Chlamydia trachomatis has a biphasic developmental cycle which is characterized by qualitative and quantitative changes in protein expression. The molecular ...
JOURNAL OF BACTERIOLOGY, Feb. 1988, p. 744-750 0021-9193/88/020744-07$02.00/0 Copyright C 1988, American Society for Microbiology
Vol. 170, No. 2
Developmental Regulation of Tandem Promoters for the Major Outer Membrane Protein Gene of Chlamydia trachomatis RICHARD S. STEPHENS,l.2 3.4* ELIZABETH A. WAGAR,2 AND URSULA EDMAN' Department of Biomedical and Environmental Health Science, School of Public Health, University of California, Berkeley, California 94720,1 and Departments of Laboratory Medicine2 and Pharmaceutical Chemistry3 and Francis I. Proctor Foundation,4 University of California, San Francisco, California 94143-0412 Received 24 June 1987/Accepted 16 November 1987
Chlamydia trachomatis has a biphasic developmental cycle which is characterized by qualitative and quantitative changes in protein expression. The molecular mechanisms that mediate these changes are unknown. Evidence for transcriptional regulation of the chlamydial major outer membrane protein gene (ompl ) was found by Northern hybridization of RNA isolated sequentially during the chlamydial developmental cycle. Early in the growth cycle a single transcript was detected, which was followed hours later in the cycle by an additional transcript. Mapping of the initiating nucleotide for each transcript suggested that this gene is regulated by differential transcription from tandem promoters.
Chlamydia trachomatis is a eubacterial pathogen that undergoes a biphasic intracellular growth cycle. Two representative developmental forms, the elementary body (EB) and the reticulate body (RB), are characteristic of the biochemical and morphological changes which transform infectious EBs to proliferating RBs. The EB is adapted for extracellular survival, is metabolically inactive, is resistant to osmotic or sonic lysis, and can attach to and penetrate mammalian cells. The RB has a fragile outer membrane, a fourfold increase in diameter, and a high rate of metabolic activity and multiplies by binary fission. Ultrastructural studies (11, 31, 34) have temporally placed these events as follows: within 2.5 to 3 h after entry of EBs into host cells, visual evidence of morphological change can be detected, and by 8 to 10 h the reorganization phase is complete and mature RBs can be identified. Evidence of binary fission is observed after 10 to 12 h, and the RBs divide for 10 to 20 h (34). Approximately 20 to 25 h after infection some of the RBs begin a reorganization to the condensed EB form, and concomitant host-cell-associated infectivity reaches a maximum within 48 to 72 h of growth (5). Becker and co-workers have shown that RNA synthesis by a chlamydial DNA-dependent RNA polymerase is an early and essential event of chlamydial reorganization, based upon studies of rifampin sensitivity. EB development was completely inhibited when rifampin was added at the time of infection (4), and when rifampin was added at different times after infection most EBs were sensitive to the drug within the initial 6 h (3). Furthermore, in vitro studies of rifampin sensitivity provided evidence that RNA polymerase is attached to EB DNA in an initiated form and transcription is one of the earliest metabolic events (25). Although the identity of early transcripts is unknown, polyacrylamide gel profiles of purified RBs and EBs have identified specific proteins that are expressed at ordered times during chlamydial development (3, 14). In sum, ultrastructural and biochemical data suggest a sequential regulation of chlamydial developmental events; however, little is known concerning the genetic basis and molecular mechanisms of these chlamydial regulatory processes. Both developmental forms of the organism contain a major *
outer membrane protein (MOMP) that constitutes over 60% of the protein of the outer membrane (7); thus, large quantities of this protein are synthesized during chlamydial growth. The MOMP is a complex and polymorphic surface antigen (7, 29) and a porin (2) and is involved with the changes in structural integrity during EB-RB differentiation (14, 20). Recently, Stephens et al. (27) reported the DNA sequence of the structural gene for MOMP (omplL2), and interestingly, Northern hybridization (RNA hybridization) revealed two omplL2 transcripts. We provide evidence that the ompl gene has two promoters tandemly arranged upstream from one structural gene. These promoters account for the presence of two ompl mRNA transcripts, and transcription of one of these can be detected within 4 h after infection. The other is transcribed only after 12 to 16 h after infection, which is a time that coincides with RB formation and the beginnings of RB binary fission.
