Oryza sativa L. - CiteSeerX

2216 Romesh K. Salgotra1 Reginald J. Millwood1 Sujata Agarwal2 C. Neal Stewart Jr.1 1

Plant Molecular Genetics, Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA 2 Genomic Hub, Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA

Received March 29, 2011 Revised April 27, 2011 Accepted April 27, 2011

Electrophoresis 2011, 32, 2216–2222

Research Article

High-throughput functional marker assay for detection of Xa/xa and fgr genes in rice (Oryza sativa L.) We apply CE for high-throughput analysis of functional markers for marker-assisted selection in rice. The accuracy, throughput and reproducibility of CE analysis for sequence-tagged site (STS) and simple sequence repeat (SSR) markers for bacterial blight resistance and aroma genes are demonstrated by using a CE system. Multiplex PCR products displayed well-differentiated allelic variants using different STS and SSR markers for identification of xa13, Xa21 and fgr genes using the CE system compared to 1.2% agarose gel images. Moreover, consumption of PCR product is much less in the CE system compared to traditional agarose gel systems. Sample consumption is less than 0.1 mL per analysis, thereby conserving samples for further downstream analysis. Out of 29 genotypes in BC1F3 generation, 16 plants were found homozygous for all the three genes, viz., xa13, Xa21 and fgr. These homozygous lines can be used as potential donors in rice breeding programmes. Keywords: CE / Marker-assisted selection / Oryza sativa L / STS and SSR assay DOI 10.1002/elps.201100196

1 Introduction

Correspondence: Professor Charles Neal Stewart Jr., Genomic Hub, Department of Plant Sciences, 2431 Joe Johnson Drive, University of Tennessee, Knoxville, TN 37996 USA E-mail: [email protected] Fax: 11-865-946-1989

useful marker was developed from this polymorphism for marker-assisted selection (MAS). The efficiency of molecular markers for the improvement of rice quality traits has been successfully utilised in previous studies [6–9]. A major nuclear recessive gene has been reported to control the formation of fragrance in rice with a molecular marker for grain fragrance identified [10]. restriction fragment length polymorphism analysis showed that the fragrance locus was linked to a single-copy DNA clone, RG28, on chromosome 8 of rice, at a distance of 4.5 cM. A number of PCR-based markers have been developed to detect fragrance and assist breeders in this trait selection using MAS [11–13]. Pyramiding different resistance genes into a rice cultivar would create an important genetic resource as a source of material for introgression into locally adapted cultivars. Gene pyramiding (gna, cry1Ac and cry2A) through transgenic approach and co-transformation with gna and the Xa21 gene of elite Chinese rice cultivars has been successfully demonstrated [14]. In rice, pyramiding dominant and recessive bacterial leaf blight (BLB)-resistance genes was accomplished to improve conventional inbred varieties [15, 16]. Enhanced BLB resistance, evidenced as a reduction in lesion length, was attributed to possible interactions of pyramided resistance genes, and has been reported in earlier gene pyramiding programmes for BLB resistance

Abbreviations: BB, bacterial blight; BLB, bacterial leaf blight; bp, base pair; FM, functional marker; MAS, marker-assisted selection; SSR, simple sequence repeat; STS, sequencetagged site

Current address: Division of Plant Breeding and Genetics, Shere-Kashmir University of Agricultural Sciences and Technology of Jammu, Chatha, Jammu-190008 (J & K), India Colour Online: See the article online to view Figs. 1–3 in colour.

Rice (Oryza sativa L.) is an important food crop that serves as a major carbohydrate source for nearly half of the world’s population. Bacterial blight (BB) of rice caused by Xanthomonas oryzae pv. oryzae (Xoo) is one of the most destructive diseases throughout the world [1]. The yield loss caused by BB can be over 50% when rice plants are infected at the maximum tillering stage. In its greatest severity, the disease can cause yield loss ranging from 74 to 81% in susceptible cultivars [2]. Chemical control for BB is not highly effective [3]. Breeding for resistance is considered to be the most effective, economical and environmentally safe approach for achieving yield stability. Aroma in rice is an important trait for many breeding programmes, and a major fragrance gene on chromosome 8 (betaine aldehyde dehydrogenase 2, BAD2) has been positionally cloned [4]. A loss of function (fragrance) caused by an 8-base pair (bp) deletion was identified [5]. Thus, a very

