PhD thesis

MASARYKOVA UNIVERZITA V BRNĚ

Přírodovědecká fakulta

PhD thesis

Jiřina ZATLOUKALOVÁ

Brno, 2008

MASARYKOVA UNIVERZITA V BRNĚ Přírodovědecká fakulta

Jiřina Zatloukalová

DEREGULATION OF CELL PROLIFERATION AND APOPTOSIS BY XENOBIOTICS AND CYTOSTATICS

Deregulace buněčné proliferace a apoptózy jako důsledek xenobiotik a cytostaticky působických látek

PhD thesis Dizertační práce

Advisor / Školitel: RNDr. Jan Vondráček, PhD

Brno, 2008

© Jiřina Zatloukalová, Masarykova univerzita v Brně, 2008

Bibliografická identifikace Jméno a příjmení autora: Jiřina Zatloukalová Název disertační práce:

Deregulace buněčné proliferace a apoptózy jako důsledek xenobiotik a cytostaticky působících látek

Název disertační práce anglicky:

Deregulation of cell proliferation and apoptosis by xenobiotics and cytostatics

Studijní program: PřF D-BI4 Biologie, doktorský studijní program Studijní obor (směr), kombinace oborů: PřF FYZZ Fyziologie živočichů Školitel:

RNDr. Jan Vondráček, PhD

Rok obhajoby:

2008

Klíčová slova v češtině:

AhR, flavony, 2,3,7,8-tetrachlorodibenzo-p-dioxin, indirubin, buněčná proliferace, kontaktní inhibice, mezibuněčná komunikace

Klíčová slova v angličtině:

AhR, flavones, 2,3,7,8-tetrachlorodibenzo-p-dioxin, indirubin, cell proliferation, contact inhibition, cell-to-cell communication

PODĚKOVÁNÍ: Na tomto místě bych především ráda poděkovala RNDr. Janu Vondráčkovi PhD, ze kterého se vyklubal nejlepší školitel, jakého bych si mohla přát. Poskytl mi perfektní pracovní zázemí, cenné rady i připomínky a neváhal mě podporovat financemi a optimismem kdykoli to bylo zapotřebí. Mé velké díky patří rozhodně také RNDr. Miroslavu Machalovi CSc., který mě svým životním optimismem a pracovním zápalem mnohokrát povzbudil a navnadil na další práci. Kromě toho se také zasloužil o finanční krytí řady experimentů a konferenčních výjezdů. Za vznik této práce se obrovským dílem zasloužil celý kolektiv Oddělení cytokinetiky (BFÚ AV ČR), protože představuje tolik potřebné přátelské a tvůrčí prostředí a tím mi nesmírně usnadnil veškeré bádání. Zejména děkuji Lence Švihálkové Šindlerové, Zdeňkovi Andrysíkovi, Lence Umannové a Viktoru Horváthovi, kteří mi nejvíce pomohli se zapracovat. Z tohoto důvodu velice děkuji také doc. RNDr. Aloisovi Kozubíkovi, CSc. a doc. RNDr. Jiřině Hofmanové, CSc., kteří toto pracovní prostředí vytvořili. Ze všech nejvíce si ale zaslouží mé díky moji rodiče a Áďa, kteří mě vždy byli duchovní oporou, poskytli mi nejlepší možné rodinné zázemí a především tolerovali mé nálady a pracovní vytížení. Část této práce (kapitola 4.6.2) byla finančně podpořena Programem rektora MU na podporu tvůrčí činnosti studentů 2006-2007 [Kategorie c) Podpora vynikajících disertačních prací v oborech lékařství, zdravotnictví, přírodovědy a informatiky].

Contents CONTENTS: 1

INTRODUCTION................................................................................................................ 4 1.1 Liver - structure and function......................................................................................... 4 1.1.1 Liver cells................................................................................................................. 4 1.1.2 Liver regeneration .................................................................................................... 6 1.1.3 Xenobiotics and liver metabolism............................................................................ 7 1.1.3.1 Cytochrome P450 enzymes ............................................................................. 8 1.1.3.1.1 CYP1 family.............................................................................................. 9 1.1.4 Molecular mechanisms of xenobiotic metabolism regulation................................ 10 1.2 Etiology of HCC........................................................................................................... 11 1.3 Experimental liver models and cell lines ..................................................................... 12 1.3.1 WB-F344 cells........................................................................................................ 13 1.3.1.1 Contact inhibition and cell confluency.......................................................... 13 1.3.2 BP8 and 5L cells .................................................................................................... 14 1.4 bHLH/PAS transcription factors family....................................................................... 14 1.4.1 Aryl hydrocarbon receptor (AhR) .......................................................................... 15 1.4.1.1 AhR signaling pathway ................................................................................. 16 1.4.1.1.1 AhR degradation ..................................................................................... 19 1.4.1.1.2 Negative feedback in AhR signaling – the role of AhR repressor .......... 20 1.4.1.1.3 Nuclear export of AhR and the role of cell density................................. 20 1.4.1.2 AhR ligands................................................................................................... 21 1.4.1.2.1 Endogenous AhR ligands ........................................................................ 21 1.4.1.2.1.1 Indirubin .......................................................................................... 22 1.4.1.2.2 Exogenous AhR ligands .......................................................................... 23 1.4.1.2.2.1 TCDD .............................................................................................. 23 1.4.1.2.2.1.1 The role of TCDD in mammalian hepatocarcinogenesis ........ 25 1.4.1.2.2.2 Polychlorinated biphenyls (PCBs) .................................................. 25 1.4.1.2.2.3 Flavonoids ....................................................................................... 27 1.4.1.2.2.3.1 Flavones ................................................................................... 30 1.4.1.3 AhR and cell cycle ........................................................................................ 31 1.4.1.4 AhR crosstalk with other signaling pathways ............................................... 33 1.4.1.4.1 AhR and ER ............................................................................................ 34 1.5 Cell-to-cell communication.......................................................................................... 36 1.5.1 Cadherin superfamily ............................................................................................. 36 1.5.1.1 Cadherins expressed in liver ......................................................................... 38 1.5.2 Catenins.................................................................................................................. 40 1.5.2.1 β-catenin........................................................................................................ 40 1.5.2.1.1 β-catenin in liver development and AhR signaling................................. 43 1.5.2.2 Plakoglobin (γ-catenin) ................................................................................. 43 2 MAIN AIMS OF STUDY.................................................................................................. 45 3 MATERIALS AND METHODS ....................................................................................... 46 3.1 Chemicals ..................................................................................................................... 46 3.2 Cell cultures and treatment........................................................................................... 46 3.2.1 Rat oval epithelial „stem-like“ cell line- WB-F344 ............................................... 46 3.2.2 Rat hepatoma cell lines- 5L and BP8 ..................................................................... 47 3.3 Cell proliferation assay................................................................................................. 47 3.3.1 Coulter Counter ...................................................................................................... 47 3.3.2 CyQUANT NF cell proliferation assay.................................................................. 47 3.4 Cell cycle analysis........................................................................................................ 48 -i-

