Nuclear Receptors Have Distinct Affinities for Coactivators ...

Nuclear Receptors Have Distinct Affinities for Coactivators: Characterization by Fluorescence Resonance Energy Transfer

Gaochao Zhou, Richard Cummings, Ying Li, Sudha Mitra, Hilary A. Wilkinson, Alex Elbrecht, Jeffrey D. Hermes, James M. Schaeffer, Roy G. Smith, and David E. Moller Department of Biochemistry and Physiology (G.Z., Y.L., S.M., H.A.W., A.E., J.M.S., R.G.S., D.E.M.) Department of Molecular Design & Diversity (R.C., J.D.H.) Merck Research Laboratories Rahway, New Jersey 07065

Ligand-dependent interactions between nuclear receptors and members of a family of nuclear receptor coactivators are associated with transcriptional activation. Here we used fluorescence resonance energy transfer (FRET) as an approach for detecting and quantitating such interactions. Using the ligand binding domain (LBD) of peroxisome proliferator-activated receptor (PPARg) as a model, known agonists (thiazolidinediones and D12, 14-PGJ2) induced a specific interaction resulting in FRET between the fluorescently labeled LBD and fluorescently labeled coactivators [CREBbinding protein (CBP) or steroid receptor coactivator-1 (SRC-1)]. Specific energy transfer was dose dependent; individual ligands displayed distinct potency and maximal FRET profiles that were identical when results obtained using CBP vs. SRC-1 were compared. In addition, half-maximally effective agonist concentrations (EC50s) correlated well with reported results using cell-based assays. A site-directed AF2 mutant of PPARg (E471A) that abrogated ligand-stimulated transcription in transfected cells also failed to induce ligand-mediated FRET between PPARg LBD and CBP or SRC-1. Using estrogen receptor (ERa) as an alternative system, known agonists induced an interaction between ERa LBD and SRC-1, whereas ER antagonists disrupted agonist-induced interaction of ERa with SRC-1. In the presence of saturating agonist concentrations, unlabeled CBP or SRC-1 was used to compete with fluorescently labeled coactivators with saturation kinetics. Relative affinities for the individual receptor-coactivator pairs were determined as follows: PPARg-CBP 5 ERa-SRC-1 > PPARg-SRC-1 .. ERa-CBP. Conclusions: 1) FRETbased coactivator association is a novel approach 0888-8809/98/$3.00/0 Molecular Endocrinology Copyright © 1998 by The Endocrine Society

for characterizing nuclear receptor agonists or antagonists; individual ligands display potencies that are predictive of in vivo effects and distinct profiles of maximal activity that are suggestive of alternative receptor conformations. 2) PPARg interacts with both CBP and SRC-1; transcriptional activation and coactivator association are AF2 dependent. 3) Nuclear receptor LBDs have distinct affinities for individual coactivators; thus, PPARg has a greater apparent affinity for CBP than for SRC-1, whereas ERa interacts preferentially with SRC-1 but very weakly with CBP. (Molecular Endocrinology 12: 1594–1604, 1998)

INTRODUCTION Nuclear receptors are a large family of ligand-activated transcription factors that bind as homo- or heterodimers to their cognate DNA elements in gene promoters (1–5). The nuclear receptor proteins contain a central DNA binding domain (DBD) and a COOH-terminal ligand binding domain (LBD) (1). The DBD is composed of two highly conserved zinc fingers that target the receptor to specific promoter/enhancer DNA sequences (hormone response elements). The LBD is about 200–300 amino acids in length and is less well conserved. There are at least four functions encoded in the LBD: dimerization, ligand binding, binding of coactivators or corepressors, and transactivation. Transactivation can be viewed as a molecular switch between a transcriptionally inactive state and an activated state of the receptor. The COOH-terminal portion of the LBD contains an activation function domain (AF2) that is required for this switch (6–8). Ligand-induced transactivation is mediated through interactions with members of a growing family of coactivator proteins including CREB-binding protein (CBP/p300) (6, 9), steroid receptor coactivator-1 1594

Affinities of Nuclear Receptors for Coactivators

(SRC-1)/nuclear receptor coactivator-1 (NcoA-1) (6, 10, 11), transcriptional intermediary factor 2 (TIF2)/ glucocorticoid receptor interacting protein 1 (GRIP-1)/ NcoA-2 (12, 13), and p300/CBP interacting protein (p/CIP) (14). Upon agonist binding, a conformational change in the LBD creates a coactivator binding surface; transcriptional activation occurs after recruitment of coactivator(s) to the receptor. This interaction is viewed as necessary and sufficient for receptormediated transcriptional activation. The binding of antagonist ligands to nuclear receptors results in a conformational state that does not allow coactivators to interact (and may also promote interactions with corepressor molecules). The coactivator CBP can form a bridge between nuclear receptors and basal transcriptional machinery (6). In addition, CBP and SRC-1 also contain intrinsic histone acetyltransferase activity that results in local chromatin rearrangement that is crucial for transcriptional activation (14–16). A ligand- and AF2-dependent interaction between selected nuclear receptors — retinoid X receptor (RXR), retinoic acid receptor (RAR), glucocorticoid receptor (GR), vitamin D receptor, thyroid receptor (T3R), and estrogen receptor a (ERa) — and CBP or SRC-1 has been demonstrated using in vitro glutathione-S-transferase (GST) pull-down experiments and with far-Western assessment of protein-protein interactions (6). Thus, AF2 mutants of T3R, ER, or RAR that impair the transcriptional function are also deficient with respect to coactivator interactions (6, 17). The important biological role of nuclear receptor coactivators was elegantly shown by Xu et al. (18) who characterized defects in steroid hormone action in SRC-1 null mice. Using homogeneous time-resolved fluorescence (HTRF) technology (19), we developed a novel approach for characterizing the ligand-dependent protein-protein interaction between nuclear receptors and coactivators. This approach was employed to characterize differential effects of specific ligands for peroxisome proliferator-activated receptor-g (PPARg) and ERa on receptor function, to determine the requirement of the PPARg AF2 domain for coactivator association, and to assess the affinity and relative specificity of these receptors for CBP vs. SRC-1.

