PCOS

Clinic al

dical Bio Me c

try mis he

&

Clinical & Medical Biochemistry

ISSN: 2471-2663

Zerva et al., Clin Med Biochem 2017, 3:1 DOI: 10.4172/2471-2663.1000123

Research Article

OMICS International

AKT2 Gene Polymorphisms, Srankl/OPG And Hormone Measurements in Polycystic Ovarian Syndrome (PCOS) Women Aikaterini Zerva1, Christos Kroupis1*, Efthihios Trakakis2, Nikoleta Poumpouridou1, Marina Tsagkla1, Evanthia Kassi3, Dimitrios Kassanos4 and Kleanthi Dima1 1Department

of Clinical Biochemistry, Attikon University General Hospital, Medical School, National and Kapodistrian University of Athens, Athens, Greece

2Department

of Obstetrics and Gynecology, Attikon University General Hospital, Medical School, National and Kapodistrian University of Athens, Athens, Greece

3Department

of Biological Chemistry, Medical School, National and Kapodistrian University of Athens, Athens, Greece

4Fetal

Medicine Unit, Third Department of Obstetrics and Gynecology, Attikon University General Hospital, Medical School, National and Kapodistrian University of Athens, Athens, Greece.

*Corresponding

author: Christos Kroupis, Department of Clinical Biochemistry, Attikon University General Hospital, Medical School, National and Kapodistrian University of Athens, Athens, Greece, Tel: ; E-mail: [email protected] Received date: February 06, 2017; Accepted date: Feb 24, 2017; Published date: March 01, 2017

Copyright: © 2017 Zerva A, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Abstract Objective: Polycystic Ovarian Syndrome (PCOS) is a common endocrinologic disorder diagnosed in 6-10% of female population at reproductive age. Altered expression of AKT2 gene has been correlated to increased insulin tolerance and reduced glucose disposal, both of which are PCOS features. The goal of this study was to investigate the association between AKT2 gene polymorphisms, serum biomarkers OPG and sRANKL as cardiovascular biomarkers, hormones (DHEAS, SHBG, testosterone, E2, LH, FSH, prolactin, insulin, 17-OH progesterone) and clinical characteristics as well (amenorrhea, oligomenorrhea, dysmenorrhea, acne, hirsutism, oily skin). Study Design: A total of 60 Greek Caucasian PCOS patients and another 30 healthy women that were age- and BMI-matched, were recruited in the study and their blood specimens and clinical characteristics collected. Serum OPG and sRANKL were measured with ELISA kits and hormones with Roche Cobas e411 immunochemical analyzer. Four AKT2 gene DNA SNPs (Single Nucleotide polymorphisms) were selected; rs11671439, rs8100018, rs3730051 and rs2304188 and novel real-time qPCR methods were developed using either the dual probe or the single probe format for their genotyping in the LightCycler platform. All findings were confirmed with DNA Sequencing and statistical analysis was performed using SNPstats and SPSS software. Results: PCOS women had higher serum levels of sRANKL, DHEAS, testosterone and 17-OH progesterone and lower levels of E2, SHBG and prolactin than controls. There was a statistically important difference for SNP rs2304188 between patients and controls regarding Minor Allele Frequency (MAF%): it was found to be more frequent in PCOS patients compared to controls [OR 4.04 (C.I. 1.12-14.54)], whereas concerning the entire population, studied individuals bearing the rs2304188 SNP have higher values of DHEAS and 17-OH progesterone, both biomarkers of PCOS. Furthermore, an association between hirsutism and SNP rs2304188 was found in PCOS patients (p=0.044). Eight participants had SNP rs8100018 in their DNA in combination with either rs11671439 or rs2304188; all were PCOS women. Conclusions: Our results adjudicate further study on AKT2 gene SNPs in relation with PCOS.

Keywords: Polycystic ovary syndrome (PCOS); AKT2 gene; SNP; sRANKL; OPG

Abbreviations BMI: Body Mass Index; CI: confidence intervals; HWE: Hardy Weinberg Equilibrium; GVS: Genome Variation Server: MAF: Minor Allele Frequency; OPG: osteoprotegerin; OR: Odds ratio; PCOS: Polycystic Ovarian Syndrome; PCR: Polymerase Chain Reaction; POM: Polycystic ovarian morphology; qPCR: quantitative Polymerase Chain Reaction; sRANKL: soluble receptor activator of nuclear factor (NF)-kB ligand; SNP: Single Nucleotide Polymorphism; SD: Standard Deviation; Tm: Melting Point.