Contents 3.5 Indirect fluorescence .................................................................................................... 48 3.6 RNA isolation and real-time PCR................................................................................ 48 3.7 Western blotting ........................................................................................................... 50 3.8 Electrophoretic mobility shift assay (EMSA) .............................................................. 51 3.8.1 Preparation of nuclear extracts............................................................................... 51 3.8.2 EMSA..................................................................................................................... 52 3.9 Chromatin immunoprecipitation (ChIP) ...................................................................... 52 3.10 RNA interference (RNAi) ............................................................................................ 53 3.10.1 Cell transfections with short interfering RNA (siRNA)...................................... 53 3.10.2 Short hairpin RNA (shRNA)............................................................................... 54 3.10.2.1 Design of shRNA .......................................................................................... 54 3.10.2.2 Preparation of tetracycline-inducible vector system for shRNA .................. 54 3.10.2.2.1 DNA agarose electrophoresis.................................................................. 54 3.10.2.2.2 DNA polyacrylamide electrophoresis (DNA-PAGE) ............................. 54 3.10.2.2.3 Cloning of shRNA cDNAs into pENTR/H1/TO vector.......................... 55 3.10.2.3 Transient cell transfections with shRNA constructs ..................................... 55 3.11 Statistical analysis ........................................................................................................ 55 4 RESULTS........................................................................................................................... 57 4.1 AhR-mediated signaling in rat oval ´stem-like´ cells, WB-F344................................. 57 4.1.1 Cellular localization of AhR in WB-F344 cells ..................................................... 57 4.1.2 Ligand-induced AhR protein degradation.............................................................. 57 4.1.3 Detection of AhR/ARNT1 complex bound to DRE sequences by EMSA assay... 62 4.1.4 Expression of Cyp1a1 gene.................................................................................... 65 4.1.5 Detection of AhR/ARNT1 complex bound to DRE sequences by ChIP assay ..... 68 4.1.6 Effects of AhR ligands on expression of other AhR-regulated genes.................... 69 4.1.7 Capacity of various AhR ligands to induce degradation of ERα........................... 71 4.2 Analysis of cytokinetic parameters of contact-inhibited WB-F344 cells exposed to AhR ligands............................................................................................................ 72 4.2.1 Induction of proliferation in confluent WB-F344 cells by AhR ligands................ 74 4.2.2 Cell cycle progression of confluent WB-F344 cells exposed to AhR ligands ....... 74 4.2.3 Expression of Ccna2 gene...................................................................................... 76 4.3 AhR activation in rat BP8 and 5L hepatoma cells ....................................................... 77 4.3.1 Cellular localization and ligand-induced degradation of AhR protein in rat hepatoma cells ........................................................................................................ 77 4.3.2 Expression of AhR-target genes in rat hepatoma cells .......................................... 79 4.4 Analysis of cytokinetic parameters of exponentially-growing rat hepatoma cells exposed to AhR ligands.......................................................................................... 80 4.4.1 Repression of proliferation in rat hepatoma cells exposed to AhR ligands ........... 80 4.4.2 Cell cycle analysis of rat hepatoma cells exposed to AhR ligands ........................ 81 4.4.3 Comparison of Cyclin A expression in hepatoma cells and in WB-F344 cells ..... 82 4.5 Deregulation of cell-to-cell communication ................................................................ 83 4.5.1 AhR ligands suppress expression of cadherins and catenins in confluent WB-F344 cells......................................................................................................... 83 4.5.2 Comparison of expression profiles of adhesive molecules in rat hepatoma cells and in WB-F344 cells.............................................................................................. 88 4.5.3 Effect of EGF-induced proliferation on β-catenin expression ............................... 89 4.6 Alternative approaches for studying AhR function...................................................... 90 4.6.1 AhR-specific siRNA .............................................................................................. 90 4.6.1.1 The role of AhR in TCDD effects on PKG expression in WB-F344 cells ... 91 4.6.1.2 Role of AhR in the effects of 3M4NF on WB-F344 cells ............................ 91

-ii-

Contents 4.6.2 AhR-specific shRNA.............................................................................................. 94 4.6.2.1 Design of shRNAs targeted against rat AhR mRNA and their cloning into the expression vector- pENTR/H1/TO.......................................................... 94 4.6.2.2 Transient transfection of confluent WB-F344 cells with shRNA constructs 96 4.6.3 AhR dominant-negative mutants............................................................................ 97 4.6.4 ARNT dominant negative mutants......................................................................... 98 5 DISCUSSION .................................................................................................................. 102 6 SUMMARY ................................................................................................................ - 115 7 SHRNUTÍ......................................................................................................................... 117 8 REFERENCES............................................................................................................ - 119 9 PUBLICATIONS ........................................................................................................ - 143 10 List of ABBREVIATIONS ....................................................................................... - 146 -

-iii-

1. Introduction 1

INTRODUCTION Regulation of cell proliferation and intercellular communication play an essential role in

the maintenance of liver homeostasis. Various toxic compounds have been shown to interfere with liver function, including many persistent and no-persistent organic pollutants. A number of these compounds have been found to induce liver tumors in laboratory animals, thus making liver chemical carcinogenesis a very useful model for experimental studies on tumor development. This introduction is intended to provide a basic overview of cellular models and mechanisms, which were used to study impact of model aryl hydrocarbon receptor (AhR) ligands on cellular proliferation in liver cells, especially in model liver progenitor cell line. 1.1

Liver - structure and function The liver plays a key role in metabolism of nutrients and various xenobiotics, such as

food additives, drugs or enviromental pollutants. It is the largest gland in human body, harbouring important processes associated with e.g. regulation of carbohydrate, lipid, amino acid and hormone metabolism, the synthesis and degradation of plasma proteins, the storage of vitamins and metals, the secretion of bile and finally with xenobiotics metabolism [11-13]. The human liver primarily consists of two lobes and many lobules containg hepatocytes, blood sinusoids and bile ducts (see Fig.1). Each lobule is passed through by central hepatic vein and surrounded with hepatic artery and portal vein, which faciliates a tight communication between liver and both vascular and lymphatic system. 1.1.1

Liver cells The principal cellular population found in liver are hepatocytes, the parenchymal diploid

or polyploid cells. Based on their localization in lobule, hepatocytes can be divided among periportal and perivenous cells, which differ in their metabolic activity, amount of specific intracellular organels and a spectrum of other liver cell populations located in their close vicinity [11,12]. Hepatocytes actively participate in the metabolism of proteins, glycides, lipids, metals and vitamins, as well as in the processes of excretion, detoxification and energy storage. Moreover, hepatocytes may also excrete various

-4-

1. Introduction

Fig.1 - Structure of the liver. Detailed views of hepatic lobules with depicted compartments of vascular and biliary system and cell types found in liver. (scheme assumed according to Encyclopaedia Britannica, Inc.; www.britannica.com) mediators acting in paracrine interactions, which may affect functions and communication with distant nonparenchymal cells. As described above, liver are interlaced by blood sinusoids, which represent a source of other cell populations essential for liver functions. Endothelial cells represent the major cell population found in sinusoids and they mediate communication between hepatocytes and inner space of sinusoids, as well as prevent patogen infiltration into the liver parenchyma [12]. Moreover, the wall of blood sinusoids is also lined with mononuclear phagocytes (Kupffer cells), hepatic stellate cells and pit cells. Kuppfer cells are liver macrophages activated by gut-derived bacterial endotoxins, which are characterized by high phagocytic, endocytic and secretory activities, important also for paracrine interactions between hepatocytes and hepatic stellate cells (HSCs) [12]. HSCs, also known as Ito cells, possess many functions, including e.g. vitamin A and lipid storage. Upon liver damage, these cells participate in initiation and progression of liver fibrosis and thus may contribute to the development of liver cancer [12]. Lymphocytes are also distributed in liver tissue with yet another cell polulation, so-called pit cells, which have characteristic features of natural killer cells (NK) and thus exert cytotoxic activity against tumor cells [12]. Furthermore, all cell populations located within sinusoids also contribute to exchange of metabolites between -5-

1. Introduction plasma and hepatocytes, degradation of undesirable particles, such as microbial agens or cellular debris, and regulation of blood flow. They also show spontaneous cytotoxicity targeted towards virus-modiffied hepatocytes, thus helping to maintain liver integrity and homeostasis [11,13]. The biliary and gall bladder system consists mostly of epithelial cells and it mediates excretion of metabolic waste products into the intestine [11-13]. 1.1.2

Liver regeneration As the liver is a target of numerous toxic compounds and infectious agens, it has a

remarkable capacity of self-renewal, or liver regeneration. The cellular sources of liver regeneration often depend on the nature of insult. Although hepatocytes are highly differentiated non-proliferating cells, after partial hepatectomy (PH), or acute chemical injury by carbon tetrachloride (CCl4) or dimethylnitrosamine (DEN), they may undergo multiple changes leading to their massive proliferation, thus restoring original liver mass [14]. Furthermore, even when the proliferation of hepatocytes is blocked by chemicals like Dgalactosamin (GalN), alkaloid retrorsine (RET) or 2-acetylaminofluorene (AAF) [15,16], liver still keeps its regenerative capacity, which is thought to be allowed by adult liver ´stemlike´ cells. These so-called oval cells are located in Hering canals, the area where the biliary ductular system is connected with hepatocytes [17,18]. Oval cells represent the progeny of adult liver stem cells, with a potency to generate hepatocytes, bile duct cells and other cell types (Fig.3). This transit amplifying compartment of precursor (oval) cells is hardly detectable in normal rat liver [2,19,20]. Another sub-population that might contribute to liver regeneration are so-called small hepatocytes, a type of precursor cells identified in the RET/PH model of liver regeneration. These cells were found in the oval cells-free nodules localised arround hepatocytes and they are able to effectively compensate for the loss of hepatocytes. The established models leading to oval cells proliferation include choline deficient/ethionine containg diets (CDE), PH combined with GalN, AAF or CCl4, and they are all being put to effective use, when processes of liver regeneration are studied [2,14,21].

-6-

1. Introduction

Fig.2 - Cell differentiation in liver development. During the third week of gestation fetal hepatoblasts differentiate into hepatocytes and biliary epithelium. Adult liver keeps regenerative ability both due to the presence of ’adult stem cells’ located in Hering canals and proliferative capacity of mature hepatocytes (scheme modified according to [2]).

