Multiplex real-time PCR assay for the detection of

Download PDF
0 downloads 0 Views 430KB Size Report
Comment
Nasturtium (Tropaeolum majus). Adult. New Zealand ns. X. Scaptomyza flava. Rocket (Eruca sativa). Adult. New Zealand. KX373683. X. L. chenopodii.
bs_bs_banner

Austral Entomology (2016) ••, ••–••

Multiplex real-time PCR assay for the detection of three invasive leafminer species: Liriomyza huidobrensis, L. sativae and L. trifolii (Diptera: Agromyzidae) Anuradha Sooda, Disna Gunawardana, Dongmei Li* and Lalith Kumarasinghe Plant Health and Environment Laboratory, Ministry for Primary Industries, PO Box 2095, Auckland 1140, New Zealand.

Abstract

Rapid and precise identification of immature stages of leafminers of the genus Liriomyza Mik associated with imported fresh produce is essential to ensure appropriate biosecurity decisions at the border, in quarantine and post border. The leafminers Liriomyza huidobrensis, Liriomyza sativae and Liriomyza trifolii are not present in New Zealand and classified as regulated pests when detected at New Zealand’s border. To assist rapid species identification of the immature stages of interceptions, a multiplex real-time TaqMan PCR assay was developed to identify these three species simultaneously in a single test. Species-specific primers and probes were designed by amplifying the mitochondrial COI gene of each targeting species, respectively. The multiplex real-time PCR assay demonstrated high specificity for all three target species and the assay detected DNA quantities as low as 0.1 pg for all species. Linear responses and high correlation coefficients between the amount of DNA and Cq values for each species were also achieved. Therefore, the assay demonstrated its sensitivity and reliability for the identification of these three invasive Liriomyza species.

Key words

border detection, interceptions, mitochondrial cytochrome oxidase I, quarantine.

IN TR ODUCTION Many leafminers of the genus Liriomyza Mik are polyphagous and important pests of vegetables and ornamental plants worldwide. The genus Liriomyza includes about 300 species with 23 species being reported as economically important (Parrella 1987; Kang et al. 2009). The most damaging species are Liriomyza huidobrensis (Blanchard), Liriomyza sativae Blanchard (Spencer 1973; Parrella 1982; Parrella & Keil 1984) and Liriomyza trifolii (Burgess), and each has been spread to various new locations around the world from America (Scheffer et al. 2006). These three species are not present in New Zealand but pose a significant quarantine threat to New Zealand agricultural and horticultural industries. Some Liriomyza species are morphologically similar even at the adult stage (Scheffer et al. 2001; Oudman et al. 1995); only male adults of these species can be identified with certainty on basis of their genitalia characteristics (Malipatil & Ridland 2008), which is time consuming and difficult for non-experts. However, male L. huidobrensis and Liriomyza langei cannot be determined by external or internal morphological characters (Scheffer et al. 2014). Identification of female adults, larvae and pupae based on morphological characters is complex and unreliable, and requires the use of molecular techniques to assist with identification. However, juvenile stages are the most common forms intercepted at ports of entry; therefore, it is important to identify these interceptions accurately and rapidly. Several molecular techniques have been developed for identification of Liriomyza species (Zehnder et al. 1983; Menken & Ulenberg 1983, 1986; Oudman et al. 1995; Chiu et al. 2000; Morgan et al. 2000). Starch gel electrophoresis was used to *[email protected] © 2016 Australian Entomological Society

discriminate Liriomyza spp. based on enzyme mobility differences (Zehnder et al. 1983; Menken & Ulenberg 1983, 1986; Oudman et al. 1995). This technique is one of the most inexpensive methods and is relatively easy to perform (Hoy 1994). However, proteins are not stable and subject to environmental influences, and the method is less sensitive than DNA methods (Hoy 1994; Michael et al. 2000). DNA techniques have been widely used for the detection of Liriomyza species, for example, the random amplified polymorphic DNA (RAPD)-PCR techniques (Chiu et al. 2000; Morgan et al. 2000) and PCRrestriction fragment length polymorphism (PCR-RFLP) method (Scheffer et al. 2001; Kox et al. 2005). Out of the two methods, RAPD-PCR can only be used for very close comparisons and must be used cautiously because of the increased chance of non-homology of co-migrating fragments (Bowditch et al. 1993). PCR-RFLP is a powerful diagnostic tool for reliable detection of all life stages of economically important Liriomyza species, however is rather time-consuming, involving postamplification digestion (Fettene & Temu 2003; Kampen et al. 2003; Scheffer et al. 2001). However, PCR-RFLP is not necessarily reliable, e.g. Scheffer et al. (2014) designed a multiplexPCR to distinguish L. huidobrensis from L. langei because of dissatisfaction with their own, previously published RFLP method (Scheffer et al. 2001). In addition, DNA barcoding (Folmer et al. 1994) has been applied to leafminers (Blacket et al. 2015; Scheffer et al. 2006) and could provide accurate identifications to species level for some species. However, DNA barcoding is also time consuming including DNA sequencing and sequence analysis; thus, it is more expensive. Recently, multiplex PCR assays were developed for differentiating Liriomyza species (Miura et al. 2004; Guan et al. 2006; Nakamura et al. 2013). This method required amplification of a region of mitochondrial (COI or COII) or nuclear gene (ITS) doi: 10.1111/aen.12237

