Peroxisomal Monodehydroascorbate Reductase ... - Plant Physiology

Peroxisomal Monodehydroascorbate Reductase. Genomic Clone Characterization and Functional Analysis under Environmental Stress Conditions1 Marina Leterrier2, Francisco J. Corpas*, Juan B. Barroso, Luisa M. Sandalio, and Luis A. del Rıó Departamento de Bioquı´mica, Biologıá Celular y Molecular de Plantas, Estacioń Experimental del Zaidıń, Consejo Superior de Investigaciones Cientı´ficas, Apartado 419, E-18080 Granada, Spain (M.L., F.J.C., L.M.S., L.A.R.); and Grupo de Senãlizacioń Molecular y Sistemas Antioxidantes en Plantas, Unidad Asociada al ´ rea de Bioquı´mica Consejo Superior de Investigaciones Cientı´ficas (Estacioń Experimental del Zaidıń), A y Biologıá Molecular, Universidad de Jaeń, Spain (J.B.B.)

In plant cells, ascorbate is a major antioxidant that is involved in the ascorbate-glutathione cycle. Monodehydroascorbate reductase (MDAR) is the enzymatic component of this cycle involved in the regeneration of reduced ascorbate. The identification of the intron-exon organization and the promoter region of the pea (Pisum sativum) MDAR 1 gene was achieved in pea leaves using the method of walking polymerase chain reaction on genomic DNA. The nuclear gene of MDAR 1 comprises nine exons and eight introns, giving a total length of 3,770 bp. The sequence of 544 bp upstream of the initiation codon, which contains the promoter and 5# untranslated region, and 190 bp downstream of the stop codon were also determined. The presence of different regulatory motifs in the promoter region of the gene might indicate distinct responses to various conditions. The expression analysis in different plant organs by northern blots showed that fruits had the highest level of MDAR. Confocal laser scanning microscopy analysis of pea leaves transformed with Agrobacterium tumefaciens having the binary vectors pGD, which contain the autofluorescent proteins enhanced green fluorescent protein and enhanced yellow fluorescent protein with the full-length cDNA for MDAR 1 and catalase, indicated that the MDAR 1 encoded the peroxisomal isoform. The functional analysis of MDAR by activity and protein expression was studied in pea plants grown under eight stress conditions, including continuous light, high light intensity, continuous dark, mechanical wounding, low and high temperature, cadmium, and the herbicide 2,4-dichlorophenoxyacetic acid. This functional analysis is representative of all the MDAR isoforms present in the different cell compartments. Results obtained showed a significant induction by high light intensity and cadmium. On the other hand, expression studies, performed by semiquantitative reverse transcriptionpolymerase chain reaction demonstrated differential expression patterns of peroxisomal MDAR 1 transcripts in pea plants grown under the mentioned stress conditions. These findings show that the peroxisomal MDAR 1 has a differential regulation that could be indicative of its specific function in peroxisomes. All these biochemical and molecular data represent a significant step to understand the specific physiological role of each MDAR isoenzyme and its participation in the antioxidant mechanisms of plant cells.

In plant cells, ascorbate is a major antioxidant that can act as a direct free radicals scavenger (Halliwell and Gutteridge, 2000) or as an electron donor to ascorbate peroxidase (APX) for scavenging hydrogen peroxide involved in the ascorbate-glutathione cycle (Asada, 1992; Noctor and Foyer, 1998). The regeneration of reduced ascorbate in this cycle is achieved by the enzyme monodehydroascorbate reductase (MDAR; EC 1.6.5.4) using NAD(P)H as electron donor. MDAR is 1 This work was supported by an Research Training Network grant of the European Union (contract HPRN–CT–2000–00094) and the Ministry of Science and Technology (projects AGL2003–05524 and BFI2002–04440–CO2–01). 2 Present address: Department of Plant Sciences, University of California, Davis, Mail Stop 3-135 Asmundson Hall, One Peter Shields Avenue, Davis, CA 95616–8617. * Corresponding author; e-mail [email protected]; fax 34– 958–129600. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.105.066225.

a FAD enzyme, is the only known enzyme to use an organic radical as a substrate, and also has been shown to reduce phenoxyl radicals (Sakihama et al., 2000). MDAR activity is widespread in plants, but it has been also described in Euglena (Shigeoka et al., 1987), Neurospora crassa (Munkres et al., 1984), and human erythrocytes (Goldenberg et al., 1983). In plants, the MDAR activity, also denominated ascorbate free radical reductase, has been described in several cell compartments, such as chloroplasts (Hossain et al., 1984), cytosol and mitochondria (Dalton et al., 1993; Jimeńez et al., 1997; Mittova et al., 2003), glyoxysomes (Bowditch and Donaldson, 1990), and leaf peroxisomes (Jimeńez et al., 1997; Lo´pezHuertas et al., 1999; Mittova et al., 2003). MDAR has been purified to homogeneity from cucumber (Cucumis sativus) fruits (Hossain and Asada, 1985) and soybean (Glycine max) root nodules (Dalton et al., 1992), and its cDNA has been isolated in a significant number of species (Murthy and Zilinskas, 1994; Sano and Asada, 1994; Grantz et al., 1995). However, the

Plant Physiology, August 2005, Vol. 138, pp. 2111–2123, www.plantphysiol.org Ó 2005 American Society of Plant Biologists

2111

Leterrier et al.

protein and the associated gene responsible for each activity have not been investigated. Very recently, it has been reported that Arabidopsis thaliana has five genes of MDAR, and one of them has multiple transcription starts that cause a dual targeting to chloroplasts and mitochondria (Obara et al., 2002; Chew et al., 2003). In chloroplasts, MDAR could have two physiological functions: the regeneration of reduced ascorbate from modehydroascorbate and the mediation of the photoreduction of dioxygen to superoxide radicals when the substrate modehydroascorbate is absent (Miyake et al., 1998). Peroxisomes are single membrane-bound subcellular organelles with an essentially oxidative type of metabolism and a simple morphology that does not reflect the complexity of their enzymatic composition (Tabak et al., 1999; Corpas et al., 2001). The main functions described for peroxisomes in plant cells are the photorespiration cycle, fatty acid b-oxidation, the glyoxylate cycle, and the metabolism of reactive oxygen species and ureides (Huang et al., 1983; Baker and Graham, 2002). These roles indicate that peroxisomes are involved in distinct metabolic networks, mainly by establishing interconnections between different cell compartments (Corpas et al., 2001; Igamberdiev and Lea, 2002; Minorsky, 2002). Different lines of evidence have shown that leaf peroxisomes can be responsible for a variety of induced oxidative stress situations (del Rıó et al., 1996, 2002). The activity of the ascorbateglutathione cycle enzymes has been demonstrated in pea (Pisum sativum) leaf peroxisomes (Jimeńez et al., 1997, 1998), but with the exception of APX, there is no molecular information on the other enzymatic components of this cycle in these organelles. In this article, we report the isolation and characterization of a full-length genomic clone encoding a mon-

odehydroascorbate reductase (MDAR 1) containing a putative peroxisomal targeting signal type 1 (PTS1) in the C terminus that was demonstrated to be localized in peroxisomes. Transcriptome analysis of peroxisomal MDAR 1 under different abiotic stress conditions showed a differential regulation. RESULTS Full-Length Genomic Clone of an MDAR from Pea Leaves

Using the PCR walking strategy, we isolated the complete gene of the MDAR 1, which comprises nine exons and eight introns, giving a total length of 3,770 bp. The sequence of 544 bp upstream of the initiation codon, which contains promoter and 5# untranslated region, and 190 bp downstream of the stop codon were also determined. Bioinformatic analysis was undertaken to identify conserved motifs found in other eukaryotic promoters and to find putative cis-elements that could be operative in the regulation of MDAR gene expression. Table I shows the promoter sequence containing several putative regulatory elements. Additionally, the comparison of the pea MDAR 1 promoter regions with that of the Arabidopsis putative peroxisomal MDAR (At3g52880) showed a TATA box (positions 2410 and 2250) in the Arabidopsis gene and many identical ciselements in the pea MDAR 1 promoter (Table I). To get deeper insights into the genomic structure of the pea MDAR1 gene, this was compared with the MDAR genes found in the Arabidopsis genome. Table II shows the five MDAR genes and the eight deduced proteins found in the Arabidopsis genome with the number of exons/introns. A comparative analysis of the intron position in the protein sequence between

