Pharmacological and functional characterization ... - Wiley Online Library

Journal of Neurochemistry, 2001, 77, 1396±1406

Pharmacological and functional characterization of muscarinic receptor subtypes in developing oligodendrocytes Fadi Ragheb,*,1 Eduardo Molina-Holgado,*,1,2 Qiao-Ling Cui,* Amani Khorchid,* Hsueh-Ning Liu,* Jorge N. Larocca² and Guillermina Almazan* *Department of Pharmacology and Therapeutics, McGill University, Montreal, Quebec, Canada ²Department of Neurology, Albert Einstein College of Medicine, Bronx, New York, USA

Abstract This study focused on the molecular and pharmacological characterization of muscarinic acetylcholine receptors expressed by progenitors and differentiated oligodendrocytes. We also analyzed the role of muscarinic receptors in regulating downstream signal transduction pathways and the functional signi®cance of receptor expression in oligodendrocytes. RT-PCR analysis revealed the expression of transcripts for M3, and to a lesser extent M4, followed by M1, M2 and M5 receptor subtypes in both progenitors and differentiated oligodendrocytes. Competition binding experiments using [3H]N-methylscopolamine and several antagonists, as well as inhibition of carbachol-mediated phosphoinositide hydrolysis, showed that M3 is the main subtype expressed in these cells. In progenitors the activation of p42/44-mitogen-activated protein kinase (MAPK) and cAMP-response element binding

protein (CREB) as well as c-fos mRNA expression were blocked by the M3 relatively selective antagonist, 4-DAMP, and its irreversible analogue, 4-DAMP-mustard. Carbachol increased proliferation of progenitors, an effect prevented by atropine and 4-DAMP, as well as by the MAPK kinase inhibitor PD98059. These results indicate that carbachol modulates oligodendrocyte progenitor proliferation through M3 receptors, involving activation of a MAPK signaling pathway. Receptor density and phosphoinositide hydrolysis are down-regulated during oligodendrocyte differentiation. Functional consequences of these events are a reduction in carbacholstimulated p42/44MAPK and CREB phosphorylation, as well as induction of c-fos. Keywords: carbachol, c-fos, CREB, muscarinic receptor, oligodendrocyte, p42MAPK. J. Neurochem. (2001) 77, 1396±1406.

Oligodendrocytes produce myelin, the insulating sheath that facilitates nerve impulse conduction. Recent reports indicate that oligodendrocytes maintain a dynamic communication with neurons through their neurotransmitter receptors. Indeed, cortical oligodendrocytes form contacts with noradrenergic boutons resembling symmetrical synapses (Paspalas and Papadopoulos 1996) and functional glutamatergic synapses terminating on oligodendrocyte progenitors have been reported (Bergles et al. 2000). In addition, glutamatergic, GABA, and purinergic receptors have been identi®ed on oligodendrocytes, in vitro or in situ, using Ca21 imaging and electrophysiological techniques (see for review Belachew et al. 1999). Studies from our laboratory and others demonstrated the capacity of oligodendrocytes to respond to cholinergic stimulation via muscarinic receptors (mAChR), (Ritchie et al. 1987; Kastritsis and McCarthy 1993; Cohen and Almazan 1994; Takeda et al. 1995). The family of mAChR is composed of ®ve subtypes (M1±M5) with different

Received February 2, 2001; revised manuscript received March 15, 2001; accepted March 15, 2001. Address correspondence and reprint requests to Dr Guillermina Almazan, Department of Pharmacology and Therapeutics, McGill University, 3655 Sir-William Osler Promenade, Montreal, Quebec H3G 1Y6, Canada. E-mail: [email protected] 1 Both authors contributed equally to this paper. 2 Present address, Instituto Cajal, CSIC, Madrid, Spain Abbreviations used: ATR, atropine; bFGF, basic ®broblast growth factor; [Ca21]i, intracellular calcium; CCh, carbachol; CS, calf serum; CREB, cAMP-response element binding protein; 4-DAMP, 4-diphenylacetoxy-N-methylpiperidine methiodide; DMEM, DIV, days in vitro; Dulbecco's, modi®ed Eagle's medium; FCS, fetal calf serum; G-protein, guanine nucleotide-binding protein; IPs, total [3H]inositol phosphates; p42MAPK, p42 mitogen activated protein kinase; MET, methoctramine; mAChR, muscarinic acetylcholine receptor; M1±M5, muscarinic receptor subtypes; OD, optical density; PDGF, plateletderived growth factor-AA; PLC, phospholipase C; PI, phosphoinositide; PIR, pirenzepine; PKC, protein kinase C; [3H]NMS, [3H]N-methylscopolamine; SFM, serum free medium; RT-PCR, reverse-transcriptase polymerase chain reaction.

1396

q 2001 International Society for Neurochemistry, Journal of Neurochemistry, 77, 1396±1406

Muscarinic receptors in oligodendrocytes 1397

molecular and pharmacological properties (for a review see Caul®eld and Birdsall 1998). All mAChR subtypes possess seven membrane-spanning domains and transduce their biological effects through association with the a subunits of Gi, Go or Gq proteins. Type-M1 receptors (M1, M3 and M5) are positively coupled to phospholipase C, while type M2 (M2, M4) negatively regulate adenylyl cyclase. At present it is unknown whether the ®ve mAChR subtypes are expressed in cells of oligodendrocyte lineage. However, progenitors and mature oligodendrocytes in culture respond to muscarinic stimulation (Ritchie et al. 1987; Kastritsis and McCarthy 1993; Cohen and Almazan 1994; Takeda et al. 1995). In a previous study we reported the presence of M1 and M2 mAChR mRNAs in developing oligodendrocytes (Cohen and Almazan 1994). In these cells, activation of mAChRs with carbachol (CCh), a stable acetylcholine analogue, increases inositol-1,4,5 trisphosphate (IP3) and intracellular Ca21 levels (Ritchie et al. 1987; Kastritsis and McCarthy 1993; Cohen and Almazan 1994), while decreasing b-adrenergic-stimulated formation of cAMP (Cohen and Almazan 1994). In addition, CCh triggered Ca21 waves (Simpson and Russell 1996), inhibited an inwardly rectifying K1 channel (Karschin et al. 1994), activated p42/ 44MAPK and c-fos gene expression and increased proliferation of oligodendrocyte progenitor (Cohen et al. 1996; Larocca and Almazan 1997). The response of oligodendrocytes to muscarinic agonists is developmentally regulated. After 6 days in vitro (DIV), CCh-mediated IP3 accumulation observed in galactocerebroside positive (GC1) oligodendrocytes was several times lower than that obtained in oligodendrocyte progenitors (Cohen and Almazan 1994). Similarly, after 8 DIV only 10% of GC1 cells showed an increase in [Ca21]i in response to CCh (He and McCarthy 1994). Furthermore, CCh stimulated the phosphorylation of CREB in young oligodendrocytes isolated from four-day-old rat cerebrum, but not in oligodendrocytes isolated from 11-day-old or older rats (Sato-Bigbee et al. 1999). The mechanisms that modulate the oligodendrocyte response to acetylcholine during development remain largely unknown. It is possible that mAChR density and/or their coupling with second messenger systems are downregulated during development. An alternative possibility is that the subtypes of mAChR expressed change during oligodendrocyte differentiation. In this work we have made considerable progress towards the clari®cation of these issues. We have characterized the subtypes of mAChRs present in progenitors and mature oligodendrocytes and assessed their level of expression using pharmacological and molecular approaches. In addition, we identi®ed the mAChR subtype that mediate downstream cholinergic signaling events, including phosphoinositide hydrolysis, activation of both p42/44MAPK and CREB as well as c-fos mRNA expression. Finally, we