MATERIALS AND METHODS Bacterial strains. The ompl gene clones were derived from C. trachomatis L2/434/Bu, BATW-5/OT, and C/TW-3/OT and have been described previously (27, 28). Plasmid pKK232-8 (Pharmacia Fine Chemicals) has been described (6) and was used to construct plasmids pCTP1, pCTP2, and pCTP1+P2 containing the ompl promoters by using standard procedures (17). Northern hybridization. Northern hybridizations of ompl mRNA obtained at different times during developmental growth was performed as follows. L929 cultures in 1-liter Spinner flasks containing 8 x 105 cells per ml were infected by the addition of approximately 107 inclusion-forming units of C. trachomatis serovar L2. Samples (50 ml) were taken from the same flask at the indicated times and centrifuged at 250 x g for 5 min. The culture medium was removed, and the cell pellet was frozen (-70°C) until all samples were obtained. The cell pellets were suspended in diethyl pyrocarbonate-treated buffer (50 mM Tris [pH8], 20 mM EDTA), and total RNA was isolated by extracting these suspensions with equal volumes of hot phenol (65°C). Hot phenol extractions were repeated five times, followed by a phenol-chloroform (1:1) extraction at room temperature. The aqueous phase was extracted three times with ether, and RNA was precipitated by using cold ethanol. RNA samples were
Corresponding author. 744
VOL. 170, 1988
electrophoresed in 1% formaldehyde-agarose gels as previously described (17). After electrophoresis the gels were soaked in 25 mM sodium phosphate buffer (pH 6.5) for 30 min, and the RNA was electrophoretically transferred (1 h at 1 A) to GeneScreen Plus membranes (New England Nuclear Corp.) in the same buffer. Hybridization buffers described by Church and Gilbert (8) were used, and the membranes were hybridized at 65°C and washed in 0.1 x SSC (1 x SSC is 0.15 M NaCl plus 0.015 M sodium citrate) at 52°C. The hybridization probe was homologous to a conserved region of ompl and was obtained from a lambda recombinant, L2/33 (27), whose DNA insert was cloned into pUC18 and labeled with 32P by nick translation. DNA sequencing and primer extension. The DNA sequencing strategy, as well as most of the DNA sequence 5' to the ompl structural genes, has been described previously (27, 28). The initiation site and sequence of RNA transcripts for the omplL2 gene were determined by primer extension by using oligonucleotide primers complementary to the DNA sequence (minus strand) of the ompl gene and dideoxy chain termination methods as previously described (24). The oligonucleotide primers were 3'-GGAATACTAGCTGCCT TAAGATACCC, 3'-GCGAAACTCAAGAGGAAGGAG, 3'-CCGAGCTCGTAACTTGCTGT and were generously provided by M. Urdea, (Chiron Corp., Emeryville, Calif.). Template mRNA was isolated as described above from Renografin (E. R. Squibb & Sons)-purified RBs (27) harvested from 18-h cultures.
TANDEM CHLAMYDIA ompl PROMOTERS
0 4 8 l2 16 20Q24 28 ...
...
....
..
..
745
82 36 48-58 72 hrs ..
cells infected with C. trachomatis serovar L2 and probed with a
RESULTS Differential transcription. Stephens et al. (27) have shown that RNA isolated from purified RBs and probed with ompl DNA displays two transcripts of approximately 1,550 and 1,400 nucleotides (nt). To study temporal regulation of ompl transcription, RNA obtained at sequential times during the chlamydial developmental cycle was evaluated by Northern hybridization (Fig. 1). The lower-molecular-weight transcript was detected as early as 4 h after infection of host cells and was clearly resolved within 8 h. Increasing amounts of this RNA transcript were apparent through 36 h, and levels then declined. In contrast, the higher-molecular-weight transcript was not detected until 12 h of growth, and stoichiometric amounts of this mRNA species were not present until approximately 16 h. After 36 h, diminishing amounts of both mRNA species were evident through 58 h. By 72 h specific hybridization was no longer detectable. Tandem promoters. Initial evaluation of the ompl mRNA transcripts was approached by estimating the number and sizes of oligonucleotide primer extension products. Two ompl transcripts could arise from (i) two structural genes with different promoters, (ii) different termination sites for a single gene, (iii) two tandem promoters for one structural gene, or (iv) processing of a single RNA transcript. Because the two mRNA transcripts differ by more than 150 nt, it was reasoned that comparison of the primer extension product(s) from an oligonucleotide primer complementary to a conserved portion within the structural gene with those from a primer complementary to a sequence approximately 100 nt upstream from the translation initiation codon of the gene could differentiate between these options. The results shown in Fig. 2 are compatible with the conclusion that the transcripts are probably generated from a single ompl gene with two promoters. Two primers were used to evaluate the primer extension products from within the structural gene to control for the possibility of spurious
32p-labeled DNA fragment located within the omplL2 structural gene. Two omplL2-2 specific bands were deleted (arrows). Lanes indicate the number of hours after inoculation, with the 0-h sample collected immediately after inoculation. Although not shown in the photographic reproduction, the lower-molecular-weight band was observed as early as 4 h. Long autoradiographic exposures enhanced the band observed at 4 h, and no hybridization was observed at 0 h.