RESULTS HTRF-Based Measurement of Nuclear ReceptorCoactivator Interaction HTRF technology relies upon europium cryptate, a lathanide (20). In the presence of appropriate chelates, lathanide ions display two remarkable characteristics: first, a pronounced Stoke’s shift with excitation and emission maxima often differing by as much as 300 nm (e.g. for the europium chelate, lmaxex 5 307 nm, lmaxem 5 620 nm); second, a long fluorescence lifetime, as long as 1 msec, or about 5 to 6 orders of magnitude longer than that of organic

1595

fluorophores, thereby allowing measurements to be carried out in a time-resolved mode (20, 21). These two properties result in extremely low backgrounds allowing assays of high sensitivity where quantities as small as tens of attomoles have been detected (22, 23). HTRF technology also incorporates a second fluorophore, XL665 (lmaxex 5 620 nm, lmaxem 5 665 nm), which mediates the fluorescence resonance energy transfer (FRET). An additional benefit of using lathanide in HTRF FRET measurements is that it has a large R0 value (R0, the distance at which 50% of the energy is transferred). The R0 for the Eu(K)-XL665 pair is about 90 Å. As a consequence, larger complexes can be detected, and the use of appropriately labeled antibody partners becomes much more facile. For the HTRF-based measurement of receptor-coactivator interaction, excitation of Eu(K) at 337 nm results in emission at 620 nm; XL665 can absorb the 620-nm emission if both molecules are close to one another (near or within R0), and subsequently emit at 665 nm. Therefore, FRET between the two fluorophores is a measure of the proximity of the molecules. The extent of the specific FRET is measured as a ratio of the emission intensity at 665 nm vs. that at 620 nm. This ratiometric readout provides additional advantages, in that 620 nm signal serves an internal standard, to minimize interference from variations due sample impurities (color, turbidity), probe concentrations, excitation intensity, and emission sensitivity. As a result, variation between multiple determinations is typically less than 2%. To mimic the functional interaction between nuclear receptors and coactivators in an HTRF-based format, we used PPARg-CBP, PPARg-SRC-1, and ERaSRC-1 as model systems (Fig. 1). The LBDs of either PPARg or ERa, each of which is also predicted to contain the ligand-dependent coactivator-binding domain, were expressed in Escherichia coli (PPARg) or yeast (ERa) and purified as GST-fusion proteins (GSTPPARgLBD and GST-ERaLBD) where the NH2 terminus of the LBDs was fused to the COOH terminus of GST. The nuclear receptor-binding domains of human CBP, CBP12453 (amino acids 1–453), and human SRC-1, SRC5682780 (amino acids 568–780) were also expressed in Escherichia coli and biotinylated after purification. As shown in Fig. 1, GST-PPARgLBD or GST-ERaLBD was indirectly linked to Eu(K) through an anti-GST antibody, which was covalently liked to Eu(K). CBP12453 or SRC5682780 was indirectly linked to XL665 through a streptavidin (SA)-biotin adapter. Thus, agonist-induced interaction between the nuclear receptor and its coactivator would bring the two fluorogenic partners together and result in the nuclear receptor ligand-dependent FRET. The stoichiometry of biotin labeling that resulted in maximal ligandinduced FRET was determined for each nuclear receptor-coactivator pair and was generally 2–2.5 biotins to one coactivator molecule.

MOL ENDO · 1998 1596

Vol 12 No. 10

Fig. 1. Strategy for Assessment of Nuclear Receptor-Coactivator Association Using the HTRF Approach GST-PPARgLBD or GST-ERaLBD proteins were indirectly linked to Eu cryptate, (Eu)K, through (Eu)K-labeled anti-GST antibody, a-GST-(Eu)K. Purified recombinant CBP1–453 or SRC568–780 proteins were biotinylated and indirectly linked to XL665 through XL665-labeled streptavidin (SA/XL665). The specific 665-nm signal of XL665 is produced only when there is a ligandinduced change in receptor conformation that results in binding to the coactivator. The extent of the FRET is measured as a ratio of 665 nm/620 nm 3 10,000.

Known PPARg Agonists Induce Dose-Dependent FRET Resulting from Interactions between PPARg LBD and CBP or SRC-1 The antidiabetic thiazolidinediones (TZDs) have been shown to be activating ligands for PPARg (24, 25). TZDs bind PPARg with high affinity in vitro and can mediate transactivation of PPAR response elementluciferase reporter constructs in mammalian cells. We first established that TZDs can induce the interaction of PPARgLBD with GST-CBP12453 using a standard pull-down approach (Fig. 2A); this demonstrated that PPARgLBD and nuclear receptor-binding domain of CBP were sufficient to mediate the agonist-dependent interaction. Figure 2, B and C, shows that, in an HTRF approach, TZDs induced a specific interaction between PPARg-LBD and CBP12453 or SRC5682780 in a dose-dependent manner. The EC50s obtained from this HTRF-based approach correlated very well with published IC50s from receptor-ligand binding-experiments and EC50s obtained via transactivation assays. Thus, the rank order of potency for these different compounds, TZDA . TZDB . TZDC 5 TZDD . TZDE, was preserved relative to published results (24–26). In addition, these effects correlate well with previously reported glucose-lowering potencies in diabetic animals (25). The differential potencies of these PPARg ligands were also nearly identical when data derived using CBP vs. SRC-1 were compared. The naturally occurring, putative endogenous ligand of PPARg, 15-

deoxyD12,14 PGJ2 (27, 28) also induced the PPARgCBP interaction, whereas a related compound, PGJ A2, which is reportedly inactive as a PPARg agonist, failed to mediate FRET between labeled PPARg LBD and labeled CBP (Fig. 2D). The PPARg AF2 Domain Is Required for Transcriptional Activation and Coactivator Association It has been shown for other nuclear receptors that AF2 function is required for both receptor-mediated transcriptional activation in cells and in vitro coactivator interaction. To ascertain whether the PPARg AF2 domain is similarly required for transactivation and interactions with coactivators, a PPARg mutant (E471A) was made, in which glutamic acid at position 471, located in a conserved AF2 core sequence, was substituted by alanine via site-directed mutagenesis. This mutant, as well as the wild-type receptor, was expressed in COS1 cells as fusion protein constructs containing the DNA-binding domain of the glucocorticoid receptor and the ligand-binding domains of human PPARg: GR/PPARgLBD and GR/ PPARgLBDE471A. As observed with other tested nuclear receptors, this mutant completely lost its ability to transactivate the reporter gene (Fig. 3A). Western blot analysis showed that the mutant chimeric receptor protein was expressed at a level similar to the wild-type chimer (data not shown). GST-PPARgLBD-E471A protein was subsequently expressed in Escherichia coli and


