Mutation of the p53 tumor suppressor gene in ... - CiteSeerX

Carcinogenesis vol.19 no.1 pp.213–217, 1998

SHORT COMMUNICATION

Mutation of the p53 tumor suppressor gene in spontaneously occurring osteosarcomas of the dog

A.Sherwood Johnson1, C.Guillermo Couto1 and Christopher M.Weghorst2,3 1Department

of Veterinary Clinical Sciences, College of Veterinary Medicine and 2Division of Environmental Health Sciences, College of Medicine and Public Health, The Ohio State University, 300 W. 10th Avenue, CHRI 1148, Columbus, OH 43210-1240, USA 3To

whom correspondence should be addressed Email: [email protected]

Inactivation of the p53 tumor suppressor gene has been implicated in the pathogenesis of numerous human cancers, including osteosarcomas. Appendicular osteosarcomas of the dog appear to be a good model for their human equivalent with regard to biologic behavior, epidemiology and histopathology. We individually screened exons 5–8 of the p53 gene for mutations in 15 canine appendicular osteosarcomas using ‘Cold’ SSCP to compare the role of this gene in human and canine osteosarcoma tumorigenesis. Seven of the tumors (47%) exhibited point mutations, with one tumor possessing two mutations within different exons. Of these, seven were missense mutations and the eighth was a ‘silent’ mutation potentially affecting the exon 6–7 splicing region. Five of the missense mutations were located in highly conserved regions IV and V, while another corresponded with the highly conserved codon 220 mutational hotspot located outside the conserved domains. The locations and types of mutations were nearly identical to those reported in human cancer. These findings provide strong evidence of the involvement of p53 mutations in the development of canine appendicular osteosarcomas. Canine osteosarcomas appear to be a promising model for their human equivalent on a clinical, pathologic, and molecular level. The pathogenesis of a wide variety of human neoplasms includes mutational inactivation of the p53 tumor suppressor gene (1,2). The encoded nuclear phosphoprotein serves as a negative regulator of cellular proliferation, promotes DNA repair, and plays a role in apoptosis (3–5). Alterations of p53 protein function may allow unrestricted cellular proliferation and subsequent development of tumors. Deletions, translocations or mutations of the p53 gene are observed in ~60% of human tumors (5). In most tumors, both p53 alleles are inactivated, one by a mutation and the other by deletion. Exons 5–8 of the p53 gene contain up to 98% of p53 mutations observed in human tumors and contain four of five evolutionarily conserved regions, which appear critical to normal function (2). The presence of p53 mutations is associated with aggressive biological behavior, poor prognosis and altered response to therapy in many human tumors (1,6–8). Human osteosarcomas (OSAs*) also have a high prevalence of p53 gene alterations. Allelic deletion of p53 has been *Abbreviations: OSAs, osteosarcomas; H&E, hematoxylin and eosin; PCR, polymerase chain reaction; SSCP, single-stranded conformation polymorphism; LOH, loss of heterozygosity. © Oxford University Press