Table I. Promoter elements identified in the 5# untranslated region of the MDAR 1 gene Positions of the cis-acting elements are indicated with respect to the ATG initiation codon 1: 1, downstream the ATG; 2, upstream the ATG. Asterisk indicates elements situated on the reverse strand. Category

Initiation Light

Abscisic acid/drought

Cold/freeze

Cis-Acting Element

Sequence

Position

Reference

INRNTPSADB ASF1MOTIFCAMV BOXIIPCCHSa CIACADIANLELHC GATABOXa IBOXa LRENPCABEa ABRELATERD1a ACGTATERD1a MYB1ATa MYBATRD22 MYCCONSENSUSATa

YTCANTYY TGACG ACGTGGC CAANNNNATC GATA GATAAG ACGTTGGCA ACGTG ACGT WAACCA CTAACCA CANNTG

263, 152 2172* 2176* 112 2226, 2109, 118*, 187 2226 2177* 2174* 2173, 2173*, 289, 145* 290 141, 141*

Nakamura et al. (2002) Terzaghi and Cashmore (1995) Block et al. (1990) Piechulla et al. (1998) Lam and Chua (1989) Giuliano et al. (1988) Castresana et al. (1988) Simpson et al. (2003) Simpson et al. (2003) Abe et al. (2003) Abe et al. (1997) Chinnusamy et al. (2003)

a

Cis-acting elements found in the promoter region (650 bp analyzed) of the Arabidopsis putative peroxisomal MDAR (At3g52880): BOXIIPCCHS (positions 2325 and 2169*), GATA BOX (positions 2570, 2516, 2193, 231, 25, 2455*, 2334*, and 2152*), IBOX (position 2336), LRENPCABE (position 2325 and 2170*), ABRELATERD1 (positions 2325, 2166, and 2167*), ACGTATERD1 (positions 2560, 2325, 2166, 2560*, 2325*, and 2166*), MYB1AT (positions 250 and 2121*), and MYCCONSENSUSAT (positions 2638, 2475, 2464, 2452, 2357, 2317, 2167, 2638*, 2475*, 2464*, 2452*, 2357*, 2317*, and 2167*). 2112

Plant Physiol. Vol. 138, 2005

Peroxisomal Monodehydroascorbate Reductase

Table II. MDAR genes and proteins found in the Arabidopsis genome Gene

cDNA

At1g63940

NM_179508 NM_179509 NM_179510 NM_105067 NM_115148 NM_113698 NM_111829 NM_120444

At3g52880 At3g27820 At3g09940 At5g03630

pea MDAR1 (AAU11490) and the eight Arabidopsis MDARs is shown in Figure 1. The existence of a pattern in the position of the introns in the different MDARs was observed. In the case of the pea putative peroxisomal MDARs, it was found that six introns had identical positions to the Arabidopsis putative peroxisomal MDAR (NP_190856) since both contain a putative PTS1. On the contrary, in At3g09940 (NP_566361), which has the same number of exons/introns as pea MDAR1, only one intron was found with identical position.

Protein

NP_849839 NP_849840 NP_849841 NP_564818 NP_190856 NP_189420 NP_566361 NP_568125

No. Exons/Introns

(BAA12349)

16/15

(AAM83213) (AAM91734) (AAF04429)

10/9 7/6 9/8 10/9

compartments, such as chloroplasts/mitochondria and cytosol. Table III shows the predicted pI and Mr of each group of MDARs. The hydropathic profile of the deduced MDAR 1 using the Kyte-Doolittle method with a window size of 19 showed that all peaks had a score lower than 1.8, indicating that most likely there are not transmembrane regions. However, the computer analysis of the sequence using the PredictProtein server on the Web site http://cubic.bioc.columbia.edu/predictprotein/ submitdef.html indicated the presence of a helical transmembrane region among the residues Gly-169 and Val-180.

Analysis of the Deduced Amino Acid Sequence of Pea MDAR 1

The MDAR 1 cDNA contained an open reading frame of 1,302 bp that coded for a protein of 433 amino acids. The deduced protein had a theoretical molecular mass of 47,351 D and a pI of 5.79. The total number of negatively charged residues (Asp 1 Glu) was 56, and the positively charged residues (Arg 1 Lys) were 50. The instability index is computed to be 27.30, which classifies the protein as stable (Guruprasad et al., 1990). This protein showed a 78% identity with the MDAR of C. sativus (BAA05408) and Lycopersicon esculentum (T06407), a 76% identity with Mesembryanthemum crystallinum (CAC82727) and Arabidopsis (NP_190856), and a 75% identity with Oryza sativa (BAD46251) and Brassica oleracea (BAD14934). The analysis of the protein sequence also showed some characteristic motifs found in other MDARs (Murthy and Zilinskas, 1994; Sano and Asada, 1994; Grantz et al., 1995). Thus, the residues Lys-6 to Phe-23 (KYILIGGGVSAGYAAREF) and Ile-35 to Ala-40 (IISKEA) seem to be involved in the binding of FAD and the residues Lys-164 to Leu-181 (KAVVVGGGYIGLELSAVL) and Met-190 to Glu-194 (MVYPE) in the binding of NAD(P)H. Additionally, there is an 11-amino acid domain between the residues Thr-286 to Asp-296 (TSVPDVYAVGD), which is important in the binding of the flavin moiety of FAD. The deduced amino acid sequence of the C terminus is Ser-Lys-Ile (SKI), probably a PTS1. The phylogenetic tree of the deduced protein of the pea MDAR 1 (Fig. 2) associated this protein with the group of other putative peroxisomal MDARs, which were well separated from the groups of isoforms that must be localized in other cell Plant Physiol. Vol. 138, 2005

Subcellular Localization of MDAR by Electron Microscopy and Confocal Laser Scanning Microscopy

The cellular localization of MDAR in pea leaves was studied by electron microscopy (EM) immunocytochemistry (Fig. 3). Using a polyclonal antibody against cucumber MDAR, immunogold particles appeared in chloroplasts and peroxisomes. However, it was also observed in mitochondria and cytosol (data not shown). To determine if the MDAR1 cDNA coded for the peroxisomal protein, we studied the potential localization of MDAR 1 in comparison with the peroxisomal marker catalase (CAT). We used the pGD binary vector that allowed the transient expression of native and autofluorescent fusion proteins when they were agroinfiltrated into the leaf cells. Figure 4 shows representative images illustrating the confocal laser scanning microscopy (CLSM) detection of the fluorescence in pea leaf cells following infiltration with Agrobacteria carrying the pGD vector with the full length of either CAT or MDAR 1. A red punctuate fluorescence pattern was obtained with the construction pGDY-CAT showing the peroxisomes that appeared as small fluorescent spots within the transformed leaf cells (Fig. 4A). Figure 4B shows the green punctuate fluorescence pattern obtained with the construction with pGDG-MDAR 1 in the same leaf sections. The colocalization of the expression of constructions pGDY-CAT and pGDGMDAR is shown in Figure 4C, where the nearly complete overlapping of the two punctuate patterns indicated that MDAR1 was localized in peroxisomes. 2113

Figure 1. Comparative analysis of the conservation and variability of the intron position of the peroxisomal MDAR 1 from pea with the different Arabidopsis MDARs (see also Table II). The intron positions are indicated in the protein sequences by boxes. Numbers at the right site indicate protein length in amino acids of each protein, and those at the top indicate the relative position among the different amino acid sequences. 2114



Figure 2. Phylogenetic tree of the MDARs. The tree was calculated by the Neighbor Joining method using ClustalW and then visualized with Treeview version 1.6.6. Prediction of protein localization in mitochondria and chloroplasts was made through the iPSORT program (http:// hypothesiscreator.net/iPSORT). The length of the branch line indicates the extent of divergence according to the scale (relative units) at the bottom.