& 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

www.electrophoresis-journal.com

Nucleic acids


[17–20]. Recently, a functional marker (FM) for the recessive resistance gene xa5 was developed [21]. In the case of xa13 gene, markers reflecting expression variations between resistant and susceptible parents were identified [22]. In the present study, an FM for Xa21 was developed from the coding sequence of both alleles [23]. This FM is expected to enhance the reliability of MAS, as it helps in direct selection of genes involved in BLB resistance. Traditional agarose and polyacrylamide gel electrophoresis have been widely used in the earliest molecular marker analyses. These techniques require simple devices and although the electrophoretic procedure can be done in most laboratories, it is labour-intensive (e.g. gel preparation, staining and photography), especially for gene mapping and genomic linkage mapping, which requires large population sizes and many molecular markers. The major limitations of these two protocols are, they are not always amenable for accurately calculating the sizes of alleles and recording of data in an electronic format, making downstream analysis problematic. CE technology is widely used in simple sequence repeat (SSR) and AFLP analyses [24]. DNA analyses using CE provides automated and accurate estimates of allele sizes. However, the high cost of the CE instrument, reagents, labeled primers and sample preparation make the use of most capillary sequencers uneconomical for routine analyses. In comparison, the CE using the QIAxcel instrument (Qiagen, USA) is a relatively inexpensive instrument that uses disposable micro-channel cartridges containing sieving-gel matrix with ethidium bromide dye to generate both gel images and determination of allele sizes. Most small- to mid-sized labs can afford this device for SSR, sequence-tagged site (STS) and other marker assays. The CE system does not require primer labelling and provides comparable resolution as other capillary sequencers in one-tenth of running time (for 96 PCR samples). The present study was designed to identify desirable recombinants that combine BB resistance with aroma quality traits in BC1F3 generation derived from the cross between aromatic breeding line IRS 544-1-2 and BB resistance, IRBB55 developed earlier at [25]. We have used marker-assisted backcross breeding to introgress the Xa21, and xa13 resistance genes into the aromatic breeding line. In the absence of markers, identifying backcrossed plants that have recessive genes would require progeny testing, which is an addition of one more generation and cumbersome too. Therefore, we would not able to distinguish, through phenotypic screens, rice lines that have only Xa21 or xa13 from those having both genes. Background analysis using mapped SSR markers was integrated with foreground selection for BB resistance genes to identify superior lines with maximum recovery of the recipient genome along with the quality traits and minimum non-targeted genomic introgressions of the donor chromosomes. Here, we report the development of a high-throughput ‘‘single-tube assay’’ method based on multiplexing FMs for the unambiguous identification of BB resistance genes, xa13 and Xa21 along with aroma in BC1F3 generation derived from the cross & 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

2217

between aromatic breeding line IRS 544-1-2 and nonaromatic donor of BB resistance, IRBB55. We also demonstrate the utility of FM-based assay for the identification of introgressed genes. The study also provides evidence for the accuracy and consistency with which the methodology can be applied on a large scale in MAS. To our knowledge, this is the first report of a FM-based multiplex genotyping assay using CE employed in MAS for the identification of introgressed BB resistance genes in rice.

2 Materials and methods 2.1 Plant materials IRS 544-1-2 is a secondary selection from INGER nursery from International Rice Research Institute, Philippines (IRRI), and a medium short duration (135 days), medium tall, sturdy stem and lengthy panicle aromatic breeding line. IRBB55, the donor parent, carrying two BLB resistance genes, namely, xa13 and Xa21, introgressed from Oryza rufipogan in the background of IR24, a widely grown rice (Oryza sativa L.) variety developed at IRRI. IRBB55 carrying two resistant genes, xa13 and Xa21, was used as male donor and crossed with IRS 544-1-2 to obtain the F1. The F1 was backcrossed to IRS 544-1-2 to obtain BC1F1 and selfed to obtain subsequent generations.