complementarity of the chosen primer sequence to some other nucleotide sequence. The first oligonucleotide primer (3'-GGAATACTAGCTGCCTTAAGATACCC), and a second primer (3'-GCGAAACTCAAGAGGAAGGAG), whose 3' ends were separated by 60 nt, were, respectively, 94 and
34 nt downstream from the first base of the initial methionine codon (27). Two primer extension products were observed for each oligonucleotide primer; they were approximately 370 and 146 nt long from the former and 306 and 82 nt long from the latter. The differences in size between the products of each primer extension were equivalent (i.e., 64 nt), suggesting that the ompl gene has two promoters separated by approximately 224 base pairs (bp). The use of a third
primer (3'-CCGAGCTCGTAACTTGCTGT) complementary to the DNA sequence 150 bp upstream from the initial methionine codon and approximately 100 bp upstream from the first promoter region confirmed these results. Only one primer extension product (-98 nt) was observed with this oligonucleotide. The 5'-terminal nucleotide sequences of the mRNA tran-
scripts were determined by primer extension sequencing (Fig. 3) and comparison of these data to the DNA sequence. The smaller transcript appears to initiate with a cytosine located 25 bp upstream from the initial methionine codon, and the larger transcript begins near an adenosine residue 221 bp upstream from this site. The nucleotide sequences of the transcripts are in perfect agreement with the 5'-flanking ompl DNA sequence (see below). By using a primer com-
746
STEPHENS ET AL.
J. BACTERIOL.
....
44
370Qa'P -309
306-.
Thus, the origin of these two transcripts is from a single ompl gene. Cloning of omplL2 promoters. Evaluation of promoter location and function was approached by cloning each of the putative promoter regions into pKK232-8, foliowed by transformation of Escherichia coli. This plasmid was constructed such that the gene for chloramphenicol acetyltransferase is preceded by a multiple cloning site, and insertion of functional promoter sequences confers chloramphenicol resistance to recombinants (6). Each of the two chlamydial
(
1 .... ....
146T..
2
_
_:
.. ..'-s..;
T
..
. ,k
A
G STAI
T -
a-123
A -. T T
.-110
.. 4Mi _* __..-
..i m
_
:z;..G G A5s
98-
8
-O
;._ it,
.:iab
-76
. t.
FIG. 2. Composite results for primer extension products obtained by using three different oligonucleotide primers (see the text). RNA was isolated from purified organisms harvested after 20 h of growth and was annealed to primers, and the sequence was extended to the 5' end of the mRNA. Left lane, Two extension products (370 and 146 nt) from a primer complementary to a sequence within the structural gene; center lane, two extension products (306 and 82 nt) from a primer within the structural gene but complementary to a sequence 64 bp upstream from the primer used in the left lane; nigt lane, one extension product (98 nt) obtained from a primer con½plementary to a DNA sequence upstream of the first initiation site. Solid diagonal lines link primer extension products with common 5' ends. Also shown in the right lane are end-labeled pBR322 MspI digests used as size markers. The double horizontal line indicates that part of the gel was removed for photographic reproduction.
3. Primer extension sequencing of the 5' end of each transcript of the ompl gene by using oligonucleotide primers and dideoxy chain termination techniques (24). Lanes 1, 3'-to-5' sequence of the smaller transcript obtained by using an oligonucleotide primer located within the structural gene; lanes 2, 3'-to-5' sequence of the larger transcript obtained by using an oligonucleotide primer located upstream from the sequence shown in lanes 1. Double dots indicate the primary initiation sites; single dots indicate
FIG.
mRNA
plementary to the DNA sequence within the structural gene, the sequence could be read past the first initiation site through to the 5' end of the larger transcript. This demonstrates the tandem organization of these promoters and the colinearity of the two transcripts with the DNA sequence.
minor initiation sites.