demonstrated in over 70% of human OSAs (9–13), while point mutations, small deletions, insertions and splice mutations are identified in 18–100% (13–17). Gross rearrangements or partial deletions of the p53 gene were demonstrated in an additional 24–50% of human OSAs (11,13,18). Immunohistochemistry is also supportive of a high prevalence (23–72%) of p53 alterations in human and canine OSAs (19–23). Osteosarcoma is also one of the sarcomas occurring in excess in families possessing germ-line mutations of the p53 gene, and is often used to define probands for epidemiologic studies of LiFraumeni syndrome (14,24–28). Several studies further demonstrate the important role of the p53 gene in the development of OSA, as a determinant of clinical behavior and therapeutic response, and as a potential basis for development of future therapy. Transgenic mice with a mutant or inactivated p53 gene have a high frequency of OSAs (29,30). Reintroduction of the wild-type p53 gene into p53-deficient metastatic human OSA cell lines results in terminal differentiation and apoptosis in vivo, and suppression of growth in vitro (7,31,32). Finally, reintroduction of a normal p53 gene and subsequent expression of a normal p53 protein product resulted in increased radiosensitivity of p53-deficient cell lines, while expression of abnormal p53 protein decreased radiosensitivity (33). Similar effects may be seen regarding susceptibility to chemotherapy and radiation therapy in human tumors (6,8). Since 1978, the dog has been proposed as a model for studies of human cancers (34). The most frequently compared canine cancer is OSA (35–37). OSA is the most common primary bone tumor in both humans and dogs (38,39). There are striking similarities between OSAs in the dog and humans regarding gender predilection, relative body mass, anatomic site, histologic grade and subtypes, high metastatic rate and prognosis (40,41). Canine OSA has a later onset, earlier onset of metastasis, and ~40 times the prevalence of the human equivalent (39,41). It is estimated that over 8000 new cases of spontaneous canine OSA occur annually in the United States (41). This may represent a significant underestimate, since many cases of canine OSA are never diagnosed. In addition, tumors in dogs and humans often have a similar response to radiation and chemotherapy (3,34,36,42). Given these similarities and the high frequency of canine OSAs relative to humans, dogs are potentially an ideal model for examining the role of p53 in the development and biological behavior of this neoplasm. Canine appendicular OSAs, in particular, are an attractive model due to their relative frequency and aggressive behavior. These tumors account for 75–80% of OSAs in the dog and develop pulmonary metastases earlier and more frequently than those of the axial skeleton, often before a primary tumor is identified (40,43). As a result, appendicular OSAs represent one of the most biologically aggressive tumors encountered in the dog. This study attempts to define the role of p53 gene alterations in the development of canine appendicular OSAs for the purpose of identifying 213

A.S.Johnson, C.G.Couto and C.M.Weghorst

similar or dissimilar molecular mechanisms of tumor development compared with their human counterparts. Formalin-fixed, paraffin-embedded surgical biopsy submissions of 15 spontaneous appendicular canine OSAs were obtained from the Ohio State University Veterinary Pathology Library. Serial 8-µm sections were cut and mounted individually on slides. Disposable microtome blades were utilized and changed following sectioning of each sample to prevent crosscontamination of DNA. One slide from each tumor was stained with hematoxylin and eosin (H&E) to confirm the presence of neoplastic tissue and assist in microdissection of tumor tissue from unstained slides. To gain access to microscopically discrete areas of tumors, affected areas were identified and microdissected from paraffin-embedded tissue sections. Selected areas were carefully scraped from single, unstained sections into a tube using a sterile disposable surgical blade and the corresponding H&E stained section as a visual template. Octane (500 µl) was added to each of the scraped samples to deparaffinize the tissue. Tubes were gently vortexed for 20 min and then centrifuged for 6 min at 14 000 g using a microcentrifuge. The octane was removed, and the pellet was washed with 500 µl of 100% ethanol for 20 min and then airdried for 2 h. The dried pellet was resuspended in 100 µl of digestion buffer (50 mM Tris, pH 8.5, 1 mM EDTA, and 0.5% Tween 20) containing 200 ng/ml of proteinase K and incubated at 55°C for a minimum of 24 h. The suspension was then microcentrifuged for 10 s, heated to 95°C for 10 min to inactivate the proteinase, and finally clarified in a microcentrifuge tube for 1 min. The supernatant was stored at 4°C and used as the DNA template in subsequent polymerase chain reaction (PCR) amplifications. In order to fully evaluate all of the nucleotides associated with exons 5–8, as well as intron/exon splice junctions, PCR primers must be designed from intron sequences. This strategy also serves to avoid co-amplification of potential p53 pseudogenes that have been identified in other species (44,45). Therefore, canine p53 introns 4, 7 and 8 were amplified using primers obtained from published canine p53 exon sequences (Table I) (46). PCR was performed using 30 cycles of denaturation (94°C, 50 s), annealing [50 s at the appropriate T(a); see Table I], and extension (72°C, 50 s). PCR products were purified and sequenced as described below. From the intron sequences thus obtained (GenBank accession numbers AF024718, AF024719 and AF024720) and previously published sequences of introns 5 and 6 (47), four pairs of intronbased PCR primers were designed for amplification of p53 exons 5–8 and their flanking intron regions (Table I). PCR amplification of exons 5–8 was performed in duplicate for each tumor sample to allow confirmation of detected mutations and identification of potential random Taq-induced mutations. Hot-start PCR utilizing Taq antibody was performed to avoid priming of non-specific templates (48,49). PCR was performed using 35–40 cycles of denaturation for 30 s (94°C), annealing for 30 s at the appropriate T(a) (see Table I), and extension for 30 s (72°C), followed by a final 7-min extension at 72°C. For each set of PCR reactions, a negative control containing no template was employed. PCR products were analyzed using 10% polyacrylamide mini-gels (Novex, San Diego, CA) at 250 V for 30 min, stained with ethidium bromide (0.5 g/ml in 13 TBE buffer) for 10 min, and visualized by UV fluorescence. PCR fragments generated from amplification of p53 exons 5–8 were analyzed by single-stranded conformation polymorphism (SSCP). The method of ‘Cold’ SSCP was followed 214