Figure 4D shows the bright field of the pea leaf area infiltrated with Agrobacterium. Tissue-Specific Expression of MDAR

To investigate the expression pattern of MDAR in different pea tissues, northern-blot analysis was performed (Fig. 5). The intensity was most intense in fruits, followed by stems and flowers, being the leaves the tissues that contained the lowest levels of transcripts of MDAR. Regulation of MDAR Activity, Protein, and mRNA Levels in Response to Various Stress Conditions

It is widely accepted that diverse environmental conditions can induce oxidative stress. Considering that MDAR is an enzyme of the ascorbate-gluthatione cycle, we examined its activity, protein, and mRNA levels under several stress conditions. Figure 6 shows the analysis of protein expression (top panel) and activity of MDAR in crude extracts of leaves from pea plants exposed to different stress conditions, including continuous light, high light intensity, continuous dark, mechanical wounding, low and high temperature, cadmium, and the herbicide 2,4-dichlorophenoxyacetic acid (2,4-D). Among all these stresses, the activity was significantly higher under high light intensity and cadmium and was reduced by the herbicide 2,4-D. Similar responses were observed in the protein expression, but the immunoreactive band was also induced with low and high temperature. These results are representative of the response of all MDAR isoforms present in the leaf because activity assays or antibodies cannot distinguish the different isoforms. Plant Physiol. Vol. 138, 2005

Figure 7 represents the analysis of the expression by semiquantitative RT-PCR of the peroxisomal MDAR 1 under the same stress conditions mentioned above. In this case, the transcript level of the peroxisomal MDAR 1 did not have a similar pattern to the activity and protein content observed in the crude extract analysis. Thus, the highest expression was detected in plants exposed to low temperature, followed by me-

Table III. Predicted pI and MW of MDAR in different plant species considering the prediction made in Figure 2 The pI and MW values were calculated from their primary structure. Subcellular Localization/ Plant Species

Peroxisome Pea Arabidopsis Cucumber Rice Rice Tomato Arabidopsis Arabidopsis Cytosol Arabidopsis Rice Rice Chloroplast/mitochondrion Rice Spinach Arabidopsis Broccoli Arabidopsis Arabidopsis Arabidopsis

pI/MW

Accession No.

5.79/47,351 6.41/46,487 5.29/47,416 5.53/46,631 5.30/46,685 5.77/47,036 5.20/48,364 5.25/47,480

AY662655 NP_190856 BAA05408 BAA77214 XP483751 Q43497 NP_566361 NP_568125

8.36/53,526 8.88/51,864 7.57/50,876

NP_189420 XP467388 XP467387

6.84/52,759 6.65/54,011 8.11/53,279 7.60/52,572 8.75/45,023 7.61/52,115 7.06/52,501

XP480126 BAB63925 NP_84839 BAD14933 NP_849840 NP_849841 NP_564818 2115

Leterrier et al.

The presence of either a TATA box, a Inr, or both seems to contribute to gene regulation (Smale, 1997; Smale et al., 1998; Nakamura et al., 2002). Thus, the Inr at position 263 corresponds to the cDNA of the MDAR 1, isolated by Murthy and Zilinskas (1994). The second Inr is situated in the first intron, at position 152. A search in the Arabidopsis databank revealed the presence of five putative MDAR genes in chromosomes 1, 3, and 5, and the number of exons/introns in these genes was different (Table II). The comparative analysis of gene organization (exon/intron) between the pea peroxisomal MDAR1 gene and the Arabidopsis genes evidenced that both putative peroxisomal MDARs have six conserved intron positions (Fig. 1), which could indicate a certain degree of conservation between both genes. Figure 3. Immunogold EM localization of MDAR in pea leaf cells. The electron micrograph is representative of thin sections of pea leaves showing the immunolocalization of MDAR in different cell compartments. Cell sections were probed with an antibody against cucumber MDAR. CW, cell wall; P, peroxisome; M, mitochondrion; CH, chloroplast. Bar 5 0.5 mm.

chanical wounding and 2,4-D. In the other stresses, the mRNA expression was not affected.

DISCUSSION

MDAR is an enzymatic component of the ascorbateglutathione cycle that is one of the major antioxidant systems of plant cells for the protection against the damages produced by reactive oxygen species (Noctor and Foyer, 1998). In contrast with the information available for glutathione reductase (GR) and APX, little is known about MDAR and still less on its specific isoforms present in different cell compartments. This study is focused on the molecular characterization of the MDAR present in peroxisomes and its response against a diverse number of abiotic stresses with the goal of understanding the physiological function of the enzyme in these organelles. In the pea MDAR 1 gene, the 5# untranslated region sequence lacks a TATA box-like sequence at the expected position. Instead, the program PLACE reveals the presence of two pyrimidine-rich initiator elements (INRNTPSADB) at the positions 263 and 152. The initiator elements (Inr) direct basal transcription initiation in some TATA-less promoters (Smale and Baltimore, 1989; Smale et al., 1998). TATA box substitutes have been shown in mammalian (Javahery et al., 1994; Smale et al., 1998), Drosophila (Burke and Kadonaga, 1996), and plant promoters (Nakamura et al., 2002), although with different consensus motifs. Little is known about plant TATA-less promoters, but the recent study by Nakamura et al. (2002) points out that this is a general characteristic of most photosynthetic genes, while the frequency of TATA-less promoters is around 10% in nonphotosynthesis genes. 2116

MDAR 1 cDNA Codes for a Peroxisomal Isoform

Although there is some evidence indicating that MDAR 1 cDNA could code for a putative peroxisomal isoform (Murthy and Zilinskas, 1994), to our knowledge there are no reports demonstrating that a specific MDAR cDNA from a plant species codes for a peroxisomal isoform. This is in contrast with the abundant biochemical data available establishing the presence of MDAR activity in these organelles (del Rıó et al., 2003). The peptide SKI is a putative PTS1, and its presence at the C terminus of the pea MDAR1 could suggest that this enzyme has a peroxisomal localization. In fact, experiments in tobacco cell cultures transformed with several variations of the SKL motif appended to the C terminus of chloramphenicol acetyltransferase, demonstrated that the SKI motif functioned as a type 1 peroxisomal targeting signal (Mullen et al., 1997). In this context, Lingard et al. (2004) recently reported preliminary results of the analysis of some peroxisomal targeting signals of several Arabidopsis MDARs. The designated AtMDAR47a (NP_190856) has a putative type 1 matrix peroxisomal targeting signal (PTS1; C-terminal Ala-Lys-Ile) that is relatively inefficient. However, the AtMDAR54 (NP_189420) has a putative type 2 membrane PTS (PTS2; C-terminal membrane-spanning domain and basic cluster) and seems to target directly to peroxisomes via a C-terminal membranePTS composed of a predicted transmembrane domain adjacent to a cluster of five basic amino acid residues (http://abstracts.aspb.org/pb2004/ public/P58/7532.html). However, these data are not strictly contradictory with the results described in this article, and they only reflect the complex nature of the peroxisomal targeting signals that have not been fully characterized yet (Baker and Graham, 2002; Reumann, 2004; Reumann et al., 2004). Moreover, this also indicates that the peroxisomal protein import system in pea and Arabidopsis has some differences. For instance, the typical peroxisomal marker enzyme, CAT, in Arabidopsis has three genes and six isoforms, and none of the genes have a typical PTS1 because the Plant Physiol. Vol. 138, 2005


Figure 4. Colocalization of MDAR 1 and CAT in pea leaves. Representative images illustrating the CLSM detection of fluorescence in pea leaf cells following infiltration with Agrobacteria carrying the pGD vector. A, Pattern obtained with the construction pGDYCAT, the red spots corresponding to peroxisomes. B, Spot pattern obtained with the construction pGDG-MDAR 1. C, Overlap of the punctuate patterns obtained in (A) and (B). D, Bright field. E and F, Fluorescence controls of leaves not infiltrated with Agrobacterium observed with the corresponding filters for fluorescence proteins EYFP and EGFP, respectively. Bar 5 80 mm. Plant Physiol. Vol. 138, 2005

2117

Leterrier et al.

Figure 5. Northern blot of total plant RNA probed with the MDAR cDNA from pea.

