Mutations in the agouti (ASIP), the extension (MC1R) - Springer Link

Mammalian Genome 12, 450–455 (2001). DOI: 10.1007/s003350020017 Incorporating Mouse Genome

© Springer-Verlag New York Inc. 2001

Mutations in the agouti (ASIP), the extension (MC1R), and the brown (TYRP1) loci and their association to coat color phenotypes in horses (Equus caballus) Stefan Rieder,1 Sead Taourit,1 Denis Mariat,1 Bertrand Langlois,2 Ge´rard Gue´rin1 1 Laboratoire de Geńe´tique biochimique et de Cytogeńe´tique, De´partement de Geńe´tique animale, INRA Centre de Recherche de Jouy, 78352 Jouy-en-Josas cedex, France 2 Station de Geńe´tique quantitative et appliqueé, De´partement de Geńe´tique animale, INRA Centre de Recherche de Jouy, 78352 Jouy-en-Josas cedex, France

Received: 22 November 2000 / Accepted: 07 February 2001

Abstract. Coat color genetics, when successfully adapted and applied to different mammalian species, provides a good demonstration of the powerful concept of comparative genetics. Using crossspecies techniques, we have cloned, sequenced, and characterized equine melanocortin-1-receptor (MC1R) and agouti-signalingprotein (ASIP), and completed a partial sequence of tyrosinaserelated protein 1 (TYRP1). The coding sequences and parts of the flanking regions of those genes were systematically analyzed in 40 horses and mutations typed in a total of 120 horses. Our panel represented 22 different horse breeds, including 11 different coat colors of Equus caballus. The comparison of a 1721-bp genomic fragment of MC1R among the 11 coat color phenotypes revealed no sequence difference apart from the known chestnut allele (C901T). In particular, no dominant black (ED) mutation was found. In a 4994-bp genomic fragment covering the three putative exons, two introns and parts of the 5⬘- and 3⬘-UTRs of ASIP, two intronic base substitutions (SNP-A845G and C2374A), a point mutation in the 3⬘-UTRs (A4734G), and an 11-bp deletion in exon 2 (ADEx2) were detected. The deletion was found to be homozygous and completely associated with horse recessive black coat color (Aa/Aa) in 24 black horses out of 9 different breeds from our panel. The frameshift initiated by ADEx2 is believed to alter the regular coding sequence, acting as a loss-of-function ASIP mutation. In TYRP1 a base substitution was detected in exon 2 (C189T), causing a threonine to methionine change of yet unknown function, and an SNP (A1188G) was found in intron 2.

Introduction Mammalian coat and skin color seems to be determined by a small number of genes shared among different species (Jackson et al. 1994; Barsh 1996; Newton et al. 2000). These genes can be classified into two main groups: those acting on the melanocyte—its development, differentiation, proliferation, and migration; and those acting directly on pigment synthesis. Variation in coat and skin colors is, therefore, likely to be understood as the effect of modified genes causing changes to either the melanocyte or the pigment synthesis or its combinations (detailed in Searl 1968; Eberle 1988). Melanocortin-1-receptor (MC1R), encoded by the Extension (E) locus, and its peptide antagonist agouti-signaling-protein (ASIP), encoded by the Agouti (A) locus, control the relative amounts of melanin pigments in mammals (Lu et al. 1994; SirCorrespondence to: G. Guérin; E-mail: [email protected]