examined the role of muscarinic receptors in oligodendrocyte proliferation. Materials and methods Materials The following reagents were obtained from the indicated supplier: Dulbecco's Modi®ed Eagle Medium (DMEM), Ham's F12, Hank's balanced salt solution, 7.5% bovine serum albumin (BSA) fraction V, fetal calf serum (FCS), calf serum (CS), 4-(2-hydroxyethyl)-1piperazineethanesulfonic acid (HEPES), penicillin/streptomycin mix, SuperScript II and PLATINUM Taq DNA Polymerase High Fidelity from Gibco/BRL (Burlington, Ontario, Canada); progesterone, biotin, sodium selenite, insulin, putrescine, carbachol, atropine methyl bromide, Triton X-100, poly-d-lysine, hydrocortisone-21-P, transferrin and 3,3 0 ,5-tri-iodo-l-thyronine from SigmaAldrich Canada (Oakville, Ontarion, Canada); methoctramine, 4-DAMP methiodide, 4-DAMP-mustard, pirenzepine, and tropicamide from RBI (Natick, MA, USA); human recombinant platelet derived growth factor-AA (PDGF-AA) and basic ®broblast growth factor (bFGF) from PeproTech Inc (Rocky Hill, NJ, USA); [3H]N-methylscopolamine ([3H]NMS) (82 Ci/mmol) and the chemiluminescence detection kit (ECL) from Amersham Canada Ltd. (Oakville, Ontario, Canada). Phospho-speci®c p42/44MAPK antibody (Thr183 and Tyr185) was obtained from Promega (Montreal, Quebec, Canada); phospho-speci®c CREB antibody from New England Biolabs (Mississauga, Ontario, Canada) and the MAPK kinase inhibitor (MEK) PD98059 from Calbiochem (La Jolla, CA, USA). Secondary antibodies used for immuno¯uorescence were purchased from Jackson Immunoresearch Laboratories (West Grove, PA, USA); analytical-grade Dowex 1-X8 (AG1-X8100± 200 mesh) from Bio-Rad (Mississauga, Ontario, Canada); myo[3H]inositol (12.3 Ci/mmol) from Dupont Co. (Mississauga, Ontario, Canada); Immobilon-P membranes from Millipore (Mississauga, Ontario, Canada), Oligotex columns from Qiagen (Mississauga, Ontario, Canada). All other reagents were obtained from VWR (Mount Royal, Quebec, Canada) ICN (Montreal, Quebec, Canada) or Fisher (Ottawa, Ontario, Canada). Serum free medium (SFM) is de®ned as DMEM: F12 (1 : 1) containing 25 mg/mL human transferrin, 30 nm triiodothyronine, 20 nm hydrocortisone-21-P, 20 nm progesterone, 10 nm biotin, 30 nm selenium, 5 mg/mL insulin, 1 mg/mL putrescine, 0.1% BSA, 50 units/mL penicillin, 50 mg/mL streptomycin. Complete medium is composed of DMEM: F12 (1 : 1) containing 50 units/mL penicillin plus 50 mg/mL streptomycin and 12% FCS. Primary culture preparation Cultures were generated as described by Almazan et al. (1993), according to the modi®ed technique of McCarthy and de Vellis (1980). Oligodendrocyte progenitors, also termed O-2 A progenitors for their ability to generate oligodendrocytes and type-2 astrocytes in vitro, were plated on 6-well dishes at a density of 15 103 cells/cm2 in order to expand their numbers and prevent differentiation. The cultures were grown in SFM containing 2.5 ng/ mL bFGF and PDGF-AA (SFM 1 GF) for 4 days. Morphological examination established that the progenitor cultures were essentially homogeneous bipolar cells, and acquired rami®ed processes as they differentiated to mature oligodendrocytes in vitro. The


1398 F. Ragheb et al.

cultures were immunocytochemically characterized as previously described (Cohen and Almazan 1994; Radhakrishna and Almazan 1994). Ninety ®ve percent of the cells reacted positively with the monoclonal antibody A2B5, a marker of oligodendrocyte progenitors, and less than 5% were galactocerebroside (GC) positive oligodendrocytes, glial ®brillary acidic protein positive astrocytes or complement type-3-positive microglia. When progenitors were cultured for 12 additional days in SFM containing 3% CS the cells acquired complex morphology and the oligodendrocyte markers GC1 and myelin basic protein (MBP1). Reverse-transcriptase polymerase chain reaction RNA was extracted from adult rat brain or from oligodendrocyte cultures on a cesium chloride cushion and treated with DNase I to remove traces of genomic DNA. For oligodendrocytes and progenitor cells, polyA1RNA was puri®ed from total RNA with Oligotex columns. Five mg of total RNA from brain or , 0.5 mg of polyA1RNA from oligodendrocyte cultures (equivalent to 60 mg of total RNA) was reversed transcribed with SuperScript II and 10 pmol of random hexamer. RNA was removed by RNase treatment and the reaction was split into seven aliquots. These multiple cDNA panels were subjected to PCR with PLATINUM Taq High Fidelity DNA Polymerase and 5 pmol of each speci®c primer for 35 cycles; 948C denaturation for 1 min, 558C primer annealing for 1 min and 728C extension for 1 min. To exclude the presence of genomic DNA, RNAs with and without reverse transcription were used as controls with b-actin primers. Primers for rat mAChRs and b-actin were derived from published nucleotide sequences (Nudel et al. 1983; Bonner et al. 1987; Liao et al. 1989) and were obtained from the GenBank data base with accession numbers M16406(M1), AB017655(M2), M16409(M3), M16406(M4), M22926(M5) and V01217(b-actin) as shown below. The PCR products were resolved on a 1.5% agarose gel and stained with ethidium bromide: Rm1a, 5 0 -860AGCTCAGAGAGGTCACAA878-3 0 ; Rm1b, 5 0 -1150TCGGTCTCG-GCCTTTCTTGGT1130-3 0 (PCR product size 290 bp); Rm2a, 5 0 -18TCCTCGAACAATGGCTTGGCTAT41-3 0 ; Rm2b, 5-500CCTACGATGAACTGCCCAGAAGAGA477-3 0 (PCR product size 482 bp); Rm3a, 5 0 -978GGTTCACCACCAAGAGCTGG997-3 0 ; Rm3b, 5 0 -1357GGTCTTGCCTGT-GTCCACGG1338-3 0 (PCR product size 379 bp); Rm4a, 5 0 -72TGGAGACAGTGGA-GATGGTGTTCA97-3 0 ; Rm4b, 5 0 -615ACAGGCAGGTAGAAGGCAGCAATG592-3 0 (PCR product size 544 bp); Rm5a, 5 0 - 1651GGCTGACCTCCAAGGTTCTG1671-3 0 ; Rm5b, 5 0 -2084GAGTCTGTGAGCAGAGCTG2064-3 0 (PCR product size 433 bp). Radioligand binding experiments Cells growing in 6-well dishes (around 100 mg protein/well for progenitors and 300 mg protein/well for mature cells) were incubated for 16 h at 48C in 1 mL of buffer containing 1 nm [3H]NMS (Fisher 1988). For saturation binding experiments, 0.01±4 nm concentrations of radioligand were used. Competition binding assays were performed with 0.75 nm [3H]NMS and the mAChR antagonists atropine, pirenzepine, 4-DAMP, methoctramine and tropicamide (10 pm20.5 mm). The binding reactions were terminated by two rapid washes with ice-cold buffer. Cells