SRL residues are not at the C terminus (Frugoli et al., 1996). However, in the case of pea CAT, the PTS1 are the PSI residues, and they are localized at the C terminus (Isin and Allen, 1991). An additional clue was the analysis of the pI and molecular weight (MW) values of the MDARs localized in the different cell compartments obtained from the phylogenetic tree (Table III). Thus, all putative peroxisomal MDARs including the pea MDAR1 had predicted average pI/MW values of 5.68/46,934. On the other hand, the cytosolic and mitochondrial/ chloroplastic isoforms had a more basic pI and higher MW values, 8.27/52,083 and 7.59/51,528, respectively. Therefore, the predicted difference in pI and MW values between the peroxisomal MDARs and the isoenzymes localized in the cytosol, chloroplasts, and mitochondria could be the result of different chemical environments and might serve as a diagnostic character for distinguishing between the amino acid sequences of peroxisomal MDARs and the isoenzymes localized in other cell compartments. The immunolocalization of MDAR by EM obtained in this study (Fig. 3) clearly confirmed previous data of the presence of MDAR activity in chloroplasts, cytosol, mitochondria, and peroxisomes (Hossain et al., 1984; Dalton et al., 1993; Murthy and Zilinskas, 1994; Jimeńez et al., 1997). In the case of peroxisomes, the gold particles were present in both membrane and matrix, indicating that the MDAR protein was not exclusively located in the membrane as it was previously inferred from biochemical data (Jimeńez et al., 1997; Lo´pezHuertas et al., 1999; Corpas et al., 2001). Moreover, depending on the program used for the determination of the hydropathic profile, sometimes we found the presence of transmembrane regions that could imply that pea MDAR 1 was localized both in the membrane and matrix of peroxisomes.

In this context, to corroborate if the pea MDAR 1 cDNA coded for the peroxisomal isoform, pea leaves were transformed with the full-length cDNA of MDAR 1 using CAT cDNA as control (Fig. 4). The colocalization obtained with CAT clearly indicated that this cDNA encoded the peroxisomal MDAR. These results suggest that the MDARs from other plants reported to have a SKI motif in the C terminus of its sequence, such as those from cucumber and tomato, very probably also have a peroxisomal localization. MDAR Activity Has a Differential Response under Oxidative Stress Conditions

In pea plants, the eight different types of abiotic stress used in this study have previously been demonstrated to produce oxidative stress due to the induction of imbalances in the antioxidative systems (Sandalio et al., 2001; Leterrier et al., 2004; RomeroPuertas et al., 2004). In our experimental conditions, the MDAR activity was up-regulated under high light intensity and cadmium and was reduced by the herbicide 2,4-D. These data contrast with other activity data reported in the literature. Thus, the increase of MDAR activity has been described in several stress conditions, for instance in tomato by salinity (Mittova et al., 2003) and high light intensity (Gechev et al., 2003), in rice by low temperature (Oidaira et al., 2000), and in Arabidopsis by UV-B radiation (Kubo et al., 1999). However, in Arabidopsis, stresses such as high temperature (30°C), enhanced light intensity (200 mE m22 s21), water deficiency (water deprivation for 2 d), and low temperature (5°C) did not affect the activity of MDAR (Kubo et al., 1999). Additionally, there are also some data about MDAR activity in other physiological processes that are related to oxidative stress. For instance, during senescence of pea leaves, a simultaneous decrease in MDAR and APX activities was observed (Jimeńez et al., 1998). During maturation of pepper (Capsicum annuum) fruits, an increase of ascorbate content has been described that can be attributed to an increase in L-galactono-g-lactone dehydrogenase and MDAR activities (Imahori et al., 1998). During cold acclimation of Scots pine (Pinus sylvestris) seed-

Figure 6. Activity and immunoblot analysis of all MDARs under different stress conditions (C, control; CL, continuous light; HL, high light intensity; D, continuous dark; W, wounding; 8°C, low temperature; 38°C, high temperature; 2,4-D and Cd).

2118



Figure 7. Differential expression of pea peroxisomal MDAR 1 under stress conditions. Semiquantitative RT-PCR was performed on total RNA isolated from leaves of plants grown under several stress conditions (C, control; CL, continuous light; HL, high light intensity; D, continuous dark; W, wounding; 8°C, low temperature; 38°C, high temperature; 2,4-D and Cd). Representative agarose electrophoresis gels of the amplification products visualized by ethidium bromide staining under UV light. T/C indicates the relative level of the MDAR amplification product (T) over the actin II internal control (C) after normalization to the control samples, and it expresses the change in folds with respect to the untreated control. Values are means of at least three different experiments. Asterisks indicate that the differences are significant.

lings, activity increases of APX, GR, MDAR, and dehydroascorbate reductase (DHAR) were described (Tao et al., 1998). In wheat (Triticum aestivum) seedlings, the activities of MDAR, APX, superoxide dismutase, DHAR, GR, and CAT were much lower in seedlings grown under low-light conditions than in those grown under high light conditions (Mishra et al., 1995). In rice seedlings germinated under water, the activity and protein expression of two isozymes of MDAR were repressed due to the oxygen-deficient conditions, but the repression was released by transferring the seedlings to air (Ushimaru et al., 1997). In summary, all these data show that MDAR activity responds to stress conditions in different ways, but no information was available on specific MDAR isoforms, and this is very important in order to study the contribution and function of each isoenzyme in its corresponding cell compartment. Peroxisomal MDAR 1 Is Up-Regulated by Cold, Mechanical Wounding, and 2,4-D Stress

Some data are available concerning MDAR mRNA expression, but much less is known on the expression of specific MDAR isoforms. In tomato, MDAR mRNA accumulates after wounding or mechanical stimulation (Grantz et al., 1995; Ben Rejeb et al., 2004), which is in agreement with the up-regulation of the transcript of the peroxisomal MDAR 1 described in this article. In Conyza bonariensis, the mRNA of MDAR is up-regulated by paraquat (Ye and Gressel, 2000) and in Brassica campestris is up-regulated by treatment with H2O2, salicylic acid, and paraquat (Yoon et al., 2004). The up-regulation in transcripts observed with cold and mechanical wounding could be related to the presence of a promoter in the MDAR 1 gene that responds to cold and ABA (Table I). In the latter case, the implication of ABA in wounding and the stress by the herbicide 2,4-D could be the reason. On the other hand, the difference observed between the activity and protein expression data obtained in crude extracts, which represent the total MDAR of all Plant Physiol. Vol. 138, 2005

cell compartments, and the data of transcript expression of the specific peroxisomal MDAR 1, does not mean that they are contradictory and could indicate that the response of each isoform depends on its specific cell compartment. MDAR, in conjuction with APX, DHAR, and GR, forms part of the ascorbate-glutathione cycle that is present in leaf peroxisomes (Jimeńez et al., 1997) and whose main function is the removal of H2O2 (Noctor and Foyer, 1998). MDAR and APX were initially found localized in the peroxisomal membranes, while the other cycle enzymes were in the soluble fraction of peroxisomes (matrix) (Jimeńez et al., 1997, 1998; Lo´pez-Huertas et al., 1999; del Rıó et al., 2003). However, EM immunocytochemical results reported in this work show that MDAR also occurs in the peroxisomal matrix. In peroxisomal membranes, three integral polypeptides (PMPs) with molecular masses of 18, 29, and 32 kD have been demonstrated to generate superoxide radicals (O22) using NAD(P) H as electron donor (Lo´pez-Huertas et al., 1997, 1999). These PMPs were characterized, and the polypeptide of 32 kD was identified as MDAR (Lo´pez-Huertas et al., 1999). The additional presence of MDAR in the peroxisomal matrix, described in this work, implies the existence of a new superoxide-generating enzymatic system that adds to xanthine oxidase, the characteristic producer of superoxide radicals in peroxisomal matrices (del Rıó et al., 2003). In addition to the generation of O22 radicals, the enzymatic production of NO from L-Arg (nitric oxide synthase activity) has also been demonstrated in pea leaf peroxisomes (Barroso et al., 1999; Corpas et al., 2004). This has prompted to propose that plant peroxisomes could act as subcellular indicators or sensors of plant stress and senescence by releasing the signaling molecules NO, O22, and H2O2 to the cytosol and triggering specific gene expressions (Corpas et al., 2001, 2004; del Rıó et al., 2003).

Table IV. Oligonucleotides used for gene cloning and for the semiquantitative PCR analysis Underlined sequences correspond to enzyme restriction sites. F, Forward oligonucleotide; R, reverse oligonucleotide. Name

Oligonuclotide Sequence (5# to 3#)

Adaptor primer 1

CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGGAGGT Ph-ACCTCCCC-NH TTAGGGGGCAAATATACTAAGTTC TTATTGGATCCGTGCATTCGTTC TTACGGAATTCGTGCATTCGTTC AACGTGTGGTTGTTGGAGG AAAGGGACAGTTGCTGTTGG TGCATAACCAGCTGAAACTCCTC CCCAGGATGAACTCCTTGTTTCAC TACAGGATCCATCCTTCCCAAGA ACACAGCGTAAAGCATATCCCACAC AGCAAGATCCAAACGAAGGA AATGGTGAAGGCTGGATTTG

Adaptor primer 2 MDAR-GEN-F MDAR-BamHI F MDAR-EcoRI-F MDAR-SQ-F MDAR-SQ-F MDAR-GSP2 MDAR-GSP1 R-MDAR-Bam MDAR-GEN-R ACT-SQ-F ACT-SQ-R

2119

Leterrier et al.