1597

Fig. 2. Induction of PPARg-CBP and PPARg-SRC-1 Interaction by Known PPARg Agonists A, TZDs induced interaction between hPPARgLBD and GST-CBP1–453 in pull-down experiments. Purified hPPARgLBD (0.2 mg) was incubated with glutathione-bound GST-hCBP1–453 (1–2 mg) in the absence or presence of 1 mM of each TZD compound (lane 1, input; lane 2, dimethylsulfoxide; lane 3, TZDB; lane 4, TZDC; lane 5, TZDD). Bound hPPARgLBD was eluted and analyzed by Western blotting. Using the HTRF approach, effects of TZDs on PPARg-CBP interaction (B), PPARg-SRC-1 interaction (C), and effects of PGs on PPARg-CBP interaction (D) were analyzed in the presence of 10 nM SA/XL665, 10 nM biotin-CBP1–453 or 10 nM biotin-SRC568–780, 1 nM GST-PPARgLBD, and 2 nM a-GST-(Eu)K as described in Materials and Methods. For panels B and C, the symbols are: E, TZDA; M, TZDB; L, TZDC; F, TZDD; , TZDE. The experiment was repeated three times with similar results.

purified. Using the HTRF assay, it was shown to have lost its ability to interact with both CBP and SRC-1 (Fig. 3B), indicating that ligand-mediated PPARg interactions with both CBP and SRC-1 depend on the AF2 domain of the receptor.

Functional Characterization of ER Ligands Using the HTRF Approach To explore the possibility that the HTRF coactivator association strategy can be readily applied to other

MOL ENDO · 1998 1598

Fig. 3. Requirement of PPARg AF-2 Function for Transactivation and Coactivator Interaction A, Ligand-activated PPARg/GR transactivation was abolished by an AF2 domain mutation. COS-1 cells were cotransfected with pSG5-hPPARg/GR or pSG5-hPPARgE471A/GR, pMMTV/luc reporter, and pSV-b-galactosidase plasmids. Five hours after transfection, cells were treated with TZDA and TZDB for 36 h. Luciferase activity was then determined and normalized with b-galactosidase activity. Each point represents the mean of three determinations. B, Purified recombinant LBD protein corresponding to wild-type vs. PPARgE471A, 1 nM each, were compared using HTRF. Only wild-type PPARg LBD was able to undergo ligand (TZDA)induced association with either CBP or SRC-1. The experiment was repeated three times with similar results. Similar results were also obtained using 5 nM or 10 nM GSTPPARgLBD and GST-PPARgLBDE471A.

nuclear receptors, an analogous system was examined in which GST-ERaLBD was used (Fig. 1). As shown in Fig. 4, the ERaLBD-SRC-1 interaction was also ligand dose-dependent. The EC50s for 17b-estradiol (E2) and diethylstilbestrol were 0.25 nM and 0.6 nM, respectively, which correlates well with their reported potencies using ligand-receptor binding and transactivation assays (29, 30). 4-OH-tamoxifen and clomi-

Vol 12 No. 10

Fig. 4. Effects of Known ER Agonists and Antagonists on ERb-Coactivator Interaction A, The ability of known ER agonists (E2 and diethylstilbestrol) to induce an interaction between ERa and SRC-1 was tested following methods described in the legend to Fig. 2. B, The effects of known ER antagonists (4-OH-tamoxifen and clomiphene) on E2-induced ERa-SRC-1 interaction were analyzed in the presence of 1.5 nM E2 (6 3 EC50). The experiment was repeated three times with similar results.

phene have been shown to antagonize the activity of ER by binding to ER LBD and preventing agonistmediated recruitment of coactivators (31, 32). Figure 4B shows that the E2-induced ERa-SRC interaction was effectively blocked by the addition of 4-OHtamoxifen or clomiphene. The IC50s obtained using this approach were also similar to reported results obtained from binding determinations or functional antagonism in transactivation experiments (31, 32). CBP and SRC-1 Interact with PPARg or ERa with Different Affinities Figure 5A shows that under the same experimental conditions, ligand binding induced the interaction of ERa only with SRC-1, whereas PPARg interacted with both CBP and SRC-1. This finding may be the result of


an intrinsic difference in affinity between each of these nuclear receptors and the two coactivators. The affinity between PPARg or ERa and between CBP or SRC-1 was analyzed using saturating concentrations of potent agonists, TZDA for PPARg and E2 for ERa. As shown in Fig. 5, B–D, unbiotinylated CBP or SRC-1 effectively competed for the TZDA-induced FRET with saturation kinetics. The PPARg-CBP interaction showed a higher apparent affinity than PPARg-SRC-1 interaction in both experimental paradigms, either using biotinylated-CBP or biotinylated-SRC-1. In contrast, unbiotinylated CBP had little effect on the ERa biotinylated-SRC-1 interaction, although unbiotinylated SRC-1 could compete efficiently with biotinylated-SRC-1. Further evidence of ERa specificity for SRC-1 vs. CBP was obtained from data depicted in Fig. 5E. In this experiment, unlabeled full-length ERa was used to compete for interactions of PPARg with biotinylated-SRC-1 or -CBP. In the presence of E2, unlabeled ERa effectively competed with PPARg for biotinylated-SRC-1 by disrupting TZDA-induced FRET. In contrast, increasing ERa concentrations did not affect the PPARg-BioCBP interaction. These data show that under our experimental conditions, there was a distinct profile of preferred receptor-coactivator interactions, which follows a rank order of PPARgCBP12453 5 ERa-SRC-15682780 . PPARg-SRC15682780 .. ERa-CBP12453.