as described previously (50). A mixture consisting of 1–5 µl of PCR product (20–200 ng of DNA), 0.4 µl of 1 mM methylmercury hydroxide, 1 µl loading buffer (15% Ficoll, 40 000 MW, 0.25% bromophenol blue, 0.25% xylene cyanol), and 13.6 µl of 13 TBE buffer was prepared for each PCR product to yield a total volume of 16–20 µl. This mixture was heated to 85°C to denature double-stranded DNA, then plunged into ice prior to loading the entire volume on the gel. Precast, 838 cm, 0.1 cm thick, and 20% polyacrylamide TBE mini-gels were used with the Novex Thermoflow SSCP System (Novex, San Diego, CA). The buffer chamber was filled with 1.253 TBE buffer. A constant (60.5°C) buffer temperature was maintained within the cell chambers during the gel run. Positive control PCR products for each exon were generated by the ‘megaprimer’ method of site-directed mutagenesis (51) using primers described in Table I. Optimal buffer temperatures of 1°C, 9°C, 7°C and 15°C were empirically determined for the p53 exon 5–8 fragments, respectively, to attain maximal differentiation between wild-type and positive control samples. Gels were run at 300 V (38 V/cm) for 3–10 h, depending on the fragment size and buffer temperature, then stained with SyberGreen (Molecular Probes, Eugene, OR) in TBE buffer for 10 min at room temperature and photographed under UV fluorescence. Evaluation of products from duplicate PCR reactions was employed for each sample to confirm positive shifts in SSCP bands. Mutant bands were isolated from the SSCP gel and re-amplified 20 cycles by PCR to enrich for mutant alleles. Following PCR, enriched mutant products were purified and concentrated into 40 µl using Micron-100 microconcentrators (Amicon, Beverly, MA) to remove salts, primers and dNTPs. Purified PCR mutant products were sequenced on an Applied Biosystem 377 Prism DNA Sequencer using an ABI PRISM™ dye terminator cycle sequencing ready reaction kit (ABI/PE, Foster City, CA) according to the manufacturer’s instructions. Electrophoresis was performed at 3000 V for 3.5 h and DNA sequences were analyzed using ABI sequencing analysis software. All mutations were confirmed by sequencing both DNA strands. Exons amplified from normal tissues, corresponding to tumor tissues containing mutations, were also sequenced to identify possible germ-line defects and to eliminate the possibility of pseudogene amplification or breedassociated polymorphisms. Silent somatic mutations within coding portions of the p53 gene were analyzed for potential effects on mRNA splicing using the Signal subprogram within the PC/Gene (Intelligenetics, Mountainview, CA) software package. Exons 5–8 of the p53 gene were screened individually for mutations in 15 canine appendicular OSAs. Breeds evaluated were: Labrador Retriever (3), Rottweiler (2), Doberman Pinscher (2), mixed breed (2), old English Sheepdog, German Shepherd Dog, Irish Setter, Great Pyrenees, Great Dane and Gordon Setter. Mutation associated SSCP band shifts were identified and confirmed in seven tumor samples (47%), one of which possessed mutations in both exons 6 and 7. An example SSCP analysis identifying a mutation is shown in Figure 1. Sequence analysis identified seven missense point mutations and a silent point mutation located at the junction of exons 6 and 7. These are summarized in Table II. Three of the mutations (codons 188, 220 and 224 of the human gene) occurred outside of the five highly conserved domains. The remaining mutations fell within highly conserved domains IV and V. Two identical mutations were observed in independent

p53 Mutations in canine osteosarcomas

Table I. Primers used for sequencing and SSCP analysis of the canine p53 gene Product location

Product size (bp)

Intron 4

707

Intron 7

329

Intron 8

~375

Exon 5

249

Exon 6

204

Exon 7

235

Exon 8

193

a(1)

