Mar 15, 1993 - Ruff, V. A., Yem, A. W.,Munns, P. L., Adams, L. D., Rear- don, I. M., Deibel, M. R. J. & Leach, K. L. (1992) J. Biol. Chem. 267, 21285-21288. 25.
Proc. Natl. Acad. Sci. USA Vol. 90, pp. 6839-6843, July 1993 Biochemistry
Overexpression, characterization, and purification of a recombinant mouse immunophilin FKBP-52 and identification of an associated phosphoprotein (glucocorticoid receptor/baculovirus expression/in vitro assembly)
EMAD S. ALNEMRI*t, TERESA FERNANDES-ALNEMRIt, DANIEL S. NELKI§, KEITH DUDLEY§, GARRETT C. DUBoIs*, AND GERALD LITWACK*t Departments of *Pharmacology and tMicrobiology and Immunology, The Jefferson Cancer Institute, Thomas Jefferson University, Philadelphia, PA 19107; and §Division of Biomolecular Sciences, King's College, Kensington, London, United Kingdom
Communicated by Sidney Weinhouse, March 15, 1993
of p59 using ligand affinity chromatography (8, 15). The calculated molecular mass of p59 obtained from its cDNA is about 52 kDa and therefore should be referred to as FKBP52. We describe here the isolation of a mouse FKBP-52 cDNA and the overexpression, characterization, and purification of a mouse recombinant FKBP-52 (rFKBP-52) using the baculovirus expression system.¶ We show that the mouse rFKBP-52 is an ATP/GTP binding protein, that it can be assembled in vitro with the glucocorticoid receptor (GR) complex, and that it is associated with a 59-kDa phosphoprotein or kinase.
To gain insight into the structure and funcABSTRACT dion of the immunophilin FKBP-52, a mouse FKBP-52 was overexpressed in Spodoptera frugiperda insect cells (Sf9 cells) with the baculovirus expression system. The purification and characterization of the recombinant FKBP-52 (rFKBP-52) was facilitated by incorporating a histidine 6-mer domain at its N terminus. The rFKBP-52 was highly purified on a Ni2+ affinity resin with an estimated recovery of 10 mg of pure protein from 1 liter of Sf9 cell culture. Subcellular fractionation revealed that the rFKBP-52 is expressed predominantiy in the nuclei of infected Sf9 cells maximally at 48 hr after infection, consistent with the nuclear localization of FKBP-52 in mammalian cells. The rFKBP-52 can be assembled in vitro with the glucocorticoid receptor complex, establishing its functionality and confirming that it is a component of the unactivated glucocorticoid receptor complex. The rFKBP-52 possesses an ATP/GTP binding activity that is stimulated by divalent cations. Furthermore, incubation of purified rFKBP-52 with [-32P]ATP and MgCl2 resulted in the phosphorylation of a 59-kDa nuclear protein. Amino acid sequence analysis of this protein revealed that it is a phosphoprotein or kinase that is associated with the rFKBP-52.
MATERIALS AND METHODS Construction of Recombinant Transfer Vector and Recombinant Baculovirus. The mouse FKBP-52 cDNA was excised from the Bluescript vector as a 2.2-kb EcoRI fragment and subcloned in frame into an EcoRI-cut pVL1393-His6 to generate the recombinant transfer vector pVL-His6-FKBP52. The pVL1393-His6 is a modified pVL1393 vector (16, 17) that contains the sequence 5'-GGATCCATGCATCACCACCACCACCACGGAATTC-3' subcloned downstream of the polyhedrin promoter. This sequence, which includes an ATG start site and a six-histidine coding sequence, was designed to be in frame with the FKBP-52 sequence, as later verified by sequencing with Bac 1 sequencing primer (Clontech). The presence of the six-histidine domain facilitates the purification of the rFKBP-52 on ProBond Ni2+ affinity resin (Invitrogen). The recombinant baculovirus, AcNPV-FKBP-52 (where AcNPV is Autographa californica nuclear polyhedrosis virus), was produced as described (16, 17). Preparation of Nuclei and Purification of rFKBP-52. Nuclei from baculovirus-infected Spodoptera frugiperda cells (Sf9 cells) were prepared by lysing the cells in Hepes/Nonidet P-40 buffer as described (18). The nuclei were extracted twice in 50 mM Tris, pH 7.9/0.6 M NaCl/1 mM phenylmethylsulfonyl fluoride (PMSF) on a rotator for 15 min at 4°C each time and centrifuged at 16000 x g; the supernatants were collected and combined. To purify the rFKBP-52, nuclear extract was prepared from 1.5 x 109 Sf9 cells infected with the AcNPVFKBP-52 virus for 48 hr. The extract was then adsorbed to