2

A Sooda et al.

regions using multiprimer sets which could differentiate Liriomyza species by the numbers and sizes of the fragments amplified. The multiplex PCR assays were fast, inexpensive and easier than RAPD-PCR, PCR-RFLP and DNA barcoding, and more sensitive than the enzyme electrophoresis method. In addition, a real-time PCR protocol to differentiate juvenile individuals of L. trifolii from L. sativae was also developed and demonstrated its specificity for L. trifolii against other Liriomyza species (Feng et al. 2007). Out of those developed assays, the real-time PCR protocol is the most sensitive and fastest method, thus suitable for routine diagnostics. Liriomyza larvae mine the leaves of the host plants and are key pests on agricultural and horticultural crops worldwide. In New Zealand borders, Liriomyza species: L huidobrensis, L. sativae and L. trifolii have been intercepted and possible entry pathways were documented. However, the majority of interceptions are in the immature stages and unable to be identified to species level morphologically; thus, it will have wider application if an assay could rapidly detect the above three species simultaneously. Therefore, a real-time PCR assay was developed to distinguish L. huidobrensis, L. sativae and L. trifolii in one test. This paper describes the development of the multiplex real-time PCR assay based on the COI gene, which allows rapid detection of all life stages of L. huidobrensis, L. sativae and L. trifolii in a single test. The limitations of the multiplex real-time PCR assay were also discussed.

Zealand were reared from the symptom leaves in the laboratory until the adults emerged, the emerged adults were used for morphological and/or molecular identification. L. sativae samples were requested from China, East Timor and Sri Lanka; the rest of the samples were border interceptions at New Zealand. All specimens were preserved in 96% ethanol and stored at room temperature prior to DNA extraction. DNA was isolated from individual specimens using prepGEM insect DNA extraction kit (ZyGEM Corporation Limited, New Zealand) according to the manufacturer’s instructions. The template DNA was quantified using Nanodrop ND-1000 Spectrophotometer (NanoDrop Technologies Inc., USA). The PCR competency and identity of the nucleic acid extracted from each specimen were confirmed by amplifying a PCR product from the COI region using the primer pair, LCO1490 and HCO2198 (Folmer et al. 1994). PCR cycling conditions were an initial denaturation step at 94 °C for 2 min followed by 5 cycles of denaturation step at 94 °C for 40 s, annealing step at 45 °C for 40 s and an elongation step at 72 °C for 60 s, which was followed by an additional 35 cycles of denaturation at 94 °C for 40 s, annealing at 51 °C for 40 s, and elongation at 72 °C for 60 s, followed by a final elongation step at 72 °C for 7 min. PCR products were analysed and sequenced as per Li et al. (2015). The sequences were submitted into GenBank under the accession numbers KU244270–KU244272, KX3733669– KX373684; the details about the sequences are listed in Table 1.