Primer sequence (39 to 59)a

T(a) (°C)

GACCTACCCTGGCACCTATGG (1) TCACGAACTCCGACTTCTTATA (–) ACTATCATCACCCTGGAAGAC (1) GCACAAACGCGTACCTCAAAG (–) AGACCGCCGGACTGAGGAGGA (1) AGCTGGTGCTGGGAGGCAGTG (–) AACTGTCCATCTGTCCTTTTC (1) CAGCCTTGTCCCATCTGTAGC (–) AACTGTCCATCTGTCCTTTTCTAACAGTAATCCCC (m) ATTCCTCCCCGATGGCTCTTA (1) CCTCAACTCCCGCCTCACAAA (–) ATTCCTCCCCGATGGCTCTTAGGTATTGC (m) CCGACCCTGGGCCTACCTTCT (1) GGCAGAGGAGATTCCACATTG (–) CCGACCCTGGGCCTACCTTCTACCTCAGGTTTGCTC (m) CTGCTTCTCTCTTCTCACCTG (1) CCTTCACCTCCTCTTGTCTTG (–) CTGCTTCTCTCTTCTCACCTGGGTAGTGTAAAC (m)

64 60 72 64 66 68 64

sense primer, (–) antisense primer, (m) primer with induced mutation (underlined) for positive control.

Table II. Point mutations identified in osteosarcoma tumor tissues Tumor sample

Breed

Exon

Codona

Mutation

Amino acid substitution

OSA-1 OSA-2 OSA-10 OSA-19 OSA-23 OSA-25

Great Pyrenees mix Doberman Pinscher Irish Setter Rottweiler mix

OSA-29c

Labrador Retriever

6 7 7 6 7 6 7 8

224 249 249 220 258 188 248 276

GAG→GAA CGG→TGG CGG→TGG TAT→TCT GAA→AAA CTT→ATT CGG→CAG GCC→GAC

noneb Arg→Trp Arg→Trp Tyr→Ser Glu→Lys Leu→Ile Arg→Gln Ala→Asp

aCorresponding to human p53 gene. bSilent mutation located at the junction cAn

of exons 6 and 7, resulting in reduced affinity of the cryptic donor splice site. identical mutation was identified in a metastasis from the same animal.

Fig. 1. ‘Cold’ SSCP analysis of canine p53 exon 8. Positive SSCP band shifts are present (arrows) in duplicate PCR reactions (lanes 29A and 29B) from a single osteosarcoma (OSA-29) which are different in mobility compared with the corresponding wild-type bands (WT). Note that a majority of the alleles comprise the mutant band, while only a small proportion of the wild-type alleles remain. Enrichment of the mutant fragment was accomplished by removing a plug from the shifted band in the original SSCP gel followed by reamplification, as seen in lane 29E. The band shift was later attributed to a missense substitution. A positive control fragment created by site-directed mutatgenesis also demonstrated an appropriately unique band shift (PC).

tumor samples at human codon 249 in the fifth highly conserved domain. Five of the eight mutations observed were G:C→A:T transitions, two were G:C→T:A transversions, and one was an A:T→C:G transversion. Three of the G:C→A:T transitions occurred at CpG sites.

Mutations were not identified in corresponding normal tissues from six of the seven cases where normal tissues were available for evaluation. Normal tissue from one case (sample OSA-19) was not available. However, the SSCP profile from this sample demonstrated the shifted mutant band to be comprised of the majority of amplified alleles (85–90%) with a faint wild-type band also being present. Thus, the nucleotide change responsible for the SSCP band shift represents a legitimate mutation, since a breed-associated polymorphism would have resulted in a mutant band shift containing either 50% or 100% of an altered allele. We have demonstrated that p53 mutations are present in canine OSAs at a frequency comparable to or greater than that of human OSAs. Of the seven missense mutations observed, five are located in the five highly conserved domains and one is at the junction of exons 5 and 6. The remaining missense mutation (codon 220) is located at one of two mutational hotspots in a small, highly conserved region at codons 213– 223 (1). Finally, the silent mutation (codon 224) located at the exon 6–7 junction may be functionally relevant since it reduces the affinity of the appropriate cryptic donor splice site relative to other surrounding potential splice sites (data not shown). Thus, each mutation identified is likely to have an impact on p53 function. Since tumor-associated mutations were not identified in corresponding normal tissues, they do not represent 215

