Mycobacterium cookii sp. nov.

INTERNATIONAL JOURNAL OF SYSTEMATIC BACTERIOLOGY, July 1990, p. 217-223 0020-7713/90/030217-07$02.oo/o Copyright 0 1990, International Union of Microbiological Societies

Vol. 40, No. 3

Mycobacterium cookii sp. nov. J. KAZDA,l* E. STACKEBRANDT,' J. SMIDA,' D. E. MINNIKIN,3 M. DAFFE,4 J. H. PARLETT,3 A N D C. PITULLE' Division of Veterinary Medical Microbiology, Research Institute Borstel, Institute for Experimental Biology and Medicine, Borstel, Federal Republic of Germany'; Institute for Microbiology, Christian-Albrechts- University, Kiel, Federal Republic of Germany2;Department of Organic Chemistry, University of Newcastle upon Tyne, Newcastle, Great Britain3; and Center for Research in Biochemistry and Cell Genetics, Centre National de la Recherche Scientific, Toulouse, France4 Strains of a new type of slowly growing scotochromogenic mycobacterium were isolated repeatedly from sphagnum vegetation and surface water of moors in New Zealand. These strains grew at 31 and 22°C but not at 37°C and possessed catalase, acid phosphatase, and arylsulfatase activities. They did not split amides, and most of them were susceptible to antituberculotic drugs. Furthermore, they did not tolerate 0.1% NaOH, and 0.2% picric acid and did not grow on compounds used as single carbon sources and single nitrogen and carbon sources. The internal similarity of the strains as determined by numerical taxonomy methods was 96.6% & 3.09%. The whole-mycolate pattern is unique in that it has not been found previously in 23 species of slowly growing mycobacteria. Evaluation of long-reverse-transcriptase-generatedstretches of the primary structure of the 16s rRNA confirmed that these organisms belong to the genus Mycobacterium. The phylogenetic position of these bacteria is unique; they are situated between slowly growing pathogenic and rapidly growing saprophytic species. The strains are not pathogenic for mice, guinea pigs, and rabbits, but they provoke a nonspecific hypersensitivityreaction to bovine tuberculin. Hence, they are considered members of a new species of nonpathogenic, slowly growing mycobacteria, for which the name Mycobacterium cookii is proposed. Strain NZ2 is the type strain; a culture of this strain has been deposited in the American Type Culture Collection as strain ATCC 49103.

During 1984 and 1985, 17 strains belonging to the genus Mycobacterium and having homogeneous properties were isolated from sphagnum vegetation and pond water obtained from sites throughout the North and South Islands of New Zealand (4, 11). These strains were not pathogenic for experimental animals, they stimulated nonspecific hypersensitivity to bovine tuberculin in sensitized guinea pigs (ll), and they were regarded as a source of nonspecific tuberculin reactions in cattle in some regions of New Zealand (4). The properties of these strains indicate that they belong to a new species. In this paper we describe the results of a taxonomic study of these unusual strains. MATERIALS AND METHODS Bacterial strains. The designations and sources of 17 previously undescribed strains of mycobacteria (referred to below as the NZ strains) are shown in Table 1. Methods. Colony morphology and the ability to grow at various temperatures (22, 31, 37, 42, and 45°C) were determined after 4 weeks of incubation on Lowenstein-Jensen slants and Middlebrook 7H10 agar inoculated with mg of cells per plate. Pigment production in the dark and photoactivity after 6 weeks of incubation were determined as previously described (8, 24). The following tests were also performed as described previously: nitrate reduction and catalase activity (2); Tween hydrolysis (14); acid phosphatase production (10); arylsulfatase activity after 3 and 10 days (12); production of acidamidase, benzamidase, urease, isonicotinamidase, nicotinamidase, pyrazinamidase, salicylamidase, alantoinase, succinamidase, and malonamidase (1);and resistance to 1and 5 pg of ethambutol per ml, 1and 10 pg of isoniazid per ml, 20 pg of rifampin per ml, 5 pg of streptomycin per ml, and 10 and 40 pg of ethionamide per ml