were solubilized in 250 mL of 0.2 N NaOH/0.1% Triton X-100 and radioactivity was determined by liquid scintillation spectrometry. Counting ef®ciency was 50% and values in dpm were used to calculate fmol of ligand bound. Non-speci®c binding determined in the presence of 25 mm atropine (Fisher 1988) was 15% at 1 nm [3H]NMS. Total [3H]inositol phosphates measurements Cells were incubated for 18 h with 1mCi/mL of [3H]myo-inositol in inositol-free DMEM containing the components found in SFM (labeling media) plus 2.5 ng/mL bFGF and PDGF-AA (for progenitors) or labeling media alone for mature cells as described (Cohen and Almazan 1994). The inhibition pro®les of CChmediated IP accumulation were determined with the mAChR antagonists atropine, pirenzepine and 4-DAMP (10 pm-0.5 mm), which were added to the cultures 10 min before stimulation with 1 mm CCh plus 10 mm LiCl. Total [3H]inositol phosphates were determined as described (Berridge et al. 1983). Labeled IPs were collected in 1.2 N ammonia formate in 0.1 N formic acid after free inositol and glycerophosphate fractions were eluted from the column. Western immunoblot analysis Cells were stimulated, harvested in sample buffer (62.5 mm TrisHCl, pH 6.82% w/v sodium dodecyl sulfate (SDS), 10% glycerol, 50 mm dithiothreitol, 0.1% w/v bromophenol blue) and boiled for 5 min as described (Larocca and Almazan 1997). Twenty micrograms of protein extracts were resolved by SDS-polyacrylamide gel electrophoresis (10%, SDS±PAGE), transferred to Immobilon-P membranes and incubated with antiphospho-speci®c p42/44MAPK (1 : 10000) or antiphospho-speci®c CREB (1 : 1000). The membranes were incubated with horseradish peroxidaseconjugated secondary antibodies and visualized by chemiluminescence. The signals were quanti®ed with a Master Scan Interpretative Densitometer (Howtek Inc., Hudson, NH, USA). To normalize for equal loading and protein transfer, membranes were stripped and incubated with an antibody for total p42MAPK. RNA extraction and northern blot analysis Total RNA was extracted from oligodendrocyte progenitors as described previously (Cohen et al. 1996). RNA pellets were resuspended in 50% formamide/2.2 m formaldehyde/20 mm MOPS and denatured for 30 min at 658C. Ten micrograms of RNA extracts were electrophoresed on a 1.3% agarose-formaldehyde gel and transferred to Hybond-N membranes. The c-fos probe was labeled with [a-32P]dCTP using a random primer kit to a speci®c activity of 108 cpm/mg DNA. Membranes were hybridized at 428C for 48 h with 106 cpm of c-fos cDNA per mL of hybridization solution (50% formamide, 25 mm sodium phosphate buffer, pH 6.5, 0.8 m NaCl, 0.5% SDS, 1 mm EDTA) and exposed to X-ray ®lms. Autoradiographs were quanti®ed by densitometry. To standardize for equal RNA loading and transfer, the membranes were stripped of radioactive probe and were stained with methylene blue. Cell proliferation assay The rate of oligodendrocyte progenitor proliferation was measured by [3H]thymidine incorporation into DNA as described (Radhakrishna and Almazan 1994). Cells grown on 24-well dishes in SFM were deprived of growth factors for 8 h before treatment



Fig. 1 RT-PCR analysis of mRNA encoding mAChR subtypes. Total RNA was extracted from oligodendroglial cultures (O oligodendrocytes differentiated in vitro for 12 days, P progenitor cells) and whole rat brain (B). RT-PCR ampli®cation was performed with speci®c primers. Three separate analyses were conducted and a representative experiment is shown.

with 100 mm CCh, 1 mm atropine, 1 mm 4-DAMP or 10 mm PD98059 in the presence of 1 mCi/mL [3H]thymidine. After 24 h, the medium was aspirated and cultures were rinsed three times with ice-cold trichloroacetic acid (TCA) and solubilized in 0.2 N NaOH/0.1% Triton-X-100. Radioactivity was determined with a scintillation spectrometer (cpm/well). Data analysis Results are presented as mean ^ SEM of at least three experiments performed in triplicate with different cell preparations unless otherwise indicated. One-way analysis of variance, followed by Dunnett's or Tukey's tests for multiple comparison, was used as indicated in order to examine the statistical signi®cance; p-values less than 0.05 were considered signi®cant. The equilibrium binding parameters and the competition binding data were estimated using the non-linear iterative algorithm ligand (Munson and Rodbard 1980; McPherson 1985). Protein content in all samples was determined by a Bio-Rad protein assay kit.