A.S.Johnson, C.G.Couto and C.M.Weghorst

germ-line mutations, pseudogenes or breed-associated polymorphisms. The p53 point mutations reported here in the dog correspond precisely to inactivating mutations previously identified in the human p53 gene in various cancer types, with the exception of codons 188 and 224 (2,53). Alternate missense point mutations have been reported at codon 224, while frameshift mutations have been identified at codon 188, one of which was a human OSA (52). Three mutations correspond to human codons 248 and 249, which are sites of mutations in human OSAs (52,53) and represent two of five mutational hotspots accounting for 23% of reported p53 mutations in human cancer (1,54). G:C→A:T transitions represent the majority (47%) of all p53 gene point mutations identified in human cancers and 62.5% of the mutations identified in this study (12). G:C→T:A transversions account for 25% of the mutations in our study and are the second most common p53 gene point mutation (20%) identified in human cancers. Of the five G:C→A:T transitions observed, 60% occurred at CpG sites, as compared with 24% in all human cancers. In general, G:C→A:T transitions at CpG sites represent endogenous DNA damage resulting from deamination of 5-methylcytosine (1,2). Over one-half of p53 germ-line mutations are of this type. G:C→T:A transversions and non-C→A:T transitions, on the other hand, are generally associated with carcinogen exposure. It should be noted that the human codon 249 is AGG versus CGG in the dog, resulting in CpG sites at the five most common sites of p53 mutation in human cancers (1,2,46). While loss of heterozygosity (LOH) was not evaluated critically, mutant SSCP bands were substantially brighter than wild-type bands in 75% of the samples, suggesting that the wild-type p53 gene is not present in the majority of cells in most samples (data not shown). Minor amounts of wild-type p53 are expected as a result of contamination with normal cells or subpopulations of tumor cells not displaying LOH. The p53 mutations reported here provide strong evidence of the role of this gene in the development of canine appendicular OSAs in a manner parallel to that demonstrated in human OSAs. Where p53 mutations were not observed, other mechanisms of p53 inactivation may exist. Mutations may be present in unexamined regions of the p53 gene or its promoter. Alternatively, overexpression of MDM2 in OSAs can bind and inactivate normal p53 protein (15,55). The possible role of alternative gene products in the development of canine neoplasia should not be discounted. Germ-line and spontaneous RB1 gene alterations are associated with the development of human, and possibly canine, OSAs (10,12,15,16,56–58). One study reported possible RB deletions in 9 of 10 canine OSAs evaluated (57). The oncogenes Ki-ras and c-myc have been implicated in the development of other canine tumors (59,60). Nevertheless, this study provides strong evidence for the involvement of p53 alterations in the development of canine appendicular OSAs. These tumors appear to be a promising model for their human equivalent on a clinical, pathologic, and molecular level. Acknowledgements We would like to acknowledge Steven E.Weisbrode, VMD, PhD, Dip. ACVP, for his assistance in histologic evaluation of tissue samples.

References 1. Greenblatt,M.S., Bennett,W.P., Hollstein,M. and Harris,C.C. (1994) Mutations in the p53 tumor suppressor gene: Clues to cancer etiology and molecular pathogenesis. Cancer Res., 54, 4855–4878.

