Article March 2013 Vol.58 No.8: 873878 doi: 10.1007/s11434-012-5553-9
Analytical Chemistry
SPECIAL TOPICS:
Multiplex detection of KRAS and BRAF mutations using cationic conjugated polymers XING BaoLing1†, SONG JinZhao2†, GE SuMei1, TANG ZhengHua1, LIU MengLu1, YANG Qiong2*, LÜ FengTing2, LIU LiBing2 & WANG Shu2* 1 2
Department of Pathology, Changzhou Wommen and Children Health Hospital, Changzhou 213003, China; Key Laboratory of Organic Solids, Institute of Chemistry, Chinese Academy of Sciences, Beijing 100190, China
Received July 3, 2012; accepted September 26, 2012; published online December 2, 2012
The mutation detections of KRAS and BRAF genes are of significant importance to predict the responses to anti-cancer therapy and develop new drugs. In this paper, we developed a multi-step fluorescence resonance energy transfer (FRET) assay for multiplex detection of KRAS and BRAF mutations using cationic conjugated polymers (CCP). The newly established detection system could detect as low as 2% mutant DNAs in DNA admixtures. By triggering the emission intensity change of CCP and the dyes labeled in the DNA, four possible statuses (three mutations and one wildtype) can be differentiated in one extension reaction. The detection efficiency of this new method in clinical molecular diagnosis was validated by determining KRAS and BRAF mutations of 51 formalin-fixed paraffin-embedded (FFPE) ovary tissue samples. Furthermore, the result of the CCP-based multi-step FRET assay can be directly visualized under UV light so that no expensive instruments and technical expertise are needed. Thus, the assay provides a sensitive, reliable, cost-effective and simple method for the detection of disease-related gene mutations. conjugated polymers, DNA mutation, KRAS, BRAF, sensors Citation:
Xing B L, Song J Z, Ge S M, et al. Multiplex detection of KRAS and BRAF mutations using cationic conjugated polymers. Chin Sci Bull, 2013, 58: 873 878, doi: 10.1007/s11434-012-5553-9
In the era of personalized medicine, understanding the mutation profile of individual tumors is useful for conducting anti-cancer therapy. In the past few years, mutations in KRAS and BRAF genes have been discovered in many different human cancers [1,2]. Mutation detection in these genes has shown good results in predicting response to anti-EGFR therapy in patients with metastatic colorectal cancer (CRC) [3–6]. Studies are underway to figure out the roles of KRAS and BRAF mutations as predictive biomarkers and drug targets in other cancers therapy [2,7–9]. Therefore, it is of significant importance to develop effective techniques for the detection of KRAS and BRAF mutations that can predict the response to cancer therapy as well as develop new drugs. Currently, various methods for KRAS and BRAF muta†These authors contributed equally to this work. *Corresponding authors (email:
[email protected];
[email protected]) © The Author(s) 2012. This article is published with open access at Springerlink.com
tion detection have been reported, such as single strand conformation polymorphism analysis (SSCP) [10], highresolution melting analysis (HRMA) [11], direct sequencing [10,12], real-time quantitative-PCR (RQ-PCR) method [13–15], and SNaPshot assay [16,17]. SSCP and HRMA are pre-screening approaches that demand subsequent sequence verification of potential mutations, leading to the increased time and cost. Direct sequencing is expensive and not sensitive enough to detect low abundant mutations. RQ-PCR has much higher analytical sensitivity for mutation detection. However, the utilization of organic dyes-labeled oligonucleotide probes carries a high cost. Compared to direct sequencing and RQ-PCR methods, SNaPshot assay can simultaneously screen several mutations and reduce the cost of assays. Nevertheless, this method still requires expensive instruments and technical expertise. Thus, a simple, inexpensive, sensitive, and multiplex mutation diagnosis method remains to be explored. csb.scichina.com
www.springer.com/scp
874
Xing B L, et al.