TANDEM CHLAMYDIA
VOL. 170, 1988 I
I
a
I
I
,I
I
I
I
100
200
300
400
500
600
P2
700 bp
omplL2
P1
4_1
no
--
I
747
ompl PROMOTERS
I
Sph I/(Hind II1)
I
Sal I
/
P2
sr
P1
I
Xho
Sph
Xho
lI/(Hind III)
FIG. 4. pCTP1, pCTP2, and pCTP1+P2 constructions used to assess promoter localization and function. The 409-bp SalI-XhoI fragment containing the P2 promoter region was inserted into the SalI site of pKK232-8 (pCTP2). Because of the lack of a SphI site in pKK232-8, the 752-bp SalI-SphI fragment was removed from an originating vector by using the Sall site and a HindIlI site from the original vector which was adjacent to the SphI site of the chlamydial insert DNA. This fragment contained both promoter regions and was designated pCTP1+P2. Similarly, the 343-bp XhoI-SphI fragment containing the P1 promoter region was inserted into the Sall and Hindlll sites of pKK232-8. After transformation each construction produced chloramphenicol-resistant colonies. CAT, Chloramphenicol acetyltransferase; MCS, multiple cloning site.
omplL2 promoter regions was cloned individually into this plasmid, yielding pCTP1 and pCTP2; a clone, pCTP1+P2, containing both promoter regions in tandem was also constructed (Fig. 4). All three constructions resulted in the isolation of chloramphenicol-resistant transformants, whereas the vector treated in a similar manner but without insert DNA or with insert DNA obtained upstream from these regions did not give rise to resistant transformants. Although the selected recombinants contained plasmid DNA with the intended organization, growth was obtained only on plates which contained less than 150 ,ug of chloramphenicol per ml. Compared with other promoters evaluated with this vector (6), and considering the large quantities of MOMP in chlamydiae, the amount of chloramphenicol acetyltransferase gene expression from these recombinants was relatively low. Furthermore, despite DNA sequence differences, only minor differences in growth were observed among the different promoter recombinants. Thus, the possibility of fortuitous promotion from these sequences must be considered. 5'-Proximal DNA sequence. The DNA sequence and proposed structural components for the -450-bp 5'-proximal region of the ompl genes for serovars L2, B, and C are shown in Fig. 5. C. trachomatis is composed of two biovars, trachoma and lymphogranuloma venereum. These biovars are very closely related, although they can be differentiated on the basis of certain cultural characteristics and pathogenic properties (18). The sequences shown in Fig. 5 represent two serovars of the trachoma biovar (B and C) and one
-392
L2
CCrCCATCTrCGAGCTATTCCAAACACAMMATCTTAGG1TMlGGMATrAACMCTCAT
B
T
C
T
T T
T T
C
C
C
C -332
L2
MAAATrGMCTGTTTTGTAATTAACTCAAAACCCTCTCArrCTCACMTCAACATATT
B
C
G
3A
TC C
C
C
C
G
GGA
TC C
C
L2 B
C
L2 B C
L2 B C
-272
.1 ,1
(Y'r.AATATr.1'.f'T=t'.r'Tr'WY'.r.TTIrt'AnAt'At'll-AT7rrrrrt-t--t-AAAAA t'A'rA A A A A I UAUAUUA I I I I I I WAAAAA t-AAt-AA | W GAA IA TUAA
G G
T T
A A
AAA CATAAAAAGA4' A A ...
T T
AAATGGCTCTCTGCTr
A
T
A
T
TAAATCAGGOGCr T T
A
_
Xho I
L2
A -152
AAGGGCTTCTTCCTGGGACGAMCGITTTrCTTATC7TCTTTACGAGA ATAAGAAA ATTTT AA G A AA G A 92
GTTATGG ...CTCGAGCATTGAACGA CATGTTCTCGATTAAGGCTGC11TMACTTGCMGAC T T
B
C
T
L2 A1TCCTCAGGCCATrAATTGCTACAGGACATC1TGTCTGGCTTrAACTAGGACGCA B
C
L2 B
CCAGAAAAAGATAGCGAGXk GACY3GCTAATTATACAA T...TTA GAGGTAAGAATG
C
C C
FIG. 5. DNA sequence comparison of the ompl noncoding regions of three C. trachomatis serovars, L2, B, and C. The sequences for B and C are identical to that of L2 except where noted. The sequence is numbered beginning at the first initiation point (+1). Also shown are the proposed structural features, including the initial methionine codon (underlined ATG), a ribosome-binding site (S-D), promoter sequences (shaded hexamers), and the inverted repeat
(arrows).
748
STEPHENS ET AL.