The immunophilin p59 or FKBP-52 is a member of the immunophilin protein family, which includes intracellular receptors that bind the immunosuppressant macrolides FKS06 and rapamycin (1). FKS06 and rapamycin are potent immunosuppressants that act by blocking specific intermediate steps in the signal transduction pathways that lead to T-cell activation (2-5). The mechanism by which FKS06 or rapamycin leads to immunosuppression is not fully established, although their immunosuppressive ability may be modulated by binding to certain members of the immunophilin protein family such as FKBP-12, -13, or -25 or the newly identified immunophiin p59 (3, 6-8). The immunophilin p59 recently has been the focus of several studies because of its association with the non-DNA binding unactivated form of steroid hormone receptors (9-12). p59 is associated directly with the heat shock protein 90 (hsp9O) subunit but not with the steroid binding subunit of the steroid receptor complex (9, 13). p59 may interact directly with heat shock protein 70 (hsp70), and p59 may be present in steroid receptor-free complexes with hsp90 and other proteins (14). The deduced rabbit p59 sequence contains two successive domains closely related to the immunophilin FKBP-12 (6, 7). The first N-terminal domain or both domains are probably the binding site(s) of the immunosuppressant FK506 or rapamycin that may be responsible for the successful purification
Abbreviations: rFKBP-52, recombinant FKBP-52; GR, glucocorticoid receptor; hsp90, 90-kDa heat shock protein; hsp70, 70-kDa heat shock protein; AcNPV, Autographa californica nuclear polyhedrosis virus; Sf9 cells, Spodoptera frugiperda cells; PMSF, phenylmethylsulfonyl fluoride. tTo whom reprint requests should be addressed at: Department of Pharmacology, Thomas Jefferson University, Bluemle Life Sciences Building, 233 South 10th Street, Philadelphia, PA 19107. $The sequence reported in this paper has been deposited in the GenBank data base (accession no. X17069).
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
6839
6840
Biochemistry: Alnemri et al.
10 ml ofpacked Ni2+ affinity resin on ice for 10 min. The resin was then packaged into a 20-ml syringe column, washed twice with 50 ml of binding buffer (20 mM sodium phosphate, pH 7.8/0.5 M NaCl/l mM PMSF), and washed three times with 75 ml of washing buffer (20 mM sodium phosphate, pH 6.0/0.5 M NaCl/l mM PMSF). The rFKBP-52 was then stepwise eluted from the resin using at each time 8 ml of washing buffer containing 100, 200, 400, 600, and 800 mM imidazole (pH 6.0). Four-milliliter fractions were collected and then analyzed by SDS/PAGE and Coomassie staining. The fractions containing rFKBP-52 were pooled and then dialyzed against 50 mM Hepes, pH 7.4/1 mM PMSF/400 mM NaCl overnight at 4°C. The dialyzed rFKBP-52 solution was clarified by centrifugation at 16000 x g and stored at -80°C in 20%o glycerol. Assembly of the rFKBP-52 with GR in Reticulocyte Lysate. The rFKBP-52 was metabolically labeled with [35S]methionine (1095 Ci/mmol, ICN; 1 Ci = 37 GBq) as described (16, 19) and extracted from Sf9 nuclei as described above. 35Slabeled nuclear extract (10 ,ug) containing rFKBP-52 was incubated in the presence or absence of recombinant monomeric activated GR (10 ,ug) in 350 jul of reticulocyte lysate for 40 min at 27°C as described (18). The lysates were diluted with 3 volumes of KP buffer (50 mM potassium phosphate, pH 7.0/1 mM PMSF/20 mM molybdic acid) and then immunoprecipitated on ice with anti-GR monoclonal antibody BUGR 2 for 16 hr. The receptor-antibody complexes were analyzed on a 10% SDS/polyacrylamide gel and visualized by autoradiography as described (19). 8-Azido[a-32P]ATP Binding. Fifteen micrograms of purified rFKBP-52 was covalently labeled with 10 ,uM 8-azido[a-32P]ATP (12.2 Ci/mmol, ICN) on ice in the presence or absence of divalent cations (0.1 mM), unlabeled ATP (10 mM), or unlabeled GTP (10 mM) using a hand-held UV light (254 nm) at a distance of 3 cm for 3 min. The labeled rFKBP-52 was adsorbed to the Ni2+ affinity resin, washed, eluted by adding 60 ,ul of Laemmli sample buffer, and then analyzed on a 10% SDS/polyacrylamide gel. The gel was then stained, dried, and autoradiographed. Determination of Kinase Activity. Aliquots of purified rFKBP-52 immobilized on Ni2+ affinity resin were incubated in 50,ul of 50 mM Hepes, pH 7.4/1 mM dithiothreitol/125 mM KCI/200 nM ['y-32P]ATP (4500 Ci/mmol, ICN) at 30°C for 30 min. The resin samples were washed, eluted by adding 50 ,ul of Laemmli sample buffer, and then analyzed on 10%o SDS/ polyacrylamide gel. The gel was stained, dried, and autoradiographed.
