y., Wu, S. J., & Shyu, Y. T. (2014). Antioxidant properties of certain cereals as affected by food-grade bacteria fermentation. Journal of Bioscience and Bioengineering, 117, 449– 456. Waters, D. M., Mauch, A., Coffey, A., Arendt, E. K., & Zannini, E. (2015). Lactic acid bacteria as a cell factory for the delivery of functional biomolecules and ingredients in cereal based

631

beverages: A review. Critical Reviews in Food Science and Nutrition, 55, 503–520. http://dx.doi.org/10.1080/10408398.2012.660251. Xia, Y., Chen, H. Q., Zhang, M., Jiang, Y. Q., Hang, X. M., & Qin, H. L. (2011). Effect of Lactobacillus plantarum LP-Onlly on gut flora and colitis in interleukin-10 knockout mice. Journal of Gastroenterology and Hepatology, 26, 405–411.