1.1.3

Xenobiotics and liver metabolism Liver plays a key role in xenobiotic metabolism facilitating excretion of chemicals from

body. However, detoxification processes may be also accompanied with increased toxicity of reactive metabolites. This is for example the case of activation of procarcinogens to

-7-

1. Introduction carcinogens, where more reactive diols, quinones and/or epoxides are produced during the promutagen metabolism thus leading to generation of e.g. DNA adducts and/or oxygen species-related genotoxic stress [22]. Drugs, food additives or numerous environmental pollutants are xenobiotics daily ingested with food, inhaled or absorbed through skin, thus leading to exposure of various body organs to their toxic metabolites. Xenobiotics enter the cells by either passive or protein-assisted membrane transport and they are metabolised by 2 principal groups of enzymes [23,24]: i) phase I enzymes, catalyzing reactions of hydroxylation, deamination, dehalogenation, epoxidation or peroxidation, which include monooxygenases, such as of cytochrome P450 (CYP) enzymes; and ii) phase II (also called conjugation phase) enzymes, which catalyze conjugation of phase I metabolites with the donors like uridine diphosphate (UDP)-glucuronate (glucuronosylation), adenosine-3´phosphate-5´-phosphosulfate (PAPS) (sulfatation) or glutathione, thus creating water-soluble complexes, which are more efficiently excreted from the body [23].

RH + O2 + NADPH + H+ → R-OH + H2O + NADP+ Fig. 3 - General chemical reaction catalyzed by cytochromes P450. RH represent xenobiotic or endogenous compounds like hormones, O2 and nicotineamide adenine dinucleotide phosphate (NADP) represent oxidant or reductant respectively.

Activities of detoxification enzymes depend on many factors, such as age, gender, genetic factors/polymorphisms, or by previous exposure to various chemicals thus resulting in drug or toxic response individuality [3,25,26]. 1.1.3.1 Cytochrome P450 enzymes CYPs are involved not only in xenobiotic metabolism but also in regulation of synthesis and metabolism of numerous steroids, biogenic amines, vitamin D3 or in various steps of metabolism of cholesterol, bile acids, retinoic acid (RA) or eicosanoids [23]. Nevertheless, enzymes of cytochrome P450 also play a key role in metabolic activation of procarcinogens and their activation to carcinogens able to induce DNA mutations or contribute to tumor promotion [23]. Therefore, mutations in CYP genes or deregulation of cytochrome-associated signaling pathways may participate in carcinogenesis and development of multiple disorders -8-

1. Introduction in organs such as liver or lung [27]. In mammals, genes encoding various CYPs can be groupped into 18 families (CYP1-18; http://drnelson.utmem.edu/CytochromeP450.html). The spectrum of CYP inducers is very broad (see Table 1) and the functions of CYP enzymes are diverse and commonly overlapping. 1.1.3.1.1 CYP1 family CYP1 family comprises of three currently described subfamilies - CYP1A, CYP1B and CYP1C. Members of CYP1A subfamily, like CYP1A1 and CYP1A2, as well as CYP1B1, the only member of CYP1B subfamily, are characterised by more then 40% protein sequence similarity and by induction of their gene expression being controlled principally by transcription factor aryl hydrocarbon receptor (AhR; see chapter 1.4.1). However, not only AhR ligands such as various polyaromatic hydrocarbons (PAHs), polyhalogenated hydrocarbons (HAHs) like polychlorinated biphenyls (PCBs), 2,3,7,8-tetrachlorodibenzo-pdioxin (TCDD) or AAF are known to induce CYP1A1 or 1B1. Various drugs and heterocyclic compounds have been also reported to be able to induce members of CYP1 family, such as CYP1A2 [23]. However, the regulation of CYP1A subfamily expression is mediated not only by AhR, but also by other nuclear receptors, such as retinoic acid receptors (RAR) or retinoic X receptors (RXR) [28]. Recently, a third CYP1 subfamily, CYP1C, has been found in teleost fish. Its members include CYP1C1 and CYP1C2, and their expression can be also regulated by AhR, which seems to be important both for liver metabolism and during development [29,30]. Enzymes belonging to CYP1 family have been shown to catalyze activation of procarcinogens by hydroxylation of PAHs and N-oxidation of aromatic amines [22]. Cyp1a1-/-, Cyp1a2-/- and Cyp1b1-/- knockout mice are viable, fertile and show different phenotypes both in vivo and in vitro [31]. In vitro assays have revealed a key role of CYP1A1 in benzo[a]pyrene (B[a]P) metabolism, where this cytochrome was found to catalyze formation of reactive B[a]P metabolites, which form adducts with DNA. In a similar manner, CYP1A2 activates food promutagen 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) to potent mutagen [23]. However, Cyp1a1-/- and Cyp1a2-/- animals were reported to response to food mutagens and various carcinogens in a different way then expected; gene inactivation of both enzymes led to increased number of e.g. DNA-adducts formation, more rapid carcinogenesis and immunosupressive effects than in wild type animals [23,31]. Contrary to that, exposure of Cyp1b1-/- mice to carcinogens results in a decrease of tumorigenic potential of tested compounds, when compared to wild type animals as expected,

-9-

1. Introduction thus indicating the important role of this enzyme in xenobiotic metabolism [23,32]. As a possible explanation of this paradox it has been suggested that although the tissue expression profiles of individual CYPs are different, their functions may affect each other in vivo. Moreover, the connection of phase I enzymes to phase II enzymes machinery found in vivo might be abolished in cell culture systems. Therefore, the interpretation of in vitro data could be inappropriate for in vivo studies results. Altogether, CYPs which effects seem to be harmful in vitro, might actually be beneficial and protect living organisms against toxic injury [23,32]. 1.1.4

Molecular mechanisms of xenobiotic metabolism regulation Tab. 1 - Cytochrome P450 Inducers. Left part of table depicts general groups of exogenous chemicals inducing cytochrome P450 expression. Right part of panel depicts reported groups of endogenous ligands of specific xenosensors (a modified table based on [3]).

Activation of specific ligand-dependent transcription factors, generally known as xenosensors (XR), regulates expression of enzymes involved in xenobiotic metabolism [33]. The most important receptors involved in xenobiotic metabolism are aryl hydrocarbon receptor (AhR), constitutive active/androstane receptor (CAR), pregnane X receptor (PXR), nuclear factor-E2 p45-related factor 2 (Nrf2), glucocorticoid receptor (GR) and peroxisome proliferator-activate receptors (PPAR α/γ), which all recognize specific DNA response elements (RE) in target genes [34,35]. However, other nuclear receptors like farnesoid receptor (FXR), hepatocytes nuclear factors (HNFs), liver X receptors (LXRs), known as orphan receptors, seem to play also a significant role in regulation of detoxification enzymes [23,34]. CAR, PXR and other nuclear receptors possess a conserved zinc finger DNA-binding domain (DBD) and ligand binding domain (LBD), while AhR binds DNA by basic helixloop-helix motif (bHLH) (see chapter 1.4.1) [36,37]. In addition, xenosensors generally also possess dimerization or protein-protein interaction domains and transactivation or

-10-

1. Introduction transrepression domains (TAD/ TRD). After recognition of specific RE, preferentially located within enhancer regions, receptors associate with coreceptors (coactivators or corepressors), mediators (e.g. mediator subunit 220, Med220), chromatin remodelling complexes (e.g. Brahma related protein 1, Brg-1) and general transcription factors (e.g. TATA- binding protein, TBP), thereby forming multiprotein complexes with the capacity to relax chromatin structure in the case of transcriptional activation, or to induce specific histone posttranslational modifications resulting in repression of gene expression. Histone acetyltransferases (HAT) (p300, cyclic adenosine monophosphate [cAMP] response elements binding [CREB]-binding protein (CBP), members of p160 family), non-HAT proteins (PPARγ-coactivator-1α, PGC1α) or histone methyltransferases (HMT) represent some of the coactivators, which, together with corepressors (e.g. nuclear receptor corepressor, NCoR; silencing mediator for retinoic acid and thyroid hormone receptor, SMRT), participate in multiple signaling pathways and also in regulation of xenobiotic metabolism [38,39]. A typical feature of CAR, AhR, PPARγ or PXR signaling pathways is a substantial substrate promiscuity, generally resulting in their mutual crosstalk and also in crosstalks with other signaling pathways driven by other nuclear receptors (e.g. estrogen recetor (ER), vitamin D receptor (VDR), retinoic acid receptors (RAR/RXR), thyroid receptor (TR) or hypoxiainducible factor (HIF) [33,40]. Potential crosstalks can be mediated by e.g. competition for shared coreceptors or mediators (e.g. receptor-interacting protein 140, RIP140). This situtation is further complicated by the fact that numerous endogenous ligands activate XRs. For example, PPARγ, mainly expressed in adipose tissue, can be activated by polyunsaturated fatty

acids

(PUFAs),

various

leucotriens

(LTs),

eicosanoids

and

nonsteroidal

antiinflammatory drugs (NSAIDs) [41]. As mentioned above, PPARγ may heterodimerize with e.g. RXR to repress expression of ER-target gene vitellogenin [42]. CAR, mainly expressed in liver and kidney, was reported to act in phenobarbital (PB), androstane or thyroid hormone metabolism [43] and similar to PXR, it may regulate induction of phase I or II xenobiotic metabolism of either endogenous steroids and fatty acids or exogenous chemical compounds [35,44]. 1.2