RESULTS AND DISCUSSION Overexpression and Purification of Mouse rFKBP-52. The cDNA for a mouse FKBP-52 was originally cloned from a mouse testis AZap cDNA library by virtue of its 3' homology to the mouse transition protein TP2 and deposited in GenBank as a cDNA coding for an unknown protein (accession number X17069). Recently the complete cDNA sequence of the rabbit immunophilin p59 was reported (6). Aligning the mouse X17069 cDNA with that of the rabbit p59 cDNA revealed >82% sequence homology, suggesting that the X17069 cDNA is the mouse counterpart of the rabbit p59 cDNA. To establish the coding frame of the mouse X17069 1 1
cDNA, since it was lacking the first ATG start codon, we resequenced the 5' region of the X17069 cDNA. This revealed that there is an extra G at position -1 and a CCCC sequence at position +35 that are missing from the X17069 sequence. Aligning the coding regions of the rabbit p59 cDNA and the edited mouse X17069 cDNA now showed >88% homology. The mouse 5' sequence also lacks 13 nucleotides coding for the first 5 N-terminal amino acids (Fig. 1). The coding sequence for the missing amino acids was substituted with DNA sequence coding for a 10-amino acid sequence containing 6 histidines to facilitate the purification of the recombinant protein. The amino acid sequence (Fig. 1) deduced from the edited X17069 cDNA revealed a conserved FK506 binding domain at positions 46-139 that is very similar to that present in the immunophilin FKBP-12 and nearly identical to that of the rabbit p59 (6, 20, 21). While this manuscript was in preparation, Peattie et al. (22) reported the isolation of the human FKBP-52 cDNA using the GenBank X17069 cDNA sequence to generate PCR primers and to clone the human cDNA. The deduced amino acid sequence of the human FKBP-52 is >79% identical to our mouse FKBP-52 (22). Therefore the mouse X17069, the rabbit p59, and the human FKBP-52 cDNAs all appear to code for the same protein. To further characterize the mouse FKBP-52 we overexpressed this protein in Sf9 insect cells using the baculovirus expression system (16, 17). A time course analysis was performed on nuclear and cytoplasmic fractions isolated from AcNPV-FKBP-52-infected Sf9 cells at 16-72 hr after infection. Only the nuclear fractions from Sf9 cells infected with the recombinant baculovirus showed a protein band, which migrates as a 66-kDa protein (Fig. 2A, lanes 24, 48, and 72). This protein band was not detected in the nuclear fractions isolated from the wild-type virus-infected cells (lane WT). Expression of the 66-kDa band followed a biphasic time course with maximal accumulation seen at 48 hr after infection, which is consistent with the time course of infection with the baculovirus. The decline in the amount of expressed protein at 72 hr after infection may be due to virus-induced cytolysis. Cytoplasmic fractions from recombinant baculovirus-infected Sf9 cells did not reveal an FKBP-52 band by Coomassie staining (data not shown). Thus the majority of the rFKBP-52 is expressed in the nucleus of infected Sf9 cells, consistent with immunological studies showing that the majority of FKBP-52 is localized to the nucleus of mammalian cells (23, 24). The increase in the apparent molecular mass of the mouse rFKBP-52 is possibly due to three causes: (i) the presence of additional N-terminal six histidines, (ii) the presence of posttranslational modifications such as glycosylation and/or phosphorylation, and (iii) the mouse FKBP-52 has an estimated isoelectric point (pl) of 6.7, which is much higher than the rabbit and human FKBP-52 pls of 5.1. These factors may lead to an increase in the actual mass and net positive charge of the rFKBP-52, ultimately resulting in higher apparent molecular mass on SDS gels. In addition to the 66-kDa rFKBP-52, a band that migrates as a 90-kDa protein was present only in the nuclear fractions from the recombinant virus-infected Sf9 cells. This band is probably the hsp90 protein, which has been shown to be associated with the FKBP-52. The expression of FKBP-52 in the nucleus of Sf9 cells may have caused the sequestration of
MetHisHisHisHisHisHisGlyIleArgHisGluAlaAlaGluAsnGlyAlaG1LnSer
ATGCATCACCACCACCACCACGGAATTCGGCACGAGGCGGCGGAGAACGGGGCGCA LGTCG
21 61
AlaProLeuProLeuGluGlyValAspIleSerProLysGlnAspGluGlyValLe
41
ValIleLysArgGluGlyThr
121
Proc. Natl. Acad Sci. USA 90 (1993)
uLys
GCGCCCCTGCCTCTCGAAGGAGTGGACATCAGCCCCAAACAGGACGAGGGCGTGCTMCAAG 47 141
GTCATCAAGAGAGAGGGTACA _-
--
Dip._ -
20
60 40 120
FIG. 1. Deduced amino acid sequence and nu-
cleotide sequence of the N-terminal part of mouse rFKBP-52. The vertical arrow indicates the beginning of the GenBank X17069 sequence. Underlined sequences (solid line) are modifications of the X17069 sequence; the dashed line is the beginning of the first FKBP-like domain.