2.2 Sampling procedure and DNA extraction Generations were advanced from BC1F1 to BC1F3 after making suitable selections for BB-resistant plants. Individual plants were selected from BC1F3 generation along with parents for analysis. Total genomic DNA of the two parents and the individual progeny plants was isolated from 3-wk-old plants using a CTAB method [26]. Purity and concentration of DNA was monitored spectrophotometrically at a wavelength of 260 and 280 nm using NanoDrop ND-1000 spectrophotometer (Wilmington, USA). All DNA samples were diluted to a working concentration of 50 ng/mL with distilled water. After adjusting the final DNA concentrations to 50 ng/mL, the DNA samples were stored at 201C.

2.3 DNA marker analysis FMs, RG136 and pTA248, closely linked to the BLB resistance genes, xa13 and Xa21, respectively were used to confirm the presence of the resistance gene. The RG136 marker (F 5 CATTGGATGGGTTGACACAG and R 5 TAG CTTCGCGTCTTGGAGAT) for xa13 [27] and the pTA248 marker (F 5 ATAGCAACTGATTGCTTGG and R 5 CGATC GGTATAACAGCAAAAC) for Xa21 [28] were used for identification of genes in BC1F3 generation. The aroma marker RM515 was used to identify the aromatic rice lines. Amplification with a forward primer (TAGGACGACwww.electrophoresis-journal.com

2218


R. K. Salgotra et al.

CAAAGGGTGAG) and a reverse primer (TGGCCTGCTC TCTCTCTCTC) was done for identification of fgr gene located on the short arm of rice chromosome 8 [29].

2.4 Multiplex PCR amplification Multiplex PCR is a variant of PCR in which two or more target sequences can be amplified by including more than one pair of primers in the same reaction. Multiplex PCR requires that primers lead to amplification of unique regions of DNA, both in individual pairs and in combinations of many primers, under a single set of reaction conditions. In addition, methods must be available for the analysis of each individual amplification product from the mixture of all the products. PCR was performed in a 25 mL reaction mixture containing 50 ng of template DNA, 5 pmol of each forward and reverse primer, and 2 multiplex PCR buffer. PCR was initiated by denaturation at 941C for 4 min followed by 35 cycles of PCR amplification with the following parameters: 2 min of denaturation at 941C, 45 s at 59.51C for primers annealing, and 1 min of primers extension at 721C. A final 7 min incubation at 721C was allowed for the completion of primers extension. Ten microlitre PCR sample reactions were loaded into each well of a horizontal 1.2% agarose gel containing 0.5 mg/mL of ethidium bromide in 1 TBE (tris-boric acid-EDTA) buffer. Products were separated at 120 V for 2 h and visualised TM using a gel documentation system (Versa Doc MP System, BioRad, USA). A 100 bp DNA ladder was used to estimate allele sizes in bps for gel. Microsatellite markers were used to assess the relative contribution of the two parental genomes of the segregants

and to identify selections with greater genetic similarity with the recurrent parent. For background selections, genomic DNA was isolated from 35-day old plants using the CTAB method [30]. Twenty primer pairs covering all 12 chromosomes were selected for the genetic diversity analysis on the basis of published rice microsatellite framework map (Table 1). The original source, repeat motifs, primer sequences and chromosomal positions for these markers can be found in rice genome database (http://www.gramene.org). Preference was given to those SSRs that have been extensively used for the analysis of aromatic rice. Individual PCRs were carried out using 50 ng of template DNA, 5 pmol of each forward and reverse primer, 10 mM dNTPs, 10 PCR buffer, 25 mM MgCl2, and 5 U of Taq DNA polymerase in a total volume of 20 mL. Template DNA was initially denatured for 941C for 5 min followed by 35 cycles of PCR amplification with the following cycling conditions of 30 s denaturation at 941C, 30 s primer annealing at 551C [24], 1 min extension at 721C and a final extension of 721C for 7 min. Ten microlitre PCR samples from the reactions were loaded into each well of a horizontal 3% MetaPhors agarose gel (Cambrex Bio Science, Rockland, Maine, USA) made with 1 TBE (Tris-boric acid-EDTA) buffer. Products were separated at 120 V for 3 h and visualised under a gel docuTM mentation system (Versa Doc MP System, BioRad, USA). A 25 bp DNA ladder was used to estimate allele sizes in bps for gel.