216

2. Hollstein,M., Sidransky,D., Vogelstein,B. and Harris,C.C. (1991) p53 mutations in human cancers. Science, 253, 49–53. 3. Hahn,K.A., Bravo,L., Adams,W.H. and Frazier,D.L. (1994) Naturally occurring tumors in dogs as comparative models for cancer therapy research. In Vivo, 8, 133–144. 4. Lane,D.P. (1993) A death in the life of p53. Nature, 362, 786–787. 5. Levine,A., Momand,J. and Finlay,C. (1991) The p53 tumour suppressor gene. Nature, 351, 453–456. 6. Callahan,R. (1992) p53 mutations, another breast cancer prognostic factor. J. Natl Cancer Inst., 84, 826–827. 7. Harris,C.C. and Hollstein,M. (1993) Clinical implications of the p53 tumor suppressor gene. N. Engl J. Med., 329, 1318–1327. 8. Lowe,S.W., Ruley,H.E., Jacks,T. and Housman,D.E. (1993) p53-Dependent apoptosis modulates the cytotoxicity of anticancer agents. Cell, 74, 957–967. 9. Andreassen,A., Oyjord,T., Hovig,E. et al. (1993) p53 abnormalities in different subtypes of human sarcomas. Cancer Res., 53, 468–471. 10. Hoogerwerf,W.A., Hawkins,A.L., Perlman,E.J. and Griffin,C.A. (1994) Chromosome analysis of nine osteosarcomas. Genes Chrom. Cancer, 9, 88–92. 11. Miller,C.W., Aslo,A., Tsay,C., Slamon,D., Ishizaki,K., Toguchida,J., Yamamuro,T., Lampin,B. and Koeffler,H.P. (1990) Frequency and structure of p53 rearrangements in human osteosarcoma. Cancer Res., 50, 7950– 7954. 12. Toguchida,J., Ishizaki,K., Sasaki,M., Ikenaga,M., Sugimoto,M., Kotoura,Y. and Yamamuro,T. (1988) Chromosomal reorganization for the expression of recessive mutation of retinoblastoma susceptibility gene in the development of osteosarcoma. Cancer Res., 48, 3939–3943. 13. Toguchida,J., Yamaguchi,T., Ritchie,B. et al. (1992) Mutation spectrum of the p53 gene in bone and soft tissue sarcomas. Cancer Res., 52, 6194–6199. 14. Iavarone,A., Matthay,K.K., Steinkirchner,T.M. and Israel,M.A. (1992) Germ-line and somatic p53 mutations in multifocal osteogenic sarcoma. Proc. Natl Acad. Sci. USA, 89, 4207–4209. 15. Miller,C.W., Aslo,A., Won,A., Tan,M., Lampkin,B. and Koeffler,H.P. (1996) Alterations of the p53, Rb, and MDM2 genes in osteosarcoma. J. Cancer Res. Clin. Oncol., 122, 559–565. 16. Scholz,R.B., Kabisch,H., Weber,B., Roser,K., Delling,G. and Winkler,K. (1992) Studies of the RB1 gene and the p53 gene in human osteosarcomas. Ped. Hem. Oncol., 9, 125–137. 17. Smith-Sorensen,B., Gebhardt,M.C., Kloen,P., McIntyre,J., Aguilar,F., Cerutti,P. and Borresen,A.L. (1993) Screening for TP53 mutations in osteosarcomas using constant denaturant gel electrophoresis (CDGE). Human Mut., 2, 274–285. 18. Masuda,H., Miller,C., Koeffler,H.P., Battifora,H. and Cline,M.J. (1987) Rearrangement of the p53 gene in human osteogenic sarcomas. Proc. Natl Acad. Sci. USA, 84, 7716–7719. 19. Grundmann,E., Ueda,Y., Schneider-Stock,R. and Roessner,A. (1995) New aspects of cell biology in osteosarcoma. Path. Res. Pract., 191, 563–570. 20. Park,H. and Park,Y. (1995) Expression of p53 protein, PCNA, and Li-67 in osteosarcomas of bone. J. Kor. Med. Sci., 10, 360–367. 21. Sagartz,J.E., Bodley,W.L., Gamblin,R.M., Couto,C.G., Tierney,L.A. and Capen,C.C. (1996) p53 tumor suppressor gene overexpression in osteogenic tumors of dogs. Vet. Path., 33, 213–221. 22. Ueda,Y., Dockhorn-Dworniczak,B., Blasius,S., Mellin,W., Wuisman,P., Bocker,W. and Roessner,A. (1993) Analysis of mutant p53 protein in osteosarcomas and other malignant and benign lesions of bone. J. Cancer Res. Clin. Oncol., 119, 172–178. 23. Wadayama,B., Toguchida,J., Yamaguchi,T., Sasaki,M.S., Kotoura,Y. and Yamamuro,T. (1993) p53 expression and its relationship to DNA alterations in bone and soft tissue sarcomas. Br. J. Cancer, 68, 1134–1139. 24. Hartley,A.L., Birch,J.M., Marsden,H.B. and Harris,M. (1986) Breast cancer risk in mothers of children with osteosarcoma and chondrosarcoma. Br. J. Cancer, 54, 819–823. 25. Li,F.P., Fraumeni,J.F. Jr., Mulvihill,J.J., Blattner,W.A., Drefus,M.G., Tucker,M.A. and Miller,R.W. (1988) A cancer family syndrome in twentyfour kindreds. Cancer Res., 48, 5358–5362. 26. Malkin,D., Frederick,P.L., Strong,L. et al. (1990) Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms. Science, 250, 1233–1238. 27. McIntyre,J.F., Smith-Sorensen,B., Friend,S.H. et al. (1994) Germ line mutations of the p53 tumor suppressor gene in children with osteosarcoma. J. Clin. Oncol., 12, 925–930. 28. Porter,D.E., Holden,S.T., Steel,C.M., Cohen,B.B., Wallace,M.R. and Reid,R. (1992) A significant proportion of patients with osteosarcoma may belong to Li-Fraumeni families. J. Bone Joint Surg., 74B, 883–886. 29. Lavigueur,A., Maltby,V., Mock,D., Rossant,J. Pawson,L. and Bernstein,A. (1989) High incidence of lung, bone, and lymphoid tumors in transgenic