Primer and probe design M A T E R I A L S AN D M E T H O D S Samples and DNA extraction The specimens used in this study, along with their country of origin, are listed in Table 1. All the leafminers collected in New Table 1

Species-specific primers and TaqMan probes were designed for the COI gene sequences of L. huidobrensis, L. sativae and L. trifolii obtained inhouse and available in GenBank, with a focus on primer sequences that could be combined in a multiplex format using online tools from Biosearch Technologies Real-Time

Sampling details for the Liriomyza spp. used in specificity tests of the real-time PCR assay and test results

†

Species

L. trifolii L. trifolii L. trifolii L. trifolii L. trifolii L. trifolii L. trifolii L. huidobrensis L. huidobrensis L. huidobrensis L. sativae L. sativae L. sativae L. sativae L. brassicae Scaptomyza flava L. chenopodii Phytomyza plantaginis Chromatomyia syngenesiae

Hosts Oregano (Origanum vulgare) Choraiya (Amaranthus viridis) Basil (Ocimum basilicum) Chives (Allium schoenoprasum) Sage (Salvia officinalis) Mint (Mentha sp.) Rocket (Eruca sativa) Snow peas (Pisum sativum var. saccharatum) Snow peas (Pisum sativum var. saccharatum) Beetroot (Beta vulgaris) Cucumber (Cucumis sativus) Dahlia sp. Tomato (Solanum lycopersicum) Cowpea (Vigna unguiculata) Nasturtium (Tropaeolum majus) Rocket (Eruca sativa) Chickweed (Stellaria media) Unknown Sow thistle (Sonchus oleraceus)

Life stages Larva Larva Larva Larva Larva Larva Pupa Larva Larva Adult Pupa Larva Adult Adult Adult Adult Larva Adult Larva

Origins

Accession #

PCR results

Fiji Fiji Fiji Fiji Fiji Fiji Fiji Zimbabwe Zambia Sri Lanka China Sri Lanka East Timor East Timor New Zealand New Zealand New Zealand Australia New Zealand

KU244271 KX373675 KC373676 KC373673 KX373671 KX373672 KX373674 KU244272 KX373670 KX373669 KX373677 KU244270 ns ns ns KX373683 KX373679 KX373684 KX373681

√ √ √ √ √ √ √ √ √ √ √ √ √ √ X X X X X

Note: X, no amplification; √, successful amplification, Morph. ID, morphological identification. ns, no sequence obtained. † Both morphological and molecular identification were conducted for the immature stage specimens, COI sequence were submitted into GenBank and their accession numbers are listed in this table. Mainly morphological identification was conducted and confirmed by the expert for the adult specimen. © 2016 Australian Entomological Society

qPCR detection of three Liriomyza species Design Software (Biosearch Technologies, Inc., USA) and GenScript advanced real-time PCR primer design tool (GenScript USA Inc. USA), subsequently synthesised by Biosearch Technologies (Biosearch Technologies, Inc. USA). The primers and probes used in the simplex and multiplex assays are listed in Table 2.

Real-time PCR reaction The real-time PCR was carried out in simplex (one set of primer/probe per reaction) and multiplex (combined primer/probe sets for all three species in a single reaction) formats, respectively. The reaction mix (for simplex and/or multiplex) contained 1× Platinum® qPCR SuperMix-UDG (Invitrogen), 0.3 μM of each primer for each target, 0.1 μM of probe for each target, 0.4 μg/μl of BSA, 1 μl of DNA and water adjusted to a 10 μl total reaction volume. SsoAdvanced Universal Probe supermix (BioRad) was also used to validate the assays. The real-time PCR reaction was performed on a Biorad CFX96™ Real-Time PCR Detection System (BioRad Laboratories, USA) with two initial holds at 50 °C for 2 min and 95 °C for 2 min, respectively, followed by 40 cycles of 95 °C for 15 s and 60 °C for 60 s. All DNA was tested in duplicate wells and two no-template-control wells were included in each assay. Results were analysed using CFX Manager Software (BioRad Laboratories).

Sensitivity and PCR efficiency of the real-time PCR The sensitivity of the real-time PCR in simplex and multiplex formats were evaluated by generating standard curves of the Cq values (which is the ‘cycle threshold’ value at which fluorescence is first detected) for the genomic DNA of L. huidobrensis, L. sativae and L. trifolii that was serially diluted by a factor of 10 (10 ng to 0.01 pg). The lowest detection limit with a positive signal was defined as the sensitivity of the assay. The PCR efficiency (E) of the multiplex and simplex assays was calculated according to the formula E = 10( 1/slope) 1 (Kubista et al. 2006). Amplification performances of simplex and multiplex real-time PCR were determined from the standard curves of the 10-fold dilutions of the genomic DNA.