Results Expression of muscarinic receptor mRNAs in oligodendroglial cells To detect the mAChR subtypes expressed by oligodendrocyte primary cultures, RT-PCR was carried out with speci®c M1±M5 oligonucleotide primer pairs. The cDNAs from progenitor and mature oligodendrocyte cultures were ampli®ed and the resulting products were resolved on a 1.5% agarose gel using rat brain cDNA as a positive control. A representative gel showing the PCR-ampli®ed products representing mRNA for M1, M2, M3, M4 and M5 subtypes (290, 482, 379, 544 and 433 bp, respectively) is shown in

Fig. 1. All subtypes were expressed in both progenitors and mature oligodendrocytes but levels of expression were more signi®cant for M3, followed by M4, and to a lower extent the M1, M2 and M5. Pharmacological characterization of muscarinic receptors in progenitors and mature oligodendrocytes To con®rm the RT-PCR data we carried out radioligand binding analysis in progenitors and differentiated oligodendrocytes with the muscarinic antagonist [3H]NMS. Saturation curves obtained at equilibrium conditions (16 h incubation at 48C) with 9±10 concentrations of [3H]NMS (0.01±4 nm) showed that speci®c binding was saturable and of high-af®nity (Fig. 2). The Scatchard plot gave single straight unbroken lines, indicating one apparent single class of binding sites with no evidence of co-operativity. In progenitors the dissociation constant (KD) for [3H]NMS was 60 ^ 2 pm, and the maximum binding capacity (Bmax) was 54 ^ 0.5 fmol/mg protein. In 12 DIV oligodendrocytes the Bmax for [3H]NMS (15 ^ 1 fmol/mg protein) was reduced by 72%, and the KD was 43 ^ 3 pm. To characterize the mAChR subtypes expressed in oligodendrocytes, speci®c [3H]NMS binding in intact cells was displaced by increasing concentrations of various antagonists. Although muscarinic antagonists lack very high selectivity for any single receptor subtype, pirenzepine binds to M1 with high-af®nity, methoctramine to M2 and tropicamide to M4/M2. 4-DAMP has been considered a selective antagonist for M3, but binds with high-af®nity to expressed M1, M3, M4 and M5 receptors, while atropine is a non-selective antagonist and displays high-af®nity for the

Fig. 2 Scatchard analysis of a representative [3H]NMS binding experiment with intact O-2A progenitors and oligodendrocytes differentiated for 12 days (12 DIV). Cells were incubated for 16 h at 48C with 0.01±4 nM of [3H]NMS, washed two times with cold buffer and radioactivity determined as described in Materials and methods. Non-speci®c binding was determined with 25 mM atropine. Results of three independent experiments performed in triplicate are shown.



Table 1 Developmental regulation of mAChRs and their signaling systems in oligodendrocytes (mean ^ SEM) Progenitors MAChR (fmol/mg protein)

54 ^ 0.5

Oligodendrocytes 15 ^ 1

3

[ H]IP (dpm/well) Control CCh (1 mM)

556 ^ 14 7028 ^ 237

2223 ^ 69 3825 ^ 50

p42MAPK (OD units) Control CCh (100 mM)

51.3 ^ 4.2 122.5 ^ 0.2

56.9 ^ 8.7 81.3 ^ 2.4

CREB (OD units) Control CCh (300 mM)

43.1 ^ 4.0 261.3 ^ 17.2

163.2 ^ 15 193.2 ^ 15.1

Experimental conditions are speci®ed in the legends of Figs 2±8.

Fig. 3 Competition binding experiments showing the effect of various antagonist on speci®c [3H]NMS binding in intact O-2 A progenitors and 12 DIV oligodendrocytes. Cells were exposed to increasing concentrations of antagonists and 0.75 nM radioligand. Model testing of the competition binding data was performed using a weighed non-linear least-squares curve ®tting program LIGAND, and the choice of the best ®t to either a one-site or to a two-site model was determined using the appropriate F-test. The experimental data points are the means of triplicate determinations from three independent experiments. The best ®t of the competitions was to a one-site model. The inhibition constants (Ki) are given in the text. B, Atrophine; W, 4-DAMP; P, pirenzepine; S, methoctramine; X, tropicamide.

®ve mAChR subtypes (Michel et al. 1989; Lazareno et al. 1990; Caul®eld 1993; Kondou et al. 1994). In progenitors [3H]NMS binding was inhibited by pirenzepine (Ki 112 ^ 5 nm) and methoctramine (Ki 1.43 ^ 0.5 mm) with low-af®nity, and with high-af®nity by atropine (Ki 0.17 ^ 0.01 nm) and 4-DAMP (0.25 ^ 0.01 nm) providing evidence that the M3 mAChRs are the main subtypes (Fig. 3, upper panel). The presence of M4 receptors was con®rmed using tropicamide, which displaced [3H]NMS with high-af®nity (Ki 15 ^ 0.1 nm). In 12 DIV oligodendrocytes, atropine (Ki 0.29 ^ 0.01 nm) and 4-DAMP (Ki 0.33 ^ 0.01 nm) displaced [3H]NMS binding with similar af®nity to progenitor cells (Fig. 3, lower panel). However, an increased af®nity was observed for pirenzepine (Ki 56 ^ 3 nm), methoctramine (Ki 135 ^ 7 nm) and tropicamide (Ki 38 ^ 2 nm).

Fig. 4 Inhibition of CCh-stimulated total [3H]inositol phosphates accumulation by muscarinic antagonists in intact O-2A progenitors and 12 DIV oligodendrocytes. Cells were incubated with 1 mM CCh in the absence or presence of increasing concentration of muscarinic antagonists. Data are expressed as a percentage stimulation by 1 mM CCh without antagonist and represent the means ^ SEM of three independent experiments performed in triplicate. B, atropine; W, 4-DAMP; P, pirenzepine.



Fig. 5 p42MAPK and CREB activation are mediated by the M3 mAChR. Cells were treated for 20 min with each of the muscarinic antagonists (at 1 mM) pirenzepine (PIR), 4-DAMP (DAM), methoctramine (MET) or atropine (ATR) prior to stimulation with 100 mM CCh for 5 min p42MAPK and CREB activation were determined by immunoblot analysis as described in Materials and methods. The upper panel shows a typical experiment in duplicates. Western blots were analyzed by densitometry and the values are expressed as the mean ^ SEM of three independent experiments performed in duplicate. Statistical differences are indicated: basal versus CCh ( p , 0.001); CCh versus ATR or DAM ( p , 0.001) for both p42MAPK and CREB.

The functional coupling of the receptors was assessed by examining CCh-stimulated phosphoinositide hydrolysis (PI) in oligodendrocyte cultures. As previously reported (Cohen and Almazan 1994), CCh at 1 mm concentration activated this second messenger system more effectively in progenitors (12-fold increase over basal levels) than in oligodendrocytes (1.7-fold) (Table 1). To investigate mAChRs subtypes coupled to PI hydrolysis, the inhibition pro®les of CCh-induced [3H]IP accumulation were examined for atropine, 4-DAMP and pirenzepine in both progenitors and 12 DIV oligodendrocytes (Fig. 4). Receptors had the selectivity expected of the M3 subtype. At both developmental stages, CChstimulated PI hydrolysis was inhibited by atropine and 4-DAMP with high potency and pirenzepine with low potency. The IC50s values in progenitor cells were 0.86 nm for atropine, 1.44 nm for 4-DAMP and 1.56 mm for pirenzepine. In mature oligodendrocytes the IC50 was 1.57 nm for atropine, 5.27 nm for 4-DAMP and 0.59 mm for pirenzepine. The inhibition curve for pirenzepine in progenitors had a tendency to be biphasic suggesting the presence of more than one binding sites.