lymphogranuloma venereum biovar (L2). The antigenic (29, 33) and ompl structural gene DNA sequence comparisons (28) for these three strains show that serovars B and L2 are closely related to each other, whereas serovar C is the most distantly related. Interestingly, there were marked differences in the level of sequence conservation among the three serovars when the 260-bp region that contains the two promoter regions (8 changes per 260 bp) was compared to the 190 bp 5'-proximal to this region (21 changes per 190 bp). Unlike the sequence comparisons within the structural ompl gene for these serovars (28), nearly all the nucleotide differences between the trachoma biovar strains and the lymphogranuloma venereum biovar were identical for the two trachoma biovar strains (serovars B and C). The putative -10 and -35 promoter regions for P1 and P2 were selected by inspection of the DNA sequence based upon the identification of the initiating base for each transcript and similarity to other procaryotic consensus promoter sequences (16). The -10 and -35 regions of these promoters were separated by 18 bp for P1 and 17 bp for P2, which is consistent with the optimal spacing (17 ± 1) for procaryotic promoters (32). Furthermore, the -10 regions were within the 5- to 7-bp spacing commonly observed between -10 regions and initiating nucleotides. Although the -10 and -35 sequences display some homology to E. coli consensus promoter sequences (i.e., three of six bases in common), they do not represent optimal recognition sequences for E. coli RNA polymerase (16). Highly expressed genes from other organisms have A+Trich sequences upstream from their promoters, and it has been proposed that this facilitates RNA polymerase binding (9). Evaluation of the distribution of the A+T content upstream from the structural gene showed some discrete regional variations. As a point of reference, the overall A+ T content for C. trachomatis has been estimated to be 55.5% (35), and the A+T content for the omplL2 structural gene is 56% (27). The 5' sequence flanking the P2 promoter region had an unusually high A+T content (70%), and the 3'flanking sequence (30 bp) was relatively A+T poor (37%). The A+T distribution immediately 5' to P1 was unremarkable, although there was an A+T-rich (70%) segment 3' to this promoter region, the significance of which is unknown. Of interest was a region very rich in A+T (76%), the 50 upstream base pairs adjacent to the XhoI site. It is this conserved region that contains a perfect 9-bp inverted repeat which, by visual inspection, was the only outstanding structural element of the noncoding sequence. Although the repeat is separated by 13 bp, it is reminiscent of an axis of symmetry found in operator DNA structures for genes that are controlled by protein repressors (32). Alternatively, this region could form a stable stem-loop structure (-12.6 kcal [-52.7 kJ] [30]) followed by four T residues and resembles a rho-independent terminator capable of stopping transcription after 70 nt. Such a termination function must necessarily be suppressed during the height of the growth cycle. Attempts to detect a 70-nt transcript by Northern hybridization were not successful; however, such a fragment would likely have a very short half-life. DISCUSSION The growth cycle of C. trachomatis begins with infection of a host cell by an EB, and 2 to 3 h after infection the EB initiates differentiation into the vegetative RB form (11, 18, 34). Metabolic activity, as measured by rates of RNA (12) and protein (1) synthesis using labeled precursors, is first
J. BACTERIOL.
detected at 12 h and rises to a maximum between 24 and 36 h of growth. Infectivity rises from 20 h to a maximum by 72 h; thus, it is during this time that some of the RBs begin the asynchronous process of differentiation into infectious EBs. Polyacrylamide gel electrophoresis of EB and RB lysates suggest constitutive production of MOMP beginning 12 h after infection (15, 19), although other proteins have been observed to be unique to each developmental form (14). Large quantities of MOMP are synthesized as an important component for the unusual outer membrane structure and integrity of the extracellular developmental form (14, 20). Recently, Stephens et al. (27) identified two prominent mRNA transcripts by Northern hybridization, using an omplL2 fragment as a probe of mid-growth-phase RNA. Northern blot analysis of RNA obtained sequentially during the chlamydial growth cycle revealed that the lowermolecular-weight transcript was detected as early as 4 h after infection and was present until 58 h. Thus, this mRNA is synthesized early in the reorganization phase and before binary fission. The observation of an ompl transcript detectable between 4 and 8 h is significant because this suggests that MOMP is needed by the cell hours before cell division. During this early predivisional developmental stage the infecting EB undergoes nuclear and outer membrane changes that result in a 4-fold increase in diameter and a 16-fold increase in surface area. The presence of ompl transcripts early in the cycle suggests that MOMP is required for incorporation as the membrane expands. In contrast, the larger transcript was detected only after 12 h of cell growth, and large amounts were not present until approximately 16 h, a time coincident with maximal rates of RNA and protein synthesis and the onset of binary fission. The presence of both transcripts at this time may represent one mechanism to efficiently increase