DISCUSSION Ligand binding promotes the association of nuclear receptors with a diverse group of universally expressed nuclear proteins, including CBP/p300, SRC1/NcoA-1, and TIF2/GRIP-1NcoA-2, which are believed to function as coactivators by forming a bridge with basal transcriptional machinery and conferring a local increase in histone acetyltransferase activity. Thus, ligand-induced transcriptional activation of target genes by nuclear receptors involves the formation of a large protein complex on the receptor homo- (e.g. ER) or heterodimeric (e.g. PPAR/RXR) receptors bound to their cognate DNA response elements. A key role for coactivators is evident from studies that show that ligand-induced and AF2-dependent interactions between nuclear receptors and their coactivators (such as SRC-1 or CBP) are both necessary and sufficient for activation of transcription (6, 17). This in vivo functional interaction can be mimicked in the absence of a receptor heterodimer partner or a DNA response element by using isolated receptors in vitro in a GST pull-down approach, or via far-Western analysis, and using the yeast two-hybrid system (6, 17, 33). The HTRF nuclear receptor strategy described here provides a novel quantitative tool for studying functional interactions of nuclear receptors with coactivator molecules (and possibly corepressors as well). The components of this system, purified recombinant nu-

1599

clear receptors and nuclear receptor binding domains of coactivators, are simple compared with transcription complexes that exist within the nucleus of cells. We achieved further simplification by using only the LBDs of the PPARg and ERa. However, we have not observed significant differences when comparing results obtained using full-length PPARg2 rather than PPARgLBD (data not shown). Compared with other approaches for measuring nuclear receptor-coactivator interactions noted above, the HTRF-based strategy provides the first in vitro homogeneous method allowing for quantitation of such events under equilibrium conditions. Importantly, the HTRF-based assessment of nuclear receptor activation was shown to be specific and predictive of in vivo receptor function, as evidenced by the following three sets of experimental results. First, EC50s of TZDs and ER agonists obtained using the HTRF approach correlated very well with other data available from ligand-binding and cell-based transactivation assays as well as with in vivo potencies in the case of TZD PPARg agonists. In addition, the putative natural ligand for PPARg, 15-deoxyD12,14 PGJ2, was fully active with an EC50 that reflects its reported activity using other approaches (27, 34), whereas PGJ A2, which is reported to be functionally inactive, was unable to induce FRET. Second, AF2 function, which is required for ligand-dependent function of nuclear receptors in cells, was shown to be necessary for transcriptional activation of a chimeric GR-PPARgLBD protein in transfected cells and for interaction of PPARg with both tested coactivators in the cell-free HTRF context (Fig. 3). Third, two known ER antagonists, 4-OH-tamoxifen and clomiphene, failed to induce the association of ERa with SRC-1 and could efficiently block the E2-induced ERa-SRC-1 interaction (Fig. 4B). These effects occurred with half-maximal activities that could be predicted from their reported potencies as ligands and antagonists in cell-based assays (31, 32). It is interesting to note that different agonists of PPARg resulted in different degrees of maximal FRET induction. As shown in Fig. 2, B and C, testing of TZDE repeatedly yielded 50–60% maximum FRET induced by TZDA, using either CBP or SRC-1; for other PPARg ligands, distinct profiles of maximal FRET that differed from TZDA or TZDF were also observed using SRC-1 (Fig. 2C). Since FRET is a measure of the proximity of the receptor LBD and coactivator, saturating concentrations of individual ligands may have resulted in some variation in net proximity achieved. Alternatively, subtle changes in the receptor-coactivator affinity may underlie these differences. In either case, alternative conformational states adopted by PPARg upon binding to structurally distinct ligands can be implicated. It is clear that functionally distinct classes of ER ligands (agonists vs. partial agonists vs. antagonists) exert alternative receptor conformations as measured by protease protection (35). Furthermore, we have observed that certain PPARg ligands that appear to function as partial

MOL ENDO · 1998 1600

Vol 12 No. 10


agonists in cell-based assays also exhibit reduced maximal FRET in the HTRF assay (J. Berger and G. Zhou, unpublished). Further understanding of potential variation in ligand-induced PPARg conformation might provide a molecular basis for variation in biological responses to in vivo treatment with different agonists. An important question concerns the extent to which different receptors (or different conformations of the same receptor in response to binding of alternative ligands) can differentially interact with subsets of the spectrum of coactivators. In other words, does signaling specificity reside at the level of direct interactions between receptors and coactivator? There appear to be clear differences in the ability of individual receptors to interact with corepressors; thus, unlike TR or RAR, PPARg does not readily associate with nuclear receptor corepressor (N-CoR) (36). In addition, ligandinduced association of coactivators (SRC-1 and p140) with RXR is differentially regulated by the heterodimeric partner; this is permitted in the case of PPARg/RXR but not in the case of RAR/RXR heterodimers (36). However, RAR was shown to actually block binding of ligands to RAR/RXR heterodimers. Therefore, the ability of any given receptor LBD to exhibit differential interactions with multiple coactivators has not been adequately explored. Several investigators have reported that PPARg exhibits a ligand-induced association with SRC-1 (11, 33, 36). Our data indicate that PPARg can also be induced to strongly associate with CBP, suggesting an important role for both SRC-1 and CBP in PPARgmediated regulation of gene transcription. In addition, the results we obtained with either SRC-1 or CBP using several compounds from the two important classes of PPARg ligands appeared to be nearly identical. CBP has been shown to be a universal coactivator or integrator required for many transcription factors, including nuclear receptors, AP-1 (6, 37), signal transducer and activator of transcription-1 (STAT-1) (38), cAMP-regulated enhancer binding protein (CREB) (39), and nuclear factor kB (NF-kB). Since cellular CBP concentrations may be limiting, recruitment of CBP to PPARg in response to agonist stimulation might antagonize the activity of other CBPrequiring transcription factors. This is a potential explanation for recently reported observations concerning the ability of 15-deoxyD12,14 PGJ2 and synthetic PPARg ligands to inhibit macrophage activation and cytokine production (40, 41).