Clin Med Biochem, an open access journal ISSN: 2471-2663

Introduction Polycystic ovarian syndrome (PCOS) is a common endocrinologic disorder diagnosed in 6-10% of the female population at reproductive age [1-2]. Although many studies have investigated PCOS prevalence, there are discrepancies in their results, partly due to the use of various definitions of the syndrome and its sub-phenotypes, differences between study cohorts, ethnicities, and types of recruitment and sampling. PCOS is characterized by hyperandrogenism, oligoovulation, and polycystic ovarian morphology [3-4]. In 1990 the National Institute of Health (NIH) proposed the first PCOS diagnostic criteria that required the combination of chronic oligo/anovulation and clinical or biochemical evidence of hyperandrogenism, with the exclusion of related disease such as nonclassical congenital adrenal hypertrophy, Cushing syndrome,

Volume 3 • Issue 1 • 1000123

Citation:

Zerva A, Kroupis C, Trakakis E, Poumpouridou N, Tsagkla M, et al. (2017) AKT2 Gene Polymorphisms, Srankl/OPG And Hormone Measurements in Polycystic Ovarian Syndrome (PCOS) Women. Clin Med Biochem 3: 123. doi:10.4172/2471-2663.1000123

Page 2 of 7 hyperprolactinemia and malfunctions of the thyroid gland [5]. Subsequently, in 2003 the Rotterdam European Society of Human Reproduction and the Embryology/American Society for Reproduction Medicine (ESHRE/ASRM) sponsored the PCOS Consensus Workshop group (Rott-PCOS) that proposed the addition of polycystic ovarian morphology (POM) to the NIH criteria, stating that PCOS could be diagnosed when any two of these three criteria were present [6]. More recently, in 2006 the Androgen Excess Society (AES) proposed new diagnostic criteria and stated that the syndrome must only be diagnosed in the presence of hyperanderogenism in combination with oligo/anovulation and/or POM [7]. Although polycystic ovarian syndrome is probably one of the most common endocrinologic disorder, its pathogenesis still remains unclear. Obesity, insulin resistance and low vitamin D levels are present in more than 50% of PCOS patients. These factors along with hyperandrogonism could have adverse effects in their long-term health. Insulin resistance is observed in up to 70% of women with PCOS. The molecular basis of this intrinsic resistance mechanism remains unknown, but post-insulin receptor defects appear to contribute to the pathophysiology of both insulin resistance and hyperandrogonemia [8]. The insulin signaling pathway includes two main arms: a metabolic arm through the activation of phosphatidylinositol 3-kinase (PI3K) and a mitogenic arm acting via mitogen-activated protein kinase [9]. The expression and activity of PI3K downstream targets have been investigated in PCOS tissues, with distinct molecular defects in post–insulin receptor signaling identified in fibroblasts and adipose tissues of PCOS women [10]. AKT gene activates 3-phosphoinositide dependent kinase (PIDK), which is activated by the product of PI3K, phosphatidylinositol 3,4,5-trisphosphate and participates in insulin signaling. Three highly conserved genes encode the forms of AKT1, AKT2 and AKT3 [7,11]. AKT2 (AKT serine/threonine kinase 2) is located at 19q13.2 locus (22 exons) and is a widely expressed gene that is involved in metabolism of insulin, mitogenic signaling and apoptosis [11]. In type 2 diabetes, there is reduced activation of AKT2 gene by insulin in adipocytes. Insulin-stimulated AKT phosphorylation is reduced 40-60% in PCOS skeletal muscle compared with matched control muscle [9]. It has traditionally been suggested that prolactin excess, enzymatic steroidogenic abnormalities and thyroid disorders need to be excluded before a PCOS diagnosis is confirmed. However, there is paucity of data regarding the prevalence of PCOS phenotype in some of these disorders, whereas other endocrine diseases that exhibit PCOS-like features may evade diagnosis and proper management, if not considered. Hyperinflammation and impaired epithelial function were reported to a larger extent in PCOS women and could be particularly associated with hyperandrogenism [12], obesity and insulin resistance. Available data from register-based and data linkage studies support that metabolic-vascular and thyroid diseases, asthma, migraine, depression, and cancer are diagnosed more frequently in PCOS, whereas fracture risk is decreased [13]. Drug prescriptions are significantly more common in PCOS than controls within all diagnostic categories including antibiotics use. The causal relationship between PCOS and autoimmune disease represents an interesting new area of research. PCOS is a lifelong condition and long-term morbidity that could be worsened by obesity, sedentary lifestyle, western-type diet and smoking, whereas lifestyle intervention including weight loss may partly or fully resolve the PCOS symptoms and could improve the long-term prognosis. As many as 20% of women with infertility


