J. Inherit. Metab. Dis. 25 (2002) 415^416 # SSIEM and Kluwer Academic Publishers. Printed in the Netherlands.
CASE REPORT A novel FUCA1 mutation causing fucosidosis in a Chinese boy P. Ip, W. Goh, K. W. Chan and P. T. Cheung Department of Paediatrics, Queen Mary Hospital, The University of Hong Kong, Hong Kong SAR, China
Correspondence: Department of Paediatrics, Queen Mary Hospital, The University of Hong Kong, Hong Kong SAR, China. E-mail:
[email protected]
Summary: We report a 6-year-old boy with an intermediate form of fucosidosis. Fucosidosis (McKusick 230000) is an autosomal recessive lysosomal storage disorder due to de¢cient a-fucosidase (EC 3.2.1.51) activity leading to accumulation of fucose-containing glycolipids and glycoproteins in various tissues. We report a 6-year-old boy with an intermediate form of fucosidosis and the molecular characterization of the FUCA1 gene. The boy is the only child of healthy, consanguineous parents who are ¢rst-degree cousins from southern China. The perinatal course was uneventful, but he was noticed to have mild global developmental delay at the age of 1.5 years. There was reportedly good initial developmental progress, but rapid developmental regression and psychomotor deterioration ensued by 2.5 years of age. He subsequently became bed-bound, with severe spastic quadriplegia, marked dystonia, loss of psychosocial response and multiple joint contractures. Radiological studies showed J-shaped sella turcica and anterior beaking of vertebrae. Magnetic resonance imaging of the brain at 3 years of age revealed globally delayed myelination without a structural anomaly and repeat imaging at 6 years of age revealed delayed myelination with generalized cerebral atrophy and abnormal increase in T1 and decrease in T2 signal intensity over both globi pallidi. Urine tests for mucopolysaccharides and organic acids were negative. Electroencephalography showed di¡use and unstable slow wave activity with no seizure clinically. Nerve conduction velocities were within normal limits. a-Fucosidase activity (performed at the Women’s and Children’s Hospital, North Adelaide, Australia) was markedly decreased in peripheral blood leukocytes (2.4 nmol/h per mg protein; control 24^162), while that of cultured skin ¢broblasts was even lower (0.24 nmol/h per mg protein; control 96^360). Other lysosomal enzyme activities were normal. Over the subsequent year, the boy showed failure to thrive, progressing scoliosis, frontal bossing and hepatomegaly. He developed recurrent bronchopneumonia and partial lung collapse. High-resolution computerized tomography of the thorax showed peribronchial thickening suggestive of a chronic in£ammatory process. A twenty-four-hour pH monitoring and video £uoroscopic swallowing study were 415
416
Case Report
both normal, without evidence of gastro-oesophageal re£ux or aspiration. Additional investigations for underlying immunode¢ciency were negative, including normal serum IgG, IgM and IgA levels, and nitroblue tetrazolium test. Analysis of his FUCA1 gene was performed on cDNA reverse transcribed from RNA from (cultured) skin ¢broblasts by polymerase chain reaction (PCR). Two fragments were ampli¢ed for cycle-sequencing and analysed with an ABI Prism 377 sequencer (Perkin Elmer). The PCR primers were 1F (GTCGCTGAGGGGTAGCGATG) and 503R (TCACCAACCAAATCCCGATGAG) for the ¢rst fragment, followed by 8F (CGGGCTCCGGGGATGAGGT) and 503R for nested PCR; and 439F (CCGAGTCCTGTGTCTTGGAAC) and 1453R (GAAGCAGGAAAACAGTGAGCAG) for the second fragment. Two known homozygous polymorphisms, S264C (809C>G) and Q281R (860C>G), were detected. A homozygous single-base substitution (396T>A) was found in exon 2, changing the tyrosine to a stop codon (Y126X). This sequence is not found within the FUCA pseudogene and is a novel mutation. The FUCA1 gene is composed of eight exons spanning approximately 23 kb. The mature mRNA is 2053 bp encoding for the 461 amino acids a-L-fucosidase. In addition to the 22 mutations reviewed by Willems and colleagues (1999), three more were retrieved from the literature (Fleming et al 1998; Inui et al 2000). Together with the current report, the 26 FUCA1 mutations are predominantly nonsense mutations (19/26) resulting from either point mutations or deletions. The relative scarcity of missense mutations (4/26) may imply the presence of alternative or compensatory enzymatic pathways capable of modifying the clinical severity, such that missense mutants compatible with retaining residual enzymatic activities will not easily lead to clinically detectable phenotypes. Though entirely speculative, it is noteworthy that measurable fucosidase activity was found in the patient’s circulating leukocytes despite the protein being truncated at amino acid position 132. Furthermore, our patient’s clinical course echoes the widely observed heterogeneity of fucosidosis, with the subtle initial symptoms and the rapid developmental regression and psychomotor deterioration indicating an intermediate type of fucosidosis. Bone marrow transplantation (BMT) has been successfully used for fucosidosis, while the potential of enzyme replacement has been raised following the reported production of recombinant canine a-fucosidase. Unfortunately, the patient’s profound CNS de¢cit precludes BMT as a treatment option, but the delineation of his molecular defect could serve to complement future prenatal diagnosis for this family when necessary. This work is supported by Edward HoTung Paediatric Research and Education Fund (PTC). REFERENCES Fleming CJ, Sinclair DU, White EJ, et al (1998) A fucosidosis patient with relative longevity and a missense mutation in exon 7 of the alpha-fucosidase gene. J Inherit Metab Dis 21: 688^689. Inui K, Akagi M, Nishigaki T, et al (2000) A case of chronic infantile type of fucosidosis: clinical and magnetic resonance image ¢ndings. Brain Dev 22: 47^49. Willems PJ, Seo HC, Coucke P, et al (1999) Spectrum of mutations in fucosidosis. Eur J Hum Genet 7: 60^67.
J. Inherit. Metab. Dis. 25 (2002)