the number of transcript copies when large quantities of MOMP product are needed for exponential growth. The Northern blot data demonstrate constitutive transcription of the smaller message, whereas the larger message is under regulatory control. The structural omplL2 gene consists of an 1,182-bp open reading frame followed by a rho-independent termination site 110 bp downstream of the first translational stop codon (27). The sizes of the primer extension products plus the size of the open reading frame and location of the termination site define transcript sizes of 1,317 and 1,540 nt, which is in good agreement with the sizes of the ompl transcripts estimated by Northern hybridization (i.e., 1,400 and 1,550 nt, respectively). Primer extension sequencing identified the initiating nucleotide of each transcript, and both primer extension sequences matched the DNA sequence upstream from the structural gene. The concept of one structural gene is compatible with the observation of precise 5' sequence identity between the gene and each transcript. It can be concluded that the ompl gene has two promoters that are tandemly arranged and separated by more than 200 bp upstream from one structural gene. These conclusions are compatible with the observations than multiple gene copies are not evident by Southern blot evaluations (26) and of the presence of a strong terminator 3' to the structural gene (27). Although promotion from fortuitous sequences is a possibility, the tandem arrangement of promoters is also supported by the cloning of DNA segments that included either the P1 or P2 promoter region or both into pKK232-8 and the finding that each of these constructions was capable of promoting chloramphenicol acetyltransferase gene expression in E. coli. The assignments of promoter sequences were based upon
CHLAMYDIA ompl PROMOTERS VOL. 170, 1988 ~~~~~~TANDEM 1988 VOL. 170, promoter
sequences in conjunction with their transcript initiation sites; thus, they may
consensus
location relative to
be considered tentative
until
additional evidence
can
be
Unfortunately, the small quantities of chlamydiae obtained from the existing cell culture systems and their contamination with host cell components hamper attempts at footprinting using chlamydial lysate. Because no transformation system exists for chlamydiae, genetic analysis is also precluded at this time. It is important to emphasize that the level of expression from these promoters in E. coli was relatively low, suggesting that these chlamydial promoters make poor substrates for transcription in E. coli hosts. This observation, in addition to the lack of high homologies to optimal promoter consensus sequences, suggests that the recognition sequences for chlamydial RNA polymerase differ from those of E. coli. This is also supported by the observation of Palmer and Falkow (21) and Stephens et al. (26) that most chlamydial genes are not expressed in E. coli hosts. Recently, the transcription initiation sites for rRNA
obtained.
genes obtained from
a
murine
Chlamydia
biovar have been
delineated, and these associated promoters also have low homology with the E. coli promoter consensus sequence. Consequently, the validity of additional investigations that employ E. coli RNA polymerase, using such techniques as footprinting or site-directed mutagenesis of these promoter regions, may be compromised by specificity differences between E. coli and chlamydial RNA polymerases. In procaryotes, multiple promoters are often present upstream from genes that are highly expressed and that are subject to regulation (32). Modulation of RNA polymerase promoter selectivity has been shown to depend upon polymerase modification, association with accessory proteins, interaction of protein effectors such as repressors and activators, and nucleotide sequence factors (32). Thus, coordinate control of gene expression is complex and often involves multiple components. Comparison of the DNA sequences of the three C. trachomatis
serovars
supports the
assignment of promoter regions and sheds some light on the potential regulatory mechanisms for this gene. The number of nucleotide mutations within the promoter region (-260 to + 1) is one-third the number observed for the 190 bp upstream from P2 (-451 to -260). Thus, the former region has been more highly conserved, which suggests a functional role for this noncoding region. The most striking structural component in this region is a perfect 9-bp inverted repeat separated by 13 bp in a region of unusually high A+T content (76%) located 40 bp downstream from P2. The structure of the 9-bp dyad is consistent with a transcriptional terminator; thus, early in the developmental cycle, transcription may terminate -70 bp after initiation from P2. Late in the reorganization phase suppression of the terminator may be effected, thereby activating transcription. Although we have been unable to directly demonstrate the validity of these speculations, a similar structure has been described for
a
Bacillus subtilis promoter,
(22). This promoter is regulated by a shift in sigma subunits during developmental changes that lead to sporulation. The organizations of the G4 region and the noncoding ompl region are remarkably similar. Like ompl, G4 contains G4
promoters each with distinct cognate -10 and -35 promoter sequences, and these promoters are separated by
two
Furthermore, 35 bp 3' from the 7-bp dyad followed by six T residues terminates transcription in vitro, although the in vivo
approximately
215
bp.
