Mutations in the transcriptional activator EYA4 ... - Oxford Academic

© 2001 Oxford University Press

Human Molecular Genetics, 2001, Vol. 10, No. 3

195–200

Mutations in the transcriptional activator EYA4 cause late-onset deafness at the DFNA10 locus Sigrid Wayne1, Nahid G. Robertson2, Frank DeClau3, Nancy Chen4, Kristien Verhoeven3, Sai Prasad1, Lisbeth Tranebjärg5, Cynthia C. Morton2, Allen F. Ryan4, Guy Van Camp3 and Richard J.H. Smith1,+ 1Molecular

Otolaryngology Research Laboratories, Department of Otolaryngology—Head and Neck Surgery, University of Iowa, 200 Hawkins Drive, Iowa City, IA 52242, USA, 2Departments of Pathology and Obstetrics, Gynecology, and Reproductive Biology, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115, USA, 3Department of Medical Genetics, University of Antwerp, Antwerp, Belgium, 4Departments of Surgery/Otolaryngology and Neurosciences and VA Medical Center, La Jolla, CA 92093, USA and 5Department of Medical Genetics, University Hospital, N-9038 Tromsö, Norway Received 2 October 2000; Revised and Accepted 5 December 2000

We identified Eyes absent 4 (EYA4), a member of the vertebrate Eya family of transcriptional activators, as the causative gene of postlingual, progressive, autosomal dominant hearing loss at the DFNA10 locus. In two unrelated families from Belgium and the USA segregating for deafness at this locus, we found different mutations in EYA4, both of which create premature stop codons. Although EYA proteins interact with members of the SIX and DACH protein families in a conserved network that regulates early embryonic development, this finding shows that EYA4 is also important post-developmentally for continued function of the mature organ of Corti.

positional cloning and candidate gene strategy, we have identified the gene that underlies sensorineural hearing loss associated with DFNA10, bringing to 12 the number of autosomal dominant deafness genes that have been cloned. The protein products of these genes are diverse in function and include ion channels (GJB2, -3 and -6 and KCNQ4), cytoskeletal elements (MYO7A), components of the extracellular matrix (COL11A2 and TECTA) and a transcription factor (POU4F3) (2). The DFNA10 gene, EYA4, encodes a transcriptional activator that interacts with members of other protein families to regulate early developmental events. RESULTS Mapping the critical DFNA10 interval

INTRODUCTION Hearing loss is the most common sensory deficit in humans. It affects 1 in 1000 newborns and increases in prevalence with age to such a degree that by the 9th decade of life ∼50% of individuals have a hearing loss of at least 25 dB (1). The type of hearing loss that affects a given person can be described in a number of ways. Etiologically, the loss can be acquired or inherited and, by audiometric testing, classified as sensorineural, conductive or mixed and quantitated as mild, moderate, severe or profound. The phenotype can be further defined by age at onset as prelingual (congenital) or postlingual and by the presence or absence of co-inherited physical abnormalities as syndromic or non-syndromic. Recent years have seen tremendous progress in localizing and cloning genes associated with inherited hearing loss. To date, 68 loci for non-syndromic hearing loss have been discovered: 30 dominant, 28 recessive, 5 X-linked and 5 mitochondrial (2). (Loci for non-syndromic hearing loss are denoted ‘DFNA’ for autosomal dominant, ‘DFNB’ for autosomal recessive and ‘DFN’ for X-linked, followed by an appended integer to indicate order of discovery.) Using a combined +To

Previously, we reported results of linkage analysis in a large American family with late-onset progressive autosomal dominant non-syndromic sensorineural hearing loss, assigning the DFNA10 locus to a 15 cM interval on chromosome 6q22–23 delimited by markers D6S474 and D6S270 (3). By including distant branches of the family, we refined the DFNA10 region to 2.8 cM flanked by D6S472 and D6S975, although haplotype inconsistencies in two persons prompted us to re-examine our data and omit these individuals from the pedigree and our analysis, thereby increasing the size of the DFNA10 interval to a 6 cM region flanked by D6S413 and D6S292 (4). All persons coded as affected share a similar audiometric profile that can be described as postlingual, initially progressive and resulting, without the influence of presbyacusis, in stable, flat sensorineural deafness (5). Mutations in EYA4 identified in DFNA10-affected patients We identified several known genes in the DFNA10 interval, including an excellent positional candidate, the most recently identified member of the vertebrate Eya gene family, Eyes absent 4 (EYA4). Mutations in another member of this family,

whom correspondence should be addressed. Tel: +1 319 356 3612; Fax: +1 319 356 4547; Email: [email protected]