Biochemistry: Alnemri et al. A
M
16
24
48
72
Proc. Natl. Acad. Sci. USA 90 (1993)
WT
kDa
94-
4-
-4--
6743-
30-
20-
B
200 mM 400 mM 600 mM 800 mM M 1 2 1 2 1 2 1 2
kDa
9467-
..f..tl
44-
433020-
i
FIG. 2.. Overexpression and purification of the mouse rFKBP-52. (A) Nuclei were prepared from recombinant baculovirus AcNPVFKBP-52-infected Sf9 cells at 16-72 hr after infection (lanes 16, 24, 48, and 72) and from wild-type baculovirus-infected Sf9 cells at 48 hr after infection (lane WT). The nuclei (2 x 105 nuclei per sample) were solubilized in Laemmli sample buffer and then analyzed on a 10%t SDS/polyacrylamide gel and visualized by Coomassie staining. Time after infection (hr) is shown above each lane. (B) Mouse rFKBP-52 was purified on Ni2+ affinity resin as described in the text. rFKBP-52 was eluted with a step gradient of imidazole (two 4-ml fractions each step). The concentration of imidazole in each step in mM is shown above the fraction numbers. Large arrows at the right in A and B indicate the rFKBP-52. The small arrow at the right in A indicates (probably) the hsp90 and at the right in B indicates the associated 59-kDa phosphoprotein. Lanes M, molecular mass markers.
some hsp90 in the nucleus, because of its affinity for FKBP52. Our experiments have shown that rFKBP-52 can bind hsp90 and hsp70 in vitro (data not shown). The rFKBP-52 was purified as described in Materials and Methods. As shown in Fig. 2B, a major 66-kDa rFKBP-52 protein band was eluted at 400-600 mM imidazole. Two minor protein bands with molecular masses of 55 and 59 kDa were also present in the 400-600 mM imidazole eluent. The 55-kDa protein band is probably a Ni2+ binding protein since it was present in eluents from a mock purification from wild-type virus-infected cells (data not shown). Interestingly, the 59-kDa protein was only present in preparations containing rFKBP-52. The association of this 59-kDa protein with rFKBP-52 is discussed below. Using this purification procedure 10 mg of pure rFKBP-52 was obtained from 1 liter of Sf9 cells. N-terminal sequence analysis of the purified, rFKBP-52 (z150 pmol) indicated a blocked N terminus. Cyanogen bromide digestion of the rFKBP-52 followed by automated Edman sequence analysis produced multiple sequences characteristic of cleavage of the FKBP-52 at internal methionine residues. N-terminal analysis of a 12-kDa cyanogen bromide fragment produced the sequence KVGEV, corresponding to deduced amino acid 103-107 of the FKBP52. Cyanogen bromide digestion of the rFKBP-52, followed
6841
by reduction of the disulfide linkages with 2-mercaptoethanol, binding to the Ni2W affinity resin, elution ofpeptides with 800 mM imidazole, and subsequent N-terminal sequence analysis, produced an amino acid sequence of 25 residues that matched the N-terminal sequence of the rFKBP-52 protein. In Vitro Assembly of the rFKBP-52 with GR. Recently we have developed an in vitro assembly system for the 8-10 S unactivated GR (18) similar to that described by Pratt and coworkers (25, 26) using the reticulocyte lysate. In our system, purified activated recombinant GR isolated from baculovirus-infected Sf9 cells is incubated with reticulocyte lysates at room temperature in the presence of an ATP regeneration system. This results in the reconstitution of the steroid binding ability and the conversion of the activated GR to the 8-10 S oligomeric non-DNA binding complex. To examine whether the rFKBP-52 can be assembled with the GR in our in vitro assembly system, we incubated 35S-labeled nuclear extracts containing rFKBP-52 with reticulocyte lysates in the presence or absence of added GR. After the assembly, the lysates were immunoprecipitated with the BUGR 2 anti-GR monoclonal antibody in a buffer containing 20 mM molybdate to stabilize the receptor complex. The immunoprecipitates were then analyzed by SDS/PAGE and autoradiography. Fig. 