1601

In contrast to results obtained with PPARg, known ER agonists promoted the interaction of ERa with SRC-1 but not with CBP. Further characterization of the relative affinities of PPARg and ERa for either coactivator revealed that PPARg interacted with CBP with higher affinity than with SRC-1. Moreover, CBP12453, which did not interact efficiently with ERa, was unable to compete for the ERa-SRC-1 interaction. The overall rank order of affinities was: PPARg-CBP 5 ERa-SRC-1 . PPARg-SRC-1 .. ERa-CBP. Poor interaction between a peptide motif derived from the nuclear receptor-binding motif of CBP with ERa has been documented using a yeast two-hybrid system (17). However, the pattern of potential coactivators that may interact directly with ERa has not been otherwise assessed. The fact that ERa does not interact with CBP with high affinity does not exclude a role for CBP in ERa function. CBP, via a discrete domain, constitutively interacts with the CBP-binding domain of SRC-1 (6). Thus, the high-affinity interaction of ERa with SRC-1 could result in CBP recruitment to the transcriptional complex. In this regard, it is interesting to note that RAR has been shown to bind to the NH2-terminal domain of CBP; however, this binding is not required for its function since a CBP NH2-terminal deletion mutant retained the ability to augment RAR activation (42). It is clear that the differential capacity of certain nuclear receptor classes (such as TR and RAR) to interact with corepressors has important physiological consequences for in vivo repression of gene transcription. Recently reported data suggest that the degree to which receptors can associate with specific coactivators in response to ligand binding can serve to modulate the subsequent biological response. Thus, in HeLa cells in which 4-OH-tamoxifen functions as an ER antagonist, increasing the SRC-1 expression level was able to confer agonist activity upon this compound (31). The present studies provide a new and precisely quantitative approach for characterizing interactions between selected nuclear receptors and coregulators. Using this approach, we have characterized the molecular pharmacology of ligand-induced interactions between PPARg or ERa and CBP or SRC-1. Clearly, interaction of these receptors with coactivators that occurs within a complex nuclear environment in vivo may differ from the observations reported here. However, our results suggest that differential affinity profiles may exist for any given combination of receptor and coactivator. Such differences

Fig. 5. Analysis of the Interaction Affinities between Nuclear Receptor Coactivators by HTRF A, PPARg interacts with both CBP and SRC-1 while ERa does not interact with CBP. Experimental conditions were the same as described in the legends to Figs. 2 and 4. The ligands (1 mM each) were E2 for ERa and TZDA for PPARg. Unbiotinylated CBP and SRC-1 were used to compete for interactions of PPARg with biotinylated-CBP (B), PPARg with biotinylated-SRC-1 (C), and ERa with biotinylated-SRC-1 (D). E, Unlabeled full-length ERa was used to compete for interactions of PPARg with biotinylatedCBP (E) and biotinylated-SRC-1 (F). The concentrations of other components are the same as described in legends to Figs. 2 and 4. The experiment was repeated three times with similar results.

MOL ENDO · 1998 1602

may contribute to cell type-specific variation in biological responses that arise because of relative changes in the pattern of coactivator expression.

Vol 12 No. 10

introduced by HW234) and SpeI (blunt ended using Klenow DNA polymerase) and cloned into pESP-1(Stratagene) cut with BamHI and SmaI. Preparation of GST Fusion Proteins from E. coli

MATERIALS AND METHODS Reagents SA/XL665 and (Eu)K were from CIS Biointernational (Cedex, France) and Packard Instrument Company (Meriden, CT). The goat anti-GST antibody and glutathione Sepharose were from Pharmacia (Piscataway, NJ). SULFO-SMCC and SPDP were from Pierce (Rockford, IL). Dry milk was from Bio-Rad (Richmond, CA). The full-length recombinant human ER protein was purchased from ABR (Affinity Bioreagents, Inc., Golden, CO). The following six TZD compounds were kindly provided by Dr. Gerard Kieczykowski, Dr. Philip Eskola, Dr. Conrad Santini, Mr. Joseph F. Leone, and Mr. Peter A. Cicala (Merck Research Laboratories, Rahway, NJ): TZDA (AD5075) 5 5-[4-[2-(5-methyl-2-phenyl-4-oxazoly)-2-hydroxyethoxy]benzyl]-2,4-thiazolidinedione; TZDB (BRL49653) 5 5-(4-[2-[methyl-(2-pyridyl)amino]ethoxy]benzyl)thiazolidine-2,4-dione; TZDC (pioglitazone) 5 5-[[4-[(5-ethyl-2-pyridyl)ethoxy]phenyl]-methyl]2,4-thiazolidinedione; TZDD (troglitazone) 5 5-[4-(6-hydroxy2, 5, 7, 8-tetramethylchroman-2-yl-methoxy)Benzyl]-2,4thiazolidinedione; and TZDE (englitazone) 5 5-[(2-benzylbenzopyranyl)-6-methyl]-2,4-thiazolidinedione. Plasmids pGEXKG-PPARgLBD expressing GST fused with LBD (from amino acids 176 of PPARg1 to 477) of human PPARg was constructed by subcloning an XhoI-XbaI (XbaI was bluntended with T4 DNA polymerase) fragment of pSG5hPPARg/GR into pGEXKG (43) digested with XhoI and HindIII (HindIII site was blunt-ended with T4 DNA polymerase). pGEXhCBP1–453, which expresses human CBP NH2-terminal 1–453 amino acids (hCBP1–453), was cloned by PCR. The primers for hCBP1–453 are: 59-ACTCGGATCCAAGCCATGGCTGAGAACTTGCTGGACGG-39 and 59-CTCAGTCGACTTATTGAATTCCACTAGCTGGAGATCC-39, and the expected DNA fragment is 1.5 kb. The template used for the PCR was human fetal brain cDNA libary (Stratagene, La Jolla, CA). The PCR-amplified 1.5 kb DNA fragment was digested with NcoI and HindIII and ligated with pGEXKG expression vector digested with NcoI and HindIII to generate pGEXhCBP12453. pGEXhSRC5682780 expressing GST fused with a human SRC-1 fragment containing amino acids 568–780 was prepared by subcloning an SRC-1 PCR fragment derived from the human fetal brain cDNA libary. The primers are: 59-ACTCGGATCCAATTCACCTAGCAGATTAAATATACAACC-39 and 59-CACATCTAGATTACTGTTCTTTCTTTTCGACTTTCACC-39. The 0.6-kb fragment was then digested with BamHI and XbaI and subcloned into the pGEX-4T-1 vector (Pharmacia). pSG5-hPPARg/GR, which contains human PPARgLBD fused to murine GRDBD, was provided by Dr. Azriel Schmidt (Merck Research Laboratories). pMMTV/luc, which contains the murine mammary tumor virus (MMTV) promoter adjacent to the luciferase (luc) gene, was also provided by Dr. Azriel Schmidt. pESP1ERaLBD expressing GST fused with the LBD (amino acids 302–595) of human ERa was constructed by performing PCR on a human ERa clone using primers HW234 (59 - CGCGGATCCAAGAACAGCCTGGCCTTGTCCCTG - 39) and HW209 (59-TCAGACTGTGGCAGGGAAACCCTCTGCCTCCCCCGTGATG-39). The product was subcloned into pTGEM (Promega, Madison, WI) and sequenced by PCR (Pharmacia) and subsequent gel electrophoresis (Stratagene Castaway System). The clone was digested with BamHI (site