* Corresponding author

(25). In addition, resistance to 0.1% NaNOz (21) and resistance to 0.2% picric acid (21) were also tested. Acid production from glucose and mannose was tested in agar medium during 6 weeks of incubation (8). Utilization of glucose, mannose, sodium succinate, sodium malonate, and sodium fumarate as sole carbon sources and utilization of sodium glutamate, trimethyldiamine, and sodium nitrate plus glucose as sole sources of carbon and nitrogen were determined by using the method of Tsukamura (22). In the phylogenetic study long-reverse-transcriptase-generatedstretches of the primary structure of the 16s rRNA of strain NZ2T (T = type strain) were compared with the 16s rRNA primary structures of 11 species of mycobacteria (17; J. Smida, Ph.D. thesis, University of Kiel, Kiel, Federal Republic of Germany, 1988). Homology values were transformed into evolutionary distance values (Knuc) (9), and an unrooted phylogenetic tree was produced by using the algorithm of Fitch and Margoliash (7). To determine the approximate degree of relatedness between strain NZ2T and Mycobacteriurn xenopi, three fragments of the 16s rRNA sequence of M . xenopi ATCC 19250 were compared with the strain NZ2T sequence. Lipid analyses were carried out on strains NZ1, NZ2T, NZ4, NZ6, NZ9, NZ13, NZ14, and NZ17 by using two different complementary methods. Cells were scraped from Lowenstein-Jensen slants, saponified, and converted to methyl esters as previously described (5). The mycolic acid methyl esters in these extracts were analyzed by thin-layer chromatography, using either CH2C12 or petroleum ether (boiling point, 50°C)-diethyl ether (9:1, vol/vol) as the developing phase (5). Nonhydroxylated fatty acid esters in the same preparations were examined by gas chromatography, using a Perkin-Elmer model 8310B gas chromatograph fitted with a 1-m column packed with 3% OV-1 and nitrogen as the carrier gas (20). To determine the composition of the chain in position 2 of the mycolates, pyrolytic conditions were used,

217 Downloaded from www.microbiologyresearch.org by IP: 179.61.157.109 On: Wed, 26 Oct 2016 16:06:58

KAZDA ET AL.

218

INT. J. SYST.BACTERIOL.

TABLE 1. Strains used in this study

TABLE 2. Characteristics of 17 NZ strains

Strain

Source

Locality"

NZ1 NZ2T

Pond water Sphagnum falcatulum

NZ3 NZ4 NZ5 NZ6 NZ7 NZ8 NZ9 NZlO NZll

Sphagnum cristatum, floating Sphagnum cristatum Sphagnum cristatum Sphagnup cristatum Sphagnum cristatum Sphagnum falcatulum Sphagnum cristatum Sphagnum cristatum Sphagnum falcatulum

Pakahi bog, SI Southern Crater, Waimaungu Valley, NI Lake Hochstetter region, NI

NZ12

Sphagnum falcatulum

NZ13

Sphagnum falcatulum

NZ14 NZ15

Sphagnum cristatum Sphagnuh cristatum, floating Sphagnum cristatum Pond water, floating Sphagnum cristatum

NZ16 NZ17

Lake Hochstetter region, NI Mai Mai Valley, SI Mai Mai Valley, SI Inangahua, SI Charleston, SI Charleston, SI Upper Kaimai, SI Southern Crater, Waimaungu Valley, NI Southern Crater, Waimaungu Valley, NI Southern Crater, Waimaungu Valley, NI Lower Kaimai, SI Southern Crater, Waimaungu Valley, NI Kaiweka Mountains, SI Pakahi field pond below low cliff, SI ~~

a

% of strains giving positive reaction

Characteristic

SI, South Island of New Zealand; NI, North Island of New Zealand.

with the injector temperature raised from 300 to 400°C (5). Alternatively, free lipids were extracted from cells to produce nonpolar and polar fractions, which were examined by thin-layer chromatography (6). The defatted cell residues were saponified and converted to methyl esters, and mycolate patterns were determined by two-dimensional thin-layer chromatography (6, 15). A portion of each polar free lipid extract was saponified with 5% tetrabutylammonium hydroxide; this was followed by phase-transfer-catalyzed esterification (16) to produce non-hydroxylated fatty acid methyl esters. These esters were purified by preparative thin-layer chromatography, and profiles were recorded by using a Shimadzy model Mini-3 gas chromatograph fitted with a 12-m bonded methyl silicone (BP-1) fused-silica capillary column (Scientific Glass Engineering) and nitrogen as the carrier gas. The DNA guanine-plus-cytosine content of strain NZ1 was determined by C. Cocito, Brussells, Belgium (3). Cultures of strains NZ1 and NZ2T that were 4 weeks old were tested for pathogenicity. For each strain five rabbits were inoculated intravehously with 10 mg (wet weight) of bacteria, five NMRI white mice were infected intravenously with 1 mg of bacteria, and five guinea pigs were infected subcutaneously with 10 mg of bacteria. After 12 weeks, the animals were necrbpsied and examined (13). Numerical analybs. On the basis of a comparison of 41 properties, the level of internal similarity of the 17 NZ strains was determined (18). A total of 43 properties of 21 species of slowly growing mycobacteria were determined and compared with the properties of strain NZ2=. All of the data obtained were converted to the simple binary form (i.e., 1 or 0) for analysis; both negative and positive matches were used (18). RESULTS AND DISCUSSION

