Mutation at Codon 322 in the Human Acetyicholinesterase. (ACHE) Gene Accounts for YT Blood Group Polymorphism. Cynthia F. Bartels,* Teresa Zelinski,t and ...
Am. J. Hum. Genet. 52:928-936, 1993
Mutation at Codon 322 in the Human Acetyicholinesterase (ACHE) Gene Accounts for YT Blood Group Polymorphism Cynthia F. Bartels,* Teresa Zelinski,t and Oksana Lockridge* *Eppley Institute, University of Nebraska Medical Center, Omaha; and tRh Laboratory, University of Manitoba, Winnipeg
Summary Acetylcholinesterase is present in innervated tissues, where its function is to terminate nerve impulse transmission. It is also found in the red blood cell membrane, where its function is unknown. We report the first genetic variant of human acetyicholinesterase and support the identity of acetyicholinesterase as the YT blood group antigen. DNA sequencing shows that the wild-type sequence of acetylcholinesterase with His322 (CAC) is the YT1 blood group antigen and that the rare variant of acetylcholinesterase with Asn322 (AAC) is the YT2 blood group antigen. Two additional point mutations in the acetylcholinesterase gene do not affect the amino acid sequence of the mature enzyme. Introduction Human acetylcholinesterase (E.C.3.1.1.7) has previously not been shown to have genetic variants, though human butyrylcholinesterase (E.C.3.1.1.8) has at least 14 variants (Whittaker 1986; McGuire et al. 1989; Gnatt et al. 1990; Lockridge 1990; Nogueira et al. 1990; La Du et al. 1991; Muratani et al. 1991; Bartels et al. 1992a, 1992b; Hada et al. 1992). Acetylcholinesterase in innervated tissues has the vital function of terminating nerve impulse transmission. The exceptionally high catalytic power of acetylcholinesterase suggested that it was an evolutionarily perfect enzyme (Quinn 1987). Genetic variants were not anticipated, since it was assumed that they would impair function. Therefore, it was remarkable to encounter three single-nucleotide substitutions in a large proportion of DNA samples obtained from 38 random persons. Recently, Zelinski et al. (1991) mapped the YT blood group locus, by linkage analysis, to the long arm of chromosome 7. Spring et al. (1992) showed, and Telen and Whitsett (1992) confirmed, that YT antigens are Received October 23, 1992; revision received January 7, 1993. Address for correspondence and reprints: 0. Lockridge, Eppley Institute, University of Nebraska Medical Center, 600 South 42d Street, Omaha, NE 68198-6805. Oc 1993 by The American Society of Human Genetics. All rights reserved.
0002-9297/93/5205-0010$02.00
928
located on red blood cell acetylcholinesterase. Getman et al. (1992) localized the acetylcholinesterase gene (ACHE) to chromosome 7q22. As a consequence of these findings, we examined our ACHE mutations in relation to the YT blood group polymorphism. Our data establish that the YT blood group polymorphism is based on a point mutation in ACHE. The YT blood group polymorphism is defined by specific human antibodies (anti-YT1 and anti-YT2) which recognize the corresponding antigens, YT1 and YT2 (Eaton et al. 1956; Race and Sanger 1975; Vengelen-Tyler and Morel 1983). Evidence that the YT antigens are located on human erythrocyte acetylcholinesterase was first obtained by Spring et al. (1992). They immunoprecipitated protein, from intact radioiodinated erythrocytes, with anti-YT1, anti-YT2, as well as with two monoclonal anti-acetylcholinesterase antibodies. PAGE showed that all four antibodies precipitated a protein, the size of which was consistent with acetylcholinesterase monomers (72 kD) and dimers (160 kD), under reducing and nonreducing conditions, respectively. Furthermore, the YT1 and YT2 immunoprecipitates had acetylcholinesterase activity. Additional evidence supporting the conclusion that erythrocyte acetylcholinesterase contains YT blood group antigens is the observation that persons with paroxysmal nocturnal hemoglobinuria, a disease in which a portion of erythrocytes are depleted of glycolipid-anchored proteins, have reduced red cell acetylcholinesterase activity
YT Blood Group Polymorphism
2
3
4
929
5
6
7
and reduced YT antigen expression (Telen et al. 1990). Other evidence is that red cells treated with papain lose both acetylcholinesterase activity (Dutta-Choudhury and Rosenberry 1984) and YT antigens (Eaton et al. 1956; Vengelen-Tyler and Morel 1983).
We amplified the ACHE gene by PCR, as shown in figure 1, and sequenced the amplified segments. For the two homozygous genotypes, all coding regions, as well as intron/exon junctions, were sequenced. The other DNA samples were sequenced only in the areas of the three polymorphisms. When a sequence differed from the normal sequence, the sample was reamplified and resequenced, thus distinguishing Taq polymerase errors from genetic variants. Oligonucleotide primers were synthesized and purified by high-performance liquid chromatography by the University of Nebraska Medical Center Molecular Biology Core Facility. Amplification mixtures contained (in 100 gl) 1 jug of white blood cell DNA; 1 tg of each amplifying primer; 250 FM each of dATP, dCTP, dGTP, and dTTP; 10 mM of Tris-Cl (pH 8.3); 50 mM of KCI; 1.5 mM of MgCl2; 0.01% gelatin; 3 mM of DTT; and 2.5 units of AmpliTaq polymerase (Cetus) (Saiki et al. 1988). In areas of high G+C content, 187.5 tM deaza dGTP and 62.5 gM dGTP were used in place of 250 gM dGTP. PCR consisted of 35 cycles of 960C for 1 min 15 s, 60'C for 1 min, and 720C for 3 min. Precise temperature regulation was required to achieve single PCR bands for this G+C-rich gene. Fluctuation of 20C for denaturation and 50C for annealing decreased yield of the desired band and gave unwanted bands. Amplification primers in exons were based on sequences in Li et al. (1991) and Soreq et al. (1990): we designed intron primers after partial intron sequencing. Nested oligonucleotide primers, labeled with 32p, were used to sequence the amplified DNA (McGuire et al. 1989). Figure 2 shows the primers used for amplification and sequencing of intron borders and of coding exons.