Etiology of HCC Despite its capacity for regenerative growth and detoxification processes, the liver is a

target organ for damage induced by toxins or various biological agens. Alcohol, hepatitis viruses, chronic inflammation, drugs and genetic or congenital predispositions are the main -11-

1. Introduction factors in development and progression of various liver diseases including acute liver failure, viral hepatitis, cirrhosis, steatosis or fibrosis [13]. Many of these diseases predispose to development of hepatocellular carcinoma (HCC), which is one of the commnon cancers worldwide, mainly associated with hepatitis viral infection or cirrhosis. With regard to the large array of factors contributing to HCC development, there are many molecular pathways and cell mechanisms modified during the liver carcinogesis [45-47]. Besides the direct effects of viral proteins (HBx), chromosome instability (deletion and insertion of provirus) and frequent mutations, epigenetic changes, in/activation of various endogenous genes (e.g. cyclin A or retinoic acid β-receptor) and deregulation of expression of genes involved in cell proliferation (Wnt/β-catenin, NFκB, AP-1), differentiation (E-cadherin) or survival (p53, XAP1) of liver cells have been all proposed as principle mechanisms involved in hepatitis B virus (HBV)-induced HCC. A well-known liver carcinogen is aflatoxin B1 (AFNB1), executing its tumor effects by e.g. direct attack of DNA molecule and/or by inactivation of gene expressing p53 protein, a tumor supressor essential for

DNA repair and proper

regulation of cell cycle [48,49]. However, although HCC pathogenesis is intensively studied, as in the case of AFNB1 effects on DNA adducts formation and tumor initiation, the molecular mechanisms underlying etiology of HCC are still rather poorly understood, especially considering the possible role of xenobiotics in liver carcinogenesis. 1.3

Experimental liver models and cell lines In past, several models have been developed to study liver carcinogenesis both in vivo

and in vitro. Generally, carcinogenesis is a multistage process consisting of initiation, promotion and progression; thus, it is necessary to study specifities of these levels both separately and also in context with each other [50]. Commonly used animal models are rats (e.g. Sprague-Dawley, LEC, Sherman, Wistar, Fischer 344) and mice (BALB/cJ, C3H, Swiss) in both wild type or mutant variants. In addition to in vivo models, a number of in vitro models of hepatocytes, oval cells or cholanigocytes are being used, either derived from healthy (primary hepatocytes, WB-F344 cells, HBC-3, H-CFU-C, met murine hepatocytes, bipotential mouse embryonic liver cells, rhe14321, BMEL, OC15-5, LE/2, LE/6, PIL-2 or BMOL cells) or tumor (HepG2, Hepa1c1c7, H4IIE cells) liver tissues of human, mouse or rat origin [51-54].

-12-

1. Introduction 1.3.1

WB-F344 cells WB-F344 cells, a well-characterized model of oval progenitor cells, were isolated from

the liver of adult male Fischer 344 rat and represent a powerfull tool in elucidating the role of progenitor cells not only in liver regenerative capacity, but also in liver carcinogenesis. These cells have been reported to differentiate into hepatocytes [55,56], cells of biliary lineage [57], and suprisingly also into mature cardiac myocytes [19], thus confirming their pluripotency. Under conditions of in vitro cultivation, they form contact-inhibited cell monolayers (see chapter 1.3.1.1), and after inoculation they show no tumorigenic activity in Fischer 344 rats [54]. Interestingly, chemically-transformed WB-F344 cells have been shown to induce liver or other tissue tumors after transplantation [58]. Furthermore, chronic maintenance of WBF344 cells in a confluent state in vitro or in a presence of tumor growth factor β1 (TGFβ1) [59] has been reported to induce their spontaneous neoplastic transformation, accompanied with a loss of contact inhibition [60]. Exposure of confluent WB-F344 cells to HGF [61], various polyaromatic hydrocarbons, TCDD or PCBs [62-66], have been reported to release these cells from contact inhibition and to induce proliferation and cell cycle progression, possibly reflecting tumor promoting effects of these compounds. 1.3.1.1 Contact inhibition and cell confluency Contact inhibition is a cell density-dependent phenomenon, which is observed in a majority of nontransformed cells, where the formation of cell monolayer in conditions of in vitro cultivation leads to cell cycle arrest. There are many hypotheses trying to explain the mechanisms leading to the inhibition of cell proliferation and accumulation of these cells in G0/G1 phases of cell cycle upon reaching cell confluency: i) establishment of cell-cell contacts [67]; ii) serum deprivation [68]; iii) additional emergence of factors in sera or cultivation media [69] or iv) redox signaling mechanisms [70]. The first hypothesis seems to be the most prevalent, based on numerous studies investigating the roles of adherens junctions and associated proteins, especially cadherins, catenins or nonreceptor tyrosine protein kinases (see the chapter 1.5) or describing the novel one, such as contactinhibin, which is suspected to have a specific growth inhibitory capacity [67,71]. In contrast with a simple inhibiton of cell growth, the contact inhibition is a tightly regulated process, which is active throughout the embryonic development and it is supposed to be constantly active in some adult tissues, in

-13-

1. Introduction order to prevent abnormal cell proliferation, which may be associated with tumor formation [72]. 1.3.2

BP8 and 5L cells As mentioned above, contact inhibition is one of the key processes deregulated in

transformed cells during carcinogenesis, as in the case of liver cancer development [73]. 5L and BP8 cells are dedifferentiated variants of rat hepatoma cells derived during induced differentiation of Reuber rat hepatoma H4IIEC3 cells [74]. Both cell lines represent various clones of the same stage in hepatocarcinogenesis development and they differ in presence (5L) or absence (BP8) of AhR protein. 5L cells respond to TCDD exposure by growth inhibition and enlargement of cells [75], while BP8 cells (named after B[a]P medium selection) have been reported to show no TCDD-induced responses on cell proliferation or cell cycle progression [76]. Thus, these cell lines represent suitable model of rat hepatoma cells in experiments, where effects of various chemical compounds are studied with respect to involvement of AhR signaling pathway. 1.4

bHLH/PAS transcription factors family

AhR, AhR nuclear translocator (ARNT), hypoxia inducible factor (HIF), single-minded protein (SIM) and AhR repressor (AhRR) are members of basic helix-loop-helix/ period-ArntSim (bHLH/PAS) family of trancription factors, which play essential roles in regulation of xenobiotic metabolism (see chapter 1.1.4), oxygen sensing, periodicity of circadian rythms or nervous system development [5]. These transcription factors form dimers with other family members, e.g. HIF1α heterodimerizes with partner protein HIF1β (also called ARNT or Tango) [77]. This specific dimerization process is mediated by PAS domains with high sequence homology [78]. Other characteristic feature of this family is the presence of bHLH structural motif necessary for DNA binding in E-box regions conservatively located in target gene enhancers [5]. Depending on their ability to form either homo- or heterodimers, members of bHLH/PAS transcription factor family can be divided into class I or II PAS proteins (see Fig. 4). Proteins belonging to class I, e.g. AhR, SIM and HIF1α, have never been reported to dimerize with other proteins in this class, but they form dimers only with class II proteins, such as ARNT or brain and muscle Arnt-like protein (BMAL). Contrary to that, class II proteins have been observed to form not only heterodimers but also homodimers.

-14-

1. Introduction Their biological importance is supported by observed lethality or low viability of their gene knockouts [5]. 1.4.1

Aryl hydrocarbon receptor (AhR) Aryl hydrocarbon receptor (also called dioxin receptor; DR) is an evolutionary

conservative [79] ligand-activated transcriptional factor expressed in a large number of mammalian tissues (especially in kidney, liver, placenta, lung or heart), which has been originally described as a potential celullar target mediating toxic responses in cells exposed to various enviromental pollutants, especially to polychlorinated dibenzo-p-dioxins [80,81]. However, further intensive studies in mouse, rat, Drosophila, Caenorhabditis or zebrafish models, have revealed numerous different activities, by which AhR may participate in various physiological processes, such as development [82-84], liver regeneration [85,86],

Fig. 4 - Classification of bHLH/PAS family members. bHLH/PAS family proteins possess distinct domains depicted in the figure by various colors. Dark green boxes represent basic helix-loop-helix domain, which are necessary for protein binding to DNA in E-box regions. Orange and yellow boxes represent A or B parts of PAS domain responsible for protein-protein interaction or ligand binding. Blue boxes represent transactivation domain (TAD), which participate in activation of transcription. Grey boxes represent transrepression