The cells of the 17 NZ strains grown on LowensteinJensen agar and on Middlebrook 7H10 agar were rod shaped

-

Pigment production in the dark .......................... .... Photochromogenicity after 4 weeks.. .....,................. Growth at 22°C after 4 weeks ................................ Growth at 31°C after 4 weeks ................................ Growth at 37, 42, and 45°C after 4 weeks ,............... Enzymatic activity Nitrate reductase (22 h) ..................................... Tween hydrolysis (5 days) .................................. Catalase ........,........... ................... ................... Acid phosphatase (18 h). .................................... Arylsulfatase (3 days). ...,...............,................... Arylsulfatase (10 days) .........................,............ Acetamidase ...........,,....................................... Benzamidase ...........,.........,............................. Urease ......................... .................................. Isonicotinamidase .............................,. .............. Nicotinamidase ...,....,..............-........................ Pyrazinamidase ...................................... .......... Salicylamidase ........................................... ..... Allantoinase ..................................................., Succinamidase .......,......................................... Malonamidase .................. ..............................., Resistance to: Ethambutol (5 pg/ml) ........................................ Ethambutol (1 pglml) ,...,................................... Isoniazid (10 pg/ml) .......................................,.. Isoniazid (1 pg/ml) ............................................ Rifampin (20 pg/ml) .......................................... Streptomycin (5 pg/ml) ...................................... Ethionamide (10 pg/ml) ,....................... ............. Ethionamide (40 pg/ml) .................,................... Tolerance to: NaNO, (0.1%) ................................................. Picric acid (0.2%) ......,.. ....., ,.................. ........... Acid production from: ........ .......................,......... D-( +)-Glucose.. ......................,...................... .., D-( +)-Mannose ...,....,..........,............................ Growth on the following single carbon sources: Glucose ........................................,.......,....,.... D-Mannose ...................................................... Sucrose .......................................................... Sodium succinate .................................. .........., Sodium malonate ..........................., ,................. Sodium fumarate ............. ................,................ Growth on the following sources of nitrogen and carbon: Sodium glutamate .......,..................................... Trimethylene diamine ........................................ NaN03 and glucose ..........................................

.

.

.

100 0 88" 100 0 0 6' 100 100 100 100 0 0 0 0 0 0 0 0

0 0

0 18" 0 0 0

15d 6' 0 0 0 0 0

0 0 0 0 0

0 0 0 0

" Strains NZ1 and NZ5 were negative. Strain NZ7 was positive. Strains NZ2T, NZ9, and NZ17 were positive. Strains NZ2T, NZ3, and NZ14 were positive. Strains NZ1 was positive.

(0.8 by 1.4 to 1.9 pm), often polymorphic, gram positive, and acid-alcohol fast and often formed clumps, but not cords or cross bands. Spores, capsules, true branching, and aerial hyphae were not observed. On Lowenstein-Jensen medium, all of the strains were eugonic and produced smooth, glistening, yellow-orangepigmented colonies when they were incubated at temperatures between 22 and 31°C. At 31"C, growth was observed after 3 to 6 weeks; at 22°C growth was observed after 6 to 8 weeks. No growth occurred at 37, 42, or 45°C. Smooth, compact, glistening, yellow-orange colonies that were 0.5 to

Downloaded from www.microbiologyresearch.org by IP: 179.61.157.109 On: Wed, 26 Oct 2016 16:06:58

MYCOBACTERIUM COOKII SP. NOV.