Fig. 6 4-DAMP blocks the phosphorylation of p42MAPK and CREB in a concentration-dependent manner. Cells were pre-treated with increasing concentrations of the M3 selective antagonist 4-DAMP for 20 min (1 nM21 mM), followed by 5 min stimulation with CCh (100 mM). p42MAPK and CREB activation were determined by immunoblot analysis as described in Materials and methods. Top shows western blots of a typical experiment in duplicate. The blots were analyzed by densitometry and the values are expressed as the mean ^ SEM of percentage inhibition of CCh-stimulated cultures of three independent experiments performed in duplicate. Statistical differences are indicated: basal versus 100 mM CCh ( p , 0.001); CCh versus 100 or 1000 nM CCh 1 4-DAMP ( p , 0.001).

Muscarinic M3 receptors mediate p42/44MAPK and CREB phosphorylation, and c-fos mRNA expression Previous studies have shown that cholinergic stimulation of oligodendrocyte progenitors increases p42/44MAPK activation (Larocca and Almazan 1997), CREB phosphorylation (Pende et al. 1997; Sato-Bigbee et al. 1999) and c-fos mRNA expression (Cohen et al. 1996) through activation of mAChRs. To determine the mAChR subtype that mediates these responses, progenitors were pre-treated, for 20 min with pirenzepine, methoctramine, 4-DAMP and atropine. A concentration of 1 mm was used for each muscarinic antagonist, which is suf®cient to fully block its preferred subtype(s) without losing speci®city (Michel et al. 1989; Lazareno et al. 1990; Caul®eld 1993; Kondou et al. 1994). Cultures were then treated with 100 mm CCh for a period of 5 min to activate p42/44MAPK or to phosphorylate CREB. For c-fos mRNA expression, cultures were treated with 100 mm CCh for 30 min. The concentrations of CCh used in our experiments are close to those required to produce maximal effects (Cohen and Almazan 1994; Cohen et al. 1996; Larocca and Almazan 1997; Pende et al. 1997). Levels of p42/44MAPK and CREB phosphorylation were



Fig. 7 CCh-stimulated c-fos mRNA expression is mediated by the M3 mAChR. Cells were treated for 20 min with the muscarinic antagonist (at 1 mM) pirenzepine (PIR), 4-DAMP (DAM), methoctramine (MET) or atropine (ATR) prior to stimulation with 100 mM CCh for 30 min. Levels of c-fos mRNA were detected by northern blotting as described in Materials and methods. Top shows an autoradiograph of a typical experiment. Autoradiographs were analyzed by densitometry and the values are expressed as mean ^ SEM of 3 independent experiments performed in duplicate. Statistical differences are indicated: basal versus CCh ( p , 0.001); CCh versus CCh 1 ATR or DAM ( p , 0.001); CCh versus CCh 1 PIR ( p , 0.01).

determined by western blotting and c-fos mRNA expression by northern blotting. CCh increased p42/44MAPK and CREB phosphorylation by , 2±3-fold (Fig. 5). Pre-treatment with atropine or 4-DAMP blocked both responses while pirenzepine and methoctramine did not affect the levels of phosphorylation. 4-DAMP reduced in a concentration-dependent manner the phosphorylation of p42/44MAPK and CREB with IC50s values of 1±10 nm (Fig. 6). Furthermore, an irreversible M3 selective antagonist, 4-DAMP-mustard (DAMP-m) (Barlow et al. 1991), was equally effective in blocking the CCh-mediated phosphorylation of both proteins (Table 2). These results con®rm the RT-PCR, binding and PI hydrolysis data and demonstrate the predominance of the M3 receptor subtype in progenitors. In line with the developmental regulation of receptor density and CCh-mediated PI hydrolysis, we observed that CCh activated p42/44MAPK and CREB phosphorylation more effectively in progenitors than in mature oligodendrocytes (Table 1). Thus, CCh increased the phosphorylation of p42/44MAPK and CREB by 200% and 500% above control in progenitors and by 30% in mature cells.

Fig. 8 4-DAMP blocks the expression of c-fos mRNA in a concentration-dependent manner. Cells were pre-treated for 20 min with increasing concentrations of the M3 selective antagonist 4-DAMP (1 nM21 mM) followed by CCh (100 mM) stimulation for 30 min. Levels of c-fos mRNA were determined by northern blotting and quanti®ed densitometrically. Values are expressed in arbitrary optical density units of percentage inhibition of CCh stimulation. Statistical differences are indicated: basal versus CCh ( p , 0.001); CCh versus CCh 1 50±1000 nM DAM ( p , 0.001); CCh versus CCh 1 10 nM DAM ( p , 0.01).

CCh increased c-fos mRNA levels six-fold above nonstimulated controls (Fig. 7) while pre-treatment of the cultures with atropine or 4-DAMP blocked c-fos mRNA expression. In contrast, 1 mm of methoctramine had no Table 2 4-DAMP-mustard (4-DAMP-m) blocks the CCh-stimulated p42MAPK and CREB phosphorylation as well as c-fos mRNA expression

Control CCh 4-DAMP-m 4-DAMP-m1CCh

p42MAPK Phosphorylation

c-fos mRNA Expression

CREB Phosphorylation

51 122 41 35

45 662 49 74

43 261 38 40

^ ^ ^ ^

4 0.2 0.1 3

^ ^ ^ ^

19 107 7 7

^ ^ ^ ^

4 17 2 2

Progenitors were pre-incubated with 1 mM 4-DAMP-m, an irreversible M3 muscarinic antagonist, for 20 min followed by 100 mM CCh. Phosphorylated (active) p42MAPK and CREB were detected by western blotting and c-fos mRNA by northern blotting. Signals were quanti®ed densitometrically. Values are the mean ^ SEM of triplicate determinations and represent relative OD units. Statistical differences were: control versus CCh ( p , 0.01, for all responses); control versus 4-DAMP-M 1 CCh ( p . 0.05, for all responses); CCh versus 4-DAMP-M 1 CCh ( p , 0.001, for all responses).