E. coli strain DH5a (GIBCO BRL, Gaithersburg, MD) served as a host for either pGEXhCBP1–453 or pGEXhSRC568–780 and BL21 (Stratagene) for pGEXhPPARgLBD. DH5a or BL21 was cultured in LB medium (GIBCO BRL) to a density of OD600 0.7–1.0 and induced for overexpression by addition of IPTG (isopropylthio-b-galactoside) to a final concentration of 0.2 mM. The IPTG-induced cultures were grown at room temperature for an additional 2–5 h. The cells were harvested by centrifugation for 10 min at 5000 3 g. The cell pellet was used for GST-fusion protein purification according to the recommended procedure from Phamacia Biotech using glutathione Sepharose beads. hCBP1–453 and hSRC568–780 proteins were generated by cleaving the corresponding GST fusion proteins with thrombin. Purification of GST-ERa LBD from Yeast The LBD of ERa was expressed in yeast as a GST fusion protein. Yeast strains were grown in fermentors at 28 C. The cell pellet (0.8 g/ml) was resuspended in TEGM [10 mM Tris, pH 7.2, 1 mM EDTA, 10% glycerol, 0.7% b-mercaptoethanol, 1 mM dithiothreitol (DTT), 10 mM sodium molybdate] containing one pellet/2 ml (40 ml/ml) Protease inhibitor cocktail PI (Sigma, St. Louis, MO; 50 mg/ml antipain, 0.7 mg/ml pepstatin, 2 mg/ml benzamidine), and lysed by shaking with glass beads in a bead beater. Unbroken cells were removed by low-speed centrifugation at 3000 3 g for 10 min. The supernatant was centrifuged at 100,000 3 g for 60 min yielding about 1 ml of cell extract per gram of cells. One milliliter of extract was allowed to bind 1 h at 4 C to 2 ml of glutathioneSepharose 4B (Pharmacia) in TEGM containing 5 mM DTT, 0.1% Triton X-100 (Sigma), and PI cocktail. The beads were washed extensively with PBS containing PI cocktail and finally eluted with the following buffer: 50 mM Tris, pH 8.0, 5 mM DTT, 0.1% Triton, 0.1% BSA, 0.1 M sodium chloride, PI, and 20 mM glutathione. Preparation of Eu(K)-a-GST The anti-GST antibody (500 mg, 3.33 nmol) at 5 mg/ml in 150 mM NaCl-0.02% azide was buffer exchanged into PBS, pH 6.8, with a BioSpin-30 (Bio-Rad, Richmond, CA) desalting column. To this was added 0.9 ml of a 9.4 mg/ml solution of SPDP in absolute ethanol (8.3 mg, 26.7 nmol, 8.0 eq), and the reaction was allowed to stand at room temperature for 30 min. The thiopyridine moiety was then cleaved by addition of 5 ml of 400 mM DTT in H2O (final concentration, 20 mM). After 15 min at room temperature, removal of excess DTT and buffer exchange into 50 mM Pi, 5 mM EDTA, pH 6.5, was achieved by increasing the total sample volume to 200 ml with PBS and then passaging through BioSpin 30 columns. To this was added activated Eu(K) that had been prepared by reacting 7.8 ml of a 2.5 mg/ml solution of Eu(K) in 10% DMF/PBS (19.6 mg, 13.4 nmol, 4 eq) with 1.3 ml of a 10 mg/ml solution of Sulfo-SMCC in H20 [13.0 mg, 29.8 nmol, 2.9 eq with respect to Eu(K)] at 4 C for 30 min. The reaction was allowed to stand at 4 C overnight. Purification was achieved by a two-step process. First, the material taken up to a total volume of 500 ml with PBS and buffer exchanged into PBS, pH 6.8, with a Nap-5 column. Subsequently, the protein was further purified by size exclusion chromatography using a BioSep-S2000 column coupled with a Waters 625 HPLC system using the same buffer. The materials were then frozen at 270 C until needed.