Chin Sci Bull
Conjugated polymers (CPs) contain a large number of repeated absorbing units, and the transfer of excitation energy along the whole backbone of CPs to the dye reporter can result in the amplification of fluorescence signals, providing an optical platform for developing highly sensitive biological detection methods [18–26]. Recently, taking advantage of light-harvesting and signal-amplifying property of cationic conjugated polymers (CCP), point mutation detection of EGFR based on fluorescence resonance energy transfer (FRET) has been developed by our group [27,28]. The established assay possesses the advantages of convenience, low cost and high sensitivity. In the present work, we developed a CCP-based multi-step FRET assay to detect KRAS and BRAF somatic mutations. The newly constructed method integrate multiplex PCR with multiplex single base extension (SBE) reaction, and the detection of multiple hotspot mutations can be simultaneously accomplished in one tube. In our established detection system, twelve mutations in KRAS and BRAF genes can be detected by suitable SBE primer design. The KRAS and BRAF mutations originated from practical clinical samples can be sensitively determined by utilizing our CCP-based multi-step FRET assay.
1 Experimental 1.1
Materials and apparatus
CCP was prepared using the procedures described in our previous paper [24]. Ex Taq, Taq DNA polymerase, shrimp alkaline phosphatase (SAP) and exonuclease I were purchased from TaKaRa Biotechnology Co., Ltd (Dalian, China). Inorganic pyrophosphatase (yeast) was from New England Biolabs (Beijing) Ltd. The dATP labeled with a texas red (dATP-TR), dCTP labeled with a fluorescein (dCTP-Fl) and dUTP labeled with a fluorescein (dUTP-Fl) were obtained from Perkin Elmer. PAGE-purified DNAs were synthesized by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. QIAmp DNA kit was purchased from QIAGEN (Beijing). All PCR and SBE reactions were carried out in a Bio-Rad Mycycler thermocycler. Fluorescence spectra were measured with a Hitachi F-4500 fluorimeter equipped with a Xenon lamp excitation source. All photographs were taken with a Canon EOS 550D digital camera in a WD-9403F UV Viewing Cabinet (Beijing Liuyi Instrument Factory, Bejing, China) under 365 nm UV light irradiation. 1.2
Clinical samples and controls
Clinical samples were excised from 51 FFPE ovary tissues (41 cancer and 10 normal samples). Genomic DNAs (gDNA) of these clinical samples were extracted using a QIAmp DNA kit according to the manufacturer’s protocol. To identify the KRAS and BRAF genes status of these samples, we sequenced their PCR amplified products using re-
March (2013) Vol.58 No.8
verse primer for KRAS gene and forward primer for BRAF gene. Positive controls were mutant DNAs prepared by PCR-mediated in vitro mutagenesis [29] and negative control was wildtype gDNA sample isolated from 293T cell line. 1.3
Multiplex PCR amplification
To amplify KRAS and BRAF genes including the mutation sites of interest, multiplex PCR was carried out. The two pairs of PCR primers involved were as follows: kras-Fw, GCCTGCTGAAAATGACTGAA; kras-Rv, AGAATGGTCCTGCACCAGTA; braf-Fw, CTCTTCATAATGCTTGCTCTG; braf-Rv, TAGTAACTCAGCAGCATCTCA. The 40 ng of DNA was added to 30 μL of a reaction mixture containing 1×Ex Taq buffer, 2 mmol/L MgCl2, 0.25 mmol/L dNTPs, 0.75 unit Ex Taq DNA polymerase, 0.2 μmol/L of each primer. Thermal cycler conditions were: 94°C for 2 min, 45 cycles of 95°C for 30 s, 60°C for 30 s, 72°C for 30 s and finally 10 min at 72°C. Multiplex PCR products were analyzed for quality and yield utilizing 2.5% agarose gel electrophoresis. Then 8 μL PCR products were taken to be treated with 1 unit of SAP, 10 units of exonuclease I and 0.05 unit of pyrophosphatase at 37°C for 1 h to remove excess primers, dNTPs, and pyrophosphate generated in PCR. 1.4
Multiplex SBE reactions