Table 3 Inhibition of carbachol-stimulated [H3]thymidine incorporation by mAChR antagonists and the MAPK kinase inhibitor PD98059 [3H]thymidine incorporation (100% of control) Control PDGF 1 bFGF (2.5 ng/mL) CCh (100 mM) CCh 1 ATR (10 mM) CCh 1 4-DAMP (10 mM) CCh 1 PD98059 (10 mM)

100 540 216 106 123 97

^ ^ ^ ^ ^ ^

5 10 5 9 9 3

3

Oligodendrocyte progenitors proliferation was measured by [ H]thymidine incorporation. Cells were pre-treated with the mAChR antagonists atropine (ATR, 10 mM), 4-DAMP (10 mM) or the MAPK kinase inhibitor PD98059 (10 mM) for 30 min before the addition of 100 mM CCh and were incubated for 24 h in the presence of 1 mCi/mL [3H]thymidine. Radioactivity was quanti®ed in the TCA precipitate. Values are the mean ^ SEM of triplicate experiments and represent relative dpm expressed as percent of control. Statistical differences were: control versus PDGF 1 bFGF ( p , 0.001); control versus CCh ( p , 0.001).

effect, whereas pirenzepine slightly reduced the CChstimulated response. In addition, 4-DAMP antagonized the effect of CCh on c-fos mRNA expression in a dosedependent manner (Fig. 8) with an approximate IC50 of 1±10 nm. Furthermore, pre-treatment with 1 mm DAMP-m, the irreversible analog of DAMP, blocked c-fos expression (Table 2). These results demonstrate that M3 receptors are responsible for c-fos mRNA induction, and further con®rm the predominance of the M3 receptor subtype in oligodendrocyte progenitors. Mature oligodendrocytes showed only a small increase in c-fos mRNA in response to CCh (, 20% above untreated cultures) and was only statistically signi®cant in 1 out of 3 experiments (results are not shown). Muscarinic M3 receptors mediate the proliferative effects of CCh Oligodendrocyte progenitors, grown for 2 days in SFM supplemented with bFGF plus PDGF, were deprived of growth factors for 8 h before the assays. Under these conditions, 2.5 ng/mL PDGF and bFGF treatment for 24 h increased [3H]thymidine incorporation by four-fold (Table 3). In the absence of either mitogen, 100 mm CCh signi®cantly stimulated [3H]thymidine incorporation (twofold). The proliferative effect of CCh was blocked by the antagonist atropine (non-speci®c) as well as by the selective M3 receptor antagonist 4-DAMP. The antagonists pirenzepine (M1) and methoctramine (M2) did not modify progenitor proliferation (data not shown). These results show that activation of muscarinic receptors increases oligodendrocyte progenitor proliferation through the M3 receptor subtype.

To explore the signaling mechanisms involved in the proliferative effects of CCh we focused on the MAPK pathway. Carbachol activated the p42/44MAPK cascade rapidly and transiently (Larocca and Almazan 1997). In the present study, the MAPK kinase (MEK) inhibitor PD98059 prevented the proliferative effects of CCh, indicating that p42/44 MAPK is involved in mAChRmediated proliferation. Discussion The present study demonstrates that M3 is the predominant muscarinic receptor subtype expressed in progenitors and differentiated oligodendrocytes. M3 is involved in the activation of downstream signaling pathways, in the regulation of c-fos gene expression, and in the stimulation of progenitor cell proliferation. In addition, the expression and the functional activity of mAChR receptors are subject to developmental regulation. RT-PCR analysis demonstrated that developing oligodendrocytes express transcripts encoding M3, followed by the M4 subtype, and lower levels of M1, M2 and M5. These ®ndings correlated well with our competition binding experiments using relatively selective mAChR antagonists. Thus, both progenitors and mature oligodendrocytes possessed high-af®nity binding sites for 4-DAMP and atropine (Ki , 0.2 nm), intermediate-af®nity binding sites for tropicamide (M4 selective) (Ki , 5 nm) and low-af®nity sites for pirenzepine (M1 selective) (Ki ,112 nm) and methoctramine (M2 selective) (Ki ,1.4 mm). However, a small difference between the pharmacological pro®les of progenitors and mature oligodendrocytes was observed. The af®nity for tropicamide, pirenzepine and methoctramine increased in mature oligodendrocytes, suggesting that as oligodendrocytes differentiate, a more heterogeneous population of receptors is acquired. The predominance of the M3 subtype was further con®rmed by measuring functional receptor activity, i.e. PI hydrolysis, activation of p42/44MAPK and CREB signaling pathways, and induction of gene expression. Of all antagonists tested only atropine and 4-DAMP inhibited CCh mediated effects with high potency. Pirenzepine, an M1 selective antagonist, inhibited CCh-stimulated PI hydrolysis with low potency (IC50 , 1.56 mm) and caused a signi®cant decrease in p42/44MAPK at high concentrations. Nevertheless as the inhibition curve for pirenzepine on PI hydrolysis had a tendency to be biphasic, we can not dismiss the presence of a small number of higher-af®nity sites, M1, not detected by the binding and contributing to these effects. Furthermore, we previously reported that pirenzepine at 1 mm concentration inhibited calcium transients as well (Cohen and Almazan 1994). The density of mAChRs in oligodendroglial cells, is lower than in cerebellar granule neurons (Alonso et al. 1990; Whitham et al. 1991), but similar to those measured in



corticostriatal neurons (Eva et al. 1990) and astrocytes (Andre et al. 1994; Kondou et al. 1994). Puri®ed myelin isolated from adult rat brain was shown to possess highaf®nity mAChR binding sites (Larocca et al. 1987a), which mediated both phosphoinositide hydrolysis and inhibition of cyclic AMP formation (Larocca et al. 1987b; Kahn and Morell 1988). A portion of the binding sites present in myelin (25%) were labeled with pirenzepine suggesting the presence of M1 receptors, while the remaining receptor sites were not identi®ed. These ®ndings demonstrate that oligodendrocytes in the adult brain express receptors and signaling systems able to sense their neuronal milieu and respond to acetylcholine released by neurons. Our investigation highlights a central role for the M3 subtype in the control of intracellular signaling events. Signaling pathways initiated by muscarinic receptors involve activation of the p42/44MAPK. These Ser/Thr kinases are important intermediates to transduce mitogenic and differentiating signals to the nucleus and can be activated by both M1- and M2-like receptors (Igishi and Gutkind 1998). In oligodendrocyte progenitors, mAChRs activate p42/44MAPK through a mechanism that requires the presence of extracellular Ca21 and involves mainly a 12-O-tetradecanolylphorbol 13-acetate-insensitive PKC pathway (Larocca and Almazan 1997). Recent studies have shown that muscarinic stimulation also induces phosphorylation of the transcription factor CREB, an event that is dependent on Ca21, downstream of the p42/44MAPK pathway, and is developmentally regulated (Pende et al. 1997; Sato-Bigbee et al. 1999). A potential gene target for CREB is the proto-oncogene c-fos, which is induced after muscarinic stimulation in oligodendrocyte progenitor cultures (Cohen et al. 1996) under conditions that promote proliferation of progenitors. Similar to p42/44MAPK and CREB activation, increases in c-fos mRNA are Ca21-dependent, suggesting that the same muscarinic receptor subtype is mediating these events. In our experiments, the M3 mAChR antagonist 4-DAMP, and its irreversible analogue 4-DAMP-mustard, blocked the CCh-stimulation of MAPK and CREB phosphorylation, and induction of c-fos mRNA expression. All these data clearly support our proposal that the M3 receptor is the subtype mediating the above-mentioned events in progenitors. Mitogenic responses triggered by muscarinic receptor activation have been reported in astrocytes (Ashkenazi et al. 1989; Guizzetti et al. 1996) and in neural precursors (Ma et al. 2000; Li et al. 2001). In agreement with our previous results, CCh caused a two-fold increase in [3H]thymidine incorporation, suggesting that mAChRs mediate proliferation of oligodendrocyte progenitors (Cohen et al. 1996). We found that the M3 antagonist, 4-DAMP, as well as the nonselective antagonist, atropine, prevented CCh-mediated proliferation. Inhibition of CCh-stimulated proliferation of