2.5 CE The duplicate samples of the PCR products described above were transferred (12-tube strips) directly from the thermo-

Table 1. Microsatellite markers employed for polymorphism assay Marker

Chromosome

Repeat motifs

Forward primer (50 –30 )

Reverse primer (50 –30 )

RM1 RM13 RM16 RM19 RM44 RM60 RM72 RM129 RM161 RM173 RM179 RM202 RM216 RM224 RM234 RM242 RM252 RM257 RM263 RM333

1 6 3 4 8 3 8 1 5 5 12 11 10 11 7 9 4 9 2 10

(GA)26 (GA)6-(GA)16 (TCA)5(GA)16 (ATC)10 (GA)16 (AATT)5AATCT(AATT) (TAT)5C(ATT)15 (CGG)8 (GA)20 (CCT)7 (TG)7 (GA)30 (CT)18 (AAG)8(AG)13 (CT)25 (CT)26 (CT)19 (CT)24 (CT)34 (TAT)19(CTT)19

GCGAAAACACAATGCAAAAA TCCAACATGGCAAGAGAGAG CGCTAGGGCAGCATCTAAA CAAAAACAGAGCAGATGAC ACGGGCAATCCGAACAACC AGTCCCATGTTCCACTTCCG CCGGCGATAAAACAATGAG TCTCTCCGGAGCCAAGGCGAGG TGCAGATGAGAAGCGGCGCCTC TCGCGCTTCTTCCTCGTCGACG CCCCATTAGTCCACTCCACCACC CAGATTGGAGATGAAGTCCTCC GCATGGCCGATGGTAAAG ATCGATCGATCTTCACGAGG ACAGTATCCAAGGCCCTGG GGCCAACGTGTGTATGTCTC TTCGCTGACGTGATAGGTTG CAGTTCCGAGCAAGAGTACTC CCCAGGCTAGCTCATGAACC GTACGACTACGAGTGTCACCAA

GCGTTGGTTGGACCTGAC GGTGGCATTCGATTCCAG AACACAGCAGGTACGCGC CTCAAGATGGACGCCAAGA TCGGGAAAACCTACCCTACC ATGGCTACTGCCTGTACTAC GCATCGGTCCTAACTAAGGG CGAGCCACGACGCGATGTACCC TGTGTCATCAGACGGCGCTCCG CCCGCTTGCAGAGGAAGCAGCC CCAATCAGCCTCATGCCTCCCC CCAGCAAGCATGTCAATGTA TGTATAAAACCACACGGCCA TGCTATAAAAGGCATTCGGG CACGTGAGACAAAGACGGAG TATATGCCAAGACGGATGGG ATGACTTGATCCCGAGAACG GGATCGGACGTGGCATATG GCTACGTTTGAGCTACCACG GTCTTCGCGATCACTCGC




Nucleic acids

2219

Figure 1. Allele sizes of one genotype (out of 29 segregants) of BC1F3 population of rice with STS (pTA248, RG136) and SSR (RM515) markers presented by the CE system (top). Gel images are shown from the analysis using 1.2% agarose gel (bottom).

cycler into the sample tray of the QIAxcel CE system. Separation was performed using the OL700 method (sample injection voltage 8 KV, 20 s, separation voltage 3 KV and separation time 700 s) in a 12-channel gel cartridge (GCK5000, Qiagen, USA). The sizes of the alleles resolved from the subsequent separation were automatically calcuTM lated in bps and exported using the BioCalculator software, which provides a gel view and an electropherogram of the separation. PCR products and alignment markers were assayed using QIAxcel automatic sequencer and data were analysed with BioCalculator software as per the manufacturer’s instructions.

3.2 CE for confirmation of xa13, Xa21 and fgr genes The multiplex PCR products in 12 tube strips were transferred directly from the thermocycler into the sample tray of the CE system. Separation was performed using the OL700 method in a 12-channel gel cartridge (GCK5000). The sizes of the alleles resolved from the subsequent separation were automatically calculated in bps and TM exported using the BioCalculator software, which provides a gel view and an electropherogram of the separation. The allele sizes obtained (Fig. 1) in CE showed similar results as observed in multiplex PCR gel for xa13, Xa21 and fgr genes of 29 segregants of BC1F3 population of rice with pTA248, RG136 and RM515, respectively.