Multiplex SBE reactions were conducted in a total volume of 15 μL containing 1×Taq buffer, 2 μmol/L dATP-TR and dUTP-Fl, 1 μmol/L of each SBE primer (Table S1), 1.5 unit Taq DNA polymerase, and 1.5 μL exonuclease/SAP/pyrophosphatase-treated multiplex PCR products. Extension reactions were ran in a thermal cycler and the conditions were 94°C for 2 min, followed by 60 cycles of 94°C for 30 s and 60°C for 30 s. To degrade unreacted dye-dNTPs, each extension products were treated with 1 unit of SAP before detecting the FRET signals. 1.5 CCP-based multi-step FRET measurement and visual detection For fluorescence measurement, 6 μL multiplex SBE products were diluted with 586 μL HEPES buffer (25 mmol/L, pH 8.0), and then 8 μL CCP (15 μmol/L) was added to the solution. The emission spectra were measured in a 3 mL quartz cuvette with an excitation wavelength of 380 nm. For visual detection, add 24 μL of CCP (15 μmol/L) to the multiplex SBE products from the above step in PCR tubes, mix thoroughly by pipetting, and then take photographs in a WD-9403F UV Viewing Cabinet under 365 nm UV light irradiation.
2
Results and discussion
In our multi-step FRET assay, cationic poly[(9,9-bis (6′-N,
Xing B L, et al.
Chin Sci Bull
N,N-trimethylammonium)hexyl) fluorenylene phenylene] (CCP, see Scheme 1 for chemical structure), fluorescein labeled dUTP and Tex Red labeled dATP were used. Among them, CCP acts as the donor for fluorescein and Tex Red, fluorescein acts as the acceptor for CCP and the donor for Tex Red to satisfy the overlap integral requirement for FRET. The overall detection strategy for the KRAS and BRAF mutations is illustrated in Scheme 1. Firstly, the multiplex PCR products were amplified from KRAS and BRAF genes by two pairs of PCR primers (kras-Fw, kras-Rv, braf-Fw and braf-Rv), which contain the mutation sites of interest. Secondly, two mutation sites in the amplified DNA fragments were simultaneously detected using SBE primers (1799T>C and 35G>T) as probes. The 3′-terminal base of 1799T>C primer is C that is complementary to the 1799T> C mutation base but not to that of wildtype; meanwhile, the T base at the 3′-terminal of 35G>T primer is complementary to the 35G>T mutation base rather than the wildtype. The dATP-TR, dUTP-Fl, and Taq DNA polymerase are used for SBE reactions. In this detection system, there are four possible statuses: 1799T>C, 1799T>C/35G>T, 35G>T and wildtype. For 1799T>C mutation, only dATP-TR is incorporated into the 1799T>C primer, when CCP was added, the strong electrostatic interactions between negatively charged DNA and cationic CCP bring them close to each other and efficient FRET from CCP to TR occurs upon exciting CCP with 380 nm. Similarly, for 35G>T mutation, only dUTP-Fl can be incorporated into 35G>T primer, leading to efficient FRET from CCP to Fl. For the case of 1799T>C/35G>T mutations, dATP-TR and dUTP-Fl are respectively incorporated into the 1799T>C and 35G>T primers, leading to multi-step FRET (CCP→Fl, CCP→TR and Fl→TR). For wildtype status, the 3′-terminal bases of both 1799T>C and 35G>T are not complementary to the wildtype targets, thus the base extension reactions cannot be performed. As a result, upon addition of CCP, weak electrostatic interactions between dATP-TR, dUTP-Fl and CCP can not keep them close enough, resulting in inefficient FRET from CCP to TR and Fl. Therefore, by triggering the
March (2013) Vol.58 No.8
875
change of emission intensity or the shift in emission color of assay solution, four possible statuses (three mutations and one wildtype) can be differentiated in one extension reaction. Figure 1(a) shows the emission spectra of SBE products upon addition of CCP with the excitation wavelength of 380 nm, and Figure 1(b) shows the corresponding image of SBE products mixed with CCP in PCR tubes under 365 nm UV light irradiation. For 1799T>C mutation, efficient FRET from CCP to TR led to a significant increase of TR emission at 613 nm, and the solution exhibited a red color. For 35G>T mutation, an