VOL. 40, 1990

219

TABLE 4. Levels of similarity between strain NZ2T and strains belonging to 21 species of slowly growing mycobacteria Straina

+J 0

+ + o aow 09op w l m m o o

M. gordonae ATCC 14470.................................... M. kansasii TMC 1204......................................... M. xenopi ATCC 19250 ....................................... M. bovis ATCC 19210 ......................................... M. scrofulaceurn TMC 1323 ................................. M. nonchromogenicum TMC 1481 ......................... M. shimoidei ATCC 27952 ................................... M. malmoense ATCC 29571 ................................. M. szulgai NCTC 10831 ....................................... M. terrae TMC 1450 ........................................... M. triviale TMC 1453 .......................................... M. asiaticum ATCC 25276 ................................... M. intracellulare ATCC 23434 .............................. M. gastri ATCC 15754......................................... M. tuberculosis ATCC 25618 ................................ M. aficanum ATCC 25420................................... M. JEavescensTMC 1541 ...................................... M. ulcerans ATCC 19423 ..................................... M. avium TMC 724 ............................................. M. rnarinum ATCC 927 ....................................... M. simiae ATCC 25275 ........................................

% Similarity to strain NZ2=

72.09 72.09 69.76 67.44 67.44 65.11 65.11 58.13 58.13 58.13 58.13 55.81 55.81 53.48 53.48 51.16 51.16 48.83 44.18 44.18 44.18

a ATCC, American Type Culture Collection, Rockville, Md.; TMC, Trudeau Mycobacterial Culture Collection, Trudeau Institute, Saranac Lake, N.Y.; NCTC, National Collection of Type Cultures, London, England.

1.0 mm in diameter and had entire margins developed on Middlebrook 7H10 agar from dilute inocula after 3 weeks of incubation at 31°C. A total of 41 properties of the NZ strains are shown in Table 2. These strains constitute a homogeneous group with a level of internal similarity of 96.61% 5 3.09% (Table 3). A comparison of the properties of strain NZ2= with the properties of 21 species of slowly growing mycobacteria showed that this organism differs from previously described species (Table 4). The partial sequence of the 16s rRNA consisting of 1,272 nucleotides of proposed type strain NZ2 is shown in Fig. 1 aligned with three long stretches of the 16s rRNA from M. xenopi ATCC 19250 which were not included in the broad phylogenetic study of Smida (Ph.D. thesis). The phylogenetic position of strain NZ2T based upon derived homology values (Table 5 ) is shown in Fig. 2. The NZ strains are mycobacteria with limited enzymatic activity. All of these strains possess catalase, acid phosphatase, and arylsulfatase activities. No amidase activity was found. Most of these organisms are susceptible to antituberculosis drugs, an unusual pattern in environmental mycobacteria. Furthermore, they did not use any of the compounds tested as single sources of carbon or nitrogen. The guanine-plus-cytosine content (63.7 2 3.0 mol%) is similar to that of Mycobactenurn bovis, but the NZ strains are not pathogenic for experimental animals and differ from M. bovis in their 16s rRNA sequence (19). Nevertheless, the NZ strains provoke a cross-reaction to bovine tuberculin (4, 11).The whole-cell mycolate pattern (Table 6) is unique in that it has not been found previously in 23 species of slowly growing mycobacteria (5, 6). The mycolate pattern confirms the homogeneity of the taxa, but some variations were observed in the nonhydroxylated fatty acid and polar glycolipid profiles. The absence of tuberculostearic acid in strain NZ4 and the low levels of this acid in strains NZ1, NZ6, NZ9, and NZ13 are unusual (Table 7). The phylogenetic position of the NZ strains is within the genus Mycobacterium between the slowly growing pathogenic mycobacDownloaded from www.microbiologyresearch.org by IP: 179.61.157.109 On: Wed, 26 Oct 2016 16:06:58

220

INT. J. SYST.BACTERIOL.

KAZDA ET AL.

TABLE 6. Mycolate types and major pyrolysis esters in eight NZ strainsn Presence of the following mycolate types: Strain I

I1

I11

IV

v

VI

Major pyrolysis ester

NZ1 NZ2T NZ4 NZ6 NZ9 NZ13 NZ14 NZ17 ~~

a

The mycolate types are described in reference 5.