-15-

1. Introduction odontogenesis [87], neuronal development [88] or endocrine disruption [89,90]. Moreover, AhR has been reported to play a pivotal role in oxidative stress responses, cell cycle regulation, apoptosis control and in tumorigenesis of some tissues [91-94] (see chapters 1.4.1.2, 1.4.1.3). Expression level of AhR is tissue-specific and it can be modulated by various endogenous and exogenous factors (differentiation, senescence, aging or cellular stress, xenobiotics, 12-O-tetradecanoylphorbol-13-acetate [TPA]), thus contributing to tissue or cell lines sensitivity to e.g. TPA or TCDD exposure [95,96]. AhR-/- mice are viable, fertile and non-responsible for some xenobiotics like benzo[a]pyrene (BaP), however, they display multiple defects in liver growth and development (e.g. decreased liver size, prolonged period of haematopoiesis, deficit in metabolic activity, portal fibrosis, hypercellularity), spleen development [83,97-99] and vascular system development [84]. Besides knockout animals, mutants with constitutively active AhR (CA-AhR) have been also very helpful for elucidation of the role of this receptor in carcinogenesis, revealing possible oncogenic potential of AhR [100,101]. Nevertheless, an impressive amount of articles reporting AhR-mediated toxicity of enviromental pollutants have been published and it still represents the major part of both past and present AhR research (see chapters 1.4.1.2). 1.4.1.1 AhR signaling pathway The current model of AhR signaling suggests, that unliganded AhR is localized in cytoplasm in a complex with chaperone heat shock protein 90 (hsp90), immunophilin-like hepatitis B virus X-associated protein (XAP2; also termed as ARA9-AhR activated protein 9 or AIP-AhR interacting protein) and hsp90-interacting protein p23 [102,103]. Nonreceptor tyrosinekinases c-Src could be probably also an internal part of this cytoplasmic complex [104]. Crucial component of this complex is dimer of Hsp90 chaperon, which binds to ligandbinding PAS B and bHLH AhR-domains, thereby mediating AhR/XAP2 interaction, retention of high-affinity ligand binding conformation and nuclear translocation mediated by association with import proteins [105,106]. Furthermore, Hsp90 phosphorylation status modulates formation and stability of cytosolic complex and AhR-transactivation activity [107], and it is suspected to effectively mask nuclear localization sequence, thus contributing to inhibition of AhR nuclear translocation and formation of stable cytosolic AhR-hsp90 interactions necessary for AhR protection against proteasome degradation [108] (see chapter 1.4.1.1.1). Co-chaperon p23 has been reported to stabilize interaction of various receptors

-16-

1. Introduction

Fig. 5 - AhR signaling pathway. AhR binding of endogenous or exogenous ligands leads to cytosolic complex dissociation, ARNT heterodimerization and AhR/ARNT– mediated regulation of target gene expression in positive or negative manner, and receptor degradation mediated by 26S proteasome machinery. Abbreviations - hsp90, chaperone 90; p23, co-chaperone protein 23; XAP1, immunophilin-like hepatitis B virus X-associated protein 1; AhR, aryl hydrocarbon receptor; ARNT, AhR nuclear translocator; DRE, dioxin responsive elements; TF, transcription factors; C, coactivators; M, mediators; ARC, ATPase chromatin remmodeling complexes; GTFs, general transcription factors; Pol II, RNA polymerase II; AhRR- AhR repressor

-17-

1. Introduction with hsp90, including e.g. glucocorticoid receptor (GR) [109] or AhR [103], and thus contribute to ligand binding. XAP2 protein has been reported to play a possible role in AhR turnover [110], intracellular localization of AhR by blocking its nuclear localization sequence (NLS) for importin binding [111], and as a protector of AhR ligand-free form against ubiquitinization [112]. After ligand binding to PAS B domain, AhR cytosolic complex undergoes undefined conformational changes resulting in NLS unmasking, AhR dissociation and translocation to the nucleus and its heterodimerization with protein partner ARNT. Cell-cell interactions have been also reported to regulate AhR localization depending on cell density, for example in HaCaT cells [113] (see chapter 1.4.1.1.3). Nevertheless, ligand-binding alone is not sufficient for AhR translocation and moreover, it is not necessary for AhR-mediated transcriptional activity [114]. The use of several specific kinase inhibitors has also suggested an important role of phosphorylation in activation of AhR-dependent signaling pathways [115,116]. Nuclear AhR/ARNT complex recognizes specific dioxin responsive elements/ xenobiotic responsive elements (DRE/XRE), with core sequence motif 5´-TNGCGTG-3´ being located in the enhancer and/or promoter regions of AhR target genes [117,118]. The exact mechanism of this process is still rather unclear and several hypotheses have suggested that it might depend on oxidation and phosphorylation status of AhR, ARNT or AhR/ARNT complex, probably mediated by protein kinase C (PKC) [118-120] and intramolecular crosstalk between bHLH and PAS A domains of AhR receptor [121]. Once bound to specific DRE, the AhR/ARNT complex recruits: i) coactivators with HAT activity like p300, CBP, steroid receptor coactivator 1 (SRC-1), nuclear coactivator 2 or 4 (NCoA2 or NCoA4), p300/CBP cointegrator protein (p/CIP), non-HAT coactivators like RIP140 or GRIP1 associated coactivator 63 (GAC63), coactivators with HMT activity like cofactor-associated arginine R methyltransferase (CARM1) or protein arginine R transferase (PRMT1) [39,122-124]; ii) mediators like Med220 [125]; iii) transcription factors like nuclear factor 1 (NF-1), Sp1 and general transcription factors like RNA polymerase II (Pol II), TBP, transcription factors IIB or IIF (TFIIB/ TFIIF) [126]; iv) histone deacetylases (HDAC)recruiting corepressors like SMRT [124]; v) ATPase-dependent chromatin remodelling complexes like Brahma-related protein 1 (Brg-1), [127]. The histone modification pattern, presence or absence of coactivators or corepressors, and global activity of multiprotein complexes formed on promoters all determine transactivation or transrepression of AhR target genes. The most studied AhR target gene, Cyp1a1, has been used in a number of studies as a model AhR reporter [128]. However, induction of Cyp1a1 expression is not always a specific -18-

1. Introduction marker of AhR activation [28,129]. Several non-AhR ligands, such as benzimidazoles, carbamates or aminoquinoline, or hyperoxia have been shown to induce Cyp1a1 expression [28,129]. Regarding the multiple roles of AhR (see chapter 1.4.1.), there are many other genes regulated by AhR. These include both genes involved in xenobiotic metabolism (Cyp1b1, Cyp1a2, Ugt1a1, Ugt1a6, Nqo1, Nrf2, Aldh3a1) [130] and genes controlling cell proliferation, differentiation, senescence, apoptosis or other physiological processes (AhRR, p27KIP1, p21CIP1, c-jun, junD, Hes-1, IL-2, Bax) [131]. Numerous other possible AhR-target genes containing conserved DREs in their 5´ upstream regions, have been predicted based on the results of microarray studies performed with human, mouse and rat cellular models, although little is known about their function [132-134]. During the presence of a ligand, AhR affects target gene expression in either positive or negative manner, undergoes incomplete degradation and AhRR-mediated regulation (see chapter 1.4.1.1.2.). The metabolization of AhR ligand then results in inhibition of AhR transactivation acitivity, its dissociation from AhR/ARNT complex, AhR nuclear export (see chapter 1.4.1.1.3) and restoration of AhR-cytosolic complex [130]. 1.4.1.1.1 AhR degradation Ligand-binding studies using mouse hepatoma (Hepa1c1c7), rat hepatoma (H4IIEC) and other cell lines [135,136] exposed to various AhR-ligands, e.g. TCDD or β-naphthoflavone (BNF) (see chapters 1.4.1.2.2.1 and 1.4.1.2.2.3.1), revealed an interesting phenomenon - the decrease in AhR total protein level as a potential feedback mechanism regulating AhR response [137]. The time interval of observed AhR depletion seems to depend on ligand stability and its metabolism rate. This event is not AhR-specific, but it follows previously described general mechanisms involved in transcriptional regulation [138]. The experiments with inhibitors of transcription and translation have revealed involvement of both transcription and translation processes in the observed decrease of AhR protein [139,140], which is in most cases incomplete (50-95% AhR degradation) [136,141]. The mechanism of AhR downregulation was elucidated by series of experiments with 26S proteasome specific inhibitor MG132 and other protease inhibitors, inhibitors of hsp90 (geldanamycin), nuclear export (leptomycin B) and NLS-mutants, which revealed a crucial role of ubiquitinization, 26S proteasome and hsp90 in AhR degradation, probably occurring in cytoplasm [108,136,142]. The nuclear localization of AhR, binding with ARNT or DNA are not required for AhR degradation [143]. Nevertheless, there is no direct evidence against the possibility of