evident emission of Fl was observed at 528 nm and the solution emitted a yellow-green color that composed of green emission of Fl and the bluish violet background. For both 1799T>C and 35G>T mutations, emissions of TR and Fl were demonstrated and the solution exhibited an orange-red color. For the wildtype, a little TR and Fl fluorescence signals were observed and the solution displayed a bluish violet color, indicating that a weak nonspecific SBE reaction occurred, but these signals were much lower than that of specific SBE reaction. By triggering the change of emission intensity or emission color of assay solutions, three kinds of mutation status were clearly distinguished from the wildtype sample. To assess the sensitivity and reproducibility of our detection system, we mixed mutant DNA with wildtype DNA in various proportions. The emission spectra of a series of extension products were measured upon adding CCP. All of the measurements were repeated three times. As demonstrated in Figure 2, for 1799T>C or 35G>T mutation, as the proportion of mutant target in the test sample increases, the emission intensity of TR or Fl increases and that of CCP decreases. For 1799T>C/35G>T mutation, the emission intensity of TR and Fl increases simultaneously and that of CCP decreases when 1799T>C/35G>T mutation proportion increases in the samples. By observing the change of emission intensity, 2%–5% level of detection for 1799T>C, 1799T>C/35G>T and 35G>T was achieved. In order to make test results more intuitive, assay plots with various
Scheme 1 Schematic representation of CCP-based multi-step FRET assay for KRAS and BRAF mutation detection and chemical structure of CCP used in the assay.
876
Xing B L, et al.
Chin Sci Bull
Figure 1 (a) Fluorescence spectra of positive (1799T>C, 1799T>C/35G> T, 35G>T) and negative controls by mixing SBE products with CCP and CCP alone in the HEPES buffer. SBE products were diluted by 100 times with HEPES buffer solution (25 mmol/L, pH 8.0) before fluorescence measurement. [CCP] = 2×10–7 mol/L in RUs. The excitation wavelength is 380 nm. (b) The corresponding images of 1799T>C, 1799T>C/35G>T, 35G>T, and wildtype when SBE products mixed with CCP (15 μmol/L in RUs) in PCR tubes under 365 nm UV light irradiation.
March (2013) Vol.58 No.8
mutation proportions were drawn as functions of FRET ratios (I528 nm/I425 nm as y axis and I613 nm/I425 nm as x axis). As revealed in Figure 2(d), the I613 nm/I425 nm and I528 nm/I425 nm FRET ratios increase with the increasing of 1799T>C and 35G>T mutation proportion in the tested samples. As expected, both I613 nm/I425 nm and I528 nm/I425 nm FRET ratios increase when 1799T>C/35G>T mutation proportion increases in the samples. As shown in the scatter diagram, we were able to detect 1799T>C, 1799T>C/35G>T and 35G>T mutations even mutant DNA represented 2% of the total input DNA. In addition, the relationship between the FRET ratios (I613 nm/I425 nm, I528 nm/I425 nm and (I613 nm+I528 nm)/I425 nm) and mutation proportions was investigated. As demonstrated in Figure S1, the dynamic range of mutation proportion is from 2% to 100%, and all mutation proportions demonstrated reproducible results. Thus, our CCP-based multiplex detection system exhibits excellent sensitivity and reproducibility. To investigate the practicality of our CCP-based multiplex detection system with clinical samples, we assayed the genomic DNAs extracted from 51 FFPE ovary tissues (41 cancer and 10 normal samples) to determine the presence of KRAS and BRAF mutations. The CCP-based multi-step FRET assay was designed to detect and differentiate twelve mutations in KRAS and BRAF genes: nine mutations in
Figure 2 Emission spectra from solutions containing CCP and extension products with various mutation proportions. (a) 1799T>C, (b) 35G>T, (c) 1799T>C/35G>T, (d) assay plots for 1799T>C, 1799T>C/35G>T and 35G>T with various mutation proportions as functions of FRET ratios.