teria and the saprophytic rapidly growing mycobacteria (Fig. 2). Furthermore, the possibility of a close phylogenetic relationship between strain NZ2T and M. xenopi ATCC 19250 can be excluded. The binary homology values of the stretches which we compared (95%) were as low as and similar to those found between individual slowly growing Mycobacterium species. Similar results with respect to the exclusiveness of strain NZ2T were obtained by E. C. Bottcher (personal communication), who compared rRNA sequences by using a polymerase chain reaction and a synthetic primer for Mycobacterium gordonae, M. xenopi, Mycobacterium kansasii, and strain NZ2T. Taxonomic description of Mycobacterium cookii sp. nov. Mycobacterium cookii (c0ok’i.i. L. gen. n. cookii, of Cook, named for Bertram Cook, who discovered the natural reservoirs of this Mycobacterium species in sphagnum vegetation and pond water in New Zealand). The description of M. cookii below is based on a study of 17 strains which shared the characteristics shown in Table 2. Cells are acid-alcoholfast, polymorphic rods (0.8 by 1.4 to 1.9 pm) which often form clumps but not cords or cross bands. Spores, capsules, true branching, and aerial hyphae do not occur. Colonies on Lowenstein-Jensen medium and Middlebrook 7H10 agar are smooth, glistening with yellow-orange pigmentation, and 0.5 to 1 mm in diameter; the optimum growth temperature is 31°C. These organisms do not grow at 37, 42, or 45°C. Biochemical characteristics are shown in Table 2. The strains are mycobacteria with limited enzymatic activity. They possess catalase, acid phosphatase, and arylsulfatase activities. For all strains nitrate reductase activity, amidase activities, and acid production from glucose and mannose are negative. These organisms do not tolerate 0.1% NaNO, and 0.2% picric acid and do not grow on media containing single carbon sources or single sources of nitrogen plus carbon. Most of the strains are susceptible to antituberculosis drugs (Table 2). M. cookii possesses a unique mycolate pattern (Table 6). The guanine-plus-cytosine content is 63.7 f 3.0 mol%. The phylogenetic position based on an evaluation of the partial 16s rRNA sequences is within the genus Mycobacterium between the slowly growing pathogenic species and the saprophytic rapidly growing species (Fig. 1 and 2). The strains which we tested are not pathogenic for guinea pigs, rabbits, or mice. They provoke nonspecific skin hypersensitivity reactions to bovine tuberculin. The type strain of M. cookii is strain NZ2. A culture of this strain has been deposited in the American Type Culture Collection as strain ATCC 49103 and in the Deutsche Sammlung von Mikroorganismen und Zellkulturen as strain DSM 43922. Strains of M. cookii have been isolated only from intact Downloaded from www.microbiologyresearch.org by IP: 179.61.157.109 On: Wed, 26 Oct 2016 16:06:58


VOL.40, 1990

ROO

nxe

221

...90C U C G A C U C G C C A A C C G C U G A G U A A C A C G U G G C U G A U C U G C C n n G C h C U U C G G C A U A A C C D U G C G A A A C U C G G U C U A A U A C C G G A U A G G A C U A C G G A C

AUAACCCUCCCAAACUGCCUCUAAUACCGGAUAGGACCAUUCUG

Rco 1x0

UnCAVnGUCUGUGGUCGAAAGC--UUUU--GCGCUUDGGGAUnGCCCGCGGCCUAUCAGCUUGUUnGUGCGGUCAUGGCCUACCAAGGCGACGACGGGUA C~C~DGUGGGGUCGUCGIA~GUGUUUGGUACCGGUGUGCGAUGGCCCGCGGCCUA~~CACCUUGUUGGDGGGCUGAUGGCCUACCAAGGCGACGACGGCDA

Rco

GCCCGCCUCACIGCCnGDCCGGCnACACUGGG&COGAGAUICGCCCCIGACUCCUACCCGACGCAGCAGUGGGGAAUADUGCACAAUGGGCGCAAGCCUn

Kxe

CCCCCCCUGbGAGGCUGUCCGGCCACACUCGGACDGAGAUACGGCCCAGACUCCUACGGGAGGCACCAGUGGGCAAUADUCCACAAOGGGCGCAAGCCUn

nco

~~CCIGCGACGCCGCGUCGGGGAUGACGGCUUCGGG~UGUAAACCUCUUUCACCADCC-CGAAGCCCAUAGCUUDDGDUCUGGGDGA~GGUAGGUCGAGA AuGCIGCGACGCCGCGUCCGGGAUGACGGCUUCGGGUUGUhAACCCCUUUCAGCCUCCACGAACCUnC-GCGUDDUCUCGUG-GUCACGGUAGGCGCAGA