acusa, 1994). ASIP acts as an antagonist of MC1R by nullifying the action of ␣-melanocyte-stimulating hormone (␣-MSH). Lossof-function of MC1R results in yellow pigment (pheomelanin), whereas gain-of-function of MC1R or loss-of-function of ASIP seems to result in the production of black pigment—eumelanin (reviewed in Barsh 1996). Tyrosinase-related protein 1 (TYRP1) coded by the Brown locus is believed to be a melanosomal membrane protein. Its enzymatic function is thought to represent 5,6-dihydroxyindole-2carboxylic acid (DHICA) oxidase (Kwon 1993; Jackson et al. 1994; Sturm et al. 1995; Lee et al. 1996). Apart from the original brown mouse mutation (Zdarsky et al. 1990), alterations in TYRP1 are known to be involved in progressive greying of mice (Johnson and Jackson 1992; Javerzat and Jackson 1998). In the horse, reduced levels of TYRP1 mRNA were found in grey horses compared with solid colored horses (Rieder et al., 2000). TYRP1 is believed to be involved in the synthesis of an intermediate “chocolate” melanin, represented in horses of a dark chestnut, liver chestnut, silver or seal brown phenotype. The successful molecular definition of coat color mutations in different mammals (Jackson 1994; Klungland et al. 1995; Joerg et al. 1996; Marklund et al. 1996, 1999; Moller et al. 1996; Vage et al. 1997, 1999; Kijas et al. 1998; Rana et al. 1999; Newton et al. 2000) and the homology among involved genes enhances the general concept of comparative genetics between species (Rudolph et al. 1992; Hayes 1995; Raudsepp et al. 1996; Caetano et al. 1999; Santschi et al. 1998; Godard et al. 2000), and its application to color determination in particular. In Equus caballus, one can roughly distinguish between the black, bay, chestnut, and chocolate coat color “families” (detailed in Wagoner 1978; Evans et al. 1990; Adalsteinsson and Thorkelsson 1991; Sponenberg 1996). Horse breeds usually display a huge variety of distinct coat color patterns. Nevertheless, some of them are known for their particular coat color, indicating homozygozity for this character. Me´rens and Friesian horses, for example, are thought to be all black, except for a low frequency of the chestnut allele (Ee), resulting occasionally in chestnut-colored horses when homozygous. Solid black is quite a rare coat color in most horse breeds and seems to be essentially recessive (Aa/Aa), although some authors mention cases of dominant inheritance—ED (Dreux 1966; Sponenberg and Weise 1997). The mutation leading to the chestnut allele (Ee) is a single base substitution in MC1R (Marklund et al. 1996). In the present study, we report for the first time the complete coding sequence and the genomic structure of equine MC1R, ASIP, and TYRP1 loci. We provide molecular evidence for a recessive segregation of horse black coat color (Aa) and show that black horses are homozygous for a deletion in the Agouti locus. We

S. Rieder et al.: MC1R, ASIP, TYRP1 loci and horse coat color phenotypes

451

Table 1. Horse panel including phenotype information of 120 individual horses and clones from the INRA horse BAC-library. The 40 horses from our restricted working panel are indicated with an asterisk. Parentheses mark horses of more than one known color phenotype (e.g., black turned grey).

Breed Anglo-Arabian Akhal Teke Arabian Breton Camargue Castillon Connemara Fjord Franches Montagnes Friesian Haflinger Mérens Percheron Poney Français de Selle Poney Suisse de Selle Pura Raça Espanõla Przewalski Thouroughbred Selle Français Trotteur Français Welsh-A Welsh Cob BAC-clone (Poney Français) Total

Bay 4

Dark Bay

Black

Black & Tan

Chestnut

1

1

Dark Chestnut

Buckskin

Dun

Grey

Roan

White

2 1*

1

2

3 (1)

1* 1

(1) 4* 1

(1) 2*

(2)

4/3*

6* 1* 1*

4*

1* 6/1* 1* 5* 5 1 1* (1)

2* 1*

6 19/2* 2

9 3/1* 3

5 1 (1)

1

1 4 1 1*

1* “1” 42 (1)

16

24 (2)

7

16 (4)

reveal mutations in the Extension, the Agouti, and the Brown loci, and discuss effects of those mutations on bay, dark bay, chestnut, and dark chestnut phenotypes in horses. Materials and methods BAC library and screening. The INRA horse BAC library (Godard et al. 1998) served as a primary genetic source to screen for clones containing MC1R, ASIP and TYRP1 sequences. Screening, clone verification, and DNA preparation (mini-prep) were performed as described previously (Godard et al. 2000).