The presence of MADR and APX in leaf peroxisomal membranes has suggested a dual complementary function of these antioxidant enzymes in peroxisomal metabolism. The first role could be the reoxidation of endogenous NADH by MDAR to maintain a constant supply of NAD1 for peroxisomal metabolism (Fang et al., 1987). A second function of these antioxidative enzymes could be to protect against H2O2 leaking from peroxisomes, particulary when the CAT activity of peroxisomes is depressed and, as a result of it, the endogenous level of H2O2 is enhanced (del Rıó et al., 2003). As hydrogen peroxide can easily permeate the peroxisomal membrane, an important advantage of the presence of APX in the membrane would be the degradation of leaking H2O2, as well as the H2O2 that is being continuously formed by dismutation of the O22 generated in the NAD(P)H-dependent electron transport system of the peroxisomal membrane (del Rıó et al., 2003). This membrane scavenging of H2O2 could prevent an increase in the cytosolic H2O2 concentration during normal metabolism and under certain plant stress situations, when the level of H2O2 produced in peroxisomes can be substantially enhanced (del Rıó et al., 1996, 2002). In summary, the data reported in this work demonstrates that in pea leaves, the MDAR 1 cDNA encodes the peroxisomal isoenzyme that has a differential response to abiotic stress conditions, indicating the probable involvement of peroxisomes in these toxic situations. This evidence emphasizes the importance of studying the MDAR isoenzyme of each cell compartment that could provide more information on the specific subcellular function of MDAR. This consideration perhaps could be extended to other antioxidative enzymes that are located in different subcellular sites. MATERIALS AND METHODS Plant Material and Growth Conditions Pea seeds (Pisum sativum) cv Phoenix, supplied by Su¨dwestdeustche Saatzucht, Rastatt, Germany, and cv Lincoln (obtained from Royal Sluis, Enkhuizen, Holland) were used. Seeds were germinated in vermiculite for 14 d and then grown in aerated optimum-nutrient solutions under greenhouse conditions (28°C to 18°C, day-night temperature; 80% relative humidity). For the stress by the herbicide 2,4-D, seedlings were grown for 21 to 28 d and then leaves were sprayed with 22.6 mM 2,4-D and grown for 4 d. For cadmium stress, seedlings were grown for 14 d, and then the nutrient solutions were supplemented with 50 mM CdCl2, and plants were grown for another 14 d. For the other stress conditions, pea seedlings of 2 to 3 weeks were exposed to continuous light (275 mE m22 s21 for 24 h), high light intensity (1,170 mE m22 s21 for 4 h), continuous dark (48 h), mechanical wounding, low temperature (8°C for 48 h), and high temperature (38°C for 4 h).

Enzyme Assays The activity of MDAR was determined spectrophotometrically by measuring the reduction of absorbance a 340 nm according to Hossain et al. (1984), with some modifications. The 1.0-mL assay mixtures contained 50 mM TrisHCl (pH 7.8), 0.2 mM NADH, 1 mM ascorbate, and sample. The reaction was started by adding 0.2 units of ascorbate oxidase (EC 1.10.3.3 from Cucurbita; Sigma-Aldrich, St. Louis), and the decrease in A340 due to NADH oxidation was followed. One milliunit of activity was defined as the amount of enzyme required to oxide 1 nmol NADH min21 at 25°C.

SDS-PAGE and Western-Blot Analysis SDS-PAGE was done on 10% polyacrylamide gels, as described by Laemmli (1970). For western-blot analysis, proteins were electroblotted to polyvinylidene difluoride membranes by a semi-dry Trans-Blot cell from Bio-Rad (Hercules, CA). After transfer, membranes were used for cross-reactivity assays with polyclonal antibodies against cucumber MDAR (Sano et al., 1995) at a 1:2000 dilution. For immunodectection, an enhanced chemiluminescence method using luminol (Corpas et al., 1998) was carried out using affinitypurified goat anti-(rabbit IgG)-horseradish peroxidase conjugate (Bio-Rad). Protein levels were determined according to the method of Bradford (1976) using bovine serum albumin as a standard.

RNA Isolation and Northern-Blot Analysis Total RNA was isolated from leaves, stems, flowers, and fruits by the acid guanidine thiocyanate-phenol-chloroform method of Chomczynski and Sacchi (1987) using the Trizol Reagent kit according to the manufacturer’s instructions. Thirteen micrograms of total RNA from the different organs was subjected to electrophoresis on a 1.2% agarose gel containing 2.2 M formaldehyde, transferred to biodyne B membrane (Bio-Rad), and hybridized with a 32P-labeled MDAR cDNA fragment and washed at high stringency, according to the manufacturer’s instructions. The blots were exposed to x-ray film with an intensifying screen.

Cloning of MDAR Promoter Region A region of the MDAR promoter was cloned using the walking PCR method (Devic et al., 1997). The primary PCR reactions (20 mL) contained 1 3 PCR buffer 3 (Boehringer-Expand Long template PCR system): 50 mM TrisHCl, pH 9.2, 14 mM (NH4)2SO4, 2.25 mM MgCl2, 20% (v/v) DMSO, 1% (v/v) Tween 20, 200 mM each deoxynucleotide triphosphate (dNTPs), 2.5 ng DNA from a walking PCR library, 200 nM Adaptor Primer 1 (see Tic IV), 200 nM MDAR-GSP1 primer (see Table IV), and 0.25 units of Taq DNA polymerase/ Pwo mix (Boehringer). All PCR reactions were carried out in the Hybaid thermocycler (Ashford, UK). Amplification of the primary PCR was as follows: one denaturation cycle at 94°C for 2 min, 7 cycles of 30 s at 94°C and 4 min at 72°C, 32 cycles of 30 s at 94°C and 4 min at 68°C with a time increment of 10 s/cycle, followed by a final cycle of extension at 68°C for 10 min. The primary PCR was diluted 100-fold prior to a second round of amplification. The secondary PCR reaction was done under the same conditions, but using 0.4 mL of the diluted primary PCR, 200 nM adaptor primer 2, and 200 nM MDAR-GSP2 primer (see Table IV). Amplification of the secondary PCR was as follows: one denaturation cycle at 94°C for 2 min, 5 cycles of 30 s at 94°C and 4 min at 72°C, 25 cycles of 30 s at 94°C and 4 min at 68°C with a time increment of 10 s/cycle, followed by a final cycle of extension at 68°C for 10 min. The PCR reaction was loaded on a 1% agarose gel, and the visualized bands were cut and extracted from the gel (Qiaex II gel extraction kit; Qiagen, Valencia, CA). The purified fragments were cloned into the pBluescript KS1 cut by SmaI and sequenced.

Crude Extracts of Plant Tissues

Isolation of the MDAR Genomic Clone

The tissues were ground to a powder in liquid N2 with a mortar and pestle. Then, they were suspended in 50 mM Tris-HCl buffer, pH 7.8 (1:4, w/v), containing 0.1 mM EDTA, 5 mM dithiothreitol, 10% (w/v) glycerol, and 0.2% (v/v) Triton X-100. Homogenates were centrifuged at 27,000g for 20 min, and supernatants were used for protein and activity analyses.

The complete MDAR genomic clone was isolated by PCR on genomic DNA from pea leaves (extracted by Qiagen DNA extraction kit) using specific primers designed from the cDNA sequence (accession no. U06164). The PCR mix contained 1 3 PCR buffer 3 Boehringer-Expand Long template PCR system: 50 mM Tris-HCl, pH 9.2, 14 mM (NH4)2SO4, 2.25 mM MgCl2, 20% (v/v)

2120



DMSO, 1% (v/v) Tween 20, 200 mM each dNTPs, 250 ng genomic DNA, 300 nM MDAR-Gen-F primer, 300 nM MDAR-Gen-R primer (see Table IV), and 0.25 units of Taq DNA polymerase/Pwo mix (Boehringer). Amplification was done with one denaturation cycle at 94°C for 2 min, 10 cycles of 20 s at 94°C, 30 s at 60°C and 4 min at 68°C, 20 cycles of 20 s at 94°C, 30 s at 60°C and 4 min at 68°C with a time increment of 10 s/cycle, followed by a final cycle of extension at 68°C for 10 min. The PCR reaction was load on a 0.8% agarose gel. The visualized band (at about 4.5 kb) was cut and extracted from the gel. The purified fragment was cloned into the pBluescript KS1 cut by SmaI and sequenced.