Kxt

nco Rx e

AGAAGCACCGCCnAACUACGUGCCACCAGCCGCCGDAAUACCU&GGGUCCGAGCCDnGUCCGGAAUUACDGGGCGUAAAGAGCUCCUAGGUGGUUUGDCG AG h A C C A C C G C C C A A C

nco Kxo

CGUnGUCCCUCAIAUUCCCUnGCUnAACDGuGGGCCUGCGGGCCAUACGGGCAGhCDGGAGUGCUGCAGGGGAGACUGGAAUUCCUnGUGUACCCGUGGA

Kco

AuGCGCAGlCAUCACGAGCAACACCGGDnGCGAAGGCGGGUCUCUGGGCAGDAACUGACGCUGAGGAGCGAAAGCGUGCGGAGCGAACAGGAUUAGAUAC AUGCGCIGA~AUCACCIGGAACACCGCUnGCGAIGGCGCGUCUCDGCGCAGUhACUGACGCUCAGGAGCGAAAgcgDGGGGAGCGAACAGGAUUAGAUAC

Kxe

Kco

GCGCGCGAUACGGCCAGGCDCGAGDGCDGCAGGGGAGACDGCAAUUCCUnGUGUAGCGGUGGA

nxo

CCUGGDACUCCACCCCGDAAACGGDCGGUACUAGGUGUGGGUUUCCUUCCUDGGGAUCCGUGCCGDAGCUAACGCAUDAAGUACCCCGCCUGGGGAGUAC CCDGGDAGUCCACGCCGUAIACGGUGGGUACUAGGUGUGGGDDCUUUCCUGAAGGAUCCGUGCCGUAGCUAACGCADUAAGUACCCCGCCDCCGGAGUAC

wco Ex.

CGCCCCAACCCUAAAACUCAAIGGIIOUGICCCCGCGGGCCaGChCAAG

CGCCGCAACCCUAAAACUCIAhGGAIEDCACGGCGGCCnGCACAAGCGGCCChCChUGUGGhUUIAUUCGAUCCAACGCGAAGAACCUUACCDGGCUUDG

Rco

Kco Kx

nc 0 Kxe Rco I!x e Rco

FIG. 1. Partial 16s rRNA sequence of strain NZ2=. Unsequenced flanking regions are indicated by dots. Position 90 refers to a position in the M . bovis BCG sequence (18). A few stretches of the M . xenopi 16s rRNA sequence are aligned to indicate the lack of genetic identity between the species. Mco, M . cookii; Mxe, M . xenopi.

M. chelonae Mycobacterium sp.

I

/scrofulaceum

M. avium

M. komossense

\

M. phlei

M. leprae

M. sphagni M. tuberculosis M. fortuitum M. f a r c h o g e s

0.01 Knuc FIG. 2. Phylogenetic tree based on partial sequences of 16s rRNAs from mycobacteria, illustrating the position of type strain NZ2. Mycobacterium sp. strain NZ2 was designated M . cookii as a result of this study. Downloaded from www.microbiologyresearch.org by IP: 179.61.157.109 On: Wed, 26 Oct 2016 16:06:58

222

KAZDA ET AL.

INT.

J. SYST. BACTERIOL.

TABLE 7. Composition of fatty acid methyl esters derived from polar lipids % Composition"

Strain

NZ1 NZ2T NZ4 NZ6 NZ9 NZ13 NZ14

12:o

14:O

1.4 4.0 6.1 7.5 5.9 8.3 4.6

0.3 0.3

~~

15:O

1.3 0.5 0.4 0.9

16: 1

16:O

X

17:O

Y

18:1

18:O

TBS

4.1 5.1 13.O 14.7 13.8 0.3 12.4

35.8 36.1 34.8 32.2 36.1 44.4 34.2

0.4 1.4 0.7 0.6 0.9 0.7 2.6

0.3 1.0 0.3

8.6 2.0 2.7 1.5 1.7 1.3 1.4

34.3 24.7 35.7 37.2 31.3 38.6 26.2

14.1 10.1 6.2 4.9 9.7 4.8 4.2

0.9 14.2

0.3 0.6

1.3 0.5 0.4 12.8

~~

Examples of abbreviations: 12:0, dodecanoate; 16: 1, hexadecenoate. TBS, Tuberculostearate (10-methyl-octadecanoate). Fatty acids x and y were not identified. The retention, times relative to hexadecanoate (16:O) were as follows: 12:0,0.45; 14:0,0.73; 15:0,0.86; 16:1,0.96; 16:0,1.00; x, 1.09; 17:0,1.13; y, 1.20; 18:1, 1.22; 18:0, 1.25; and TBS, 1.30. a