Informative horse coat color panel—breeds and DNA extraction. Blood or hair samples from 120 horses were collected, and DNA was extracted according to standard protocols. The panel includes horses of a total of 22 different breeds representing a range of 11 distinct coat colors (Table 1). Each horse was either personally known to the authors or informative photos were at their disposal from the breeder or the breeding organizations. The three BAC clones were included in the panel and served as sources to establish reference sequences (GenBank accession numbers AF288357, AF288358, and AF288359, respectively). A restricted basic working panel (40 animals) included selected horses of particular coat colors, taking breed and pedigree information into account. The working panel was used to find sequence differences in the candidate genes of potential association with coat color phenotypes. The French national studs (Haras Nationaux; SIRE Pompadour) provided us further with stud-book information of large half-sib families from their stallions, segregating for the reported colors. Samples were taken from private breeding operations and organizations (Association du Cheval de Castillon; Association Française du Poney Connemara; Association du Cheval Frison, Haras National Suisse Avenches).

Cross-species PCR amplification. A first primer pair was designed from either already existing equine sequence data (MC1R—accession number X98012; unpublished bovine sequence data from INRA, Limoges; and TYRP1—accession number AF076781) or from bovine and human GenBank sequence data (ASIP—accession numbers X99691 and L37019). These primers were used to screen the library and to obtain primary horse gene sequence fragments. A PCR-walking strategy was then applied by using equine gene-specific primers, combined with a primer based on conserved mammalian sequence data. An overview of relevant primers and their relative position on the different gene sequences is given in Table 3.

9

1

3

7

1

1

Total 8 1 7 1 4 12 2 1 5 6 1 5 5 1 1 2 1 16 31 8 1 1 “1” 120

To complete the 5⬘- and 3⬘-ends of the three loci, the BAC clones were digested with Sau3AI and subcloned into a pGEM4z dephosphorylated vector (Promega, Lyons, France). PCR amplification was carried out on ligation products by using an equine gene-specific primer combined with the “universal” and “reverse” cloning-vector primers. PCRs were performed on PTC 100 MJ-Research thermocyclers by using GoldStar Taq-polymerase from Eurogentec (Seraing, Belgium) or an Expand High Fidelity PCR system from Boehringer (Ingelheim, Germany). Cycling followed standard protocols and manufacturer’s instructions (Table 3).

Sequencing and mutation analysis. PCR fragments were purified with columns (Qiagen or Millipore), and direct sequencing was performed with an ABI 377 sequencer (Perkin-Elmer) by using a dye-terminator sequencing reaction kit. Equine MC1R, ASIP, and TYRP1 sequences visualized with the “Sequence Analysis” software package (Perkin-Elmer) were aligned and compared among horses with GCG (Devereux et al. 1984) in order to detect mutations. Potential mutations were then confirmed by repeated sequencing of both strands. Later, extended typing of all mutations was either processed with a detection kit from Perkin-Elmer according to the manufacturer’s instructions (ABI Prism SnaPshot ddNTP primer extension kit: Aln1-845G, Aln2-C2374A, AU3-A4734G, ADEx2, TEx2C189T, Tln2-A1188G, and MC1R-C901T) or partially performed as PCRRFLP (MC1R-C901T with Taql according to Marklund et al. 1996; TEx2C189T with RsrII and Tln2-A1188G with NspI). The deletion in ASIP exon 2 (ADEx2) was usually analyzed by a simple PCR amplification and electrophoresis on a 4% agarose gel (for primers see Table 3).

Results Clones for MC1R, ASIP, and TYRP1 were isolated from the INRA horse BAC library as reported in Godard et al. (1998, 2000). The correct content of the clones was confirmed by sequencing of relevant gene fragments and alignment to GenBank data. A preliminary total sequence of the three genes, based on the BAC clones, was then established and characterized. An MC1R fragment of 1721 bp, including the protein coding sequence (954 bp) and parts of the 5⬘- and 3⬘-UTRs, was systematically sequenced and compared among 40 horses of the working panel (Fig. 1, Table 1). Apart from the chestnut mutation at position C901T (Marklund et al. 1996), no other mutation in equine MC1R was observed. Interestingly, no gain-of-function MC1R mutation, namely, dominant black (ED), was detected. A C1140T

452


Fig. 1. Structure of horse MC1R, ASIP, and TYRP1 gene: length, exon-intron junctions and relative position of mutation sites are indicated. Coding portions of the exons are given in black boxes; introns and UTRs are indicated as lines (relative exon-intron size on figure does not reflect real proportions).

