Optimisation of Polymerase Chain Reaction Recombinant DNA Technology, 7.5p (MBC111) Lab Report Version-1 (04/03/2008)
Authors: Mazhar Gull
[email protected] Molecular biology-08 Umer Naveed Chaudhary
[email protected] Molecular biology -08
Lab supervisors: Sazzad Karim
[email protected] Elie Järnmark elie.jä
[email protected] School of Life Sciences University of Skövde, Box 408 541 28 Skövde, Sweden
Summary Polymerase chain reaction (PCR) technique is used to manipulate and replicate DNA from a specific sequence of interest. Two primers (forward and reverse); each of them is complementary to the each strand of template DNA, thermo stable DNA polymerase, deoxyribonucleoside tri phosphate (dNTPs) magnesium and buffer are involved in this amplification. PCR amplification also needs an automated thermocycler to run the reactions in many cycles of denaturation, annealing of primer and polymerization. The aim of this study was the optimisation of reaction condition using different concentration of the template DNA, DNA polymerase, MgSO4, annealing temperature for maximum yield of PCR product. The optimal vent DNA polymerase concentration was 0.5U/20µl.
Table of Contents 1. Introduction .....................................................................................................1 2. Materials and Methods ....................................................................................1 2.1 Experimental set up for PCR .....................................................................1 2.2 Gel electrophoresis ....................................................................................3 3. Results .............................................................................................................3 4. Discussion .......................................................................................................4 5. References.......................................................................................................4
Optimisation of Polymerase Chain Reaction
1. Introduction Polymerase chain reaction (PCR) is an enzymatic repetitive manipulation of the DNA sequence of interest in vitro (Reece, 2004). According to Mullis, it is a simple, rapid, inexpensive, and oligonucleotide primer directed enzymatic process for manipulation of large amount of DNA from a specific target sequence (Mullis et al., 1987). The complementary strands of the double stranded DNA target sequence are denatured by heating up to 95ºC to form single strand DNA which act as template. The separated strands are then cooled around 53ºC in the presence of primers which are complementary to each strand. This results in annealing process (Guyer et al., 1989). The temperature is raised up to 72ºC and heat stable DNA polymerase attaches to the each template and copy target sequence with the help of free deoxyribonucleoside tri phosphate (ddNTPs).the DNA polymerase must be heat stable so that it can tolerate the heat during denaturation processes. Two primers which are complementary to each strand attach at 3´ ends, and by elongation each primer makes a template for annealing the other primer. Exact replicas of target sequence are produced in short time. After the elongation again the temperature raised to separate the double stranded DNA containing both original DNA and its replica to start a new cycle. These cycles are repeated generally for 30 or more times to get a more amount of target DNA sequence in between two primer binding sites (Reece, 2004). For the more trustworthy results all the parameters should be optimised. In this laboration the optimisations of reaction was done by different standards which were different template DNA, different MgSO4 concentrations, annealing temperature and DNA polymerase concentrations.
2. Materials and Methods 2.1 Experimental set up for PCR All the steps of laboration work were performed by following the instruction in the laboratory compendium for the course of recombinant DNA technology (Karim and Järnmark, 2008). Master mix which was prepared for PCR having all the reagents except the DNA polymerase because that was under consideration. The concentration of master mix with variable dilution of DNA polymerase is given in Table 1. The concentrations of DNA polymerase which were used varied from 1U/20µl to 0.05U/20µl.The composition of the master mix using different concentrations are given in Table 1.