upstream promoter is that
a
function of this terminator is unknown (22). It is of interest that the
10 promoter
regions for
P1
and
749
as well as the -35 regions, bear little resemblance to each other. Because these putative promoters represent the first to be identified for human strains of C. trachomatis, the significance of this finding is unknown. Clearly, large amou nts of message and protein are produced, implying that they are promoter sequences with excellent sequence specificities for chlamydial RNA polymerase. However, since P2 is controlled by regulatory mechanisms, these sequence differences suggest that nucleotide sequence factors play a role in promoter selectivity for chlamydial RNA polymerase. The preferred proposal for differential tr'anscriptional control of the ompl gene, and perhaps for other genes expressed late in the reorganization phase, is found in the lack of consensus sequences between P2 and P1 promoter regions and the dramatic increase of transcription from P2 that is coincident with the initial detection of protein synthesis between 12 and 16 h after infection (1, 15, 19). This evidence suggests that up to 12 h, specific genes are transcribed which mediate events necessary for the reorganization phase of development and that a concomitant and generalized metabolic change occurs be.tween 12 and 16 h. We speculate that such a change is compatible with a point-source shift such as would be mediated by an RNA polymerase modification. Examples of RNA polymerase modifications with which major metabolic shifts are associated are phosphorylation of the polymerase and association of the polymerase with accessory proteins, as has been shown with alternative sigm'a subunits in B. subtilis sporulation (13) or the expression of E. coli genes that utilize the heat shock sigma subunit (10). The effect of the terminator may be overcome by a modified holoenzyme, or perhaps the role of the terminator is to provide a transcriptional pause at P2 to prevent occlusion of P1 by RNA polymerase (23) and thereby facilitate orderly transcription from both promoters. Comparisions of ompl promoter regions with promoter regions for the murine biovar rRNA genes (J. N. Engel and D. Ganem, personal communication) show no striking consensus sequences. A study of DNA homology between human strains of C. trachomatis and the murine biovar has demonstrated approximately 60% heteroduplex formation, although these heteroduplexes are not thermostable (35). Although the lack of similarity between these promoter regions may imply a difference in regulatory mechanisms for their genes, it may simply reflect the evolutionary distance between these chlamydial strains. It will be of interest to compare the promoter regions of other highly expressed chlamydial genes to evaluate the role of these sequences.
P2,
ACKNOWLEDGMENTS We thank Jennifer Clyne and Michael Hines for technical assistance.
This research was supported by The Edna McConnel Clark Foundation, the MacArthur Foundation, and funds provided by ONR contract N00014-81-C-0570. E.A.W. is supported by STD Training Program Grant A107234. LITERATURE CITED 1. Alexander, J. J. 1968. Separation of protein synthesis in meningopneumonitis agent from that in L cells by differential susceptibility to cycloheximide. J. Bacteriol. 95:327-332. 2. Bavoil, P., A. Ohlin, and J. Schachter. 1984. Role of disulfide bonding in outer membrane structure and permeability in Chla-
mydia trachomatis. infect. Immun. 44:479-485.
3. Becker, Y., H. Loker, I. Sarov, Y. Asher, B. Gutter, and Z. Zakay-Rones. 1971. Studies on the molecular biology of trachoma agent, p. 13-26. In R. L. Nichols (ed.), Trachoma and related disorders caused by chlamydial agents. Excerpta Me-
750
STEPHENS ET AL.
dica, Amsterdam. 4. Becker, Y., and Z. Zakay-Rones. 1969. Rifampicin-a new antitrachoma drug. Nature (London) 222:851-853. 5. Bernkopf, H., P. Mashiah, and Y. Becker. 1962. Correlation between morphological and biochemical changes and the appearance of infectivity in FL cell cultures infected with trachoma agent. Ann. N.Y. Acad. Sci. 98:62-81. 6. Brosius, J. 1984. Plasmid vectors for the selection of promoters. Gene 27:151-160. 7. Caldwell, H. D., J. Kromhout, and J. Schachter. 1981. Purification and partial characterization of the major outer membrane protein of Chlamydia trachomatis. Infect. Immun. 31:11611176. 8. Church, G. M., and W. Gilbert. 1984. Genomic sequencing. Proc. Natl. Acad. Sci. USA 81:1991-1995. 9. Cole, S. T., E. Bremer, I. Hindennach, and U. Henning. 1982. Characterisation of the promoters for the ompA gene which encodes a major outer membrane protein of Escherichia coli. Mol. Gen. Genet. 188:472-479. 10. Cowing, D. W., J. C. A. Bardweli, E. A. Craig, C. Woolford, R. W. Hendrix, and C. A. Gross. 1985. Consensus sequence for Escherichia coli heat shock gene promoters. Proc. Natl. Acad. Sci. USA 82:2679-2683. 11. Friis, R. R. 1972. Interaction of L cells and Chlamydia psittaci: entry of the parasite and host responses to its development. J. Bacteriol. 110:706-721. 12. Gutter, B., and Y. Becker. 1972. Synthesis and maturation of ribosomal RNA during the developmental cycle of trachoma agent, a prokaryotic obligate parasite of eukaryocytes. J. Mol. Biol. 66:239-253. 13. Haldenwang, W. G., N. Lang, and R. Losick. 1981. A sporulation-induced sigma-like regulatory protein from B. subtilis. Cell 23:615-624. 14. Hatch, T. P., l. Allan, and J. H. Pearce. 1984. Structural and polypeptide differences between envelopes of infective and reproductive life cycle forms of Chlamydia spp. J. Bacteriol. 157:13-20. 15. Hatch, T. P., M. Miceli, and J. E. Sublett. 1986. Synthesis of disulfide-bonded outer membrane proteins during the developmental cycle of Chlamydia psittaci and Chlamydia trachomatis. J. Bacteriol. 165:379-385. 16. Hawley, D., and W. R. McClure. 1983. Compilation and analysis of Escherichia coli promoter DNA sequences. Nucleic Acids Res. 11:2237-2255. 17. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 18. Moulder, J. W., T. P. Hatch, C.-C. Kuo, J. Schachter, and J. Storz. 1984. Genus I. Chlamydia Jones, Rake and Stearos 1945, 55AL, p. 729-739. In N. R. Krieg and J. G. Holt (ed.), Bergey's manual of systemic bacteriology, vol. 1. The Williams & Wilkins Co., Baltimore. 19. Newhall, W. J., V. 1987. Biosynthesis and disulfide cross-linking of outer membrane components during the growth cycle of Chlamydia trachomatis. Infect. Immun. 55:162-168.