point mutation, observed only in the BAC clone, remains to be confirmed on genomic horse DNA. A 4994-bp sequence of equine ASIP, including the three putative exons, two introns and parts of the 5⬘- and 3⬘-UTRs, was established (Fig. 1). Equine-specific primer pairs were set to amplify and to sequence systematically the three agouti exons, as well as parts of the intronic flanking regions. Four mutations, three SNPs (single nucleotide polymorphism), and a deletion were detected. The first SNP was located in intron 1, 3 bp after exon 1 (A845G, SNP Aln1). A second SNP was detected in intron 2 (C2374A, SNP Aln2), and a third SNP was found in the 3⬘-UTRs, (A4734G), exactly 50 bp after the regular stop codon—SNP AU3 (Fig. 1). In addition to these SNPs, a deletion of 11 bp in exon 2 (ADEx2) was detected. The position of ADEx2 may vary by 4 bp owing to the repetitive structure in this part of the gene. We consider it to be between position 2174–2184 on genomic DNA level or at position 191–201, with regard to the start codon, if only exonic sequences are taken into account. The 11-bp deletion in ASIP exon 2 (ADEx2) alters the amino acid sequence and is believed to extend the regular termination signal by 210 bp to 612 bp. The frameshift initiated by the deletion results in a novel modified agouti-signaling-protein. ADEx2 was completely associated with horse recessive black coat color (Aa/ Aa) in all horses typed so far. In the deleted sequence, SNP-AU3 theoretically becomes part of the extended exon 3. However, this G-to-A substitution does not change the amino acid sequence and, therefore, remains a silent mutation with yet unknown function. The three agouti SNPs were typed in the horse panel to test for linkage disequilibrium with the DISLAMB program (Terwilliger 1995) and for haplotype analysis (Schibler et al. 2000). Only one coat color phenotype (black) and one SNP (AU3; ∼2554bp from the deletion; Fig. 1) were in disequilibrium (results not shown). In addition to the TYRP1 gene sequence reported by Rieder et

al. (2000), we completed the coding sequence (1626 bp) and sequenced also parts of the 5⬘- and 3⬘-UTRs, as well as intron 2. A new total fragment of 3327 bp was established (Fig. 1). Intronexon junctions were determined according to the human TYRP1 gene structure (Sturm et al. 1995). Two SNPs were found in equine TYRP1: one in putative exon 2 (C189T) and one in intron 2 (A1188G). The base substitution in exon 2 results in an amino acid change from threonine to methionine with yet unknown effect. None of the two mutations showed any obvious association with the coat color phenotypes taken into account in this study (Table 2). Discussion A functional melanocortin-1-receptor (E) is fundamental for eumelanin expression. Gain-of-function mutations MC1R (ED) or loss-of-function mutations in the MC1R antagonist ASIP (Aa) are believed to enhance this process, resulting in black coat color phenotypes. From our panel of 120 horses, only 24 from nine different breeds were considered to be of a solid black phenotype (Table 1). Depending on the breed and according to studbook information, the parents of those 24 black horses were carriers of all basic color types (black, bay, chestnut). The typing of the 24 solid blacks subsequently revealed that all were homozygous for the 11-bp deletion in agouti exon 2 (ADEx2). Apart from one chestnut and two greys (which were born black), none of the remaining typed 96 non-black horses was found to be homozygous for ADEx2. Thus, horse black coat color clearly follows a recessive mode of inheritance in all horses tested in the present study. In addition, information taken from a small horse family helped to confirm the epistatic relationship among grey, chestnut, bay, and black, such that bay and black are not expressed in the


453

Table 2. Distribution of genotypes of intraexonic mutations in the MC1R, ASIP, and TYRP1 loci, among different horse coat colors. Parentheses indicate horses with more than one known color phenotype (e.g., black turned grey). BAC clones were found E/-; A/- and C/- for the above listed mutations.