p53 Mutations in canine osteosarcomas mice overexpressing mutant alleles of the p53 oncogene. Mol. Cell. Biol., 9, 3982–3991. 30. Wilkie,T.M., Schmidt,R.A., Baetscher,M. and Messing,A. (1994) Smooth muscle and bone neoplasms in transgenic mice expressing SV40 T antigen. Oncogene, 9, 2889–2895. 31. Radinsky,R., Fidler,I.J., Price,J.E., Esumi,N., Tsan,R., Petty,C.M., Bucana,C.D. and Bar- Eli,M. (1994) Terminal differentiation and apoptosis in experimental lung metastases of human osteogenic sarcoma cells by wild type p53. Oncogene, 9, 1877–1883. 32. Wang,J., Bucana,C.D., Roth,J.A. and Zhang,W.W. (1995) Apoptosis induced in human osteosarcoma cell is one of the mechanisms for the cytocidal effect of Ad5CMV-p53. Cancer Gene Therapy, 2, 9–17. 33. Miyakoshi,J., Nobuyuki,Y., Shuji,O. and Takebe,H. (1995) Changes in radiation sensitivity of human osteosarcoma cells after p53 introduction. Japan. J. Cancer Res., 86, 711–713. 34. Hewitt,H.B. (1978) The choice of animal tumors for experimental studies of cancer therapy. Adv. Cancer Res., 27, 149–200. 35. Brodey,R.S. (1979) The use of naturally occurring cancer in domestic animals for research into human cancer: general considerations and a review of canine skeletal osteosarcoma. Yale J. Biol. Med., 52, 345–361. 36. MacEwen,E.G. (1990) Spontaneous tumors in dogs and cats: models for the study of cancer biology and treatment. Cancer Met. Rev., 9, 125–136. 37. Misdorp,W. (1980) Animal model: canine osteosarcoma. Am. J. Path., 98, 285–288. 38. Liu,S.K., Dorfman,H.D., Hurvitz,A.I. and Patnaik,A.K. (1977) Primary and secondary bone tumors in the dog. J. Small Anim. Pract., 18, 313–326. 39. Malawar,M.M., Link,M.P. and Donaldson,S.S. (1993) Sarcomas of bone. In DeVita,V.T.,Hellman,S. and Rosenberg,S.A. (eds) Cancer: Principles and Practice of Oncology. J.B. Lippencott, Co., Philadelphia, 4th edn, pp. 1509–1566. 40. Brodey,R.S. and Riser,W.H. (1969) Canine osteosarcoma. A clinicopathologic study of 194 cases. Clin. Orthop. Rel. Res., 62, 54–64. 41. Withrow,S.J., Powers,B.E., Straw,R.C. and Wilkins,R.M. (1991) Comparative aspects of osteosarcoma: dog versus man. Clin. Ortho. Relat. Res., 270, 159–168. 42. Gillette,E.L. (1980) Spontaneous canine neoplasms as models for therapeutic agents. In Fidler,I.J. and White,R.J. (eds) Design of Models for Testing Cancer Therapeutic Agents. Van Nostrand Reinhold, New York, pp. 185–192. 43. Goldschmidt,M.H. and Thrall,D.E. (1985) Malignant bone tumors in the dog. In Newton,C.D. and Nunamaker,D.M. (eds) Textbook of Small Animal Orthopaedics. J.B. Lippincott, Philadelphia, PA, pp. 887–898. 44. Weghorst,C.M., Buzard,G.S., Calvert,R.J., Hulla,J.E. and Rice,J.M. (1995) Cloning and sequence of a processed p53 pseudogene from rat: a potential source of false ‘mutations’ in PCR fragments of tumor DNA. Gene, 166, 317–322. 45. Zakut-Houri,R., Oren,M., Bienz,B., Lavie,V., Hazum,S. and Givol,D. (1983) A single gene and a pseudogene for the cellular tumour antigen p53. Nature, 306, 594–597. 46. Kraegel,S.A., Gumerlock,P.H., Dungworth,D.L., Oreffo,V.I.C. and Madewell,B.R. (1992) K-ras activation in non-small cell lung cancer in the dog. Cancer Res., 52, 4724–4727. 47. Devilee,P., Van Leeuwen,I.S., Voesten,A., Rutteman,G.R., Jan H.V. and Cees J.C. (1994) The canine p53 gene is subject to somatic mutations in thyroid carcinoma. Anticancer Res., 14, 2039–2046. 48. Chou,Q., Russell,M., Birch,D.E., Raymond,J. and Bloch,W. (1992) Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications. Nucl. Acids Res., 20, 1717–1723. 49. Kellogg,D.E., Rybalkin,I., Chen,S., Mukhamedova,N., Vlasik,T., Siebert,P.D. and Chenchik,A. (1994) TaqStart Antibody: ‘hot start’ PCR facilitated by a neutralizing monoclonal antibody directed against Taq DNA polymerase. BioTechniques, 16, 1134–1137. 50. Hongyo,T., Buzard,G., Calvert,R. and Weghorst,C.M. (1993) ‘Cold SSCP’: a simple, rapid and non-radioactive method for optimized single-strand conformation polymorphism. Nucl. Acid Res., 21, 3637–3642. 51. Sarkar,G. and Sommer,S.S. (1990) The ‘megaprimer’ method of sitedirected mutagenesis. BioTechniques, 8, 404–407. 52. Cariello,N.F., Douglas,G.R. and Soussi,T. (1996) Databases and software analysis of mutations in the human p53 gene, the human hprt gene and the lacZ gene in transgenic rodents. Nucl. Acids Res., 24, 119–120. 53. Hainuat,P., Soussi,T., Shomer,B., Hollenstein,M., Greenblatt,M., Hovig,E., Harris,C.C. and Montesano,R. (1996) Database of p53 somatic mutations in human tumors and cell lines. Nucl. Acids Res., 25, 151–157. 54. Cho,Y., Gorina,S., Jeffrey,P. and Pavletich,N.P. (1994) Crystal structure of a p53 tumor suppressor–DNA complex: a framework for understanding how mutations inactivate p53. Science, 265, 346–355. 55. Nakayama,T., Toguchida,J., Wadayama,B., Kanoe,H., Kotoura,Y. and