problems (including fecundability and early pregnancy loss) have been diagnosed with PCOS. It is often called the most common cause of anovulatory infertility in women. PCOS is also associated with cardiovascular problems, neurological and psychological effects on quality of life (including anxiety and depression), and breast and endometrial cancers [14]. Recently there was a connection between cardiovascular disease and osteoprotegerin (OPG, an osteoclast inhibitory factor) and sRANKL (soluble receptor activator of nuclear factor (NF)-kB ligand) biomarkers [15]. There is no known PCOS cause; however, there has been evidence that shows that both environmental as well as genetic factors play a role in the etiology [16]. The goal of this study was to investigate the association among AKT2 gene SNPs (Single Nucleotide Polymorphisms), OPG/sRANKL as cardiovascular biomarkers, hormone measurements and clinical characteristics as well in PCOS patients in the Greek female population.

Materials and Methods Subjects We studied a total of 60 Caucasian patients with PCOS aged 18-35 and 30 Caucasian control women that were age-and BMI-matched. Weight and height were measured and obesity was assessed by estimating Body Mass Index (BMI). All patients were recruited from the reproductive endocrinology clinic of Attikon University General Hospital (physician in charge: E.T.). Participation in the research protocol was offered to patients meeting the PCOS Rotterdam diagnostic criteria and the following inclusion criteria: being premenopausal, not pregnant and not submitted to hormonal therapy (including oral contraceptives) for at least 3 months prior to testing. Control subjects were healthy women working at Attikon University General Hospital with regular menstrual cycles and without any family history of PCOS or hirsutism. They had no evidence of hirsutism, acne, alopecia, endocrine dysfunction and were not submitted to hormonal therapy (including oral contraceptives) for at least 3 months prior to testing. A standard questionnaire was filled, including menstural periods and irregularity, hirsutism and acne, reproductive history, gynecological history and use of medications including oral contraceptive pills. The presence of hirsutism was scored in all subjects using the Lorenzo Scale [17]. Subjects with diabetes were excluded. Transvaginal ultrasonography was performed in all subjects. The ethics committee of the hospital approved the study and a signed informed consent was obtained from each participant.

Methods Serum measurements Whole blood was obtained on day 2 or 3 of the menstrual cycle or during amenorrhea, centrifuged for 10 min at 3500 rpm and serum was collected and stored in -80°C until assayed. Hormone measurements included DHEAS, SHBG, testosterone, E2, LH, FSH, T3, T4, TSH, FT3, FT4, insulin, prolactin and were performed on an automated routine immunochemical analyzer COBAS e-411 (Roche Diagnostics, Manheim, Germany) that employs electrochemiluminescence.

Volume 3 • Issue 1 • 1000123

Citation:


Page 3 of 7 Serum OPG and sRANKL were measured by commercial ELISA kits (Biomedica Gruppe, Vienna, Austria). The limit of detection for OPG was 0.14 pmol/L and that of sRANKL 0.02 pmol/L. Both kits show inter-assay precisions of less than 8% in their performance characteristics.

Genomic DNA isolation From an additional blood sample collected in EDTA tubes, genomic DNA was isolated from 200 μL by the QIAamp DNA Blood Mini kit (Qiagen, Germany) according to the manufacturer's instructions. DNA purity and quantity were determined by fluorescence readings with the use of Quant-iTdsDNA-BR kit in the Qubit 1.0 fluorimeter (Life SNP rs2304188

Location Intron 10

Technologies Invitrogen, USA). Extracted DNA was stored in -20°C until assayed.

Genotyping Four intronic SNPs (rs2304188, rs11671439, rs3730051 and rs8100018) spanning the entire 51.5-kb genomic length of AKT2 gene were selected for evaluation of their association with the disease (Table 1). We developed novel real-time qPCR methods for their genotyping by using either the dual or single hybridization probe format. The sequences of the primers and probes of the proposed real time PCR assays synthesized by TIB MOLBIOL (Berlin, Germany) are shown in Table 1.