Genotype

Bay

MC1R E/E E/Ee Ee/Ee Total

7 35 (1) – 42 (1)

ASIP A/A A/Aa Aa/Aa Total

33 9 (1) – 42 (1)

TYRP1 (Ex2) C/C C/T T/T Total

36 (1) 6 – 42 (1)

Dark Bay 9 7 – 16

9 7 – 16

16 – 16

Black

Black & Tan

Chestnut

Dark Chestnut

Buckskin

Dun

Grey

Roan

White

Total

14 10 (2) – 24 (2)

7 – – 7

– – 16 (4) 16 (4)

– – 9 9

– 1 – 1

3 – – 3

1 3 3 7

– – 1 1

– 1 – 1

41 54 25 120

– – 24 (2) 24 (2)

1 6 – 7

8 (2) 7 (2) 1 16 (4)

7 2 – 9

– 1 – 1

2 1 – 3

3 2 2 7

– 1 – 1

– 1 – 1

61 34 25 120

22 (2) 2 – 24 (2)

7 – – 7

13 (4) 3 – 16 (4)

7 2 – 9

1 – – 1

3 – – 3

7 – – 7

1 – – 1

– 1 – 1

106 14 – 120

Table 3. List of primers used in this study. Fragment length is given only for final test products; all other fragment sizes depend on particular primer combinations. Annealing temperature was set for all primer pairs between 58° and 60°C, and extension times were usually at 30s for all fragments below 1 kbp; others according to the Taq-polymerase manufacturer’s instructions.

Primer name MC1R: M5p-F1 M5p-F5 M5p-R1 TestMe-F TestMe-R M3p-R1 TestSNPMe-F ASIP: AE1-F1 AE1-F2 AE1-R AE2-F1 AE2-R TestADEx2-F TestADEx2-R AE3-F1 AE3-R1 AE3-R2 TestSNPAln1-R TestSNPADEx2-R TestSNPAln2-F TestSNPAU3-R TYRP1: TEx2F1 TEx2R1 Tln2F1 Tln2R1 Tln2F2 Tln2R2 TestSNPTEx2-F TestSNPTln2-F

Sequence (5⬘–3⬘) GTTCCTGGAGGAGGATTAGAAG ATGAGCTGAGTGGGACGCCTG CATCAGGAATGGACACTTCCAG CCTGGAAGTGTCCATTCCTGATG GTAGTAAGCGATGAAGAGGGTGC CTGATGTCACCACCTCCCTGTGC CTTCATCTGCTGCCTGGCCGTGT CTAGGGTCTTCTAGGGCCACTGAC CCCTTGCCCACCTGCCTGACTG GAGCAAGGAGCTCTGGCCTATG GTCAGCAGCCAGGCTAATGAGAAC CAGCAAACATCAGCTCCCTGAG CTTTTGTCTCTCTTTGAAGCATTG GAGAAGTCCAAGGCCTACCTTG CATAGTCCAAAGAGCTCCCAGG AGTACTAGGCAGTCACGCCCGCTA GATACAGCGCGTGCGCAGTCCG TGAGGCCCCAGGCCAGGCTACT GAAGATCTCTTCTTCTTTTCTGCT CTGGCCTGGAGCCCTGAACCAGA TGCGAAGGGCCCTCAGGGTCTC GCTGCAAACCAGAGCCTTGTCC GCTTTGAGTCTCTTGCAGGACTG TTCTCAGGGCACAACTGTGGG CCCAAGGAAGGTCTTCTTGACTG TGCTGACTCACGAAGACACTTC CTTACTGTGGATTCTATGATCCTG GAATCCTCTGTCTGGGCCTGGGA CTTAACCACTATGTTTACCACAT

|

Fragment length (bp)

Relative position on sequence

445

>–22bp 597–617 759–780 758–780 1180–1202 1644–1666 888–900

|

102

|

476

|

469

presence of chestnut and that grey is always expressed. We typed a grey Camargue stallion (born bay—EE/Ee − A/Aa) and a grey Camargue mare (born chestnut—Ee/Ee − A/Aa). The two had a male foal, all black at birth. The foal was found heterozygous at the MC1R locus (EE/Ee) and homozygous at the ASIP locus (Aa/ Aa). A full-sister of this black-born foal was chestnut born (Ee/Ee) and did not carry the Aa-allele at the agouti locus (A/A). Within 2 years time the foals turned grey like their parents. Loss of the antagonistic agouti protein function inducing an increased eumelanin synthesis (similar to what was shown by Bultman et al. 1992 for the mouse, or by Vage et al. 1997 for the Standard Silver fox) would be a possible explanation of the role of