Table 2

Specificity of the multiplex real-time PCR The specificity of the multiplex real-time PCR was checked by, first testing all primer sets (in multiplex) against the DNA of each selected species individually, to check that only the correct primer set was detecting the selected species for that reaction and there was no cross reaction with the other two species. And second, testing all primer sets (in multiplex) against nontarget leafminer species: Agromyzidae of Liriomyza brassicae, L. chenopodii, Phytomyza plantaginis, Chromatomyia syngenesiae and Drosophilidae of Scapomyza flava that are established in New Zealand (Table 1).

Validation of the multiplex real-time PCR Blind panel testing was conducted to validate the performance of the multiplex real-time PCR assay. A total of 31 samples were provided to the operators with no information about the identity of the samples. Those samples consisted of different life stages, host ranges and origins. The samples were used to test the realtime PCR protocol in multiplex format, non-template controls were included (Table 4).

RESULTS PCR performance All real-time PCR assays showed a strong linear correlation (R2 > 0.98) between the Cq value and the template concentration over a range of 6 orders of magnitude (Fig. 1a–f). The slopes for both the simplex and multiplex assays ranged from 3.6 to 3.4, resulting in PCR efficiencies ranging from 90 to 96% for the simplex vs. 91 to 93% for the multiplex (Table 3). There was ≤3% difference in efficiency between the simplex and multiplex assays.

Sensitivity of real-time PCR assay The highest dilution at which both simplex and multiplex TaqMan assays could still detect L. huidobrensis, L. sativae and L. trifolii was 10 5, i.e. 0.1 pg of DNA per reaction. At this dilution, both assays gave Cq values between 36.2 and 37.3 (Fig. 1 and Table S1). However, greater reliability and consistency of detection were observed with the 10 4 dilution (1 pg

Primers and probes used in the real-time PCR assay

Primers/probe HUI-F HUI-R HUI-P SAT-F SAT-R SAT-P TRI-F TRI-R TRI-P

3

Sequence 5′–3′

Target species

Amplicon size (bp)

CCTCCAGCTCTTACCCTTCTAC CTGAAGCTCCTCCATGAGCAA FAM–AAGAAGTATAGTTGAAAACGGAGCTGGGA-BHQ1 ACCCCCTGCTTTAACTCTTTT AGCACCACCATGTGCAATAA CAL Fluor Red 610-CAGTATAGTAGAAAATGGGGCTGGGA-BHQ2 CGGAGCTGGTACAGGATGA GAAGCTCCACCATGTGCAATA CAL Fluor Gold 540-CCGTTTACCCTCCCCTTTCCTCA-BHQ1

L. huidobrensis

112

L. sativae

109

L. trifolii

66

Note: F, Forward primer; P, probe; R, Reverse primer. © 2016 Australian Entomological Society

4

A Sooda et al.

Fig. 1. Simplex and multiplex real-time PCR standard curves showing log DNA concentration (template dilutions) plotted against threshold cycles (Cq). The figure shows amplification of L. huidobrensis HUI-F/R/P simplex (a) and multiplex (b); L. trifolii TRI-F/R/P simplex (c) and multiplex (d); and L. sativae SAT-F/R/P simplex (e) and multiplex (f). R2 = regression correlation coefficient. Table 3 PCR efficiencies of all three primer/probe sets in simplex and multiplex assays Primer/Probe

Target species

Simplex

Multiplex

HUI-F/R/P SAT-F/R/P TRI-F/R/P

L. huidobrensis L. sativae L. trifolii

92% 96% 90%

91% 93% 92%

of the template DNA) where Cq values below 35, well prior to the total 40 amplification cycles were consistently recorded.

Specificity of real-time PCR assay To assess the specificity of the primers and probes, the multiplex reaction was tested for cross-reactivity among the three target © 2016 Australian Entomological Society

species, and three non-target species that are present in New Zealand. Neither the non-specific signal nor any crossamplification was observed, and only the correct species was amplified by the specific set of primers/probe in the multiplex PCR (Table 1).

Validation of the multiplex real-time PCR The multiplex real-time PCR assay was validated against samples received at the New Zealand border, and some nontarget species: Scapomyza flava, L. brassicae, L. chenopodii, an unidentified Agromyzidae species and a whitefly species (Hemiptera: Aleyrodidae). The assay was able to successfully detect L. huidobrensis, L. sativae and L. trifolii of various life stages, origins and hosts, accurately (Table 4). All the nontarget species were tested negative in the multiplex real-time

qPCR detection of three Liriomyza species Table 4

5

List of specimens used in the blind panel tested by multiplex real-time PCR and test results