196


Figure 1. SSCP result of EYA4 exon 12 for the American DFNA10 family. Each lane on the gel is the SSCP result of the individual in the pedigree directly above. A dramatic shift segregates with the hearing loss (far right, a normalhearing unrelated control; closed square, affected male; open square, unaffected male; closed circle, affected female; open circle, unaffected female; /, deceased).

stop codon in exon 14. We next screened a Belgian family segregating for deafness at the DFNA10 locus and identified a cytosine→thymine transition in exon 20 at position 2200 (2200C→T) in all affected persons. This base change converts an arginine codon (CGA) to a stop codon (TGA) (Fig. 2B). Apart from these mutations, we could identify no other nucleotide changes segregating with hearing loss in the EYA4 coding sequence. However, we did find a single nucleotide polymorphism (SNP) in exon 11. The published EYA4 cDNA sequence places an adenine at position 1270 in exon 11, but some persons in both families were heterozygous for an adenine and a guanine at this position. The latter converts a serine codon (AGC) to a glycine codon (GGC), and creates an HaeIII restriction site. Restriction analysis of multiple affected and unaffected members from both families revealed the presence of A/G heterozygotes, and A/A and G/G homozygotes, each segregating independently of the hearing loss (data not shown). EYA4 splice variants in the cochlea

Figure 2. Sequencing results for EYA4. (A) In family A, a portion of the electropherogram for EYA4 exon 12 sequenced from subcloned PCR products demonstrates the insertion of two adenine residues (arrows) in one allele of the affected individual; wild-type sequence is seen in the other allele (compare with unaffected alleles). (B) In family B, a portion of the electropherogram for EYA4 exon 20 shows a cytosine→thymine transition (arrow), resulting in a premature stop codon (TGA).

EYA1, are associated with syndromic hearing loss (6,7). We screened the American family for mutations in the coding region of EYA4 by single-strand conformation polymorphism (SSCP) analysis of its 21 exons and found a striking band shift in exon 12 that segregated with the hearing loss (Fig. 1). Direct sequencing of exon 12 produced an electropherogram featuring the superimposition of two sequences, suggesting a frameshift mutation. By sequencing subclones of exon 12 PCR products from affected and unaffected family members, we were able to characterize the mutation as the insertion of two adenine residues at position 1468 (1468insAA) (Fig. 2A). This mutation is predicted to generate a frameshift and premature

Alternative splicing of EYA4 mRNA has been reported for exons 5, 16 and 20 and results in several isoforms (8). Exon 5 may be spliced in or out; the first 68 bp of exon 16 may be spliced out by use of a cryptic splice acceptor site within the exon that results in a predicted truncated protein of 452 amino acids; and exon 20 may be substituted for exon 19, equal in length and with 69.3% nucleic acid identity and 66.7% amino acid identity. To determine which splice variants are expressed in the cochlea, we performed RT–PCR and sequencing on human fetal cochlear RNA, using primers flanking exons 5, 16 and 19/20. We also screened human fetal and adult brain cDNA libraries. We detected neither the exon 5-containing isoform of EYA4 nor the shorter form of exon 16 but could amplify both exon 19- and exon 20-containing splice variants in human fetal cochlear cDNA (data not shown). Both of the latter two isoforms also were present in human brain cDNA libraries, although we found only the exon 19-containing variant in fetal brain. Adult brain had minimally detectable exon 19containing EYA4 transcripts and abundant expression of the exon 20-containing variant. Adult rat cochlea had only the exon 20-containing variant. Eya4 inner ear expression By in situ hybridization, strong Eya4 mRNA expression was observed in the neuroepithelia of the developing rat inner ear (Fig. 3). At embryonic day 14.5 (E14.5) and E16.5, moderate expression was present primarily in the upper epithelium of the cochlear duct, a region that gives rise to Reissner’s membrane and the stria vascularis. Low-level expression was observed in the mesenchyme surrounding the duct. The highest levels of expression were seen at E18.5 and were found in areas of the cochlear duct destined to become the spiral limbus, organ of Corti and spiral prominence, especially its more rapidly maturing basal turn. These areas continued to express Eya4 as total expression decreased. Strong expression was also observed in the developing cochlear capsule during the period of ossification, from shortly after birth until postnatal day 14 (P14). In the developing vestibular system, expression was