sphagnum vegetation and the pond water associated with this vegetation in ew Zealand. Characteristics hich differentiate M. cookii from other related mycobacteyia. M . cookii can be differentiated from M . gordonae by its failure to grow at 37"C, by its failure to hydrolyze Tween, by its susceptibility to antituberculosis drugs and 0.1% NaOH,, and by its failure to grow in medium containing NaNO, and glucose as N and C sources. Furthermore, there are marked differences in the 16s rRNA sequences and the mycolate and lipid patterns (K.-H. Schroder, personal communication). M . cookii is easily differentiated from M . xenopi by its failure to grow atl45, 42, and 37"C, by its lack of nicotinamidase and pyrazinamidase activities, and by its whole-cell mycolate pattern. Furthermore, M . xenopi shows marked resistance to most of the antituberculosis drugs tested and tolerance to 0.1% NaNO, and grows on sodium glutamate as a single source of nitrogen and carbon, properties which were negative in M . cookii. In addition, a close phylogenetic relationship between M . cookii and M . xenopi can be excluded since the binary homology values for stretches of 16s rRNA are as low as 95%. M . kansasii can be differentiated from M . cookii by its failure to develop pigment in the dark, by its growth at 37"C, by its positive nitrate reductase activity, by its ability to hydrolyze Tween, by its splitting of urea and nicotinamide, and by its production of acid from glucose. Furthermore, M . kansasii grows on media containing mannose and sodium succinate as sole carbon sources and on media containing NaNO, and glucose as single sources of carbon and nitrogen. The whole-mycolate pattern of M . kansasii differs from that of M . cookii.

r

ACKNOWLEDGMENTS

We thank C. Cocito (UniversitC Catholique de Louvain, Brussels, Belgium), who determined the guanine-plus-cytosine content of strain NZ1; K.-H. Schroder (Research Institut Borstel, Borstel, Federal Republic of Germany), who compared M . cookii, M . gordonae, and M . xenopi by using biochemical methods; K.-J. Schaper (Research ' Institute Borstel), who wrote the computer program for numeribal taxonomy; B. R. Cook (University of Canterbury , Tauranga, New Zealand), who organized the field investigation; and Corina Dierfeld, Hilde Hahn, Elke Link, and Werner Mohr (Research Institute Borstel), who provided skillful technical assistance. This work was supported by a grant from the German Leprosy Relief Association ((to J.K.), by the Deutsche Foschungsgemeinschaft, and by a grant from the Gesellschaft fur Biotechnologische Forschung for performing research of relevance for the Deutsche Sammlung von Mikroorganismen (to E.S.).

LITERATURE CITED

1. Bonicke, R. 1961. Die Bedeutung der Acylamidasen fur die Identifizierung und Differenzierung der verschiedenen Arten der Gattung Mycobacterium. Jahresber. Borstel 57-87. 2. Bonicke, R. 1962. Identification of mycobacteria by biochemical methods. Bull. Int. Union Tuberc. 32:13-86. 3. Coene, M., and C. Cocito. 1985. A microanalytical procedure for determination of the base composition of DNA. Eur. J. Biochem. 150:475479. 4. Cook, B. R., and J. Kazda. 1988. Mycobacteria in pond water as a source of non-specific reactions to bovine tuberculin in New Zealand. N.Z. Vet. J. 136:184-188. 5. Daffe, M., M. A. Laneelle, C. Asselineau, V. Levy-Frebault, and H. L. David. 1983. Interet taxonomique des acides gras des mycobacteries. Proposition d'une methode d'analyse. Ann. Microbiol. (Paris) 134B:241-256. 6. Dobson, G., D. E. Minnikin, S. M. Minnikin, J. H. Parlett, M. Goodfellow, M. Ridell, and M. Magnusson. 1985. Systematic analysis of complex mycobacterial lipids, p. 237-265. In M. Goodfellow and D. E. Minnikin (ed.), Chemical methods in bacterial systematics. Academic Press, Inc. (London), Ltd., London. 7. Fitch, W. M., and E. Margoliash. 1967. Construction of phylogenetic trees: a method based on mutation distances as estimated from cytochrome C sequences is of general applicability. Science 155279-284. 8. Gordon, R. E., and M. M. Smith. 1953. Rapidly growing acid-fast bacteria. I. Species descriptions of Mycobacterium phlei Lehmann and Neumann and Mycobacterium smegmatis (Trevisan) Lehmann and Neumann. J. Bacteriol. 66:41-48. 9. Hori, H., and S. Osawa. 1979. Evolutionary changes in 5s RNA secondary structure and phylogenetic tree of 54 5s RNA species. Proc. Natl. Acad. Sci. USA 76:381-386. 10. Kappler, W. 1965. Zur Differenzierung von Mykobakterien mit dem Phosphatase-Test. Beitr. Klin. Tuberk. Spezif. Tuberk. Forsch. 130:223-226. 11. Kazda, J., and B. R. Cook. 1987. Unusually high densities of slowly growing mycobacteria on sphagnum moss in New Zealand. Int. Peat J. 2:119-125. 12. Kubica, G. P., and A. L. Ridgon. 1961. The arylsulfatase activity of acid-fast bacilli. 111. Preliminary investigation of rapidly growing acid-fast bacilli. Am. Rev. Respir. Dis. 83:737-740. 13. Meissner, G. 1959. Untersuchungen an atypischen Mykobakterien. 11. Vergleichende tierexperimentelle Untersuchungen zur Frage ihrer Pathogenitat und Virulenz. Beitr. Klin. Tuberk. Spezif. Tuberk. Forsch. 121:365-380. 14. Meissner, G., K. H. Schroder, G. E. Amadis, W. Anz, S. Chaparas, H. B. W. Engel, P. A. Jenkins, W. Kappler, H. H. Kleeberg, E. Kubala, M. Kubin, D. Lauterbach, A. Lind, M. Magnusson, Z. Mikova, S. R. Pattyn, W. B. Schaefer, J. L. Stanford, M. Tsukamura, L. G. Wayne, I. Willers, and E. Wolinsky. 1974. A co-operative numerical analysis of nonscotoand nonphotochromogenic slowly growing mycobacteria. J. Gen. Microbiol. 83:207-235. 15. Minnikin, D. E., S. M. Minnikin, J. H. Parlett, and M. Good-