3 Results 3.3 DNA polymorphism between parents 3.1 Multiplex assay for presence of BB-resistant and aroma genes in progenies A total of 29 BC1F3 generation genotypes were analysed for FMs using CE and a standard agarose method. In this study, disease-resistant rice progeny plants were selected by phenotypic and genotypic selection each generation. The selected BC1F2 plants were self-fertilised to produce BC1F3 progeny. Using MAS, 29 BC1F3 plants showing the parental phenotype and presumably possessing target resistance genes in various combinations were obtained through their STS marker genotypes. For Xa21, the STS marker pTA248 amplified a resistant parent-specific 1376 bp fragment in 19 recombinants (Fig. 1). In case of xa13, 699 bp amplified fragment specific to 22 resistant recombinants were observed. Of these, 19 BC1F3 plants were homozygous for both xa13 and Xa21 genes. For aroma, 20 plants showed the presence of fgr gene in BC1F3 population. Out of 29 genotypes in BC1F3 generation, 16 plants were homozygous for all the three genes, viz., xa13, Xa21 and fgr. & 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

To better determine the relative contribution of the two parental genomes to the BB-resistant BC1F3 segregants and to identify selections with greater genetic similarity with the recurrent parent, 20 SSR markers covering all 12 chromosomes were used. The results showed clear DNA polymorphism between IRS 544-1-2 and IRBB 55 parents with SSR markers using the CE system (Fig. 2). Similar results were obtained when same PCR product was separated and analysed on 3% MetaPhors agarose gel.

3.4 Background selection for recurrent parent Background selection is important to recover maximum genome of recurrent parent in MAS. In the present study, 20 microsatellite markers well distributed on rice chromosomes were used for background selection. A representative example for background selection for recovery of parental genome from recurrent parent IRS 544-1-2 and nonwww.electrophoresis-journal.com

2220



Figure 2. Polymorphisms between IRS 544-1-2 and IRBB 55 parents with SSR markers. Gel images are shown from the analyses using the CE system (top) and 3% MetaPhors agarose gel (bottom).

Figure 3. Allele size with RM222 marker for background selection (top). Lanes 3, 4 and 9 represent homozygote plants for the recurrent parent allele (below).

recurrent parent IRBB 55 with SSR marker RM222 is provided in Fig. 3. The allele size obtained during CE showed similar results for RM222 marker of the allele at 213 bp. It is to be noted that, for as yet unknown reasons, the contribution of the recurrent parent to the genome of the progeny was less than expected at each of the generations. At the BC1F2 generation, the progeny plant having maximum contribution from the recurrent parent was self-fertilised to obtain BC1F3 lines that were screened using the ‘‘R’’ gene linked markers to identify plants that were homozygous for different ‘‘R’’ genes or their combinations. As expected, plants were obtained that were homozygous for ‘‘R’’ genes and fgr gene, lines with various gene combinations.

motifs affecting plant phenotype can be identified. The presence of BB resistance genes, viz., xa13 and Xa21, in the BC1F3 generation recombinants was elucidated by using the FMs, leading to molecular confirmation of resistant plants. Considerable time and effort can be saved by simultaneously amplifying multiple sequences in a single reaction, a process referred to as multiplex PCR. Multiplex PCR products showed clear allele sizes of different STS and SSR markers for identification of xa13, Xa21 and fgr genes. Out of 29 genotypes in BC1F3 generation, 16 plants were homozygous for all the three genes, viz., xa13, Xa21 and fgr. Functional MAS for identification of bacterial leaf blight resistance genes has also been reported in rice [31].

4.1 Primer concentration

4 Discussion FM development requires allele sequences of functionally characterised genes from which polymorphic, functional & 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

The amplification of different alleles may be imbalanced because of stochastic effects in the multiplex PCR. Additionally, one allele can be preferentially amplified over www.electrophoresis-journal.com

Nucleic acids


the other from unequal sampling amplification during the early stages of PCR. Varying the concentration of primers of one locus may affect the amplification at the other loci in the multiplex. Differences in the DNA sequences of these loci (pTA248, RG136 and RM515) can also lead to variation in the efficiency of primer binding. Therefore, it becomes essential to optimise primer concentrations to obtain not only best signal intensities but also balanced peak heights for a multiplex set. Equal concentrations (0.1 or 0.25 mM) of the primers resulted in intense allelic products at pTA248 and fgr, leading to dwarfing of other peaks. The optimal primer concentrations of these primers for the multiplex were determined to be 0.1 mM (pTA248, RG136) and 0.25 mM (RM515).