197

Figure 3. In situ hybridization for Eya4 mRNA in the developing rat cochlea. Expression is greatest in the epithelium of the cochlear duct (CD). At E14.5 and E16.5, this expression is greatest in the upper half of the duct, cells destined to form the stria vascularis and Reissner’s membrane. Concurrently, weak expression is observed in the mesenchyme adjacent to the cochlear duct. Cochlear expression of Eya4 mRNA peaks at E18.5 and is found preferentially in the lower half of the duct epithelium, in the greater (arrows) and lesser (arrowheads) epithelial ridges, especially in the basal turn. At older ages, expression becomes restricted to cells derived from the spiral limbus (SL), organ of Corti (oC) and spiral prominence. For the first 2 weeks after birth, strong expression also is observed in cells of the developing bony cochlear capsule, as illustrated at P12.

observed primarily in the developing sensory epithelia (data not shown). DISCUSSION EYA4 is the most recently identified member of the vertebrate Eya gene family, a group of four transcriptional activators that interact with other proteins in a conserved regulatory hierarchy to ensure normal embryologic development. We identified mutations in EYA4 in two families with DFNA10, a form of autosomal dominant, postlingual, progressive, sensorineural hearing loss, making EYA4 the second gene in this family to be associated with human disease. Mutations in the first vertebrate Eya gene to be discovered, EYA1, underlie both branchio-oto (BO) and branchio-oto-renal (BOR) syndromes, autosomal dominant forms of syndromic deafness characterized by sensorineural, conductive or mixed hearing loss, in addition to branchial and otic abnormalities and also, in the case of BOR syndrome, renal anomalies (9). The structure of EYA4, as deduced from its cDNA sequence, conforms to the basic pattern established by EYA1–3, and includes a highly conserved 271 amino acid C-terminus called the eya-homologous region (eyaHR; alternatively referred to as the eya domain or eya homology domain 1) and a more divergent proline–serine–threonine (PST)-rich (34–41%) transactivation domain at the N-terminus (8,10) (Fig. 4A). Studies of Drosophila eya indicate that the eyaHR mediates interaction with the gene products of sine oculis (so) and

Figure 4. EYA-encoded protein and cDNA structure. (A) The general structure of EYA proteins; (B) a diagram of EYA4 cDNA showing the positions (triangles) of the two mutations identified in DFNA10 families; and (C) a diagram of EYA1 cDNA showing the positions of mutations associated with BOR syndrome. N, N-terminus; C, C-terminus; eyaHR, eya-homologous region. EYA1 and EYA4 share 31.8% amino acid identity.

dachshund (dac), and that expression of both eya and so is initiated by eyeless (ey) (11,12). In vertebrates, members of the Six gene family (the orthologs of so) bind to Eya proteins to