HTRF Assay Protocol SA/XL665 was used as supplied by the manufacturer. Reaction conditions were as follows: 198 ml of reaction mixture [100 mM HEPES, 125 mM KFz 0.125% (wt/vol) 3-[(3-cholamidopropyl) dimethyl-ammonio]-1-propanesulfonate (CHAPS), 0.05% dry milk, 1 nM GST-PPARgLBD or GST-ERbLBD, 2 nM anti-GST-(Eu)K, 10 nM biotin-CBP1–453 or biotin-SRC568–780, 20 nM SA/XL665] were added to each well, followed by addition of 2 ml test sample in appropriate wells. Plates were mixed by hand and covered with TopSeal. The reaction was incubated overnight at 4 C, followed by measurement of fluorescence reading on a Discovery instrument (Packard). One 96-well plate requires about 3 min. The fluorescence signal is stable for at least 3 days at 4 C. Data were expressed as the ratio, multiplied by a factor of 104, of the emission intensity at 665 nm to that at 620 nm. The ratios were directly used for plotting to obtain EC50 values. Alternatively, the ratio obtained from each tested well was normalized by subtracting results obtained from control (dimethylsulfoxide) wells, followed by calculation of percent maximum activation (using maximal ligand-induced FRET as 100%). Transient Transfections COS-1 cells were transfected with plasmid DNA constructs using a standard lipofectamine method (GIBCO/BRL). COS-1 cells were seeded in 96-well plates at 1.2 3 104 cells per well in DMEM containing 10% charcoal stripped FCS for 16–20 h before transfection. Cells were cotransfected with pSG5hPPARg/GR wild-type or pSG5-hPPARgE471A/GR mutant, pMMTV/luc reporter construct, and pSV-b-galactosidase as internal standard for variation in transfection efficiency and sample toxicity. The DNA-lipid complex was removed after 5 h. The cells were exposed to test compounds in DMEM containing 5% charcoal-stripped FCS. Cell lysates were prepared with Reporter Lysis Buffer (Promega, Madison, WI). Luciferase activity in cell extracts was determined using Luciferase Assay Buffer (Promega) in a ML3000 Luminometer (Dynatech Laboratories, Chantilly, VA). GST Pull-Down Assay GST-hCBP1–453 protein (1–2 mg) bound to glutathione Sepharose (10 ml) was incubated with 0.2 mg of purified hPPARgLBD in 100 ml Buffer A [8 mM Tris, pH 7.4, 120 mM KCl, 8% glycerol, 0.5% (wt/vol) CHAPS, 1 mg/ml BSA] for 12–16 h at 4 C. Samples were pelleted by centrifugation at 11,000 3 g for 20 sec and washed four times with 300 ml cold Buffer A. The samples were then suspended in 20 ml Laemmli sample buffer, heated for 5 min at 100 C, and electrophoresed in 4–20% SDS-polyacrylamide gels. Electrophoretically separated proteins were electroblotted onto polyvinylidene difluoride (PVDF) membrane. The membrane was blocked in TBST buffer (10 mM Tris, pH 8.0, 150 mM NaCl, 0.2% Tween 20) containing 5% dry milk for 1 h at room temperature. The primary rabbit antihuman PPARgLBD antibody was raised against purified recombinant hPPARgLBD. Primary antibody incubation was performed in TBST buffer containing 5% dry milk at 4 C for 12–16 h. Secondary antibody incubation and chemiluminescent detection with enhanced chemiluminescence (ECL) (Amersham, Arlington Heights, IL) were performed as described in instructions provided by the manufacturer.

Acknowledgments We thank Drs. Joel Berger and Mark D. Leibowitz for helpful discussions. We appreciate the preparation of TZDA, TZDB, TZDC, TZDD, and TZDE by Dr. Gerard Kieczykowski, Dr. Philip Eskola, Dr. Conrad Santini, Mr. Joseph F. Leone, and

1603

Mr. Peter A. Cicala (Merck Research Laboratories, Rahway, NJ). We thank Dr. Azriel Schmidt (Merck Research Laboratories) for plasmids pSG5-hPPARg/GR and pMMTV/luc. We also thank Dr. Barbara Leiting for providing a protein purification procedure. We gratefully acknowledge the excellent technical assistance of Sheng-Jian Cai and Gretel Salzmann.

Received April 17, 1998. Revision received June 5, 1998. Accepted June 16, 1998. Address requests for reprints to: Gaochao Zhou, Merck Research Laboratories, 126 East Lincoln Avenue, RY 80N31C, Rahway, New Jersey 07065. E-mail: Gaochao Zhou@ Merck.com.

REFERENCES 1. Mangelsdorf DJ, Thummel C, Beatro M, Herrlich P, Schurtz G, Umesono K, Blumberg B, Kastrner P, Mark M, Chambon P, Evans RM 1995 The nuclear receptror superfamily: the second decade. Cell 83:835–839 2. Kliewer SA, Umesono K, Noonan DJ, Heyman RA, Evans RM 1992 Convergence of 9-cis retinoic acid and peroxisome proliferator signaling pathways through heterodimer formation of their receptors. Nature 358:771–774 3. Yu VC, Delsert C, Andersen B, Holloway JM, Devary OV, Naar AM, Kim SY, Boutin JM, Glass CK, Rosenfeld MG 1991 RXRb: a coregulator that enhances binding of retinoic acid, thyroid hormone, and vitamin D receptors to their cognate response elements. Cell 67:1251–1266 4. Chambon P 1994 The retinoid signaling pathway: molecular and genetic analyses. Semin Cell Biol 5:115–125 5. Tsai MJ, O’Malley BW 1994 Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 63:451–486 6. Kamei Y, Xu L, Heinzel T, Torchia J, Kurokawa R, Gloss B, Lin SC, Heyman RA, Rose DW, Glass CK, Rosenfeld MG 1996 A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell 85:403–414 7. Cavailes V, Dauvois S, Danielian PS, Parker MG 1994 Interaction of proteins with transcriptionally active estrogen receptors. Proc Natl Acad Sci USA 91:10009–10013 8. Chen JD, Evans RM 1995 A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 377:454–457 9. Chakravarti D, LaMorte VJ, Nelson MC, Nakajima T, Schulman IG, Jugulion H, Montminy M, Evans RM 1996 Role of CBP/p300 in nuclear receptor signalling. Nature 383:99–103 10. Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1995 Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270:1354– 1357 11. Zhu Y, Qi C, Calandra C, Rao MS, Reddy J 1996 Cloning and identification of mouse steroid receptor coactivator-1 (mSRC-1), as a coactivator of peroxisome proliferator-activated receptor g. Gene Expression 6:185–195 12. Voegel JJ, Heine MJ, Zechel C, Chambon P, Gronemeyer H 1996 TIF2, a 160 kDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors. EMBO J 15:3667–3675 13. Hong H, Kohli K, Garabedian MJ, Stallcup MR 1996 CRIP1, a transcriptional coactivator for the AF-2 transactivation domain of steroid, thyroid, retinoid, and vitamin D receptors. Mol Cell Biol 17:2735–2744 14. Yang XJ, Ogryzko VV, Nishikawa J, Howard BH, Nakatani Y 1996 A p300/CBP-associated factor that com-

MOL ENDO · 1998 1604

15. 16.

17. 18.

19. 20. 21. 22.

23. 24.

25.

26. 27.

28.

29.