progenitors with the MAPK kinase inhibitor, PD 98059, revealed the involvement of the p42/44MAPK cascade in this event. The proliferative responses mediated by mAChRs are apparently related to the activation of PI hydrolysis, DAG production, and activation of PKC in astrocytes and in transfected cell lines (Ashkenazi et al. 1989). A most recent report provides evidence that the atypical PKCz isoform is involved in mAChR-induced proliferation of astrocytoma cells as a selective peptide inhibitor blocked PKCz translocation as well as [3H]thymidine incorporation (Guizzetti and Costa, 2000). Although we showed that MAPK activation by carbachol is blocked by PKC inhibitors (Larocca and Almazan 1997), more studies are required to determine whether PKCz isoform is involved in the upstream activation of p42/44MAPK and consequent proliferation of oligodendrocyte progenitors. Oligodendrocyte differentiation results in a diminished responsiveness to CCh stimulation (Kastritsis and McCarthy 1993; Cohen and Almazan 1994; He and McCarthy 1994). Our study shows that the density of mAChRs is downregulated during in vitro development. Hence, the decrease in CCh-mediated PI hydrolysis, p42/44MAPK and CREB phosphorylation as well as the previously observed reduction in intracellular Ca21 release are a consequence of reduced receptor levels. In progenitors, binding studies indicate a receptor density of 55 fmol/mg protein, whereas in oligodendrocytes [3H]NMS binding was decreased by 72%. Similar reductions in total [3H]IP accumulated after CCh stimulation were measured in mature oligodendrocytes. In agreement with our results, others have provided evidence for a developmental regulation of mAChR responsiveness in oligodendrocytes. Using both 4- and 11-day-old progenitors and differentiated oligodendrocytes isolated from rat cerebrum, CCh-mediated CREBphosphorylation increased around three-fold above control levels in 4-day-old rats, an effect that was abolished in 11-day-old rats (Sato-Bigbee et al. 1999). It could be postulated that factors in culture medium or differences in oligodendrocyte function related to the lack of axonal contact or activity are responsible for the alteration in mAChR density that we observed in vitro. In fact, one report has shown that coculture of mature oligodendrocytes with neurons from dorsal root ganglia or superior cervical ganglia prevents the loss of CCh-mediated Ca21 signaling (He et al. 1996). It therefore seems possible that ACh, either alone or in combination with other cellular signals, may contribute to the maintenance of functional mAChR in mature oligodendrocytes which serve neuromodulatory functions in addition to their proposed mitogenic role in progenitor cells. In summary, our results show that cultured oligodendroglial cells express all ®ve mAChRs. The M3 receptor subtype is highly expressed and seems to play an important role in oligodendrocyte growth.



Acknowledgements This work was funded by the Medical Research Council and the Multiple Sclerosis Society of Canada (GA). EM-H was supported by a postdoctoral fellowship from the Ministry of Education and Culture of Spain. H-NL and AK held studentships from the Multiple Sclerosis Society of Canada. JNL was supported by the American National Multiple Sclerosis Society. We thank Dr Jose M. Vela for his help with the computer photoimages, Dr R. Gould for his help during our ®rst attempts to assess muscarinic receptors gene expression by PCR and Dr Paul Clarke for his help with ®gures. We also thank Drs William Norton and Walter Mushynski for their useful comments on the manuscript.

References Almazan G., Afar D. E. H. and Bell J. C. (1993) Phosphorylation and disruption of intermediate ®lament proteins in oligodendrocyte precursor cultures treated with calyculin A. J. Neurosci. Res. 36, 163±172. Alonso R., Didier M. and Soubrie P. (1990) [3H]N-methylscopolamine binding studies reveal M2 and M3 muscarinic receptor subtypes on cerebellar granule cells in primary culture. J. Neurochem. 55, 334±337. Andre C., Dos Santos G. and Koulakoff A. (1994) Muscarinic receptors pro®les of mouse brain astrocytes in culture vary with their tissue of origin but differ from those of neurons. Eur. J. Neurosci. 6, 1702±1709. Ashkenazi A., Ramachandran J. and Capon D. J. (1989) Acetylcholine analogue stimulates DNA synthesis in brain-derived cells via speci®c muscarinic receptor subtypes. Nature 340, 146±150. Barlow R. B., McMillen L. S. and Veale M. A. (1991) The use of 4-diphenylacetoxy-N-(2-chloroethyl)-piperidine (4-DAMP mustard) for estimating the apparent af®nities for some agonists acting at muscarinic receptors in guinea pig ileum. Br. J. Pharmacol. 102, 657±662. Belachew S., Rogister B., Rigo J. M., Malgrange B. and Moonen G. (1999) Neurotransmitter-mediated regulation of CNS myelination: a review. Acta Neurologica Belgica 1, 21±31. Bergles D. E., Roberts J. D. B., Somogyi P. and Jahr C. E. (2000) Glutamatergic synapses on oligodendrocyte precursor cells in the hippocampus. Nature 405, 187±191. Berridge M. J., Dawson C. P., Downes C. P., Helsop J. P. and Irvine R. F. (1983) Changes in the levels of inositol phosphates after agonistdependent hydrolysis of membrane phosphoinositides. Biochem. J. 212, 473±482. Bonner T. I., Buckley N. J., Young A. C. and Brann M. R. (1987) Identi®cation of a family of muscarinic acetylcholine receptor genes. Science 237, 527±532. Caul®eld M. P. (1993) Muscarinic receptors: characterization, coupling and function. Pharmacol. Ther. 58, 319±379. Caul®eld M. B. and Birdsall N. J. M. (1998) International Union of Pharmacology. XVII.Classi®cation of Muscarine Acetylcholine Receptors. Pharmacol. Rev. 50, 279±290. Cohen R. I. and Almazan G. (1994) Rat oligodendrocytes express muscarinic receptors coupled to phosphoinositide hydrolysis and adenylyl cyclase. Eur. J. Neurosci. 6, 1213±1224. Cohen R. I., Molina-Holgado E. and Almazan G. (1996) Carbachol stimulates c-fos expression and proliferation in oligodendrocyte progenitors. Mol. Brain Res. 43, 193±201. Eva C., Ricci S., Genazzani E. and Costa E. (1990) Molecular mechanism of homologous desensitization and internalization of