J. BACTERIOL. 20. Newhall, W. J., V, and R. B. Jones. 1983. Disulfide-linked oligomers of the major outer membrane protein of chlamydiae. J. Bacteriol. 154:998-1001. 21. Palmer, L., and S. Falkow. 1986. Characterization of cloned genes from Chlamydia trachomatis, p. 91-95. In L. Leive (ed.), Microbiology-1986. American Society for Microbiology, Washington, D.C. 22. Rather, P. N., R. E. Hay, G. L. Ray, W. G. Haldenwang, and C. P. Moran. 1986. Nucleotide sequences that define promoters that are used by Bacillus subtilis sigma-29 RNA polymerase. J. Mol. Biol. 192:557-565. 23. Sancar, G. B., A. Sancar, J. W. Little, and W. D. Rupp. 1982. The' uvrB gene of Escherichia coli has both lexA-repressed and lexA-independent promoters. Cell 28:523-530. 24. Sanger, F. S., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467. 25. Sarov, I., and Y. Becker. 1971. Deoxyribonucleic acid-dependent ribonucleic acid polymerase activity in 'purified trachoma elementary bodies:' effect of sodium chloride on ribonucleic acid transcription. J. Bacteriol. 107:593-598. 26. Stephens, R. S., C.-C. Kuo, G. Newport, and N. Agabian. 1985. Molecular cloning and expression of Chlamydia trachomatis major outer membrane protein antigens in Escherichia coli. Infect. Immun. 47:713-718. 27. Stephens, R. S., G. Muilenbach, R. Sanchez-Pescador, and N. Agabian. 1986. Sequence analysis of the major outer membrane protein gene from Chlamydia trachomatis serovar L2. J. Bacteriol. 168:1277-1282. 28. Stephens, R. S., R. Sanchez-Pescador, E. A. Wagar, C. Inouye, and M. S. Urdea. 1987. Diversity of Chlamydia trachomatis major outer membrane protein genes. J. Bacteriol. 169:38793885. 29. Stephens, R. S., M. R. Tam, C.-C. Kuo, -and R. C. Nowinski. 1982. Monoclonal antibodies to Chlamydia trachomatis: antibody specificities and antigen characterization. J. Immunol. 128:1083-1089. 30. Tinoco, I., 0. C. Uhlenbeck, and M. D. Levine. 1971. Estimation of secondary structure in ribonucleic acids. Nature (London) 230:362-367. 31. Tribby, I. I. E., R. R. Friis, and J. W. Moulder. 1973. Effect of chloramphenicol, rifampicin and nalidixic acid on Chlamydia psittaci growing in L cells. J. Infect. Dis. 127:155-163. 32. von Hippel, P. H., D. G. Bear, W. D. Morgan, and J. A. McSwiggen. 1984. Protein-nucleic acid interactions in transcription: a molecular analysis. Annu. Rev. Biochem. 53:389-446. 33. Wang, S.-P., and J. T. Grayston. 1971. Classification of TRIC and related strains with micro-immunofluorescence, p. 305-321. In R. L. Nichols (ed.), Trachoma and related disorders caused by chlamydial agents. Excerpta Medica, Amsterdam. 34. Ward, M. E. 1983. Chlamydial classification, development and structure. Br. Med. Bull. 39:109-115. 35. Weiss, E., S. Schramek, N. N. Wilson, and L. W. Newman. 1970. Studies on thermal denaturation of DNA from various chlamydiae. J. Infect. Dis. 121:65-69.