30.

petes with the adenoviral oncoprotein E1A. Nature 382:319–324 Ogryzko VV, Schiltz RL, Russanova V, Howard BH, Nakatani Y 1996 The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell 87:953–959 Spencer TE, Jenster G, Burcin MM, Allis CD, Zhou J, Mizzen CA, McKenna NJ, Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1997 Steroid receptor coactivator-1 is a histone acetyltransferase. Nature 389:194–198 Heery DM, Kalkhoven E, Hoare S, Parker MG 1997 A signature motif in transcriptional co-activators mediates binding to nuclear receptors. Nature 387:733–736 Xu J, Qiu Y, DeMayo FJ, Tsai SY, Tsai MJ, O’Malley BW 1998 Partial hormone resistance in mice with disruption of the steroid receptor coactivator-1 (SRC-1) gene. Science 279:1922–1925 Kolb A, Neumann K, Mathis G 1996 New developments in HTS technology. Pharm. Manuf. Int. 31:31–39 Dickson EF, Pollak A, Diamandis EP 1995 Time-resolved detection of lanthanide luminescence for ultrasensitive bioanalytical assays. J Photochem Photobiol 27:3–19 Holzwarth AR 1995 Time-resolved fluorescence spectroscopy. In: Sauer K (ed) Methods in Enzymology. Academic Press, San Diego, CA, pp 334–362 Orellana A, Laukkanen ML, Keinanen K, 1996 Europium chelate-loaded liposomes: a tool for the study of binding and integrity of liposomes. Biochim Biophys Acta 1284:29–34 Mathis G 1993 Rare earth cryptates and homogeneous fluoroimmuno assays with human sera. Clin Chem 39: 1953–1959 Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO, Willson TM, Kliewer SA 1995 An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor g. J Biol Chem 270:12953– 12956 Berger J, Bailey P, Biswas C, Cullinan CA, Doebber TW, Hayes NS, Saperstein R, Smith RG, Leibowitz MD 1996 Thiazolidinediones produce a conformational change in peroxisomal proliferator-activated receptor-g: binding and activation correlate with antidiabetic actions in db/db mice. Endocrinology 137:4189–4195 Lebovitz HE 1993 Insulin mimetic and insulin-sensitizing drugs. Diabetes Res Clin Pract 20:89–91 Forman BM, Tontonoz P, Chen J, Brun RP, Spiegelman BM, Evans RM 1995 15-deoxy-prostaglandin J2 is a ligand for the adipocyte determination factor PPARg. Cell 83:803–812 Kliewer SA, Lenhard JM, Willson RM, Patel I, Morris DC, Lehmann JM 1995 A prostaglandin J2 metabolite binds peroxisome proliferator-activated receptor g and promotes adipocyte differentiation. Cell 83:813–819 Tremblay GB, Tremblay A, Copeland NG, Gilbert DJ, Jenkins NA, Labrie F, Giguere V 1997 Cloning, chromosomal localization, and functional analysis of the murine estrogen receptor b. Mol Endocrinol 11:353–365 George G, Kuiper LM, Carlsson B, Grandien K, Enmark E, Haggblad J, Nilsson S, Gustafsson JA 1997 Comparison

Vol 12 No. 10

31.

32.

33.

34.

35.

36.

37. 38.

39.

40.

41. 42.

43.

of the ligand binding specificity and transcript tissue distribution of estrogen receptors a and b. Endocrinology 138:863–870 Smith CL, Nawaz Z, O’Malley BW 1997 Coactivator and corepressor regulation of the agonist/antagonist activity of the mixed antiestrogen, 4-hydroxytamoxifen. Mol Endocrinol 11:657–666 McInerney EM, Tsai MJ, O’Malley BW, Katzenellenbogen BS 1996 Analysis of estrogen receptor transcriptional enhancement by a nuclear hormone receptor coactivator. Proc Natl Acad Sci USA 93:10069–10073 Krey G, Braissant O, L’Horset F, Kalkhoven E, Perroud M, Parker MG, Wahli W 1997 Fatty acids, eicosanoids, and hypolipidemic agents identified as ligands of peroxisome proliferator activated receptors by coactivatordependent receptor ligand assay. Mol Endocrinol 11: 779–791 DuBois RN, Gupta R, Brockman J, Reddy BS, Krakow SL, Lazar MA 1998 The nuclear eicosanoid receptor, PPARgamma, is aberrantly expressed in colonic cancers. Carcinogenesis 19:49–53 McDonnell DP, Clemm DL, Hermann T, Goldman ME, Pike JW 1995 Analysis of estrogen receptor function in vitro reveals three distinct classes of antiestrogens. Mol Endocrinol 9:659–669 DiRenzo J, Soderstrin M, Kurokawa R, Oliastro MH, Ricote M, Ingrey S, Horlein A, Rosenfeld MG, Glass CK 1997 Peroxisome proliferator-activated receptors and retinoic acid receptors differentially control the interactions of retinoid 3 receptor heterodimers with ligands, coactivators, and corepressors. Mol Cell Biol 17:2166– 2176 Bannister AJ, Kouzarides T 1995 CBP-induced stimulation of c-Fos activity is abrogated by E1A. EMBO J 14:4758–4762 Zhang JJ, Vinkemeier U, Gu W, Chakravarti D, Horvath CM, Darnell Jr JE 1996 Two contact regions between Stat1 and CBP/p300 in interferon gamma signaling. Proc Natl Acad Sci USA 93:15092–15096 Kwok PP, Lundblad JR, Chrivia JC, Richards JP, Bachinger HP, Brennan RG, Roberts SG, Green MR, Goodman RH 1994 Nuclear protein CBP is a coactivator for the transcription factor CREB. Nature 370:223–226 Ricote M, Li AC, Willson TM, Kelly C, Glass CK 1998 The peroxisome proliferator-activated receptor-g is a negative regulator of macrophage activation. Nature 391: 79–82 Liang C, Ting AT, Seed B 1998 PPAR-g agonists inhibit production of monocyte inflammatory cytokines. Nature 391:82–86 Kurokawa R, Kalafus D, Ogliastro MH, Kioussi C, Xu L, Torchia J, Rosenfeld MG, Glass CK 1998 Differential use of CREB binding protein-coactivator complexes. Science 279:700–703 Guan KL, Dixon LE 1991 Eukaryotic proteins expressed in Escherichia coli: an improved thrombin cleavage and purification procedure of fusion proteins with glutathione S-transferase. Anal Biochem 192:262–267