198


induce nuclear translocation of the resultant protein complex (13). N-terminal transcriptional activation has been demonstrated for the Drosophila eya and murine Eya1–3 gene products, suggesting that EYA interactions and pathways are conserved across species (10–18). Eya genes are expressed in a wide range of tissues early in embryogenesis, and although each Eya gene has a unique expression pattern, there is extensive overlap. For example, murine studies have shown that Eya1, -2 and -4 are all expressed in the presomitic mesoderm and head mesenchyme, but only Eya1 and -4 are expressed in the otic vesicle (13). Eya3 expression is restricted to craniofacial and branchial arch mesenchyme, in regions underlying or surrounding the Eya1-, -2- or -4-expressing cranial placodes (13,16). The mutations that we identified in EYA4 are predicted to affect the eyaHR. The 1468insAA mutation in the American family causes a frameshift and subsequent novel stop codon in exon 14. Since the eyaHR of EYA4 is encoded by the 3′-most 6 bp of exon 12 through the 5′-most 78 bp of exon 21, this mutation effectively eliminates the entire eyaHR. The 2200C→T mutation in the Belgian family creates a premature stop codon, eliminating 52 amino acids from the C-terminal end of the eyaHR (Fig. 4B). Given the importance of the eyaHR to EYA protein function, it is not surprising that these mutations have a phenotypic correlate. Nor is the association of late-onset hearing loss with developmentally important transcriptional activators unprecedented, as mutations in POU4F3 are known to cause postlingual hearing loss at the DFNA15 locus (15). What is surprising, however, is the limited DFNA10 phenotype, especially when one considers the clinical impact of EYA1 mutations. Like the DFNA10-causing EYA4 mutations, the BOR syndrome-causing mutations in EYA1 nearly all cluster in the eyaHR (Fig. 4C), but the BOR syndrome phenotype is characterized by widespread disruption of normal embryogenesis. BOR patients have numerous congenital anomalies, including branchial fistulae or cysts, preauricular pits or tags, malformed or small auricles, external auditory canal atresia or stenosis, ossicular hypoplasia, malformed middle ear spaces, underdeveloped or absent cochleae, abnormal semicircular canals, and renal hypoplasia, dysplasia or aplasia. In contrast, no congenital anomalies, not even hearing loss, are part of the DFNA10 phenotype. Cardiac expression of EYA4 does make it an excellent candidate gene for the form of syndromic lateonset sensorineural hearing loss that maps to the DFNA10 interval and is associated with progressive dilated cardiomyopathy (8,19), but in the families that we reported there were no cardiac problems. In situ hybridization studies in developing rodent inner ears revealed a spatial variability in Eya4 expression not seen with Eya1 expression. Both Eya1 and -4 are expressed early in the otic vesicle (8,20). However, after differentiation of the otic vesicle into auditory and vestibular components, Eya4 is concentrated in the upper cochlear duct within cells which develop into the stria vascularis and Reissner’s membrane, whereas Eya1 is expressed in the floor of the cochlear duct, an area that gives rise to the organ of Corti. Throughout development of the inner ear, Eya1 expression is maintained in derivatives of the neuroepithelium of the cochlear duct floor; Eya4 expression shifts only from the upper cochlear duct to the neuroepithelium of the cochlear duct floor at stage E18.5.

These data suggest an apparent disjunct between the early expression of Eya4 and the late-onset hearing loss characteristic of DFNA10; however, it is not unusual for genes to play different roles at different times in development. Eya4 is present in the adult rodent inner ear, where we documented expression of the exon 20-containing splice variant. Based on our in situ data and the DFNA10 phenotype, we speculate that Eya4 plays a developmental role in embryogenesis and a survival role in the mature system. Although we did not characterize the neuroepithelial cell types that express Eya4, since there is apparent overlap in expression of Eya1 and Eya4 in embryogenesis, some functions of Eya4 may become redundant to Eya1 during development. Creating and studying a mouse with a targeted mutation of Eya4 would resolve many of these issues. MATERIALS AND METHODS Patients The American family was ascertained through the Department of Otolaryngology—Head and Neck Surgery at the University of Iowa, and the Belgian family through the Medical Genetics Department at the University of Antwerp. Family histories were obtained by questionnaire and personal interviews. Information on deceased family members was obtained from relatives. Otologic examination and audiograms were performed or reviewed for most family members. Individuals were considered affected if they had bilateral sensorineural hearing loss in the middle and high frequencies below the 95th percentile of an age- and sex-dependent control curve of the general population. Normal-hearing individuals >50 years of age in the American family and >40 years in the Belgian family were coded as unaffected if hearing thresholds at most frequencies were better than 20 dB hearing level or above the 50th percentile (5). Genotyping Genomic DNA was extracted from peripheral blood lymphocytes by standard techniques. Polymorphic microsatellite markers selected from the Généthon map were amplified from genomic DNA using standard PCR protocols (3), and PCR products were resolved on polyacrylamide gels. Mutation detection SSCP. EYA4 exons 1–20 were amplified from genomic DNA from family members and a normal-hearing, unrelated control using primers located in the flanking introns as previously described, with minor modifications (8) (Table 1). The 5′ coding end of exon 21 was amplified using 5′ intronic and 3′ intra-exonic primers (8). PCR products were resolved on polyacrylamide gels. Sequencing. Exons were amplified from genomic DNA from an affected member of each of the two families and a normalhearing, unrelated control. PCR products were gel purified and sequenced in both directions using the ABI 373A Dye terminator cycle sequencing system (Perkin Elmer) with the primers used for PCR. Sequences were compared with the published