-19-

1. Introduction nuclear AhR degradation, especially when nuclear localization of various enzymes acting in ubiquitin degradation machinery has been confirmed [136]. 1.4.1.1.2 Negative feedback in AhR signaling – the role of AhR repressor Aryl hydrocarbon receptor repressor (AhRR) is one of the AhR target genes, which might play an inhibitory role in regulation of AhR signaling [144 ]. Although its N-terminal sequence with bHLH and PAS A domains is highly similar to AhR, there are some notable differences (namely modified PAS A domain and absence of TAD or PAS B/LBD) within the C-terminal part of protein (see Fig.4). AhRR has been reported to dimerize with both AhR and ARNT, but in contrast to AhR, AhRR forms stable dimers with ARNT capable to bind XRE in a ligand-independent manner. Another difference between AhR and AhRR is the constitutive nuclear localization of AhRR. Presumably, AhRR functions as a competitive repressor of AhR and acts probably in two manners: i) by competing with AhR for ARNT binding; and/or ii) by competing of AhRR/ARNT complex with AhR/ARNT complex for XRE-binding [145]. Therefore, AhRR could be unique tool for modulation of AhR action in various signaling pathways (see chapter 1.4.1.4). The tissue-specific expression of AhRR might be one of the possible modulators playing an important role in prediction of tissue sensitivity to e.g. TCDD exposure [146,147]. 1.4.1.1.3 Nuclear export of AhR and the role of cell density It has been suggested that cell density, rather than cell cycle, regulates cellular localization of AhR. Experiments with HaCaT cells have shown that cell density status and cell-to-cell communication might be involved in AhR nuclear export signaling. In sparsely growing cells, AhR is predominantly localized in nucleus, while in semiconfluent cells AhR can be found both in cytoplasm and nucleus. In confluent HaCaT cells AhR is primarily localized in cytoplasm, with no transactivation capacity, as measured by reporter gene assay [113]. Binding of an endogenous ligand and activation of AhR during the cell growing phase might explain the changes in AhR cellular localization. Therefore, the mechanisms driving the AhR cellular localization in exogenous ligand-exposed confluent cells seem to be similar to growing cells, but regulated by other mechanisms than cell density. An important component of AhR nuclear export is nuclear export sequence (NES) localized in N-terminal part of

-20-

1. Introduction receptor near NLS. It has been reported that, like in case of nuclear import, phosphorylation of NES may regulate nuclear export [148,149]. 1.4.1.2 AhR ligands As the structure of AhR ligand binding domain (LBD) is not known, a computer model has been proposed, based on published PAS B domain structures of protein homologues like HIF-2α. This model of LBD has suggested that AhR promiscuity in binding of structurally diverse ligands might depend on several hypothetical amino acid residues, which was later tested in rat, mouse or human hepatoma cell lines [150-153]. Other chemical models based on thermodynamic or molecular electrostatic potentials were also used in effort to explain the binding properties of various AhR ligands [150,154]. However, prediction of AhR LBD structure is complicated by tissue and species differences in AhR transactivation capacity and by variability of ligand binding affinity [155,156]. Moreover, ligand binding itself is not sufficient for AhR activation, thus indicating importance of e.g. specific ligand stucture in this process. AhR agonists were shown to induce conformational changes in AhR protein, while antagonistic ligands-binding to LBD domain do not induce structural alternation of AhR molecule, which might be necessary for AhR activation and nuclear translocation, and futhermore, they block LBD from binding to other ligands [114,157]. The N-terminal half of AhR containing bHLH domain seems to be conserved in animals, while the C-terminal part of molecule containing transactivation domain (TAD) seems to be degenerated and polymorphic, and it might play a role in both cellular localization of AhR and in ligand binding affinity [158,159]. The majority of best known AhR ligands are exogenous chemicals, while little is known about endogenous AhR ligands. The most studied AhR ligands include some well-known toxicants, such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or benzo[a]pyrene (B[a]P), both suspected to be human carcinogens. Besides the wide group of toxic polyaromatic compounds, natural dietary constituents, like flavonoids and carotenoids, or some clinical drugs are the best known AhR ligands [160,161]. 1.4.1.2.1 Endogenous AhR ligands The existence of hypothetical endogenous AhR ligand is supported e.g. by observation of AhR nuclear localization being independent of the presence of exogenous ligand or by ligand-independent role of AhR in cell cycle regulation (see chapter 1.4.1.3). Regarding the -21-

1. Introduction substrate promiscuity of LBD, many endogenous physiological chemicals like indoles [162,163], arachidonic acid (AA) metabolites [164,165], tetrapyrroles [166], tryptophan metabolites [167], several carotenoids and retinoids [168,169], or novel AhR ligands e.g. 2(1′H-indole-3′-carbonyl)-thiazole-4-carboxylic acid (ITE) or low-density lipoprotein (LDL) [170-172] have been suggested to be endogenous AhR agonists and/or antagonists [151,160]. However, a majority of these endogenous AhR ligands seem to be rather speculative and more intensive studies seem necessary for their explicit identification and characterization. 1.4.1.2.1.1 Indirubin Indirubin, the red-coloured isomer of indigo and metabolite of tryptophan firstly described in 1855 by Schunk (see Fig.6), is suspected to be a potent AhR ligand being present in humane urine or in fetal bovine serum (FBS) (www.wikipedia.org) [173]. Its biological activities have been first reported as a part of the effects of traditional chinese herbal mixture, Danggui Longhui Wan, which is used as therapeutical agens in treatment of various form of leukaemia, especially chronic myeloid leukaemia (CML) [174]. Further investigations have revealed that indirubin may form DNA adducs and deregulate both nucleic acid and protein synthesis, which could mediate its antitumor potential [175].

Fig. 6 - Chemical structure of indirubin. During plant and mammalian tryptophan metabolism, many indigoids and indoles are generated, including indirubin, a putative endogenous AhR ligand and inhibitor of protein kinases. Indirubin analogues, e.g. indirubin-3´-monoxime, have been shown to inhibit cell proliferation and to induce apoptosis in human cancer cell lines, such as Jurkat T or MCF-7 cells [173,176,177]. When tested in yeast assays or in human hepatoma HepG2 cells, indirubin has been reported to be even more potent AhR ligand than TCDD [178]. Experiments performed in vivo confirmed the ability of indirubin to induce expression of Cyp1a1 and Cyp1a2 genes and to exhibit anti-tumor activity in both rats and humans

-22-

1. Introduction [176,179,180]. Indirubin has been also found to be a potent inhibitor of kinases, such as glycogen synthase kinase 3β (GSK-3β) or cyclin-dependent kinases (CDKs), especially CDK1 in complex with cyclin B, however these functions were shown to be AhRindependent [175]. Indirubin and its derivates could be also used in therapy of other noncancer diseases, such as Alzheimer disease or diabetes [181]. 1.4.1.2.2 Exogenous AhR ligands Exogenous ligands represent almost all known AhR ligands, with the best known model compound being 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Numerous toxic effects of dioxin led to the discovery of AhR, which has been found to be responsible for harmfull effects of many other polyaromatic compounds, including PAHs, such as benzo[a]pyrene (B[a]P), or halogenated aromatic hydrocarbons (HAHs) such as dibenzo-p-dioxins (PCDDs), dibenzofurans (PCDFs), polychlorinated biphenyls (PCBs)/ polybrominated biphenyls (PBBs) [160,182]. Some of HAHs are highly inert compounds leading to their accumulation in the environment. In contrast, PAHs are well metabolized by mammalian enzymes, thus generating even more toxic derivates with teratogenic, mutagenic or carcinogenic potential. Exposure of humans or animals to some AhR exogenous ligands has been shown to lead to cancer development as well as to some other non-cancerous diseases [182]. On the other hand, AhR is also receptor for many naturally occurring chemicals like flavonoids and other plant metabolites exhibiting anti-tumor activity and used in cancer therapy (see chapter 1.4.1.2.2.3). It is also noteworthy, that many synthetic small molecule chemical inhibitors, like p53 inhibitor pifithrin-α, ERK inhibitor U0126, inhibitor of protein glycosylation tunicamycin or Jun N-terminal kinase (JNK) inhibitor SP600125 may act as AhR ligands and inducers of expression of AhR-target genes like Cyp1a1 [183-186]. 1.4.1.2.2.1 TCDD Delerious effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on human health have been first reported during 50´s to 70´s in USA and Vietnam, when subjects working either in herbicides-producing factories or with 2,4,5-trichlorophenoxyacetic acid (2,4,5-T)-containing defoliants, such as Agent Orange, have been exposed to TCDD, which is formed as a contaminant during synthesis [187]. Another large scale accidental TCDD-contamination of humans had happened in 1976 in Seveso, Italy. It has been

-23-

1. Introduction

Fig. 7 - Chemical structure of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD).