Sequence Analysis, Database Searches, Subcellular Localization Predictions, and Primer Designs BLAST searches were made with the National Center for Biotechnology Information Web site (http://www.ncbi.nlm.nih.gov/). Alignments were performed using OMIGA (2.0) and ClustalW v.1.8 (J.D. Thompson, D.G. Higgins, and T.J. Gibson, 1994; http://www.infobiogen.fr/services/analyseq/ cgi-bin/clustalw_in.pl). The phylogenic tree was made from a protein alignment with ClustalW and then visualized using TREE VIEW v.1.6.6 (R.D.M. Page, 2001; http://taxonomy.zoology.gla.ac.uk/rod/rod.html). Primer design was done with OMIGA or with PRIMER3 (S. Rozen and H.J. Skaletsky, 2000; http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi). Localization predictions were realized with PSORT Prediction and iPSORT Prediction (http://psort.nibb.ac.jp). The theoretical molecular mass and pI were estimated using http://www.expasy.org/cgi-bin/pi_tool.

Agrobacterium Culture, Transformation, and Agroinfiltration Agrobacterium tumefaciens strain LBA4404 was maintained on Luria-Bertani solid medium containing rifampycin (100 mg/mL). Transformations with the pGDY-CAT and pGDB-MDAR 1 plasmids were realized with modified protocol of the freeze-thaw method (Holsters et al., 1978). Agrobacteria were cultured in LB medium to OD550 of 0.5 to 1.5 and then centrifuged. Pellet was resuspended in cold CaCl2 (20 mM), and aliquots were frozen in liquid nitrogen. Cells were transformed by adding 1 mg plasmid DNA to an aliquot and incubated successively 5 min at 37°C, 5 min in liquid nitrogen, and 5 min at 37°C. Transformed Agrobacteria were maintained on LB medium supplemented with kanamycin (100 mg/mL) and rifampycin (100 mg/mL). Transformed Agrobacteria were incubated overnight in LB medium supplemented with kanamycin (100 mg/mL) and rifampycin (100 mg/mL). One milliliter of the overnight culture was used to inoculate 50 mL LB supplemented with kanamycin (50 mg/mL), rifampycin (50 mg/mL), MES (10 mM), and acetosyringone (20 mM). After another overnight incubation, cells were pelleted and resuspended in a solution containing MgCl2 (10 mM), MES (10 mM), and acetosyringone (100 mM). Cells were left in this medium for 3 h and then infiltrated by pressing a 2-mL syringe on the underside of the pea leaves. For coinfiltration, Agrobacterium solutions were mixed equally before infiltration. Leaves were examined by microscopy between 48 and 120 h postinfiltration.

CLSM Semiquantitative RT-PCR Two micrograms of total RNA from leaves was used as a template for the RT reaction. It was added to a mixture containing 5 mM MgCl2, 1 mM dNTPs, 0.5 mg oligo(dT) primers, 13 RT buffer, 20 units of Rnasin ribonuclease inhibitor, and 15 units of AMV reverse transcriptase (Finnzymes, Espoo, Finland). The reaction was carried out at 42°C for 40 min, followed by a 5-min step at 98°C, and then by cooling to 4°C. Amplification of actin II cDNA from pea (X68649) was chosen as a control. The MDAR 1 and actin II cDNAs were amplified by PCR as follows: 1 mL of the produced cDNA diluted 1/20 was added to 250 mM dNTPs, 1.5 mM MgCl2, 1 3 PCR buffer, 1 unit of Ampli Taq Gold (PE-Applied Biosystems, Foster City, CA), and 0.5 mM of each primer (MDAR-SQ-F, MDAR-SQ-R, ACT-SQ-F, and ACT-SQ-R) in a final volume of 20 mL. Reactions were carried out in the Hybaid thermocycler. A first step of 10 min at 94°C was followed by 28 cycles of 30 s at 94°C, 30 s at 60°C, and 45 s at 72°C. Amplified PCR products were detected after electrophoresis in 1% agarose gels stained with ethidium bromide. Quantification of the bands was performed using a Gel Doc system (Bio-Rad) coupled with a highly sensitive CCD camera. Band intensity was expressed as relative absorbance units. The ratio between the MDAR 1 and actin II amplification was calculated to normalize for initial variations in sample concentration. Mean and SD were calculated after normalization to actin II.

Leaves in pea plants were agroinfiltrated and monitored between 2 and 6 d. Leaf segments of approximately 25 mm2 were cut in small pieces and mounted for examination with a CLSM system (Leica TCS SL; Leica Microsystems, Wetzlar, Germany) using the recommended filters for fluorescence proteins EGFP (excitation, 488 nm; emission, 508 nm) and EYFP (excitation, 514 nm; emission, 527 nm). Images were captured using the Leica TCS software.

EM and Immunocytochemistry Pea leaf segments of approximately 1 mm2 were fixed, dehydrated, and embedded in LR White resin according to Corpas et al. (1994). Immunolabelling was performed as indicated by Sandalio et al. (1997). Ultrathin sections were incubated for 2 h with the antibody against cucumber MDAR diluted 1:500 in TBST [10 mM TrisHCl (pH 7.6), 0.9% (w/v) NaCl, 0.05% (v/v) Tween 20, and 0.02% (w/v) NaN3] buffer. The sections were then incubated for 1 h with goat anti-rabbit IgG conjugated to 15-nm gold particles (Bio Cell, Cardiff, UK) diluted 1:40 in TBST plus 2% (w/v) bovine serum albumin. Sections were poststained in 2% (v/v) uranyl acetate for 3 min and examined in a Zeiss EM 10C transmission electron microscope (Jena, Germany). Sequence data from this article have been deposited with the EMBL/ GenBank data libraries under accession number AY662655 for the MDAR 1.

Construction of Plasmids Used in Colocalization All binary vectors used in this study were derivates of plasmids pGDG and pGDY containing the autofluorescent proteins enhanced green fluorescent protein (EGFP) and enhanced yellow fluorescent protein (EYFP), respectively (Goodin et al., 2002). MDAR 1 cDNA (without ATG) was amplified by PCR on the pGEM-T-EASY-MDAR 1 containing the full-length cDNA, using the following primers with additional BamHI restriction sites: MDAR-BamHI F- and R-MDAR-Bam (see Table IV). PCR product was cut by BamHI after subcloning in pGEM-T-Easy and then fused in phase with EGFP in the pGDG also cut by BamHI. The correct orientation was corroborated by sequencing. pGDY-CAT was made as follows: First, CAT cDNA (accession no. X60169) was PCR amplified from the phage lgt11 pea cDNA library with primers containing the additional restriction site BglII (forward 5#-TCTGTCGACCTGCAAATCTTGCGAT-3#) and SalI (reverse 5#-ACAAGATCTGATCCTTACAAGCATC-3#). Purified PCR product (without ATG) was subcloned in pGEM-T-Easy. After a digestion with BglII and SalI restriction enzymes, the fragment was ligated in phase with EYFP in the pGDY also cut by BglII and SalI. The construct was checked by sequencing.


ACKNOWLEDGMENTS We are most grateful to Kozi Asada (Fukuyama University, Hiroshima, Japan) for the antiserum against the cucumber MDAR. We also thank Barbara A. Zilinskas (Rutgers University, New Brunswick, NJ) for the supply of pea MDAR cDNA and Peter Ro¨mer (Su¨dwestdeustche Saatzucht, Rastatt, Germany) for the supply of pea seeds cv Phoenix. We specially acknowledge Michael Goodin (University of Kentucky, Lexington) for his generous donation of the pGD vectors. We sincerely thank Manuel Go´mez and Ana Ma Leoń-Lo´pez for their valuable help in the growth of pea plants. The technical assistance for the EM and CLSM analyses, which were carried out at the Centre of Scientific Instrumentation of the University of Granada and the Technical Services of the University of Jaeń, respectively, is acknowledged. Received May 27, 2005; revised May 31, 2005; accepted May 31, 2005; published July 29, 2005.

2121

Leterrier et al.