3 shows a major 66-kDa rFKBP-52 band present predominantly in the immunoprecipitates from the GR-containing reticulocyte lysate. A corresponding very faint band was also present in the immunoprecipitates from the minus GR reticulocyte lysate that could be due to the ability FKBP-52 to interact with hsp70, which binds nonspecifically to protein A-Sepharose. Another minor 52-kDa band was also present predominantly in the immunoprecipitates from the GR-containing reticulocyte lysate that could represent the Sf9 FKBP-52. In another set of experiments the GR complex was assembled in the presence or absence of added purified rFKBP-52. The assembled preparations were labeled with [3H]triamcinolone acetonide and then adsorbed to Ni2+ affinity resin. The assembled preparation containing rFKBP-52 was able to bind to the Ni2+ affinity resin and showed severalfold higher steroid binding than the minus rFKBP-52 control preparations (data not shown). These results confirm that our rFKBP-52 is a functional protein and that the FKBP-52 is a true component of the unactivated GR complex. FKBP-52 Is an ATP/GTP Binding Protein. By structural analysis of the predicted amino acid sequence of the rabbit immunophilin p59, Callebaut et al. (7) predicted that it contains an ATP/GTP binding domain within the second FKBP-like domain, near the FK506 binding site. To test this possibility, purified rFKBP-52 was incubated under different conditions with 8-azido[a-32P]ATP and then UV crossGR kDa
-
+
9467-
43-
30-
20-
~> +
FIG. 3. Assembly ofthe mouse rFKBP-52 with GR in reticulocyte lysates. 35S-labeled rFKBP-52 was assembled with GR in reticulocyte lysates and analyzed as described in the text. Lane -, assembly in the absence of GR; lane +, assembly in the presence of GR. The large arrow indicates the rFKBP52. The small arrow indicates (probably) the Sf9 FKBP-52. Molecular mass markers are indicated.
6842
Proc. Natl. Acad. Sci. USA 90 (1993)
Biochemistry: Alnemri et al.
linked. The labeled protein was then analyzed by SDS/PAGE and autoradiography. Fig. 4 shows that the rFKBP-52 is covalently labeled with 8-azido[a-32P]ATP. The covalent labeling was enhanced by divalent cations such as Ca2+ and Mg2+ (lanes 2-4). In the presence of excess unlabeled ATP or GTP the covalent labeling of the rFKBP-52 with 8-azido[a-32P]ATP was significantly inhibited (lanes 5 and 6). These data indicate that the rFKBP-52 can bind ATP, GTP, and probably other nucleotides. The binding site(s) and the functional significance of this activity are not yet known, although this activity may be involved in the assembly or trafficking of steroid receptor complexes since it has been shown that assembly of the GR or progesterone receptor is an energyrequiring process (26, 27). Identification of a rFKBP-52-Associated Phosphoprotein. Because of the ability of the rFKBP-52 to bind ATP we were interested in determining whether it possesses a kinase or ATPase activity. Purified rFKBP-52 was adsorbed to Ni2+ affinity resin and aliquots of the resin were incubated with [y-32P]ATP in the presence or absence of Ca2+ or Mg2+ and then analyzed by SDS/PAGE and autoradiography (Fig. SA). Surprisingly, a highly radioactive protein band migrating as a 59-kDa protein was only present in the FKBP-52 preparation incubated with Mg2+ (Fig. 5A, lane Mg2+). There was only a faint band corresponding to the rFKBP-52 above the 59-kDa band. To determine whether this 59-kDa phosphoprotein is associated with the rFKBP-52 or it is just a copurifying contaminant, we adsorbed nuclear extracts from Sf9 cells infected with either the wild-type virus, a GR recombinant baculovirus (16), or the recombinant AcNPV-FKBP-52 baculovirus to Ni2+ affinity resin. The resins were then incubated with [y32P]ATP and Mg2+ and analyzed as described above (Fig. 5 B and C). Coomassie staining of the resin-adsorbed proteins shows that only the rFKBP-52 preparation contains a 59-kDa band in addition to the rFKBP-52 band (Fig. SB, lane FKBP-52). Both of these bands were not present in the wild-type or GR virus controls (Fig. SB, lanes WT and GR). In addition, the autoradiogram shows a 59-kDa radioactive band present only in the rFKBP-52 preparation (Fig. SC, lane FKBP-52). These data suggest that the 59-kDa species is a phosphoprotein or kinase that is specifically associated with the rFKBP-52. Purification and Amino Acid Sequence Analysis of the rFKBP-52-Associated Protein. To purify the 59-kDa associ-