360–384 632–653 946–967 1930–1953 2385–2406 2125–2148 2205–2226 4425–4446 4764–4787 4970–4991 846–867 2181–2204 2351–2373 4735–4756 −12bp 442–464 344–364 1752–1774 832–853 1277–1300 166–188 1165–1187

the ADEx2 mutation. The data strongly suggest that ADEx2 is the causal horse recessive black allele (Aa). In the absence of a functional proof of the ADEx2 mutation (e.g., cDNA synthesis, Northern Hybridization), we tried to determine the equine gene structure of ASIP in the 4994-bp genomic fragment with three different “exon-trapping” softwares (www.infobiogen.fr; www.genethon.fr). Intron-exon junctions were easily recognized for putative exons 1 and 2 of both the regular and the mutated genomic ASIP sequence (4994 bp/4983 bp). Putative exon 3 was only recognized correctly in its “regular and mutated (extended) form” by “Genie Predictions”. In addition, the total regular coding sequence derived from the 4994-bp genomic equine ASIP

454

fragment shares a nucleic acid similarity of 88.6%, 86%, 83.1%, and 87.1% and an amino acid similarity of 84.2%, 80.3%, 79.4% and 84% with bovine, human, mouse, and fox agouti sequences, respectively (X99691, X99692, U12770, U12774, U12775, L06451, L06941, Y09877). These data show that the equine ASIP gene structure is most probably the same as those of other mammalian species. More extended sequence information, especially of the ASIP 5⬘- and 3⬘-UTRs, compared within characteristic horse color phenotypes, might reveal additional mutations not detected in this study so far (e.g., wild-type, black and tan). It was quite surprising not to find any equine MC1R polymorphism, even in parts of its 5⬘- and 3⬘-UTRs. In contrast to what has been observed in other mammalian species, we have thus far been unable to detect a gain-of-function receptor mutation in the horse MC1R (ED). Hence, additional MC1R sequence information might help to answer the question whether such a horse dominant black allele exists. Therefore, further studies should include horses with a well-documented dominant black coat color inheritance. The recently reported MC1R-allele “ea” (Wagner and Reissmann, 2000) was not observed in our panel. We could not find any association between the agouti Aa-allele status (A/Aa versus A/A) and “dark” shaded horses (Table 2). From the 120 horses typed, 34 were heterozygote carriers of the Aaallele. From those, 9 were considered normal bay and 7 dark bay, as well as 7 normal chestnut and 2 dark chestnut. One normal chestnut was found homozygous for the Aa-allele. A loss-offunction MC1R mutation is expected to be epistatic to a loss-offunction ASIP allele. Thus, the Aa/Aa homozygous chestnut horse appears to be the same as the original recessive yellow (extension) mutation of mouse MC1R, which arose on a C57BL6 nonagouti background (Robbins et al. 1993). A statistically significant tendency (⌾2⳱9.1; p < 0.01) of lighter bay shades carrying the EE/Ee genotype (35 of 42 bay horses) and darker bay shades carrying the EE/EE genotype (9 of 16 dark bay horses) was found in our panel. Thus, lighter bay shades would be at least partially explained by a dosage effect of an average 50% less working melanocortin-1-receptor function due to the Ee-allele (Table 2). However, this result might be biased by the structure of our horse panel and presently unknown genetic variation. It is known that TYRP1 acts only on the eumelanic pathway. An association between TYRP1 alleles and the reported chocolate (“dark chestnut, liver chestnut, silver, seal brown”) coat color family would, therefore, be restricted to a non-chestnut background of the individual horse. Yet, all horses studied with a putative chocolate phenotype were of chestnut background (i.e., Ee/Ee homozygous, Table 2). Therefore, a gene different from TYRP1 must be involved in the chocolate phenotypes in addition to MC1R. To conclude, this study makes a general contribution to coat color genetics and supports the aim to define equine coat colors on a molecular level. The study demonstrates that, although major coat color genes seem to remain conserved in different species, mutations in such genes associated with particular coat colors might be quite diverse. Moreover, particular coat colors, even if phenotypically similar in various species, might have completely different genetic sources. Acknowledgments. The authors thank the numerous private horse owners, breeders, Haras Nationaux, and associations for providing blood and hair samples of their horses for this study. We also appreciate the contributions of J.C. Me´riaux (GIE LABOGENA, Jouy) for some of the DNA samples; D. Vaiman (LGBC, INRA Jouy) for scientific discussions and an introduction into haplotype analysis; L. Schibler (LGBC, INRA Jouy) for technical advice; and R. Julien (Unite´ associeé INRA, Universite´ de Limoges) for providing unpublished bovine sequence data. This study was supported by a grant from the Haras Nationaux. S. Rieder benefited from a one-year postdoctoral position from INRA, De´partement de Geńe´tique animale.