Table 1. EYA4 screening primers (5′→3′) Exon

Forward primer

Reverse primer

1 (5′)

cgaggtcaaataaaaacggag

aacaaatagcgtacacaagcg

1 (3′)

agtccggagttttggctc

gggttctctcaactcaggc

2

gtatgattttcagtagtgttatcgc

cttgagagaatgctcctacaag

3

tgaacctgagtgaagaagttg

cttactagtgctccgaaactg

4

gctgcaatttcaacttttc

tgattctgggtatcttcagg

5

catagcaacagacagcaatc

tgcaagcattgaagattattc

6

actcacatgtacttattcttctacg

tacgtaaggacacacgagc

7

atccaagtattatccaaccatc

tgtatttatgaagcaacctttg

8

ttgttgccacagtaatgc

cctgcctataaccaaagaag

9

gaattagttctcccaaaacatg

caacttagaaggaaaatcatcttac

10

atatatggcaacctgagagtactc

tttcaaagtgtttctctcacag

11

tgactggtttaatgggagag

tataaaagtatttcacctgggtg

12

atcacactacaatctttaagaatgag

gaagtgctattcttgacctaagtc

13

gatttcttggagtaacatttcttg

tctaggaagggagacattttc

14

ctgaaattttacctcattatgtgtac

tctggtgttggatacaactattc

15

cttcaagcatggtaacaagc

gtgcaaaactccacagcc

16

tggagttttgcacatgtaat

ctatacccagagtacctttgttag

17

caatattcatctctcgactctg

tcaatacgatacacatagaaagg

18

tagaaggttatttagtattagaaaac

tggacacattccatacag

19

gttaatgaatgcagtggc

gttcaaagcaactttcttttc

20

cactctgaactttatctcatttatc

gcattagaagtatcacaccg

21

agatctccggctaaagaac

ttccttccctctctctcc

199

products were gel purified and directly sequenced using the ABI PRISM Dye terminator cycle sequencing system (Perkin Elmer) with the primers used for PCR or with nested primers. In situ hybridization In situ hybridization was performed according to the modified protocol of Simmons et al. (22) and Luo et al. (23). [35S]UTPlabeled sense and antisense probes were synthesized from linearized PCRII vector (Invitrogen) containing an insert of bases 448–978 of mouse Eya4 cDNA which had been PCR amplified from a mouse skeletal muscle cDNA library. Tissue was prepared from Sprague–Dawley rats and CBA mice at E12, E14, E16, E18, E20, P0, P2, P4, P6, P8, P10, P14, P17, P21 and >P21. Embryos were removed from the uteri of anesthetized rats and the entire embryo (E12–E14) or head (E16–E20) was fixed in 4% paraformaldehyde. For postnatal stages, cochleae were dissected from rats and mice that had been anesthetized then perfused with saline followed by 4% paraformaldehyde. Decalcification in 8% EDTA with 4% paraformaldehyde was performed on stages >P6. Frozen sections 20 µm thick were cut, mounted on slides, and air and vacuum dried. Tissue sections were permeablized with proteinase K before being hybridized to the probe at 56°C overnight. Non-specific probe binding was minimized by treatment with ribonuclease A and serial high-stringency washes. Slides were coated with Kodak NTB-2 liquid audioradiograph emulsion, incubated at 4°C for 4 weeks, developed in Kodak D-19 and fixed in Kodak fixer. Counterstaining was accomplished with bisbenzimide. Signal distribution was documented by fluorescence photomicrography. ACKNOWLEDGEMENTS