Morph. ID and/or Mol. ID†

Hosts

Numbers of individual

Life stages

Origins

Real-time PCR results

Aleurodidae Agromyzidae Chromatomyiasyngenesiae‡ L. brassicae§ L. brassicae L. brassicae L. chenopodii¶ L. chenopodii L. chenopodii L. huidobrensis L. huidobrensis L. huidobrensis L. sativae L. trifolii L. trifolii L. trifolii L. trifolii L. trifolii L. trifolii L. trifolii L. trifolii L. trifolii Phytomyza plantaginis Scaptomyza flava††

Basil (Ocimum basilicum) Sow thistle (Sonchus oleraceus) Sow thistle (Sonchus sp.) Nasturtium (Tropaeolum majus) Nasturtium (Tropaeolum majus) Nasturtium (Tropaeolum majus) Chickweed (Stellaria media) Chickweed (Stellaria media) Spinach (Spinacia oleracea) Snow peas (Pisum sativum var. saccharatum) Snow peas (Pisum sativum var. saccharatum) Beetroot (Beta vulgaris) Dahlia sp. Chives (Allium schoenoprasum) Choraiya (Amaranthus viridis) Basil (Ocimum basilicum) Choraiya (Amaranthus viridis) Choraiya (Amaranthus viridis) Basil (Ocimum basilicum) Choraiya (Amaranthus viridis) Basil (Ocimum basilicum) Choraiya (Amaranthus viridis) Unknown Nasturtium (Tropaeolum majus)

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 3 1 1 1 4 2 1 1

eggs Pupa Larva Adult Larva Adult leg Larva adult Larva Pupa adult Adult Larva Adult Larva Adult Larva pupa Pupa Larva Larva Empty pupal case Adult Adult

Fiji New Zealand New Zealand New Zealand New Zealand New Zealand New Zealand New Zealand New Zealand Zimbabwe Zimbabwe Sri Lanka Sri Lanka Fiji Fiji Fiji Fiji Fiji Fiji Fiji Fiji Fiji Australia New Zealand

X X X X X X X X X √ √ √ √ √ √ √ √ √ √ √ √ √ X X

Note: X, no amplification; √, successful amplification; Morph. ID, morphological identification; Mol. ID, molecular identification. † For the adult specimen, morphological identification was conducted and confirmed by the expert. For the immature stage specimens, the specimen ID was identified by COI sequences. The specimens of L. huidobrensis, L. sativae and L. trofolii used in the blind panel test were from the same population/interception as Table 1. ‡ DNA sequence of COI for Chromatomyia syngenesiae was submitted to GenBank under the accession number of KX373680. § L. brassicae samples used for blind panel test were from the same population; the adult was used for morphological ID. ¶ L. chenopodia: the same COI sequences obtained, so only one sequence was submitted to GenBank under accession number KX373678. †† DNA sequence of COI for Scaptomyza flava obtained was submitted to GenBank under the accession number of KX373682.

PCR assay (Table 4). The blind panel test results were independently matched to the original identities of the samples provided.

D I S C U S S IO N The definitive identification of pests at borders and in quarantine is becoming increasingly important to enable accurate biosecurity decision making. Leafminers are often intercepted as immature stages without the presence of adults on imported plants or plant products via international trade. Male adults could be morphologically identified to the species level (Malipatil & Ridland 2008), whereas for immature stages, adequate morphological identification keys are not available for species level identification and require specific expertise. Sometimes rearing of immature stages to adults is required which results in a critical delay in identification. In New Zealand, a significant challenge in this area is the large percentage of immature invertebrates (such as eggs, larvae or pupae) are intercepted at the borders, which can be difficult or impossible to identify to species level using morphological methods. So, there is an increasing need to develop tools to speed up the diagnostic process of leafminers for quarantine treatment of infested material at ports of entry.

Over the past decade, a number of molecular methods like Starch gel electrophoresis, RAPD-PCR, multiplex PCR, PCRRFLP and DNA barcoding have been developed and evaluated for the detection and species identification of Liriomyza spp. However, these methods are either less sensitive, or rather time-consuming (Fettene & Temu 2003; Kampen et al. 2003) thereby making them unsuitable for routine identifications (Feng et al. 2007). Here, we developed a novel multiplex realtime PCR assay that combines multiple primers and probes in a single reaction for simultaneous species identification of L. huidobrensis, L. sativae and L. trifolii. This method was tested on different life stages of the insects; it offers the advantages against the morphological identification. In comparison, the molecular tests are relatively easy to perform while the morphological identification requires considerable expertise and will take years to build up. The real-time PCR assay could be easily adapted to large scale screening while the morphological screening requires examination of each of the individual specimens. The novel multiplex real-time PCR assay developed in this study is specific for L. huidobrensis, L. sativae and L. trifolii, and no cross amplification was detected. Direct sequencing of the real-time PCR amplicons further confirmed the specificity of our assay. The standard curve analysis showed a strong linear correlation (R2 > 0.98) between the Cq value and the template concentration over a range of 6 orders of magnitude. Reliable © 2016 Australian Entomological Society