Sasaki,M.S. (1995) MDM2 gene amplification in bone and soft-tissue tumors: association with tumor progression in differentiated adipose-tissue tumors. Int. J. Cancer, 64, 342–346. 56. Benedict,W.F., Fung,Y.K.T. and Murphree,A.L. (1988) The gene responsible for the development of retinoblastoma and osteosarcoma. Cancer, 62, 1691–1694. 57. Townsend,T., Kochevar,D.T. and Straw,R.C. (1993) Tumor suppressor gene changes in canine osteosarcoma. Vet. Cancer News, 16, 8–9. 58. Weischelbaum,R.R., Beckett,M. and Diamond,A. (1988) Some retinoblastomas, osteosarcomas and soft tissue sarcomas may share a common etiology. Proc. Natl Acad. Sci. USA, 85, 2106–2109. 59. Engstrom,W., Barrios,C., Azavedo,E., Mollermark,G., Kangstrom,L.E., Aliason,I. and Larsson,O. (1987) Expression of c-myc in canine mammary tumors. Anticancer Res., 7, 1235–1238. 60. Kraegel,S.A., Pazzi,K.A. and Madewell,B.R. (1995) Sequence analysis of canine p53 in the region of exons 3–8. Cancer Lett., 92, 181–186. Received on May 19, 1997; revised on September 24, 1997; accepted on September 26, 1997

217