A
B
Pu
Q
kDa
Mg2+
Ca24 kDa
-
_
-
+
+
-
+ ++
+
+
+
-
-
-
+
67-
43-
43-
30-
30-
20-
20-
FIG. 5. Kinase activity associated with the rFKBP-52. (A) Purified rFKBP-52 was adsorbed to Ni2+ affinity resin and aliquots of the resin were incubated with [y.32P]ATP in the presence or absence of Mg2+ (0.1 mM) (lane Mg2+) or Ca2+ (0.1 mM) (lane Ca2+) and then analyzed by SDS/PAGE and autoradiography. (B and C) Nuclear extracts from Sf9 cells infected with either the wild-type virus (lane WT), a GR recombinant baculovirus (lane GR), or the recombinant AcNPV-FKBP-52 baculovirus (lane FKBP-52) were adsorbed to Ni2+ affinity resin. The resins were incubated with [y.32P]ATP and Mg2+ and the proteins were then analyzed on a 10% SDS/ polyacrylamide gel and visualized by Coomassie staining (B) and autoradiography (C). Exposure time in A and C was 45 min. Molecular mass markers are indicated.
ated protein we were interested in determining whether we can enrich the protein using nuclear extracts from uninfected Sf9 cells. Purified rFKBP-52 was adsorbed to Ni2+ affinity resin and then washed extensively with 2 M NaCl buffer. The washed resin was then incubated with nuclear extracts from uninfected Sf9 cells, washed several times with low salt buffer, incubated with [y-32P]ATP and Mg2+, and then analyzed as described above. As shown in Fig. 6A, incubation of washed rFKBP-52 preparation with Sf9 nuclear extracts resulted in a severalfold increase in the amount and radioactivity of the 59-kDa protein. No Coomassie-stainable or radioactive band was present in resin adsorbed with only nuclear extracts (lane 1), suggesting that the associated R i
A
kDa
1
2
3
C AP
kDa M
94-
672
JW.',ij,
I
qlP
67-
_
43-
43-
_Ip
30-
30-
_
20-
20- A_
3 ._-
:.
FIG. 6. Enrichment and purification of the rFKBP-52-associated phosphoprotein. Purified rFKBP-52 immobilized on a Ni2+ affinity resin was washed extensively with 2 M NaCl buffer or 6 M guanidine hydrochloride. The salt-washed FKBP-52 was incubated with a nuclear extract from uninfected Sf9 cells (A, lane 3). The guanidine hydrochloride-washed FKBP-52 was renatured in a native buffer and
433020
C
S
94-
67-
1
9467-
I,". Kva
4
94-
GTP----- + ATP
CLO
_-
-
1
2
3
4
5
6
FIG. 4. Covalent labeling of the mouse rFKBP-52 with 8-azido[a-32P]ATP. Purified rFKBP-52 (15 ,ug per sample) was incubated with 8-azido[a-32P]ATP in the presence (+) or absence (-) of divalent cations or unlabeled ATP or GTP. The labeled proteins were analyzed on a 10%o SDS/polyacrylamide gel and visualized by autoradiography. The arrow indicates the rFKBP-52. Molecular mass markers are indicated.
then incubated with a nuclear extract from human CEM lymphocytes (B, lane 3). The resins were incubated with [y-32P]ATP and Mg2+ and then analyzed as described in the legend to Fig. 5. (A) Coomassiestained gel (top) and the corresponding autoradiogram (bottom). Lane 2 in A, salt-washed FKBP-52; lane 1 in B, guanidine hydrochloride-washed FKBP-52 controls. Ni2+ affinity resins adsorbed with nuclear extracts from Sf9 cells (A, lane 1) or CEM lymphocytes (B, lane 2) are also shown as controls. (C) Purified 59-kDa associated phosphoprotein (lane AP). Arrows indicate the 59-kDa associated phosphoprotein. Molecular mass markers are indicated (lane M). Exposure time in A is 45 min and in B is 18 hr.