6

A Sooda et al.

amplification was achieved at DNA template concentrations as low as 0.1 to 1 pg allowing small amount of tissue to be used for DNA extraction and preserving the rest of the specimen. The blind panel testing of the assay further validated the robustness and suitability of this assay in providing reliable, quick and accurate diagnosis of the species of interest. As all the other tests, there are limitations for this real-time PCR assay. It could only detect the three target species, with all other Liriomyza species that are tested remaining unidentified. In comparison with the recently developed multiplex PCR assay for identification of Liriomyza species (Nakamura et al. 2013), the multiplex real-time PCR assay developed in this study is more sensitive and faster; there is no need of post PCR manipulation, such as gel-electrophoresis. Thus it could provide rapid identification of the target species. It has been applied in detection of suspected Liriomyza specimens intercepted at the border and post borders at New Zealand as demonstrated in the current study. The real-time PCR assay did not show any cross-reactions among the three target species. It is specific to New Zealand common interceptions, L. trifolii from Fiji and L. huidobrensis from Zambia and Zimbabwe. The specificity of the assay was also tested using L. sativae from China, East Timor and Sri Lanka. No cross-reactions were observed with L. brassicae L. chenopodii and New Zealand Agromyzidiae species tested. Unfortunately we could not obtain L. langei, a closely related species to L. huidobrensis to test the specificity of the real-time PCR assay. L. langei is only present in the USA (Scheffer et al. 2001; Scheffer et al. 2014); PCR-RFLP methods and multiplex PCR methods have been used to differentiate the two species (Scheffer et al. 2001 and Scheffer et al. 2014). In silico tests of the real-time PCR primers/probe detected significant mismatches in L. langei sequences to the L. huidobrensis-specific primers/probe (3 for HUI-F, 1–2 for HUI-R and 2–4 for HUI-P). Therefore the real-time PCR assay will be able to distinguish L. huidobrensis from L. langei. Moreover, other Liriomyza species, such as Liriomyza baptisiae, Liriomyza bryoniae, Liriomyza chinensis, Liriomyza stringta and Liriomyza trfoliearum, have not been tested in the real-time PCR protocol, but phylogenetic analysis showed that they are distantly separated from the three target species (Scheffer et al. 2007). Thus the current multiplex real-time PCR assay should not cross-react with those Liriomyza species. Although limited numbers of samples from each target species have been tested in the current study, the target species tested covered a wide ranges of origins, L. huidobrensis from Sri Lanka, Zambia, Zimbabwe; L. sativae from China, East Timor, Sri Lanka; and L. trifolii from Fiji (Table 1). This multiplex real-time PCR assay has already demonstrated its robustness by accurately detecting those target specimens from various geological locations. In addition, the robustness of the assay was also validated in silico using the available sequences online. Those sequences were derived from specimens obtained from a wide range of origins, such as L. huidobrensis from China, South Africa, South Korea, USA; L. sativae from Bangladesh, China, Papua New Guinea; L. trifolii from China, USA. Thus, it suggested that this multiplex realtime PCR assay could detect the three target species from a wide range of locations. © 2016 Australian Entomological Society

This real-time PCR assay were developed using the ‘universal’ DNA barcoding region—the 5′-end region of the COI gene; however the 3′-end region of COI gene has been used for Liriomyza population studies (Scheffer et al. 2006; Scheffer & Lewis 2005). For example, three haplotypes detected for L. sativae using the sequences of the 3′-end of COI gene (Blacket et al. 2015; Scheffer & Lewis 2005); thus, it is impossible to test in silico whether the primers/probes for this assay could bind to all the haplotypes of L. sativae (Blacket et al. 2015; Scheffer & Lewis 2005; Scheffer et al. 2006 and Scheffer et al. 2014). However, the multiplex real-time PCR assay could detect L. sativae collected from Australia, China and Sir Lanka. Unfortunately, L. huidobrensis, L sativae and L. trifolii specimens from other countries were not obtained for testing this protocol; thus, further specificity tests might be needed prior to deployment in other countries.