sequence for EYA4 cDNA (8). Exons in which mutations were detected (exons 12 and 20) were sequenced in an additional one or two affected family members. In the case of exon 12, PCR products from individual family members were subcloned using the TOPO XL cloning kit (Invitrogen), and clones from each individual were sequenced in both directions using M13 forward and reverse primers. SNP genotyping. The SNP was detected in exon 11 as a double peak for A and G in the electropherogram of individuals during mutation screening. A guanine residue in this position creates an HaeIII restriction site (GGCC) that is non-existent with an adenine in this position. PCR amplified exon 11 from several affected and unaffected members of both families were digested with HaeIII and run on agarose gels. Splice variant analysis Total cellular RNAs were extracted (21) from cochleae (membranous labyrinths) obtained from second trimester human fetuses, in accordance with guidelines established by the Human Research Committee at the Brigham and Women’s Hospital. Reverse transcription of RNAs was performed using oligo(dT) primer and Superscript II reverse transcriptase (Gibco BRL) according to the manufacturer’s protocol. PCR was performed using gene-specific EYA4 primers flanking the exons to be analyzed (sequences available on request). PCR

We are grateful to the families who made this research possible. This work was supported in part by NIH Otolaryngology Research Training Grant 5-T32-DC00040 (S.W.) and NIH grants DC03402 (C.C.M.) and DC03544 (R.J.H.S.). REFERENCES 1. Morton, N.E. (1991) Genetic epidemiology of hearing impairment. Ann. N. Y. Acad. Sci., 630, 16–31. 2. Hereditary Hearing Loss Homepage (http://hgins.uia.ac.be/dnalab/hhh/ ). 3. O’Neill, M.E., Marietta, J., Nishimura, D., Wayne, S., Van Camp, G., Van Laer, L., Negrini, C., Wilcox, E.R., Chen, A., Fukushima, K. et al. (1996) A gene for autosomal dominant late-onset progressive non-syndromic hearing loss, DFNA10, maps to chromosome 6. Hum. Mol. Genet., 5, 853–856. 4. Verhoeven, K., Fagerheim, T., Prasad, S., Wayne, S., De Clau, F., Balemans, W., Verstreken, M., Schatteman, I., Solem, B., Van de Heyning, P. et al. (2000) Refined localization and two additional linked families for the DFNA10 locus for nonsyndromic hearing impairment. Hum. Genet., 107, 7–11. 5. De Leenheer, E.M.R., Huygen, P.L.M., Wayne, S., Smith, R.J.H. and Cremers, C.W.R.J. (2001) The DFNA10 phenotype. Ann. Otol. Rhinol. Laryngol., in press. 6. Abdelhak, S., Kalatzis, V., Heilig, R., Compain, S., Samson, D., Vincent, C., Weil, D., Cruaud, C., Sahly, I., Leibovici, M. et al. (1997) A human homologue of the Drosophila eyes absent gene underlies branchio-otorenal (BOR) syndrome and identifies a novel gene family. Nature Genet., 15, 157–164. 7. Abdelhak, S., Kalatzis, V., Heilig, R., Compain, S., Samson, D., Vincent, C., Levi-Acobas, F., Cruaud, C., Le Merrer, M., Mathieu, M. et al. (1997) Clustering of mutations responsible for Branchio-Oto-Renal (BOR) syn-

200

8.

9. 10.

11. 12.

13.