Biochemistry: Alnenui et al. protein is not a Ni2+ binding protein. To rule out the possibility that the 59-kDa protein binds to the histidine domain that was artificially introduced at the N terminus of the rFKBP-52, we chemically synthesized a 15-mer peptide containing the histidine domain and the next 8 N-terminal amino acids. Incubation of this peptide with Sf9 nuclear extracts and adsorption to the Ni2+ resin did not show any association of the 59-kDa protein with this peptide (data not shown). These data confirm that the 59-kDa protein is a rFKBP-52-associated protein and that it is expressed constitutively in Sf9 cells. To determine whether a similar protein exists in mammalian cells, we prepared a nuclear extract from CEM lymphocytes (28) and incubated it with guanidine hydrochloride-washed rFKBP-52. Purified rFKBP-52 was adsorbed to Ni2+ affinity resin, washed with 6 M guanidine hydrochloride to remove any residual associated 59-kDa protein, and then renatured in a native buffer. The washed resin was incubated with CEM lymphocyte nuclear extracts and then analyzed as described above. Fig. 6B shows a 59-kDa radioactive band that is present predominantly in the preparation containing rFKBP-52 and CEM lymphocyte nuclear extracts (lane 3). No such activity was observed with the washed rFKBP-52 (lane 1) or with resin adsorbed with only CEM nuclear extracts (lane 2). The CEM 59-kDa protein is apparently not as abundant as its Sf9 counterpart since it was necessary for us to expose the autoradiogram overnight to detect the signal. After establishing that the associated 59-kDa phosphoprotein can be stripped from the FKBP-52 using guanidine hydrochloride, we mixed nuclear extracts from uninfected Sf9 cells and nuclear extracts from Sf9 cells infected with the recombinant baculovirus AcNPV-FKBP-52 and then adsorbed the extracts to the Ni2+ affinity resin. The resin was washed as described for the purification of rFKBP-52 above and then eluted with 6 M guanidine hydrochloride. The eluate was concentrated on an Amicon 30 concentrator and then dialyzed against a native buffer. As expected, the associated 59-kDa protein was the only protein present in the eluate (Fig. 6C) and was >90% pure as determined by Coomassie staining. Amino acid sequence analysis of the N terminus of this protein revealed the following sequence: MFWGLIMEPNKRYTQVVEKPF. Several other internal sequences were obtained after cyanogen bromide cleavage of the protein followed by SDS/PAGE and electroblotting to Immobilon membranes. There were no known proteins that contained any of our sequences in the GenBank. Northern blot analysis of total RNA from human lymphocytic cell lines and from Sf9 cells with a 200-bp partial cDNA probe of the 59-kDa phosphoprotein showed that this protein is highly expressed in human Jurkat and insect Sf9 cells compared to other cell lines (data not shown). We conclude that the 59-kDa phosphoprotein that is associated with the rFKBP-52 is a protein that might be involved in regulating the function of the FKBP-52. It has been shown that the binding of the immunosuppressant FK506 to FKBP12 inhibits T-cell activation by inhibiting the phosphatase activity of calcineurin, which is required to activate the T-cell-specific transcriptional factor NF-AT (4). The FK506-FKBP12 forms a complex with calcineurin resulting in its inactivation. On the other hand, the FK506-FKBP-52 does not form a complex with or inhibit the phosphatase activity of calcineurin (15); therefore, it would be interesting if the FKBP-52-associated phosphoprotein were a nuclear kinase that acts on transcriptional factor NF-AT directly. Phosphorylation of NF-AT by this kinase would inhibit its activity and would complement inhibition of calcineurin phosphatase activity. Recently it has been shown that the FKBP-52 exists as a 110-kDa high molecular mass