accompanied with development of chloracne, certain types of tumors, leukemias and reproductive toxicity [188]. Based on this evidence, World Health Organization (WHO) suggested to carry out dioxin risk assessment for a more precise evaluation of TCDD impact on human health and cancer risk prediction (WHO 1998, 2001). In 1997, TCDD was classified by the International Agency for Research on Cancer (IARC) as a group 1 (compound carcinogenic to humans) carcinogen, being present in the enviroment as a consequence of imperfect combustion of organic compounds, or as a contaminant of pesticides and herbicides. Although TCDD has been suggested to act mostly as a nongenotoxic tumor promoter, there is also some evidence supporting its involvement in tumor initiation through e.g. generation of oxidative stress leading to oxidative damage of DNA. Its tumorigenic effects have been related e.g. to inhibition of apoptosis in spontaneous preneoplastic cells or to modulation of

the function and/or expression of cell surface

molecule critical for cell-cell and cell-extracellular matrix (ECM) communications during tumor invasion [188,189]. Acute and/or chronic exposure to TCDD has been reported to be accompanied with a number of toxic effects, including chloracne, thymic atrophy, loss of body weight, immune dysfuntion, hepatic damage, steatosis, gastric epithelial hyperplasia, fatty degeneration of the liver, deregulation of bile acid metabolism and oxidative stress [156,189]. TCDD has been further shown to induce neurotoxicity, immunotoxicity or teratogenicity thus contributing to complex disruption of organ homeostasis [131,156,189]. Due to its lipophilicity, TCDD may enter the cells by passive transport and accumulate preferentially in adipose tissues. Besides apoptosis modulation, dioxin affects also cell proliferation, differentiation and senescence through e.g. deregulation of hormone receptor-, growth receptor-, c-Src- and MAPK-signaling (e.g. TR, GR, EGF, TGF, ERK1/2, JNK), and it may act as a potent endocrine disruptor interfering with ER and AR signaling [190-194] (for futher details see chapters 1.4.1.3, 1.4.1.4). Almost all toxic effects of TCDD appear to be mediated by AhR, although some AhR-independent mechanisms like AP-1, MAPK or cSrc -24-

1. Introduction kinase activation have been suggested to participate in TCDD-induced expression of genes not involved in AhR transcription battery [133,195-197]. 1.4.1.2.2.1.1 The role of TCDD in mammalian hepatocarcinogenesis TCDD has been found to be carcinogenic in rodents of either sex, but preferentially in females [198]. Apart from some pathological abnormalities, including increased liver weight and

liver

hypertrophy,

hepatocyte

hypertrophy

or

bile

duct

hyperplasia,

both

cholangiocarcinoma and hepatocellular adenoma incidence have been increased in TCDDexposed female rats [198]. These studies have strongly suggested that chronic TCDD exposure is related to development of liver cancer, although this AhR agonist was shown to be non-genotoxic and thus probably not sufficient for induction of tumor initiation [199]. Hepatic/enzyme-altered foci (AHF/AEF) (early preneoplastic hepatocytes) might be formed spontaneously or after exposure of hepatocytes to genotoxic inducers and they represent a population of cells sensitive to tumor promoting activity of TCDD. A chronic TCDD consumption is accompanied with development of AEF, neoplastic nodules and HCC in female rats [200-202]. Apart from hepatocytes, liver oval cells have been proposed to represent another cellular target of TCDD and a source of initiated cells [203]. The important roles of TCDD in hepatocarcinogenesis may involve: i) suppression of apoptosis, a key mechanism involved in destruction of initiated cells; and ii) upregulation of DEN-initiated cell proliferation resulting in clonal expansion of preneoplastic nodules [199]. Regulation of proliferation and cell cycle progression in liver cells is tightly associated with modulation of cell-cell communication and contact inhibition [204]. Importantly, TCDD has been reported to release oval cells from contact inhibition and to induce proliferation of liver cells by e.g. activation of AhR signaling and deregulation of gap junction intercellular communication (GJIC) [62,205,206] (see chapters 1.4.1, 1.3.1.1). Taken together, the mechanisms of TCDD-induced development of liver cancers are complex and still far from being

understood,

although

AhR

plays

a

critical

role

in

the

TCDD-induced

hepatocarcinogenesis [199]. 1.4.1.2.2.2 Polychlorinated biphenyls (PCBs) Polychlorinated biphenyls (PCBs) had been widely manufactured and used since 1929, which has led to their global distribution [207]. Inert nature of these compounds, leading to

-25-

1. Introduction resistance to chemical and biological degradation, resulted in their worldwide accumulation, and although their production has been banned in 1970 (1984 in Czechoslovakia), PCBs still persist in our enviroment and represent human and animal health risks [207]. There are 209 possible congeners varying in the number and position of chlorine atoms, which possess different biological activities. However, PCBs had not been manufactured as single congeners, but as commercial mixtures like Aroclor, Clophen, Delor or Kanechlor.

Fig. 8 - Structure of PCBs. Figure depicts the basic structure of PCBs consisting of two biphenyl cores with indicated numbers and positions (ortho-, meta-, para-) of chlorine substitutions (scheme according to [4]).

As in the case of TCDD, the toxic effects of PCBs has been accidentally revealed as a consequence of several industrial incidents in Japan and Taiwan [208,209]. Chronic exposure of animals and humans has been shown to be accompanied with a variety of physiological defects like wasting syndrom, chloracne, edema, hepatic hypertrophy, porphyria, endocrine disruption, enhancement of inflammation, immunotoxicity, reproductive toxicity and other TCDD-like liver effects like adenofibrosis, formation of AEF, neoplastic nodules and HCC [207,210,211]. In two stage models of hepatocarcinogenesis with or without DEN, PCBs were demonstrated to act as potent tumor promoters, however some low-chlorinated congeners are probably also able to induce mutations as other genotoxic tumor initiators [207,212]. Coplanar non-ortho-substituted PCB congeners like PCB 77, PCB 81, PCB 126 or PCB 169 are AhR agonists, and these so-called dioxin-like PCBs exert many effects similar to TCDD. Mono-ortho-substituted congeners have been also shown to exhibit a weak AhR agonist activity. Nevertheless, this is generally lower than the activity of dioxin-like PCBs, and mono-ortho congeners have been also shown to induce phenobarbital-like toxic responses. Together with di-ortho-substituted congeners, they represent the most prevalent PCB congeners found either in commercial mixtures or in the environment. The non-dioxinlike PCBs, such as PCB 153, are not AhR ligands and they exert their effects through AhR-26-

1. Introduction independent mechanisms, e.g. by deregulation of cell-cell communication, activation of NFκB and AP-1 signaling, and induction of gene expression associated with liver tumorigenesis [213-215]. Like TCDD, some PCBs have been also demonstrated to directly affect cell proliferation, contact inhibition or cell cycle progression [65,216]. Both humans and animals are exposed to mixtures of PCBs and final effects of these mixtures are actually derived from mutual effects of individual congeners, which might be additive, non-additive, synergistic or antagonistic and both species- and tissue-specific [217,218]. In order to predict the effects of various PCBs mixtures and individual congeners, toxicity equivalent factors (TEFs) concept has been established, expressing toxic effects of PCBs relative to TCDD (TEFTCDD= 1). Toxic equivalents (TEQs) expressing total toxicity of PCB mixtures with respect to a given congener concentration, enable to assess the potential toxicity of complex mixtures and selected PCBs congeners in exposed humans or animals [219]. For example, a prototypical AhR TCDD-like agonist, PCB 126, has been determined to have TEF 0.1. Taken together, both position and number of chlorine substitutions in biphenyl structure are critical determinants predicting, whether a given congener will activate AhR and induce dioxin-like toxicity. 1.4.1.2.2.3 Flavonoids Flavonoids are secondary plant metabolites formed from phenylalanine, tyrosine and malonate, which are present in vegetables, fruits, seeds, nuts, grains, leaves or flowers, but also in beverages like tea, beer, juice or wine. The majority of flavonoids contains three aromatic rings (A, B, C) and differ in status of their oxidation and substitution, especially in ring C (see Table 2). Based upon their structure they can be divided into 6 classes: flavones, isoflavones, flavonols, flavanones, catechins and anthocyanidines. Alternative classifications of flavonoids (flavans, flavones, isoflavones, flavanones, isoflavanones, flavonolignans, anticyanidins and chalcones) have been also proposed, suggesting that lignans, chalcones and anthocyanidins should be separated as plant phenols [220,221] (see Tab. 2). Due to a heterogeneity of aromatic structure, flavonoids can have multiple functions. In plants, they are important for growth, development, photosynthesis, UV-B protection of epidermal cells in leaf surface, hairs or wax and they may act as colour attractants for insect-mediated pollination or as protectors against insect and mammalian herbivory. In animals, various flavonoids obtained from diet have been demonstrated to have antioxidative, antimicrobial, antiviral effects, antiatherosclerotic, antiinflammatory, antiosteoporotic and antitumor effects

-27-

1. Introduction Hollman, 1997

Hodek, 2002

Ren, 2003

flavones

flavones

flavones

isoflavones

isoflavones

isoflavones

flavanones

flavanones

flavanones

flavonols

flavonols -

anthocyanidins

anthocyanidins -

catechins

flavanols flavanonols

-

flavan

-

isoflavanone

-

chalcone

flavonolignans

-

Tab. 2 - Different classifications of flavonoids. Groups like flavones, isoflavones and flavanones are included in all three selected classifications, while e.g. flavanonols may represent a unique class of compounds. [Scheme based on [Hodek, 2002 #315; Hollman, 1997 #322; Ren, 2003 #323].]