Xing B L, et al.
Chin Sci Bull
March (2013) Vol.58 No.8
877
is 3% in ovarian cancer. The low incidence may explain the absence of BRAF mutations in our assay. Furthermore, no mutations were detected in 10 normal ovary samples. DNA sequencing analysis was performed to confirm the presence of mutations. As revealed in Figure S4, four mutations were consistent with the results obtained from the CCP-based multiplex detection system. This supports the tentative conclusion that our CCP-based multi-step FRET assay is a valid approach to efficiently detect somatic mutations in clinical samples.
3 Conclusions
Figure 3 Scatter diagram of mutation status from 51 ovary samples using FRET ratios (I613 nm/I425 nm) as x axis and FRET ratios (I528 nm/I425 nm) as y axis. The cutoff values of I613 nm/I425 nm and I528 nm/I425 nm ratios were (a) 0.19 and 0.16 for 1799T>C/35G>T probe group, (b) 0.21 and 0.14 for 1799T> G/35G>C probe group, respectively.
codons 12 and 13 of the KRAS gene and three mutations in codon 600 of the BRAF gene (Table S2). Twelve SBE primers were divided into six probe groups to detect the twelve mutations (Table S1). Fluorescence spectra using the other five probe groups as SBE primers (Figure S2) were consistent with those using p1799T>C/p35G>T probe group that was demonstrated in Figure 1. Cutoff values were established as the mean +3SD with I613 nm/I425 nm or I528 nm/I425 nm ratio values of negative control reactions. Only the samples with readout above these cutoff values were considered as positive signals. As presented in FRET ratio scatter diagram in Figure 3, four samples with KRAS mutation were identified in 41 ovarian cancer samples by 1799T>C/35G>T and 1799T>G/35G>C probe groups. No mutations were detected by the other four probe groups (Figure S3). Our method can easily differentiate mutation statuses of samples. As indicated in Figure 3, of the ovarian cancer samples positive for KRAS mutations, three samples carried a 35G>T mutation and one sample carried a 35G>C mutation. The incidence (10%) of KRAS mutations in ovarian cancer samples was consistent with COSMIC Database (Catalogue Of Somatic Mutations In Cancer Database). No BRAF mutations were identified in 41 ovarian cancer samples. According to COSMIC Database, the incidence of BRAF mutations
In summary, we have demonstrated CCP-based multi-step FRET assay for multiplex detection of KRAS and BRAF mutations. Compared to the methods reported previously, our assay possesses the following several unique features. Firstly, taking advantage of light-harvesting and light-amplifying effect of CCP, high sensitivity was obtained. The new detection system could detect even as low as 2% mutation of total DNA. The application of this method in clinical molecular diagnosis was validated by determining KRAS and BRAF mutations in 51 FFPE ovary tissues. Secondly, by triggering the emission intensity change of assay solution, four possible statuses (three mutations and one wildtype) can be differentiated in one extension reaction, which streamlined workflow, and saved diagnostic time and DNA input. More importantly, the detection can be visualized under UV light so that no expensive instruments and technical expertise are needed. Our method is sensitive, reliable, cost-effective and simple for KRAS and BRAF mutation detection. Therefore, with the era of personalized medicine coming, it is believed that the CCP-based multi-step FRET assay has greatly potential application in clinical diagnosis. This work was supported by the National Natural Science Foundation of China (90913014, 21021091). 1 2 3