PCR primers

Probes

Tanneal

GTGGGGGTAGGAACGTG

CCCCAGACCTGTGTGT X̽I̽ ̽TTCCA

56

CCTGCATTAGCCTGTGATGAA

GGGTCCTTGCTTGCCCAC-FL

59

CCCTATGACTTCATCTCAGGAAGTAC

LC 640-TTCTAGACTCCCAAGCCTCCGTTTCCT

GAAAAAAGCCTGTCATGGA

AAAAAA XI ̽ AGCAGGGGCCGGGGAC

53

TTGTGATGGAGTATGCCAACG

ACGAAGCCGCCTGCCTCAAGGG-FL

59

TGGGCAAGCCACTTAACCT

LC705-GAGGGGCACCAGATGACACTGA

GAGGCTGGCATCACAGTC rs11671439

rs8100018

Intron 1

Intron 4

AACTTGCTTTAACCCATGC rs3730051

Intron 8

Table 1: Primers and probe sequences used in AKT2 genotyping analysis. The SNP position is underlined. Probes were labeled either with fluorescein (FL) or with LC 640 or 705 dyes. ̽ XI denotes FL. Real-time PCR was performed in glass capillary tubes in the LightCycler 1.5 instrument (Roche Applied Science, Switzerland). The amplification mixture of a total volume of 10 μL included 1 μL of genomic DNA extract as template (~30 ng), 2 pmol/μL forward primer, 2pmol/μL reverse primer, either 0.1 μM Simple probe or a combination of 0.15 μM FL-Sensor probe with fluorescein and 0.15 μM Anchor probe labeled with LC640 or LC705 dye (in the case of dual probe format) and 1 μL of 10× FastStart DNA Master Hybprobe mix (Roche Applied Science, Switzerland). We added MgCl2 to a final optimal 3 mM concentration. Sterile H2O was used to supplement up to 10 μL. The cycling protocol consists of pre-incubation at 95°C for 10 min for hot-start activation, followed by 40 cycles of denaturation at 95°C for 10 secs, annealing at a specified temperature (Table 1 for Tanneal) for 20 sec and extension at 72°C at 30 sec. Emitted fluorescence was measured at the end of each annealing step at a selected fluorescence channel (F1 for simple probes, F2 for LC640 or F3 for LC705 anchor probe). Immediately after amplification, melting curve analysis was performed on the LightCycler. The melting curve protocol included raising the temperature at 95°C for 10 secs, cooling at 40°C for 120 sec and slow heating to 85°C at a rate of 0.3°C/sec, during which time fluorescence measurements were continuously collected in the selected fluorescence channel. The first derivative plot (-d(F)/dT vs. T) is then used for easy identification of wild-type and mutant alleles by their different peaks, as the mismatched probe will dehybridize at an earlier stage.

DNA Sequencing For the verification of the real-time qPCR results, the Gold Standard method of DNA Sequencing was used for method comparison. After the purification of the amplicons prepared from conventional PCR reactions (High Pure PCR Cleanup Micro kit, Roche Applied Science, Switzerland), cycle sequencing reaction were performed with the Big Dye 1.1 reagent in both directions with the use of either the forward or the reverse primer (ThermoFisher Applied Biosystems, USA). 10 μL of the purified cycle sequencing reactions (by NucleoSeq columns, Macherey-Nagel, Germany) were heated at 95 for 2 min and cooled immediately at 4 for 2 min with 10 μL formamide and then run in capillaries of the ABI Prism 310 Genetic Analyzer. For the analysis of DNA sequencing electropherograms the Chromas 2.01 software was used (Technelysium Pty Ltd, Australia) and results were compared with the expected gene sequences with the NCBI BLAST tool (https:// blast.ncbi.nlm.nih.gov).

Statistics Genotyping statistical analysis was performed through the SNPStats Internet platform (http://bioinfo.iconcologia.net/snpstats/start.html). The variants were tested for Hardy-Weinberg equilibrium (HWE) in either POCS patients or controls for each studied SNP, tables with genotype and allele frequencies were constructed and Odds Ratios (OR) and 95% confidence intervals (CI) were calculated. Further analysis was performed with SPSS v.22 (IBM, USA). Descriptives were calculated for all variables. The distribution of continuous variables was assessed with Kolmogorov-Smirnov test.


Volume 3 • Issue 1 • 1000123

Citation:


Page 4 of 7 Comparisons between continuous variables non-normally distributed were performed with Mann-Whitney U. Dichotomous comparisons were performed using Fisher’s exact test. The level of significance was set at p ≤ 0.05.

allele determination and DNA Sequencing electrophore grams e.g., for SNP rs3730051 are shown in Supplementary Figures 1,2,3 respectively. Each real-time PCR reaction included a blank and either a homozygote or a heterozygote positive control.

Results

Controls

Cases

Cases and controls were matched for age and BMI (Table 2, p>0.05, Mann Whitney). Almost all PCOS clinical characteristics except amenorrhea were significantly more frequent for cases than controls as calculated with Fisher’s exact test (Table 2). Cases had significantly higher values for sRANKL (p