14. 15.


drome in the eyes absent homologous region (eyaHR) of EYA1. Hum. Mol. Genet., 6, 2247–2255. Borsani, G., DeGrandi, A., Ballabio, A., Bulfone, A., Bernard, L., Banfi, S., Gattuso, C., Mariani, M., Dixon, M., Donnai, D. et al. (1999) Eya4, a novel vertebrate gene related to Drosophila eyes absent. Hum. Mol. Genet., 8, 11–23. Vincent, C., Kalatzis, V., Abdelhak, S., Chaib, H., Compain, S., Helias, J., Vaneecloo, F.M. and Petit, C. (1997) BOR and BO syndromes are allelic defects of EYA1. Eur. J. Hum. Genet., 5, 242–246. Xu, P.X., Cheng, J., Epstein, J.A. and Maas, R.L. (1997) Mouse Eya genes are expressed during limb tendon development and encode a transcriptional activation function. Proc. Natl Acad. Sci. USA, 94, 11974–11979. Bonini, N.M., Bui, Q.T., Gray-Board, G.L. and Warrick, J.M. (1997) The Drosophila eyes absent gene directs ectopic eye formation in a pathway conserved between flies and vertebrates. Development, 124, 4819–4826. Bonini, N.M. and Fortini, M.E. (1999) Surviving Drosophila eye development: integrating cell death with differentiation during formation of a neural structure. Bioessays, 21, 991–1003. Ohto, H., Kamada, S., Tago, K., Tominaga, S.I., Ozaki, H., Sato, S. and Kawakami, K. (1999) Cooperation of Six and Eya in activation of their target genes through nuclear translocation of Eya. Mol. Cell Biol., 19, 6815–6824. Xu, P.X., Woo, I., Her, H., Beier, D.R. and Maas, R.L. (1997) Mouse Eya homologues of the Drosophila eyes absent gene require Pax6 for expression in lens and nasal placode. Development, 124, 219–231. Vahava, O., Morell, R., Lynch, E.D., Weiss, S., Kagan, M.E., Ahituv, N., Morrow, J.E., Lee, M.K., Skvorak, A.B., Morton, C.C. et al. (1998) Mutation in transcription factor associated with inherited progressive hearing loss in humans. Science, 279, 1950–1954.

16. Heanue, T.A., Reshef, R., Davis, R.J., Mardon, G., Oliver, G., Tomarev, S., Lassar, A.B. and Tabin, C.J. (1999) Synergistic regulation of vertebrate muscle development by Dach2, Eya2, and Six1, homologs of genes required for Drosophila eye formation. Genes Dev., 13, 3231–3243. 17. Zimmerman, J.E., Bui, Q.T., Steingrimsson, E., Nagle, D.L., Fu, W., Genin, A., Spinner, N.B., Copeland, N.G., Jenkins, N.A., Bucan, M. and Bonini, N.M. (1997) Cloning and characterization of two vertebrate homologs of the Drosophila eyes absent gene. Genome Res., 7, 128–141. 18. Xu, P.X., Adams, J., Peters, H., Brown, M.C., Heaney, S. and Maas, R. (1999) Eya1-deficient mice lack ears and kidneys and show abnormal apoptosis of organ primordia. Nature Genet., 23, 113–117. 19. Schonberger, J., Levy, H., Grunig, E., Sangwatanaroj, S., Fatkin, D., MacRae, C., Stacker, H., Halpin, C., Eavey, R., Philbin, E.F. et al. (2000) Dilated cardiomyopathy and sensorineural hearing loss: a heritable syndrome that maps to 6q23–24. Circulation, 101, 1812–1818. 20. Kalatzis, V., Sahly, I., El-Amraoui, A. and Petit, C. (1998) Eya1 expression in the developing ear and kidney: towards the understanding of the pathogenesis of Branchio-Oto-Renal (BOR) syndrome. Dev. Dynamics, 213, 486–499. 21. Chirgwin, J.R., Przybyla, A.E., MacDonald, R.J. and Rutter, W.J. (1979) Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry, 18, 5294–5299. 22. Simmons, D.M., Arriza, J.L. and Swanson, L.W. (1989) A complete protocol for in situ hybridization of messenger RNA in brain and other tissues with radio-labeled single-stranded RNA probes. J. Histol., 12, 169–181. 23. Luo, L., Bennett, T., Jung, H.H. and Ryan, A.F. (1998) Developmental expression of α9 acetylcholine receptor mRNA in the rat cochlea and vestibular inner ear. J. Comp. Neurol., 393, 320–331.