VOL. 40, 1990

16. 17.

18. 19. 20. 21.


fellow. 1985. Mycolic acid pattern of some rapidly growing species of mycobacteria. Zentralbl. Bakteriol. Parasitenkd. Infektionsk. Hyg. Abt. 1 Orig. Reihe A 259:446460. Saddler, G. S., A. G. O’Donnell, M. Goodfellow, and D. E. Minnikin. 1987. SIMCA pattern recognition in the analysis of streptomycete fatty acids. J. Gen. Microbiol. 133:1137-1147. Smida, J., J. Kazda, and E. Stackebrandt. 1988. Moleculargenetic evidence for the relationship of Mycobacterium leprae to slow growing pathogenic mycobacteria. Int. J. Lepr. 56: 449-545. Sokal, R. R., and P. H. A. Sneath. 1963. Principles of numerical taxonomy. Freeman and Co., San Francisco. Suzuki, Y., A. Nagata, Y. Ono, and T. Yamada. 1988. Complete nucleotide sequence of the 16s rRNA gene of Mycobacteriurn bovis BCG. J. Bacteriol. 170:288&2889. Tisdall, P. A., G. D. Roberts, and J. P. Anhalt. 1979. Identification of clinical isolates of Mycobacterium with gas-liquid chromatography alone. J. Clin. Microbiol. 10:50&515. Tsukamura, M. 1965. Differentiation of mycobacteria by picric acid tolerance. Am. Rev. Respir. Dis. 92:491492.

223

22. Tsukamura, M. 1967. Differentiation of mycobacteria by utilisation of nitrogen compounds and carbon sources. Am. Rev. Respir. Dis. 95:307-310. 23. Tsukamura, M. 1969. Identification of group I1 scotochromogens and group I11 nonphotochromogens of mycobacteria. Tubercle 5051-60. 24. Tsukamura, M., and S. Tsukamura. 1968. Differentiation of mycobacteria by susceptibility to nitrite and propylene glycol. Am. Rev. Respir. Dis. 98505-506. 25. Wayne, L. G., R. C. Good, M. I. Krichevsky, Z. Blacklock, S. D. Chaparas, D. Dawson, D. Dawson, S. Froman, W. Gross, J. Hawkins, P. A. Jenkins, I. Juhlin, W. Kappler, H. H. Kleeberg, I. Krasnow, M. J. Lefford, E. Mankiewicz, C. McDurmont, G. Meissner, E. E. Nel, S. R. Pattyn, F. Portaels, P. A. Richards, S. Riisch, K. H. Schroder, I. Szabo, M. Tsukamura, and B. Vergmann. 1981. First report of the cooperative open-ended study of slowly growing mycobacteria (International Working Group of Mycobacterial Taxonomy). Int. J. Syst. Bacteriol. 31: 1-20.