LITERATURE CITED Abe H, Urao T, Ito T, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003) Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling. Plant Cell 15: 63–78 Abe H, Yamaguchi-Shinozaki K, Urao T, Iwasaki T, Hosokawa D, Shinozaki K (1997) Role of Arabidopsis MYC and MYB homologs in drought- and abscisic acid-regulated gene expression. Plant Cell 9: 1859–1868 Asada K (1992) Ascorbate peroxidase: a hydrogen peroxide scavenging enzyme in plants. Physiol Plant 85: 235–241 Baker A, Graham I (2002) Plant Peroxisomes: Biochemistry, Cell Biology and Biotechnological Applications. Kluwer Academic Publishers, Dordrecht, The Netherlands Barroso JB, Corpas FJ, Carreras A, Sandalio LM, Valderrama R, Palma JM, Lupiań˜ez JA, del Rıó LA (1999) Localization of nitric oxide synthase in plant peroxisomes. J Biol Chem 274: 36729–36733 Ben Rejeb I, Lenne C, Leblanc N, Julien JL, Ammar S, Bouzid S, Ayadi A (2004) Iron-superoxide dismutase and monodehydroascorbate reductase transcripts accumulate in response to internode rubbing in tomato. C R Biol 327: 679–686 Block A, Dangle JL, Hahlbrock K, Schulze-Lefert P (1990) Functional borders, genetic fine structure, and distance requirements of cis elements mediating light responsiveness of the parsley chalcone synthase promoter. Proc Natl Acad Sci USA 87: 5387–5391 Bowditch MI, Donaldson RP (1990) Ascorbate free-radical reduction by glyoxysomal membranes. Plant Physiol 94: 531–537 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248–254 Burke TW, Kadonaga JT (1996) Drosophila TFIID binds to a conserved downstream basal promoter element that is present in many TATA-boxdeficient promoters. Genes Dev 10: 711–724 Castresana C, Garcia-Luque I, Alonso E, Malik VS, Cashmore AR (1988) Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia. EMBO J 7: 1929–1936 Chew O, Whelan J, Millar AH (2003) Molecular definition of the ascorbateglutathione cycle in Arabidopsis mitochondria reveals dual targeting of antioxidant defenses in plants. J Biol Chem 278: 46869–46877 Chinnusamy V, Ohta M, Kanrar S, Lee BH, Hong X, Agarwal M, Zhu JK (2003) ICE1: a regulator of cold-induced transcriptome and freezing tolerance in Arabidopsis. Genes Dev 17: 1043–1054 Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156–159 Corpas FJ, Barroso JB, Carreras A, Quiro´s M, Leon AM, Romero-Puertas MC, Esteban FJ, Valderrama R, Palma JM, Sandalio LM, et al (2004) Cellular and subcellular localization of endogenous nitric oxide in young and senescent pea plants. Plant Physiol 136: 2722–2733 Corpas FJ, Barroso JB, del Rıó LA (2001) Peroxisomes as a source of reactive oxygen species and nitric oxide signal molecules in plant cells. Trends Plant Sci 6: 145–150 Corpas FJ, Barroso JB, Sandalio LM, Distefano S, Palma JM, Lupiań˜ez JA, del Rıó LA (1998) A dehydrogenase-mediated recycling system of NADPH in plant peroxisomes. Biochem J 330: 777–784 Corpas FJ, Bunkelmann J, Trelease RN (1994) Identification and immunochemical characterization of a family of peroxisome membrane proteins (PMPs) in oilseed glyoxysomes. Eur J Cell Biol 65: 280–290 Dalton DA, Baird LM, Langeberg L, Taugher CY, Anyan WR, Vance CP, Sarath G (1993) Subcellular localization of oxygen defense enzymes in soybean (Glycine max [L.] Merr.) root nodules. Plant Physiol 102: 481–489 Dalton DA, Langeberg L, Robbins M (1992) Purification and characterization of monodehydroascorbate reductase from soybean root nodules. Arch Biochem Biophys 292: 281–286 del Rıó LA, Corpas FJ, Sandalio LM, Palma JM, Barroso JB (2003) Plant peroxisomes, reactive oxygen metabolism and nitric oxide. IUBMB Life 55: 71–81 del Rıó LA, Palma JM, Sandalio LM, Corpas FJ, Pastori GM, Bueno P, Lo´pez-Huertas E (1996) Peroxisomes as a source of superoxide and hydrogen peroxide in stressed plants. Biochem Soc Trans 24: 434–438 del Rıó LA, Sandalio LM, Palma JM, Corpas FJ, Lo´pez-Huertas E,

2122

Romero-Puertas MC, McCarthy I (2002) Peroxisomes, reactive oxygen metabolism, and stress-related enzyme activities. In A Baker, I Graham, eds, Plant Peroxisomes. Biochemistry, Cell Biology and Biotechnological Applications. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 221–258 Devic M, Albert S, Delseny M, Roscoe T (1997) Efficient PCR walking on plant DNA. Plant Physiol Biochem 35: 331–339 Fang TK, Donaldson RP, Vigil EL (1987) Electron transport in purified glyoxysomal membranes from castor bean endosperm. Planta 172: 1–13 Frugoli JA, Zhong HH, Nuccio ML, McCourt P, McPeek MA, Thomas TL, McClung CR (1996) Catalase is encoded by a multigene family in Arabidopsis thaliana (L.) Heynh. Plant Physiol 112: 327–336 Gechev T, Willekens H, Van Montagu M, Inze´ D, Van Camp W, Toneva V, Minkov I (2003) Different responses of tobacco antioxidant enzymes to light and chilling stress. J Plant Physiol 160: 509–515 Giuliano G, Pichersky E, Malik VS, Timko MP, Scolnik PA, Cashmore AR (1988) An evolutionarily conserved protein binding sequence upstream of a plant light-regulated gene. Proc Natl Acad Sci USA 85: 7089–7093 Goldenberg H, Grebing C, Low H (1983) NADH-monodehydroascorbate reductase in human erythrocyte membranes. Biochem Int 6: 1–9 Goodin MM, Dietzgen RG, Schichnes D, Ruzin S, Jackson AO (2002) pGD vectors: versatile tools for the expression of green and red fluorescent protein fusions in agroinfiltrated plant leaves. Plant J 31: 375–383 Grantz AA, Brummell DA, Bennett AB (1995) Ascorbate free radical reductase mRNA levels are induced by wounding. Plant Physiol 108: 411–418 Guruprasad K, Reddy BVB, Pandit MW (1990) Correlation between stability of a protein and its dipeptide composition: a novel approach for predicting in vivo stability of a protein from its primary sequence. Protein Eng 4: 155–161 Halliwell B, Gutteridge JMC (2000) Free Radicals in Biology and Medicine. Oxford University Press, New York Holsters M, de Waele D, Depicker A, Messens E, van Montagu M, Schell J (1978) Transfection and transformation of Agrobacterium tumefaciens. Mol Gen Genet 163: 181–187 Hossain MA, Asada K (1985) Monodehydroascorbate reductase from cucumber is a flavin adenine dinucleotide enzyme. J Biol Chem 260: 12920–12926 Hossain MA, Nakano Y, Asada K (1984) Monodehydroascorbate reductase in spinach chloroplast and its participation in regeneration of ascorbate for scavenging of hydrogen peroxide. Plant Cell Physiol 25: 385–395 Huang AHC, Trelease RN, Moore TS Jr (1983) Plant Peroxisomes. Academic Press, New York Igamberdiev AU, Lea PJ (2002) The role of peroxisomes in the integration of metabolism and evolutionary diversity of photosynthetic organisms. Phytochemistry 60: 651–674 Imahori Y, Zhou YF, Ueda Y, Chachin K (1998) Ascorbate metabolism during maturation of sweet pepper (Capsicum annuum L.) fruit. J Jpn Soc Hortic Sci 67: 798–804 Isin SH, Allen RD (1991) Isolation and characterization of a pea catalase cDNA. Plant Mol Biol 17: 1263–1265 Javahery R, Khachi A, Lo K, Zenzie-Gregory B, Smale ST (1994) DNA sequence requirements for transcriptional initiator activity in mammalian cells. Mol Cell Biol 14: 116–127 Jimeńez A, Hernańdez JA, del Rıó LA, Sevilla F (1997) Evidence for the presence of the ascorbate-glutathione cycle in mitochondria and peroxisomes of pea leaves. Plant Physiol 114: 275–284 Jimeńez A, Hernańdez JA, Pastori G, del Rıó LA, Sevilla F (1998) Role of the ascorbate-glutathione cycle of mitochondria and peroxisomes in the senescence of pea leaves. Plant Physiol 118: 1327–1335 Kubo A, Aono M, Nakajima N, Saji H, Tanaka K, Kondo N (1999) Differential responses in activity of antioxidant enzymes to different environmental stresses in Arabidopsis thaliana. J Plant Res 112: 279–290 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680–685 Lam E, Chua NH (1989) ASF-2: a factor that binds to the cauliflower mosaic virus 35S promoter and a conserved GATA motif in cab promoters. Plant Cell 1: 1147–1156 Leterrier M, Leoń AM, Corpas FJ, del Rıó LA (2004) Functional analysis of cytosolic NADP-dependent isocitrate dehydrogenase: cloning and ex-