2221

automatically analyse 96 samples without the need for manual sample and gel preparations. Furthermore, the gel separation time for 12 samples was less than 12 min compared to more than 2 h using traditional agarose gel electrophoresis. This advantage is more obvious when larger samples with more markers are analysed. In the present study, homozygous lines containing all three genes, viz., xa13, Xa21 and fgr, can be used as potential donors for different genes and/or can be used in backcross breeding to introgress the resistance genes into other BB susceptible aromatic rice varieties. Moreover, the cost saving resulting from the labour, time saved etc. render the CE system attractive for MAS screening. The authors have declared no conflict of interest.

4.2 Number of multiplex PCR cycles Improvement in sensitivity of PCR assay can be achieved by using an increased number of cycles. With increased template DNA, however, effect of cycle number is not that apparent; instead it could lead to artefact production and compromise of peak balance. Therefore, increased number of PCR cycles would adversely affect the allele peaks. This is effectively achieved only in the linear phase of the PCR, where differences in the template DNA concentrations are best represented [32]. To optimise the cycle number keeping sensitivity as well as optimum quantification of different markers in mind, we amplified template DNA at 30, 35, 38 and 40 cycles. Multiplex loci gave good signal intensities from 35 and more cycles; we chose the minimal adequate number of cycles (35) for the multiplex assay. The CE system offers a broad range and optimised application in separation of multiple PCR fragments and data can be viewed in both electropherogram and gel image formats. The CE system ensures greater accuracy than slabgel methods. Sample consumption is less than 0.1 mL per analysis, thus conserving sample for possible downstream analysis. A comparison of the actual gel images obtained from agarose and the images from the CE system of PCRamplified samples with different FMs for xa13, Xa21 and fgr introgressed genes in rice variety are similar. Multiplex PCR products showed clear allele sizes of different STS and SSR markers for identification of xa13, Xa21 and fgr genes in CE compared to 1.2% agarose gel image. Moreover, consumption of PCR product is much less using CE compared to agarose gel electrophoresis. It has been reported that only 2 ng of DNA can be visualised on 3% high resolution Metaphore agarose gel and about 0.6 ng of DNA can be reliably detected using CE [33]. In this study, CE was shown to be effective in MAS for screening of different genotypes for various gene targets. More than one FM with allele size differences of at least 50 bp can be screened in a single-tube assay method based on multiplex FMs and CE. Moreover, the material cost for sample analysis was comparable to those using agarose gels. However, the CE was less labour-intensive since it could & 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

5 References [1] Mew, T. W., Vera Cruz, C. M., Medalla, E. S., Plant Dis. 1992, 76, 1029–1032. [2] Srinivasan, B., Gnanamanickam, S., Curr. Sci. 2005, 88, 1229–1231. [3] Devadath, S., in: Bacterial Blight of Rice. International Rice Research Institute, Manila, Philippines 1989, pp. 89–98. [4] Bradbury, L. M. T., Henry, R. J., Jin, Q., Reinke, R. F., Waters, D. L. E., Mol. Breed. 2005, 16, 279–283. [5] Bradbury, L. M. T., Fitzgerald, T. L., Henry, R. J., Jin, Q. S., Waters, D. L. E., Plant Biotechnol. J. 2005, 3, 363–370. [6] Liu, Q., Li, Q., Cai, X., Wang, H., Tang, S., Yu, H., Wang, Z., Gu, M., Crop Sci. 2006, 46, 2354–2360. [7] Toojinda, T., Tragoonrung, S., Vanavichit, A., Siangliw, J. L., Pa-In, N., Jantaboon, J., Siangliw, M., Fukai, S., Plant Prod. Sci. 2005, 8, 330–333. [8] Zhang, Z. Y., Chen, X., Zhang, C., Xin, Z. Y., Chen, X. M., Sci. Agric. Sin. 2002, 35, 789–793. [9] Zhou, P. H., Tan, Y. F., He, Y. Q., Xu, C. G., Zhang, Q., Theor. Appl. Genet. 2003, 106, 326–331. [10] Ahn, S. N., Bollich, C. N., Tanksley, S. D., Theor. Appl. Genet. 1992, 84, 825–828. [11] Chen, S., Wu, J., Yang, Y., Shi, W., Xu, M., Plant Sci. 2006, 171, 505–514. [12] Cordeiro, G. M., Christopher, M. J., Henry, R. J., Reinke, R. F., Mol. Breed. 2002, 9, 245–250. [13] Garland, S., Lewin, L., Blakeney, A., Reinke, R., Henry, R., Theor. Appl. Genet. 2000, 101, 364–371. [14] Tang, K.-X., Tinjuangjun, P., Xu, Y., Sun, X.-F., Gatehouse, J. A., Ronald, P. C., Qi, H.-X., Lu, X.-G., Christou, P., Kohli, A., Planta 1999, 208, 552–563. [15] Gopalakrishnan, S., Sharma, R. K., Anand Rajkumar, K., Joseph, M., Singh, V. P., Singh, A. K., Bhat, K. V., Singh, N. K., Mohapatra, T., Plant Breed. 2008, 127, 131–139. [16] Sundaram, R. M., Vishnupriya, M. R., Biradar, S. K., Laha, G. S., Ashok Reddy, G., Shobha Rani, N., Sarma, N. P., Sonti, R. V., Euphytica 2008, 80, 411–422.