References Adalsteinsson S, Thorkelsson F (1991) Islenski hesturinn, Litaafbrigdi (The Icelandic Horse and its Colours). Fe´lagsbokbandid-Bokfell hf; Islandsmyndir hf. Barsh GS (1996) The genetics of pigmentation: from fancy genes to complex traits. Trends Genet 12, 299–305 Bultman SJ, Michaud EJ, Woychik RP (1992) Molecular characterization of the mouse agouti locus. Cell 71, 1195–1204 Caetano AR, Shiue YL, Lyons LA, O’Brien SJ, Laughlin TF et al. (1999) A comparative gene map of the horse (Equus caballus). Genome Res 9, 1239–1249 Devereux J, Haeberli P, Smithies O (1984) A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res 1, 387–395 Dreux Ph (1966) Contribution a` l’e´tude du ge`ne E chez le cheval domestique. Extrait Ann Geńe´t 9, 168–170 Eberle AN (1988) The Melanotropins. (Basel, Switzerland: Verlag Karger) Evans WJ, Borton A, Hintz H, Van Vleck LD (1990) The Horse, 2nd ed. (New York, NY, USA: W.H. Freeman and Co.) Godard S, Schibler L, Oustry A, Cribiu EP, Gue´rin G (1998) Construction of a horse BAC library and cytogenetical assignment of 20 type I and type II markers. Mamm Genome 9, 633–637 Godard S, Vaiman A, Schibler L, Mariat D, Vaiman D et al. (2000) Cytogenetic localization of 44 new type I sequences in the horse. Mamm Genome 11, 1093–1097 Hayes H (1995) Chromosome painting with human chromosome-specific DNA libraries reveals the extent and distribution of conserved segments in bovine chromosomes. Cytogenet Cell Genet 71, 168–174 Jackson IJ (1994) Molecular and developmental genetics of mouse coat color. Annu Rev Genet 28, 189–217 Jackson IJ, Budd P, Horn JM, Johnson R, Raymond S, Steel K (1994) Genetics and molecular biology of mouse pigmentation. Pigment Cell Res 7, 73–80 Javerzat S, Jackson IJ (1998) White-based brown (Tyrp1B-w) is a dominant mutation causing reduced hair pigmentation owing to a chromosomal inversion. Mamm Genome 9, 469–471 Joerg H, Fries HR, Meijerink E, Stranzinger GF (1996) Red coat color in Holstein cattle is associated with a deletion in the MSHR gene. Mamm Genome 7, 317–318 Johnson R, Jackson IJ (1992) Light is a dominant mouse mutation resulting in premature cell death. Nat Genet 1, 226–229 Kijas JMH, Wales R, To¨rnsten A, Chardon P, Moller M, Anderson L (1998) Melanocortin receptor 1 (MC1R) mutations and coat color in pigs. Genetics 150, 1177–1185 Klungland H, Vage DI, Gomez-Raya L, Adalsteinsson S, Lien S (1995) The role of melanocyte-stimulating hormone (MSH) receptor in bovine coat color determination. Mamm Genome 6, 636–639 Kwon BS (1993) Pigmentation genes: the tyrosinase gene family and the pmel 17 gene family. T J Investig Dermatol 100, 134S–140S Lee ZH, Hou L, Moellmann G, Kuklinska E, Antol K et al. (1996) Characterization and subcellular localization of human Pmel 17/silver, a 100kDa (Pre)melanosomal membrane protein associated with 5,6,dihydroxyindole-2-carboxylic acid (DHICA) converting activity. T J Investig Dermatol 106, 605–610 Lu D, Willard D, Patel IR, Kadwell S, Overton L et al. (1994) Agouti protein is an antagonist of the melanocyte-stimulating-hormone receptor. Nature 371, 799–802 Marklund S, Moller MJ, Sandberg K, Andersson L (1996) A missense mutation in the gene for melanocyte-stimulating hormone receptor (MC1R) is associated with the chestnut coat color in horses. Mamm Genome 7, 895–899 Marklund S, Moller M, Sandberg K, Anderson L (1999) Close association between sequence polymorphism in the KIT gene and the roan coat color in horses. Mamm Genome 10, 283–288 Moller MJ, Chaudhary R, Hellmeń E, Hoÿheim B, Chowdhary B, Anderson L (1996) Pigs with the dominant white coat color phenotype carry a duplication of the KIT gene encoding the mast/stem cell growth factor receptor. Mamm Genome 7, 822–830 Newton JM, Wilkie AL, He L, Jordan SA, Metallinos DL et al. (2000) Melanocortin 1 receptor variation in the domestic dog. Mamm Genome 11, 24–30 Rana BK, Hewett-Emmett D, Jin L, Chang BHJ, Sambuughin N et al. (1999) High polymorphism at the human melanocortin 1 receptor locus. Genetics 151, 1547–1557 Raudsepp T, Fro¨nicke L, Scherthan H, Gustavsson I, Chowdhary BP