pression under abiotic stress conditions. Free Radic Biol Med (Suppl 1) 36: S136 Lingard MJ, Trelease RN, Lisenbee CS (2004) Subcellular sorting pathways and molecular targeting signals for peroxisomal monodyhydroascorbate reductase isoforms in Arabidopsis thaliana (abstract no. 631). http://abstracts.aspb.org/pb2004/public/P58/7532.html Lo´pez-Huertas E, Corpas FJ, Sandalio LM, del Rıó LA (1999) Characterization of membrane polypeptides from pea leaf peroxisomes involved in superoxide radical generation. Biochem J 337: 531–536 Lo´pez-Huertas E, Sandalio LM, Go´mez M, del Rıó LA (1997) Superoxide radical generation in peroxisomal membranes: evidence for the participation of the 18 kDa integral membrane polypeptide. Free Radic Res 26: 497–506 Minorsky PV (2002) Peroxisomes: organelles of diverse function. Plant Physiol 130: 517–518 Mishra NP, Fatma T, Singhal GS (1995) Development of antioxidative defense system of wheat seedlings in response to high light. Physiol Plant 95: 77–82 Mittova V, Tal M, Volokita M, Guy M (2003) Up-regulation of the leaf mitochondrial and peroxisomal antioxidative systems in response to salt-induced oxidative stress in the wild salt-tolerant tomato species Lycopersicon pennellii. Plant Cell Environ 6: 845–856 Mullen RT, Lee MS, Flynn CR, Trelease RN (1997) Diverse amino acid residues function within the type 1 peroxisomal targeting signal. Implications for the role of accessory residues upstream of the type 1 peroxisomal targeting signal. Plant Physiol 115: 881–889 Munkres KD, Rana RS, Goldstein E (1984) Genetically determined conidial longevity is positively correlated with superoxide dismutase, catalase, glutathione peroxidase, cytochrome c peroxidase, and ascorbate free radical reductase activities in Neurospora crassa. Mech Ageing Dev 24: 83–100 Murthy SS, Zilinskas BA (1994) Molecular cloning and characterization of a cDNA encoding pea monodehydroascorbate reductase. J Biol Chem 269: 31129–31133 Miyake C, Schreiber U, Hormann H, Sano S, Asada K (1998) The FADenzyme monodehydroascorbate radical reductase mediates the photoproduction of superoxide radicals in spinach thylakoid membranes. Plant Cell Physiol 39: 821–829 Nakamura M, Tsunoda T, Obokata J (2002) Photosynthesis nuclear genes generally lack TATA-boxes: A tobacco photosystem I gene responds to light through an initiator. Plant J 29: 1–10 Noctor G, Foyer CH (1998) Ascorbate and glutathione: keeping active oxygen under control. Annu Rev Plant Physiol Plant Mol Biol 49: 249–279 Obara K, Sumi K, Fukuda H (2002) The use of multiple transcription starts causes the dual targeting of Arabidopsis putative monodehydroascorbate reductase to both mitochondria and chloroplasts. Plant Cell Physiol 43: 697–705 Oidaira H, Sano S, Koshiba T, Ushimaru T (2000) Enhancement of antioxidative enzyme activities in chilled rice seedlings. J Plant Physiol 156: 811–813 Piechulla B, Merforth N, Rudolph B (1998) Identification of tomato Lhc promoter regions necessary for circadian expression. Plant Mol Biol 38: 655–662 Reumann S (2004) Specification of the peroxisome targeting signals type 1 and type 2 of plant peroxisomes by bioinformatics analyses. Plant Physiol 135: 783–800 Reumann S, Ma C, Lemke S, Babujee L (2004) AraPerox. A database of


putative Arabidopsis proteins from plant peroxisomes. Plant Physiol 136: 587–608 Romero-Puertas MC, McCarthy I, Go´mez M, Sandalio LM, Corpas FJ, del Rıó LA, Palma JM (2004) Reactive oxygen species-mediated enzymatic systems involved in the oxidative action of 2,4-dichlorophenoxyacetic acid. Plant Cell Environ 27: 1135–1148 Sakihama Y, Mano J, Sano S, Asada K, Yamasaki H (2000) Reduction of phenoxyl radicals mediated by monodehydroascorbate reductase. Biochem Biophys Res Commun 279: 949–954 Sandalio LM, Dalurzo HC, Go´mez M, Romero-Puertas MC, del Rıó LA (2001) Cadmium-induced changes in the growth and oxidative metabolism of pea plants. J Exp Bot 52: 2115–2126 Sandalio LM, Lo´pez-Huertas E, Bueno P, del Rıó LA (1997) Immunocytochemical localization of copper,zinc superoxide dismutase in peroxisomes from watermelon (Citrullus vulgaris Schrad.) cotyledons. Free Radic Res 26: 187–194 Sano S, Asada K (1994) cDNA cloning of monodehydroascorbate radical reductase from cucumber: a high degree of homology in terms of amino acid sequence between this enzyme and bacterial flavoenzymes. Plant Cell Physiol 35: 425–437 Sano S, Miyake C, Mikami B, Asada K (1995) Molecular characterization of monodehydroascorbate radical reductase from cucumber highly expressed in Escherichia coli. J Biol Chem 270: 21354–21361 Shigeoka S, Yasumoto R, Onishi T, Nakano Y, Kitaoka S (1987) Properties of monodehydroascorbate reductase and dehydroascorbate reductase and their participation in the regeneration of ascorbate in Euglenagracilis. J Gen Microbiol 133: 227–232 Simpson SD, Nakashima K, Narusaka Y, Seki M, Shinozaki K, YamaguchiShinozaki K (2003) Two different novel cis-acting elements of erd1, a clpA homologous Arabidopsis gene function in induction by dehydration stress and dark-induced senescence. Plant J 33: 259–270 Smale ST (1997) Transcription initiation from TATA-less promoters within eukaryotic protein-coding genes. Biochim Biophys Acta 1351: 73–88 Smale ST, Baltimore D (1989) The ‘‘initiator’’ as a transcription control element. Cell 57: 103–113 Smale ST, Jain A, Kaufmann J, Emami KH, Lo K, Garraway IP (1998) The initiator element: a paradigm for core promoter heterogeneity within metazoan protein-coding genes. Cold Spring Harb Symp Quant Biol 63: 21–31 Tabak HF, Braakman I, Distel B (1999) Peroxisomes: simple in function but complex in maintenance. Trends Cell Biol 9: 447–453 Tao DL, Oquist G, Wingsle G (1998) Active oxygen scavengers during cold acclimation of Scots pine seedlings in relation to freezing tolerance. Cryobiology 37: 38–45 Terzaghi WB, Cashmore AR (1995) Light-regulated transcription. Annu Rev Plant Physiol Plant Mol Biol 46: 445–474 Ushimaru T, Maki Y, Sano S, Koshiba T, Asada K, Tsuji H (1997) Induction of enzymes involved in the ascorbate-dependent antioxidative system, namely, ascorbate peroxidase, monodehydroascorbate reductase and dehydroascorbate reductase, after exposure to air of rice (Oryza sativa) seedlings germinate under water. Plant Cell Physiol 38: 541–549 Ye B, Gressel J (2000) Transient, oxidant-induced antioxidant transcript and enzyme levels correlate with greater oxidant-resistance in paraquatresistant Conyza bonariensis. Planta 211: 50–61 Yoon HS, Lee H, Lee IA, Kim KY, Jo J (2004) Molecular cloning of the monodehydroascorbate reductase gene from Brassica campestris and analysis of its mRNA level in response to oxidative stress. Biochim Biophys Acta 1658: 181–186

2123