CO NC LUSI ON A rapid, sensitive and specific TaqMan probe based multiplex real-time PCR assay was developed and validated for the detection of three invasive leafminer species, L. huidobrensis, L. sativae and L. trifolii. This assay is not only cost effective, but also a rapid and a sensitive method. It reduces the DNA template requirement many fold compared to traditional DNA-based methods. This tool will be especially useful to overcome the limitation of traditional morphological identification in rapid detection of these important pest species at any life stages at the border and during incursion response operations. The assay has already demonstrated its values for routine identification in New Zealand.

ACKNOWLEDGEMENTS We thank Dr. Mallik Malipatil (Australia) for identification and confirmation of leafminer species. We are also grateful to Dr. Lucy Tran-Nguen (Australia), Dr. Nicholas Martin (New Zealand) and Dr. Qing-Hai Fan (New Zealand) for providing specimens for this research. We would give our thanks to Drs Qing-Hai Fan, Alan Flynn, David Waite, Lia Liefting and Catia Delmeglio for providing valuable comments for the manuscript. Our great thanks also goes to the editor, two anonymous reviewers for their valuable comments and suggestions for the manuscript. This research was funded by the Ministry for Primary Industries New Zealand Operational Research Programme.

REFERENCES Blacket MJ, Rice AD, Semeraro L & Malipatil MB. 2015. DNA-based identifications reveal multiple introductions of the vegetable leafminer Liriomyza sativae (Diptera: Agromyzidae) into the Torres Strait Islands and Papua New Guinea. Bulletin Entomology Research 105, 533–544.

qPCR detection of three Liriomyza species Bowditch BN, Albright DG, Williams J & Braun MJ. 1993. The use of RAPD markers in comparative genome studies. Methods Enzymology 224, 294–308. Chiu YC, Wu WJ, Shiao SF & Shih CJ. 2000. The application of RAPDPCR to develop a rapid diagnostic technique for identification of 6 species of Liriomyza. Clinical Journal of Entomology 20, 293–309 (in Chinese). Feng X, Chen NZ, Ma J, Zhu SF & Hu XN. 2007. Molecular identification of Liriomyza trifolii (Burgess) (Diptera: Agromyzidae) based on real-time PCR. Journal of Applied Entomology 131, 548–552. Fettene M & Temu EA. 2003. Species-specific primer for identification of Anopheles quadriannulatus sp. B. (Diptera: Culicidae) from Ethiopia using a Multiplex polymerase chain reaction assay. Journal of Medical Entomology 40, 112–115. Folmer O, Black M, Hoeh W, Lutz R & Vrijenhoek R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3, 294–297. Guan W, Wang Z, Cai X, Wang Y & Chen D. 2006. Molecular identification of Liriomyza trifolii and Liriomyza sativae. Clinical Journal of Entomology 43, 558–561 (in Chinese). Hoy MA. 1994. Insect Molecular Genetics: An Introduction to Principles and Applications. Academic press, San Diego, CA. Kang L, Cheng B, Wei JN & Xian LT. 2009. Roles of thermal adaptation and chemical ecology in Liriomyza distribution and control. Annual Review Entomology 54, 127–145. Kampen H, Sternberg A, Proft J et al. 2003. Polymerase chain reaction based differentiation of the mosquito sibling species Anopheles claviger S.S. and Anopheles petragnani (Diptera: Culicidae). The American Journal of Tropical Medicine and Hygiene 69, 195–199. Kox LFF, van den Beld HE, Lindhout BI & de Goffau LJW. 2005. Identification of economically important Liriomyza species by PCR-RFLP analysis. OEPP/EPPO Bulletin 35, 79–85. Kubista M, Andrade JM, Bengtsson M et al. 2006. The real-time polymerase chain reaction. Molecular Aspects of Medicine 27, 95–125. Li D, Fan Q-H, Waite DW, Gunawardana D, George S & Kumarasinghe L. 2015. Development and validation of a real-time PCR assay for rapid detection of two-spotted spider mite, Tetranychus urticae (Acari: Tetranychidae). PLoS One 10, e0131887. Malipatil M, & Ridland P. 2008. Polyphagous Agromyzid leafminers. Identifying polyphagous agromyzid leafminers (Diptera: Agromyzidae) threatening Australian primary industries. Lucid key: Australian Department of Agriculture, Fisheries and Forestry. Menken SBJ & Ulenberg SA. 1983. Diagnosis of the agromyzids Liriomyza bryoniae and L. trifolii by means of starch gel electrophoresis. Entomologia Experimentalis et Applicata 34, 205–208. Menken SBJ & Ulenberg SA. 1986. Allozymatic diagnosis of four economically important Liriomyza species. Annals of Applied Biology 109, 41–47. Michael SC, Soonwon C & Felix AHS. 2000. The current state of insect molecular systematics: a thriving tower of Babel. Annual Review Entomology 45, 1–54. Miura K, Tagami Y, Ohtaishi M & Iwasaki A. 2004. Application of molecular techniques to distinguish Liriomyza trifolii from L. sativae on tomato cultivation in Japan. Journal of Economic Entomology 97, 964–969. Morgan DJW, Reitz SR, Atkinson PW & Trumble JT. 2000. The resolution of Californian populations of Liriomyza huidobrensis and L. trifolii (Diptera: Agromyzidae) using PCR. Heredity 85, 53–61.