2222


[17] Huang, N., Angeles, E. R., Domingo, J., Magpantay, G., Singh, S., Zhang, Q., Kumaravadivel, N., Bennett, J., Khush, G. S., Theor. Appl. Genet. 1997, 95, 313–320. [18] Sanchez, A. C., Brar, D. S., Huang, N., Khush, G. S., Crop Sci. 2000, 40, 792–797. [19] Yoshimura, S., Yoshimura, A., Iwata, N., McCouch, S. R., Abenes, M. N., Baraoidan, M. R., Mew, T. W., Nelson, R. J., Mol. Breed. 1995, 1, 375–387. [20] Li, Z. K., Sanchez, A., Angeles, E., Singh, S., Domingo, J., Huang, N., Khush, G. S., Genetics 2001, 159, 757–765. [21] Iyer, A. S., McCouch, S. R., Mol. Plant Microbe Interact. 2004, 17, 1348–1354. [22] Chu, Z., Yuan, M., Yao, J., Ge, X., Yuan, B., Xu, C., Li, X., Fu, B., Li, Z., Bennetzen, J. L., Zhang, Q., Wang, S., Genes Dev. 2006, 20, 1250–1255. [23] Song, W. Y., Wang, G. L., Chen, L. L., Kim, H. S., Pi, L. Y., Holsten, T., Gardner, J., Wang, B., Zhai, W. X., Zhu, L. H., Fauquet, C., Ronald, P. C., Science 1995, 270, 1804–1806. [24] Mathies, R. A., Huang, X. C., Nature 1992, 359, 167–169.



[25] Joseph, M., Gopalakrishnan, S., Sharma, R. K., Mol. Breed. 2004, 13, 377–387. [26] Rogers, O. S., Bendich, A. J., Plant Mol. Biol. Manual 1998, 6, 1–10. [27] Chu, Z., Fu, B., Yang, H., Xu, C., Li, Z., Sanchez, A., Park, Y. J., Bennetzen, J. L., Zhang, Q., Wang, S., Theor. Appl. Genet. 2006, 112, 455–461. [28] Chen, X. S., Temnykh, Y., Xu, Y. G., Li, Z., Sanchez, A., Park, Y. J., Bennetzen, J. L., Zhang, Q., Wang, S., Theor. Appl. Genet. 1997, 95, 553–567. [29] Temnykh, S., DeClerck, G., Lukashova, A., Lipovich, L., Cartinhour, S., McCouch, S. R., Genome Res. 2001, 11, 1441–1452. [30] Doley, J. J., Doley, J. L., Focus 1990, 12, 13–15. [31] Perumalsamy, S., Bharani, M., Sudha, M., Nagarajan, P., Arul, L., Sarawathi, R., Balasubramanian, P., Ramalingam, J., Plant Breed. 2010, 129, 400–406. [32] Hittalmani, S., Parco, A., Mew, T. V., Zeigler, R. S., Huang, N., Theor. Appl. Genet. 2000, 100, 1121–1128. [33] Bassam, B. J., Caetano-Anolles, G., Appl. Biochem. Biotechnol. 1993, 42, 181–188.