Proc. Natl. Acad. Sci. USA 90 (1993)
6843
complex (15) and that the FKBP-52 may form a dimer. However, our interpretation is that the association of the FKBP-52 with the 59-kDa phosphoprotein may give rise to a 110-kDa complex. We thank Dr. M. Summers for the baculovirus expression system and Dr. W. J. Hendry III for the BUGR 2 monoclonal antibody. We also thank Dr. L. Wang for her technical assistance. This work was supported by research Grant DK 13531 from the National Institutes of Health. 1. Schreiber, S. L. (1991) Science 251, 283-287. 2. Schreiber, S. L. (1992) Cell 70, 365-368. 3. Schreiber, S. L. & Crabtree, G. R. (1992) Immunol. Today 13, 136-142. 4. Liu, J., Farmer, J. D. J., Lane, W. S., Friedman, J., Weissman, I. & Schreiber, S. L. (1991) Cell 66, 807-815. 5. Sigal, N. H. & Dumont, F. J. (1992) Annu. Rev. Immunol. 10, 519-560. 6. Lebeau, M.-C., Massol, N., Herrick, J., Faber, L., Renoir, J.-M., Radanyi, C. & Baulieu, E.-E. (1992) J. Biol. Chem. 267, 4281-4284. 7. Callebaut, I., Renoir, J. M., Lebeau, M. C., Massol, N., Burny, A., Baulieu, E.-E. & Mornon, J. P. (1992) Proc. Natl. Acad. Sci. USA 89, 6270-6274. 8. Yem, A. W., Tomasselli, A. G., Heinrikson, R. L., ZurcherNeely, H., Ruff, V. A., Johnson, R. A. & Deibel, M. R. J. (1992) J. Biol. Chem. 267, 2868-2871. 9. Renoir, J.-M., Radanyi, C., Faber, L. & Baulieu, E.-E. (1990) J. Biol. Chem. 265, 10740-10745. 10. Tai, P.-K., Maeda, Y., Nakao, K., Wakim, N. G., Duhring, J. L. & Faber, L. E. (1986) Biochemistry 25, 5269-5275. 11. Rexin, M., Busch, W. & Gehring, U. (1991) J. Biol. Chem. 266, 24601-24605. 12. Sanchez, E. R. (1990) J. Biol. Chem. 265, 22067-22070. 13. Tai, P. K., Albers, M. W., Chang, H., Faber, L. E. & Schreiber, S. L. (1992) Science 256, 1315-1318. 14. Perdew, G. H. & Whitelaw, M. L. (1991) J. Biol. Chem. 266, 6708-6713. 15. Wiederrecht, G., Hung, S., Chan, H. K., Marcy, A., Martin, M., Calaycay, J., Boulton, D., Sigal, N., Kincaid, R. L. & Siekierka, J. J. (1992) J. Biol. Chem. 267, 21753-21760. 16. Alnemri, E. S., Maksymowych, A. B., Robertson, N. M. & Litwack, G. (1991) J. Biol. Chem. 266, 3925-3936. 17. Summers, M. D. & Smith, G. E. (1987) A Manual of Methods for Baculovirus Vectors and Insect Culture Procedures (Texas Agric. Exp. Stn. B., College Station), Bull. 1555. 18. Alnemri, E. S. & Litwack, G. (1993) Biochemistry 32, 53875393. 19. Alnemn, E. S., Maksymowych, A. B., Robertson, N. M. & Litwack, G. (1991) J. Biol. Chem. 266, 18072-18081. 20. Maki, N., Sekiguchi, F., Nishimaki, J., Miwa, K., Hayano, T., Takahashi, N. & Suzuki, M. (1990) Proc. Natl. Acad. Sci. USA
87, 5440-5443. 21. Standaert, R. F., Galat, A., Verdine, G. L. & Schreiber, S. L. (1990) Nature (London) 346, 671-674. 22. Peattie, D. A., Harding, M. W., Fleming, M. A., DeCenzo, M. T., Lippke, J. A., Livingston, D. J. & Benasutti, M. (1992) Proc. Natl. Acad. Sci. USA 89, 10974-10978. 23. Gasc, J. M., Renoir, J. M., Faber, L. E., Delahaye, F. & Baulieu, E.-E. (1990) Exp. Cell Res. 186, 362-367. 24. Ruff, V. A., Yem, A. W., Munns, P. L., Adams, L. D., Reardon, I. M., Deibel, M. R. J. & Leach, K. L. (1992) J. Biol. Chem. 267, 21285-21288. 25. Hutchison, K. A., Brott, B. K., De Leon, J. H., Perdew, G. H., Jove, R. & Pratt, W. B. (1992) J. Biol. Chem. 267, 2902-2908. 26. Hutchison, K. A., Czar, M. J., Scherrer, L. C. & Pratt, W. B. (1992) J. Biol. Chem. 267, 14047-14053. 27. Smith, D. F., Stensgard, B. A., Welch, W. G. & Toft, D. 0. (1992) J. Biol. Chem. 267, 1350-1356. 28. Alnemri, E. S. & Litwack, G. (1990) J. Biol. Chem. 265, 17323-17333.