4
5
6
7
Davies H, Bignell G R, Cox C, et al. Mutations of the BRAF gene in human cancer. Nature, 2002, 417: 949954 Vakiani E, Solit D B. KRAS and BRAF: Drug targets and predictive biomarkers. J Pathol, 2011, 223: 220230 Allegra C J, Jessup J M, Somerfield M R, et al. American Society of Clinical Oncology Provisional Clinical Opinion: Testing for KRAS gene mutations in patients with metastatic colorectal carcinoma to predict response to anti-epidermal growth factor receptor monoclonal antibody therapy. J Clin Oncol, 2009, 27: 20912096 Karapetis C S, Khambata-Ford S, Jonker D J, et al. K-ras mutations and benefit from cetuximab in advanced colorectal cancer. N Engl J Med, 2008, 359: 17571765 Van Cutsem E, Köhne C H, Hitre E, et al. Cetuximab and chemotherapy as initial treatment for metastatic colorectal cancer. N Engl J Med, 2009, 360: 14081417 Di Nicolantonio F, Martini M, Molinari F, et al. Wild-type BRAF is required for response to panitumumab or cetuximab in metastatic colorectal cancer. J Clin Oncol, 2008, 26: 57055712 Ratner E, Lu L, Boeke M, et al. A KRAS-variant in ovarian cancer
878
8
9
10
11
12
13
14
15
16
17
18
Xing B L, et al.
Chin Sci Bull
acts as a genetic marker of cancer risk. Cancer Res, 2010, 70: 6509 6515 Yeh J J, Routh E D, Rubinas T, et al. KRAS/BRAF mutation status and ERK1/2 activation as biomarkers for MEK1/2 inhibitor therapy in colorectal cancer. Mol Cancer Ther, 2009, 8: 834843 Nakayama N, Nakayama K, Yeasmin S, et al. KRAS or BRAF mutation status is a useful predictor of sensitivity to MEK inhibition in ovarian cancer. Br J Cancer, 2008, 99: 20202028 Calistri D, Rengucci C, Seymour I, et al. Mutation analysis of p53, K-ras, and BRAF genes in colorectal cancer progression. J Cell Physiol, 2005, 204: 484488 Simi L, Pratesi N, Vignoli M, et al. High-resolution melting analysis for rapid detection of KRAS, BRAF, and PIK3CA gene mutations in colorectal cancer. Am J Clin Pathol, 2008, 130: 247253 Park J, Han S W, Oh D Y, et al. Analysis of KRAS, BRAF, PTEN, IGF1R, EGFR intron 1 CA status in both primary tumors and paired metastases in determining benefit from cetuximab therapy in colon cancer. Cancer Chemother Pharmacol, 2011, 68: 10451055 Jarry A, Masson D, Cassagnau E, et al. Real-time allele-specific amplification for sensitive detection of the BRAF mutation V600E. Mol Cell Probes, 2004, 18: 349352 Lang A H, Drexel H, Geller-Rhomberg S, et al. Optimized allele-specific real-time PCR assays for the detection of common mutations in KRAS and BRAF. J Mol Diagn, 2011, 13: 2328 Clayton S J, Scott F M, Walker J, et al. K-ras point mutation detection in lung cancer: Comparison of two approaches to somatic mutation detection using ARMS allele-specific amplification. Clin Chem, 2000, 46: 19291938 Magnin S, Viel E, Baraquin A, et al. A multiplex SNaPshot assay as a rapid method for detecting KRAS and BRAF mutations in advanced colorectal cancers. J Mol Diagn, 2011, 13: 485492 Balschun K, Wenke A K, Röcken C, et al. Detection of KRAS and BRAF mutations in advanced colorectal cancer by allele-specific single-base primer extension. Expert Rev Mol Diagn, 2011, 11: 799 802 Gaylord B S, Massie M R, Feinstein S C, et al. SNP detection using peptide nucleic acid probes and conjugated polymers: Applications in