1
Table 1. Master mix formulation PCR Reagents Reagents concentrations
Master Mix
Template DNA (10ng/µl)
1µl 1µl 1µl 1µl 5µl (20ng) (20ng) (20ng) (20ng) dNTPs (2.5mM) 1.6µl 1.6µl 1.6µl 1.6µl 8µl (200µM) (200µM) (200µM) (200µM) PCR buffer (10X) 2µl 2µl 2µl 2µl 10µl (1X) (1X) (1X) (1X) 0.6µl 0.6µl 0.6µl 0.6µl 3µl MgSO4 (25mM) (3mM) (3mM) (3mM) (3mM) Primer 1 (10µM) 0.25µl 0.25µl 0.25µl 0.25µl 1.25µl (0.5µM) (0.5µM) (0.5µM) (0.5µM) Primer 2 (10µM) 0.26µl 0.26µl 0.26µl 0.26µl 1.3µl (0.5µM) (0.5µM) (0.5µM) (0.5µM) DNA polymerase 1µl 0.5µl 0.25µl 0.05µl (2U/20µl) (1U/20µl) (0.5U/20µl) (0.1U/20µl) Deionised water 13.2µl 13.8µl 14µl 14.2µl 71µl _______________________________________________________________ Total reaction volume 20µl 20µl 20µl 20µl 98.53µl * dNTPs = Deoxynucleotide triphosphate
The concentartion of DNA polymerase is varying from 0.1U – 2 U/20 µl is given in Table 1. The different concentrations (2U/20µl) (1U/20µl) (0.5U/20µl) (0.1U/20µl) were diluted properly so that volume of different concentration (1µl ,0.5µl, 0.25µl, 0.05µl) could be taken in the PCR vial. Optimization of MgCl2 Optimization of MgCl2 concentration was done between 0 to 6 mM/20 µl. Optimization of DNA template. Optimization of DNA template was done between 1 pg to 10 ng concentrations. Optimization of PCR annealing temperature. Optimization of annealing temperature was done between 46°C to 70°C. The thermocycler was run according to the programme given in Table 2. The PCR programme consists of three steps of denaturation, annealing and extension (Table 2). After the first cycle the whole process was repeated 29 times. At the end of 30 cycles the PCR product was given final extension at 72ο C for 15 minutes so that the entire PCR product gets properly amplified. Table 2. Thermocycler programme
Process
temperature (°C)
1) Initial denaturation 2) Denaturation 3) Annealing 4) Extension Repeat steps 2-4 for 29 times 5) Final Extension 6) Stop
Time (minutes)
95 ºC 95 ºC 55 ºC 72 ºC
5 min 30 sec 1min 1 min
72 ºC 4 ºC
5 min for ever
2
Table 2, shows the amount of time for which each step is performed during a PCR reaction.
Forward Primer sequence- 5'GAAAATCATGGGTTCTTTCTTCTCAGC3' Reverse Primer sequence- 5' CGGAGAGTCACTTAGCCAGAGACCTA3' 2.2 Gel electrophoresis The 0.8% agarose gel was prepared according to the instruction given in the laboratory compendium for the course of recombinant DNA technology (Karim and Järnmark, 2008) and gel image of product was taken.
3. Results The optimisation of various parameters was done in this PCR reaction. By measuring the amount of products the higher optimised concentration will be used for farther experiments. DNA polymerase was optimised in four different concentrations which vary from 1-0.05U/ 20µl. the optimised concentration of magnesium was 2nM, DNA template having 10ng optimised value and the annealing temperature was 60 ºC because at these optimised values higher PCR product was obtained. Figure 1.Gel image of DNA polymerase amplification. 1U 0.5U 0.25U 0.05U
3
Figure 1. The gel image shows the amplification of DNA by using different concentration of DNA polymerase which varies from 1-0.05U/20ul. The bands were present in 0.5U and 0.25 concentrations.
4. Discussion The purpose of this laboration was to optimise the different variables during PCR reaction to get maximum amount of amplify DNA. Four different concentrations of DNA polymerase were used and it was expected that the higher concentration of DNA polymerase will produce higher amount of amplified DNA, but it did not happened during the laboration. There was no band produced by the 1U DNA polymerase on agarose gel but only smear formation. There was some experimental error with that concentration or that amount is very high for PCR reaction. The most suitable concentration of the DNA polymerase was between 0.5-0.25U/20ul because at these concentrations apparent, broad and clear bands were present on gel image. At 0.05U concentration there was no clear band on agarose gel. It does not mean that there was no amplification of DNA but due to lowest concentration of DNA polymerase only a non significant DNA produced which was not enough to produce any band on agarose gel. Both DNA polymerase concentrations (0.5-0.25) can be used for further amplification but we must use the higher concentration (0.5U) because we expect that the higher concentration will produce more amount of amplified DNA. Its is suggested from the results that the optimised parameters for PCR are 0.5U/20μl DNA polymerase, 10ng/μl template, 60˚C annealing temperature and 2mM MgSO4 concentration.
5. References Mullis, K. and Faloona, F. A. (1987) Specific synthesis of DNA in vitro via a polymerase catalyzed chain reaction. Meth. in Enzymol. 255:335-350. Reece, R. (2004) Analysis of gene and genome. NJ 07030, USA, Willey Ltd. Guyer, R.L. and Koshland, D.E. (1989) The Molecule of the year. Jr science. 246:1543-1546
4