S. Rieder et al.: MC1R, ASIP, TYRP1 loci and horse coat color phenotypes (1996) Zoo-FISH delineates conserved chromosomal segments in horse and man. Chromosome Res 4, 1–8 Rieder S, Stricker Ch, Joerg H, Dummer R, Stranzinger G (2000) A comparative genetic approach for the investigation of aging grey horse melanoma. J Anim Breed Genet 117, 73–82 Robbins LS, Nadeau JH, Johnson KR, Kelly MA, Roselli-Rehfuss L et al. (1993) Pigmentation phenotypes of variant extension locus alleles result from point mutations that alter MSH receptor function. Cell 72, 827–834 Rudolph JA, Spie SJ, Byrns G, Rojas CV, Bernoco D, Hoffman EP (1992) Periodic paralysis in Quarter Horses: a sodium channel mutation disseminated by selective breeding. Nat Genet 2, 144–147 Santschi EM, Purdy AK, Valberg SJ, Vrotsos PD, Kaese H, Mickelson JR (1998) Endothelin receptor B polymorphism associated with lethal white foal syndrome in horses. Mamm Genome 9, 306–309 Schibler L, Cribiu EP, Oustry-Vaiman A, Furet JP, Vaiman D (2000) Fine mapping suggests that the goat polled intersex syndrome and the human blepharophimosis ptosis epicanthus syndrome map to a 100-kb homologous region. Genome Res 10, 311–318 Searle AG (1968) Comparative Genetics of Coat Colour in Mammals. (London: Logos Press) Siracusa LD (1994) The agouti gene: turned on to yellow. Trends Genet 10, 423–428

455 Sponenberg DP (1996) Equine color genetics. (Ames, Iowa USA: Iowa State University Press) Sponenberg DP, Weise MC (1997) Dominant black in horses. Genet Sel Evol 29, 403–408 Sturm RA, O’Sullivan BJ, Box NF, Smith AG, Smit SE et al. (1995) Chromosomal structure of the human TYRP1 and TYRP2 loci and comparison of the tyrosinase-related protein gene family. Genomics 29, 24–34 Terwilliger JD (1995) A powerful likelihood method for the analysis of linkage disequilibrium between trait loci and one or more polymorphic marker loci. Am J Hum Genet 56, 777–787 Vage DI, Lu DS, Klungland H, Lien S, Adalsteinson S, Cone RD (1997) A non-epistatic interaction of agouti and extension in the fox, Vulpes vulpes. Nat Genet 15, 311–315 Vage DI, Klungland H, Lu D, Cone RD (1999) Molecular and pharmacological characterization of dominant black coat color in sheep. Mamm Genome 10, 39–43 Wagner HJ, Reissmann M (2000) New polymorphism detected in the horse MC1R gene. Anim Genet 31, 289–290 Wagoner DM (1978) Equine Genetics and Selection Procedures. (Tyler, USA: Equine Research Incorporation) Zdarsky E, Favor J, Jackson IJ (1990) The molecular basis of brown, an old mouse mutation, and of a revertant to wild-type. Genetics 126, 443–449