March (2013) Vol.58 No.8
19
20
21
22
23
24
25
26
27
28
29
neurodegenerative disease identification. Proc Natl Acad Sci USA, 2005, 102: 3439 Thomas S W, Joly G D, Swager T M. Chemical sensors based on amplifying fluorescent conjugated polymers. Chem Rev, 2007, 107: 13391386 Duan X, Liu L, Feng F, et al. Cationic conjugated polymers for optical detection of DNA methylation, lesions and single nucleotide polymorphisms. Acc Chem Res, 2010, 43: 260270 Feng F D, Tang Y L, He F, et al. Cationic conjugated polymer/DNA complexes for amplified fluorescence assays of nucleases and methyltransferases. Adv Mater, 2007, 19: 34903495 Xu H, Wu H, Huang F, et al. Magnetically assisted DNA assays: High selectivity using conjugated polymers for amplified fluorescent transduction. Nucleic Acids Res, 2005, 33: e83 Liu B, Bazan G C. Homogeneous fluorescence-based DNA detection with water-soluble conjugated polymers. Chem Mater, 2004, 16: 44674476 Duan X, Yue W, Liu L, et al. Single-nucleotide polymorphism (SNP) genotyping using cationic conjugated polymers in homogeneous solution. Nat Protoc, 2009, 4: 984991 Duan X, Li Z, He F, et al. A sensitive and homogeneous SNP detection using cationic conjugated polymers. J Am Chem Soc, 2007, 129: 41544155 Duan X, Wang S, Li Z. Conjugated polyelectrolyte-DNA complexes for multi-color and one-tube SNP genotyping assays. Chem Commun, 2008, 44: 13021304 Song J, Yang Q, Lü F, et al. Visual detection of DNA mutation using multicolor fluorescent coding. ACS Appl Mater Interfaces, 2012, 4: 28852890 Yang Q, Qiu T, Wu W, et al. Simple and sensitive method for detecting point mutations of epidermal growth factor receptor using cationic conjugated polymers. ACS Appl Mater Interfaces, 2011, 3: 45394545 Higuchi R, Krummel B, Saiki R K. A general method of in vitro preparation and specific mutagenesis of DNA fragments: Study of protein and DNA interactions. Nucleic Acids Res, 1988, 16: 7351 7367
Open Access This article is distributed under the terms of the Creative Commons Attribution License which permits any use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.
Supporting Information Figure S1 Relationship between the FRET ratios (I613 nm/I425 nm, I528 nm/I425 nm and (I528 nm+I613 nm)/I425 nm) and mutation percentage. (a) 1799T>C, (b) 35G> T, (c) 1799T>C/35G>T. The maximum RSD was 8.3%. Figure S2 (a) Fluorescence spectra and corresponding images of assay solutions using the other five probe groups as SBE primers. (a) 1799T> A/p35G>A, (b) 1799T>G/35G>C, (c) 34G>A/38G>A, (d) 34G>C/38G>C, (e) 34G>T/38G>T. The experiment condition is the same as described in the Figure 1 in the text. Figure S3 Scatter diagram of mutation status from 51 ovary samples using the other four probe groups as SBE primers. (a) 1799T>A/35G>A, (b) 34G>A/38G>A, (c) 34G>C/38G>C, (d) 34G>T/38G>T. Figure S4
Sequencing results of mutant samples. Reverse primer was used as sequencing primer.
Table S1
SBE probe groups used in CCP-based multi-step FRET assay
Table S2
Twelve mutations in KRAS and BRAF genes
The supporting information is available online at csb.scichina.com and www.springerlink.com. The supporting materials are published as submitted, without typesetting or editing. The responsibility for scientific accuracy and content remains entirely with the authors.