Material and Methods Samples DNA samples of known YT genotype were from 17 people from Manitoba, Canada. Samples from 38 random people of various ethnic backgrounds were from the United States. Most of the DNA samples were purified from white blood cells, following the procedure of Sambrook et al. (1989). Four DNA samples were purified from buccal cells, also by standard methods. DNA Amplification and Sequencing To assess the amino acid sequence of acetylcholinesterase in the three YT genotypes (YT*1/1, YT*1/2, and YT*2/2), we determined the ACHE gene DNA sequence of one sample of each homozygous genotype.
YT Genotyping and Nomenclature YT genotyping was performed by the capillary indirect-antiglobulin method (Lewis et al. 1958). Freshly drawn red blood cells were exposed separately to antiYT1 IgG and anti-YT2 IgG. The presence of specific IgG on the red cells was detected in the second phase of the test, with antihuman globulin (evidenced by agglutination in the capillary). Genotypes YT*1/1, YT*1/2, and YT*2/2 are based on designations by The International Society of Blood Transfusion (ISBT) Working Party on Terminology for Red Cell Surface Antigens (Lewis et al. 1990), which has developed terminology consistent with the recommendations of the Human Gene Mapping Nomenclature Committee (Shows et al. 1987). The recommended ter-
1
Figure I Agarose gel showing PCR amplifications covering the entire human ACHE coding region. Lane 1, 688 bp from intron 1 to Phel56 in exon 2. Lane 2, 867 bp from GIu4 to Ser293 in exon 2. Lane 3, 709 bp from Cys257 in exon 2 to Glu376 in exon 3. Lane 4, 662 bp from intron 2 to intron 3. Lane 5, 2,126 bp from Tyr465 in exon 3 to Tyr563 in exon 6. Lane 6, 488 bp from intron 3 to exon 5. Lane 7, 301 bp, including exon 6. Molecular weight markers (1-kb ladder; BRL) are between lanes 4 and 5.
..ctctcccctcatctttgccaacctgccccact oct a cacGagat aa ccttguggcgacagtgccctaatctcctccctcctgg PstI PvuII intronl:Exon2
-31
-->
MetArgProProGlnCysLeuLeuHis
cttctcgaccgacccttcaccctttccctttctttctcccagcag:ACGCCGCCTGCCCTGCACCATGAGGCCCCCGCAGTGTCTGCTGCAC Taq I Pst I +1 ThrProSerLeuAlaSerProLeuLeuLeuLeuLeuLeuTrpLeuLeuGlyGlyGlyValGlyAlaGluGlyArgGluAspAlaGluLeuLeu
ACGCCTTCCCTGGCTTCCCCACTCCTTCTCCTCCTCCTCTGGCTCCTGGGTCGGGAG6ATGcGGG rGGGCCGGGAGGATGCAGA&GOIFTGCTG"& 20
Ncoo 80 Acc I 100 TyrValAspThrLeuTyrProGlyPheGluGlyThrGluMetTrpAsnProAsnArgGluLeuSerGluAspcysLeuTyrLeuAsnValTrp TATGTGGACACCCTATACCCAGGTTTTGAGGGCACCGAGATGTGGAACCCCAACCGTGAGCTGAGCGAGGACTGCCTGTACCTCAACGTGTGG 120
ThrProTyrProArgProThrSerProThrProvalLeuvalTrpIleTyrGlyGlyGlyPheTyrSerGlyAlaSerSerLeuAspValTyr
ACACCATACCCCCGGCCTACATCCCCCACCCCIGnCCaICQICIGATCThTmGGGGTGGCTTCTACAGTGGGGCCTCCTCCTTGGACGTGTAC 140
-->
160
AspGlyArgPheLeuValGlnAlaGluArgThrValLeuvalserMetAsnTyrArgValGlyAlaPheGlyPheLeuAlaLeuProGlySer GATGGCCGCTTCTTGGTACAGGCCGAGAGGACTGTGCTGGTGTCCATGAACTACCGGGTGCGGGCCCTTGGCTTCCTGGCCCTGCCGGGGAGC 180
220
Pst I
SerValThrLeuPheGlyGluSerAlaGlyAlaAlaSerValGlyMetHisLeuLeuSerProProSerArgGlyLeuPheHisArgAl-aVal TCAGTGACGCTGTTTGGGGAGAGCGCGGGAGCCGCCTCGGTGGG GTGCACCTGCTGTCCCCGCCCAGCCGGGGCCTGGICCAGGCG~fTl 240
Sph I