7

Nakamura S, Masuda T, Mochizuk A et al. 2013. Primer design for identifying economically important Liriomyza species (Diptera: Agromyzidae) by multiplex PCR. Molecular Ecology Resources 13, 96–102. Oudman L, Aukema B, Menken SBJ & Ulenberg SA. 1995. A procedure for identification of polyphagous Liriomyza species using enzyme electrophoresis. Bull. OEPP⁄EPPO Bulletin 25, 349–355. Parrella MP. 1982. A review of the history and taxonomy of economically important serpentine leafminers (Liriomyza spp.) in California (Diptera: Agromyzidae). Pan-Pacific Entomologist 58, 302–308. Parrella MP & Keil CB. 1984. Insect pest management: the lesson of Liriomyza. Bulletin of the Entomological Society of America 30, 22–25. Parrella MP. 1987. Biology of Liriomyza. Annual Review Entomology 32, 201–224. Scheffer SJ & Lewis ML. 2001. Two nuclear genes confirm mitochondrial evidence of cryptic species within Liriomyza huidobrensis (Diptera: Agromyzidae). Annals of the Entomological Society of America 94, 1146–1151. Scheffer SJ, Wijesekara A, Visser D & Hallet RH. 2001. Polymerase chain reaction-restriction fragment-length polymorphism method to distinguish Liriomyza huidobrensis from L. langei (Diptera: Agromyzidae) applied to three recent leafminer invasions. Journal of Economic Entomology 94, 1177–1182. Scheffer SJ, Lewis ML & Ravindra CJ. 2006. DNA barcoding applied to invasive leafminers (Diptera: Agromyzidae) in the Philippines. Annals of the Entomological Society of America 99, 204–210. Scheffer SJ & Lewis ML. 2005. Mitochondrial phylogeography of vegetable pest Liriomyza sativae (Diptera: Agromyzidae): divergent clades and invasive populations. Annals of the Entomological Society of America 98, 181–186. Scheffer SJ, Winkler IS & Wiegmann BM. 2007. Phylogenetic relationships within the leaf-mining flies (Diptera:Agromyzidae) inferred from sequence data from multiple genes. Molecular Phylogenetics and Evolution 42, 756–775. Scheffer SJ, Lewis ML, Gaimari SD & Reitz SR. 2014. Molecular survey for the invasive leafminer pest Liriomyza huidobrensis (Diptera: Agromyzidae) in California uncovers only the native pest Liriomyza langei. Journal of Economic Eentomology 107, 1959–1964. Spencer KA. 1973. Agromyzidae (Diptera) of Economic Importance. Dr. W. Junk, The Hague, The Netherlands. Zehnder GW, Trumble JT & White WR. 1983. Discrimination of Liriomyza species (Diptera: Agromyzidae) using electrophoresis and scanning electron microscopy. Proceedings of the Entomological Society of Washington 85, 564–574. Accepted for publication 5 July 2016.

S U P P O R T I N G IN F O R M A T I O N Additional Supporting Information may be found in the online version of this article at the publisher’s web site: Table S1 Mean Cq values of 10 fold serial dilutions in simplex and multiplex real-time PCR with the three species-specific primer/probe sets.

© 2016 Australian Entomological Society