muscarinic receptors in primary cultures of neonatal neurons. J. Pharmacol. Exp. Ther. 253, 257±265. Fisher S. K. (1988) Recognition of muscarinic cholinergic receptors in human SK-N-SH neuroblastoma cells by quaternary and tertiary ligands is dependent upon temperature, cell integrity, and the presence of agonists. Mol. Pharmacol. 33, 414±422. Guizzetti M. and Costa L. G. (2000) Possible role of protein kinase Cz in muscarinic receptor-induced proliferation of astrocytoma cells. Biochem. Pharmacol. 60, 1457±1466. Guizzetti M., Costa P., Peters J. and Costa L. G. (1996) Acetylcholine as a mitogen: muscarinic receptor-mediated proliferation of rat astrocytes and human astrocytoma cells. Eur. J. Pharmacol. 297, 265±273. He M. and McCarthy K. D. (1994) Oligodendroglial signal transduction systems are developmentally regulated. J. Neurochem. 63, 501±508. He M., Howe D. G. and McCarthy K. D. (1996) Oligodendroglial signals transduction systems are regulated by neuronal contact. J. Neurochem. 67, 1491±1499. Igishi T. and Gutkind S. J. (1998) Tyrosine kinases of the Src family participate in signaling to MAP kinase from both Gq and Gi-coupled receptors. Biochem. Biophys. Res. 244, 5±10. Kahn D. W. and Morell P. (1988) Phosphatidic acid and phosphoinositide turnover in myelin and its stimulation by acetylcholine. J. Neurochem. 50, 1542±1550. Karschin A., Wischmeyer E., Davidson N. and Lester H. A. (1994) Fast inhibition of inwardly rectifying K1 channels by multiple neurotransmitter receptors in oligodendroglia. Eur. J. Neurosci. 6, 1756±1764. Kastritsis C. H. and McCarthy K. D. (1993) Oligodendroglial lineage cells express neuroligand receptors. Glia 8, 106±113. Kondou H., Inagaki N. and Fukui H. (1994) Formation of inositol phosphates mediated by M3 muscarinic receptors in type-1 and type-2 astrocytes from neonatal rat cerebral cortex. Neurosci. Lett. 180, 131±134. Larocca J. N. and Almazan G. (1997) Acetylcholine agonists stimulate mitogen-activated protein kinase in oligodendrocyte progenitors by muscarinic receptors. J. Neurosci. Res. 50, 743±754. Larocca J. N., Cervone A. and Ledeen R. W. (1987a) Stimulation of phosphoinositide hydrolysis in myelin by muscarinic agonist and potassium. Brain Res. 436, 357±362. Larocca J. N., Ledeen R. W., Dvorkin B. and Makman M. H. (1987b) Muscarinic receptor binding and muscarinic receptor-mediated inhibition of adenylate cyclase in rat brain myelin. J. Neurosci. 7, 3869±3876. Lazareno S., Buckley N. J. and Roberts F. F. (1990) Characterization of muscarinic M4 binding sites in rabbit lung, chicken heart, and NG108-15 cells. Mol. Pharmacol. 38, 805±815. Li B.-S., Ma W., Zhang L., Barker J. L., Stenger D. A. and Pant H. C. (2001) Activation of phosphatidylinositol-3 kinase (PI-3K) and extracellular regulated kinases (Erk1/2) is involved in muscarinic receptor-mediated DNA synthesis in neural progenitor cells. J. Neurosci. 21, 1569±1579. Liao C. F., Themmen A. P. N., Joho R., Barberis C., Birnbaumer M. and Birnbaumer L. (1989) Molecular cloning and expression of a ®fth muscarinic acetylcholine receptor. J. Biol. Chem. 264, 7328±7337. Ma W., Maric D., Li B.-S., Hu Q., Andreadis J. D., Grant G. M., Liu Q.-Y., Shaffer K. M., Chang Y. H., Zhang L., Pancrazio J. J., Pant H. C., Stenger D. A. and Barker J. L. (2000) Acetylcholine stimulates cortical precursor cell proliferation in vitro via muscarinic receptor activation and MAP kinase phosphorylation. Eur. J. Neurosci. 12, 1227±1240. McCarthy K. D. and de Vellis J. (1980) Preparation of separate



astroglial and oligodendroglial cell cultures from rat cerebral tissue. J. Cell Biol. 85, 890±902. McPherson G. A. (1985) Analysis of radioligand binding experiments: a collection of computer programs for the IBM PC. J. Pharmacol. Meth. 14, 213±228. Michel A. D., Stefanich E. and Whiting R. L. (1989) Direct labeling of rat M3-muscarinic receptors by [3H]4DAMP. Eur. J. Pharmacol. 166, 459±466. Munson P. J. and Rodbard D. (1980) LIGAND: a versatile computerized approach for characterization of ligand-binding systems. Ann. Biochem. 107, 220±239. Nudel U., Zakut R., Shani M., Neuman S., Levy Z. and Yaffe D. (1983) The nucleotide sequence of the rat cytoplasmic b-actin gene. Nucleic Acids Res. 11, 1759±1771. Paspalas C. D. and Papadopoulos G. C. (1996) Ultrastructural relationships between noradrenergic nerve ®bers and non-neuronal elements in the rat cerebral cortex. Glia 17, 133±146. Pende M., Fisher T. L., Simpson P. B., Russell J. T., Blenis J. and Gallo V. (1997) Neurotransmitter- and growth factor-induced cAMP response element binding protein phosphorylation in glial cell progenitors: role of calcium ions, protein kinase C, and

mitogen activated protein kinase/ribosomal S6 kinase pathway. J. Neurosci. 17, 1291±1301. Radhakrishna M. and Almazan G. (1994) Protein kinases mediate basic ®broblast growth factor's stimulation of proliferation and c-fos induction in oligodendrocyte progenitors. Mol. Brain Res. 26, 18±128. Ritchie T., Cole R., Kim H. S., de Vellis J. and Noble E. P. (1987) Inositol phospholipid hydrolysis in cultured astrocytes and oligodendrocytes. Life Sci. 41, 31±39. Sato-Bigbee C., Pal S. and Chu A. K. (1999) Different neuroligands and signal transduction pathways stimulate CREB phosphorylation at speci®c developmental stages along oligodendrocyte differentiation. J. Neurochem. 72, 139±147. Simpson P. B. and Russell J. T. (1996) Mitochondria support inositol 1,4,5-trisphosphate-mediated Ca21 waves in cultured oligodendrocytes. J. Biol. Chem. 271, 33493±33501. Takeda M., Nelson D. J. and Soliven B. (1995) Calcium signalling in cultured rat oligodendrocytes. Glia 14, 225±236. Whitham E. M., Challiss R. A. and Nahorski S. R. (1991) M3 muscarinic receptors are linked to phosphoinositide metabolism in rat cerebellar granule cells. Eur. J. Pharmacol. 206, 181±189.