-28-

1. Introduction beneficial for treatment and therapy of multiple diseases like cancer, cardiovascular and neurodegenerative diseases [222]. Some flavonoids have been also found to be potent inhibitors of reverse transcriptase, aromatase, tyrosin protein kinases, glucosidase II, histone acetyltransferases, DNA topoisomerases and/or CYPs [222]. With exception of catechins, dietary flavonoids may enter the body as non-absorbable saccharide complexes. Colon microbial flora is believed to digest these complexes, thus generating aglycones, free active forms of flavonoids without sugar moiety, which may pass through gut wall into blood system and liver. However, whether aglycones are better absorbed than glycosylated forms is still a matter of discussion [222]. In liver, flavonoids can be methylated or conjugated with glucuronides and sulphates and excreted in bile or urine [221]. Some of the most studied flavonoids include: genistein found in legumes (isoflavones); quercetin or kaempferol found in e.g. onions and apples (flavones/ flavonols); catechin or epigallocatechin gallate found in red wine or tea (catechins/ flavanols); hesperetin or naringenin found in citruses (flavanones) and apigenin found in parsley (flavones; see chapter 1.4.1.2.2.3.1). Flavonoids may regulate cell cycle progression or apoptosis in a cell-dependent manner, which may partially depend on their ability to bind AhR as agonists and/or antagonists [223,224]. Another important aspect of flavonoid activity is their ability to suppress negative effects of toxic AhR-ligands like TCDD. Black tea theaflavins, resveratrol and many other flavonoids have been reported to regulate AhR activity and thus protect the exposed cells from the TCDD-induced toxicity. However, these protective effects are short-term and depend on the rate of flavonoid metabolism [225,226]. Some flavonoids are considered to be “pure” AhR antagonists, e.g. epigallocatechin gallate or α-naphtoflavone (ANF). However, the ability of these compounds to antagonize AhR seem to be cell type-specific [227,228]. The structural similarity of flavonoids to physiological estrogens, their capacity to activate estrogen and aryl hydrocarbon receptor and to inhibit enzymes like aromatase (estrogen synthetase, CYP19) indicate a possible involvement of flavonoids in regulation of steroid metabolism and ER signaling pathways [229,230]. Flavonoids acting as phytoestrogens are able to interact with both types of mammalian estrogen receptors, ERα and ERβ. Their estrogenic and antiestrogenic activities depend on tissue type, concentration of physiological estrogens, degree of sexual maturity, and their capacity to act as agonist or antagonist of ER [231]. Apart from beneficial effects implemented in anti-cancer therapy, flavonoids have been also reported to be potential mutagens and inducers of oxidative stress, cell proliferation and covalent modification of proteins [232-234]. Therefore, although flavonoids may act as beneficial agens in cancer therapy, their dose-dependent effects are tissue-, species- and cell context-specific. Therefore, -29-

1. Introduction applications of these compounds in clinical practice should be cautious, similar to other xenobiotics. 1.4.1.2.2.3.1 Flavones Flavones represent a large group of flavonoids, exemplified by some well-known natural compounds, such as apigenin or chrysin. In this chapter, the main emphasis will be put on flavones studied as model ligands of AhR, such as synthetic beta-naphthoflavone (BNF) and 3´-methoxy-4´-nitroflavone (3M4NF). The ability of BNF to induce aryl hydrocarbon hydrolase (AHH) activity, later identified as activity of cytochrome P450 enzyme, have been reported already in early 70´s. [235]. Today, BNF is used as a model AhR agonist, a potent inducer of xenobiotic metabolizing enzymes (CYP1A1, CYP1A2, CYP2E1, UGT1As) in various tissues, and as a tumor promoter in rat hepatocarcinogenesis [236,237]. The search for AhR antagonists has led to design and characterization of many synthetic flavone derivatives with various chemical substituents being located at different positions on aromatic molecule. For example, alpha-naphthoflavone (7,8-benzoflavone; ANF), an isomer of BNF, has been found to bind to AhR and to inhibit TCDD-induced Cyp1a1 expression, thus indicating that this flavone acts as a potent antagonist [238-240]. However, antagonistic effects of ANF have been later shown to depend on flavone concentration, as revealed by a series of experiments, when induction of Cyp1a1 expression and AhR transformation in cells treated with ANF in micromolar concentrations suggested that it may act as AhR agonist [228,240,241]. Therefore, based on space models of known AhR ligands, other AhR antagonists with basic flavone structure have been designed. Nitro-substitutions in 4´ position of flavone B ring have been identified as promissing feature important for AhR antagonism, while methoxy- substitution in 3´ position contributed to enhanced receptor binding. These findings resulted in synthesis of 3´-methoxy-4´-nitroflavone (3M4NF) and its identification as a “pure” AhR antagonist, with no effect on Cyp1a1 gene expression in MCF-7 or Hepa1c1c7 cells. This flavone has been shown to reduce TCDD-induced AhR activation [239,242]. 3M4NF-binding to AhR prevents TCDD-induced AhR nuclear translocation, formation of AhR/ARNT/DRE complex, AhR degradation and expression of both endogenous and reporter DRE-driven genes [242,243]. Besides its ability to inhibit TCDD-mediated AhR activation, 3M4NF has been also shown to suppress TCDD-induced inhibition of apoptosis and activation of Akt and Erk1/2 kinases in human mammary epithelial MCF-10A cells [244].

-30-

1. Introduction A)

B)

Fig. 9 - Chemical structures of model flavones. A) 3´-methoxy-4´-nitroflavone – 3M4NF; B) beta-naphthoflavone (5,6-benzoflavone) - BNF. In vivo, 3M4NF has been shown to attenuate B[a]P genotoxicity; however, when other parameters than micronuclei induction were measured, some effects of B[a]P have been actually enhanced by 3M4NF exposure, occurring via both AhR-dependent and -independent mechanisms [245,246]. These studies indicated the existence of AhR-independent mechanism being involved in 3M4NF action. 3M4NF has been shown to inhibit TCDD-mediated DREdriven reporter gene LacZ and Cyp1a1 gene induction in vivo [247]. Nevertheless, although 3M4NF is commonly being used as a pure AhR antagonist, there is some evidence suggesting that 3M4NF is actually a weak AhR agonist inducing Cyp1a1 gene expression in Hepa1c1c7 cells [248]. Effects of 3M4NF thus seem to depend on cell type, tested concentration and promoter context of regulated genes. 1.4.1.3 AhR and cell cycle The first indications that AhR might be involved in cell cycle regulation were based on observations that TCDD may inhibit cell proliferation and DNA synthesis in rat primary hepatocytes [249]. Later, AhR-deficient Hepa1c1c7 cells have been reported to have prolonged doubling time in comparison with AhR+/+ cells, suggesting that AhR might play a role in G1-phase control of the Hepa1c1c7 cells [250]. In contrast with the previous findings, TCDD-induced cell proliferation was observed in hepatocytes isolated from Sprague-Dawley rats exposed to TCDD for 30 weeks [206]. Experiments performed in Sprague-Dawley rats have demonstrated that TCDD inhibits centrilobular hepatocyte proliferation, while simultaneously inducing periportal hepatocyte proliferation [251]. Thus, since the very begining, conflicting results are being reported regarding the role of AhR in cell cycle regulation. Moreover, TCDD-induced changes in rat liver cell proliferation seem to depend on timing and duration of dioxin exposure, and they could be reversible [252].

-31-

1. Introduction When comparing KO to AhR-wild type (AhRwt) fibroblasts, an accumulation of AhRnull fibroblasts in G2/M phase of cell cycle and elevated apoptosis have been observed [253]. The initiation of cell mitosis is strictly regulated process accompanied with the activity of cdc2/cyclinB complex (mitotic promoting factor, MPF) or Polo kinase (Plk)-activated Cdc2 protein [254,255]. Downregulation of Cdc2 and Plk proteins at both mRNA and protein levels have been observed in AhR-null fibroblasts as compared to AhRwt fibroblasts, where the Cdc2 and Plk protein kinase activities remain unchanged [253]. Both Cdc2 and Plk depletion seem to be related to upregulation of TGF-β3 or TGF-β1, and increased rate of apoptosis, both features being characteristic for liver of AhR-/- mice [256]. Interestingly, the experiments performed in AhR-/- fibroblasts transfected with Tet-OFF-regulated Ahr gene variants, revealed an unexpected finding that neither ligand binding nor AhR LBD itself are required in reported decrease of proliferation observed in AhR-/- fibroblasts [253,257].. Taken together, AhR may indirectly regulate expression of negative growth factors, such as TGF-β [257]; however, this effect seems to be again cell type-specific [258]. A direct evidence for the AhR role in cell cycle regulation came from studies of groups of Göttlicher and Whitlock [76,250]. The first group reported inhibition of proliferation of rat hepatoma cells 5L treated with TCDD [75,259], which has not been observed in AhRdeficient BP8 clone [260]. The second group described a ligand-independent decrease of proliferation rate in AhR-/- mouse hepatoma Hepa1c1c7 cells. These cells show a prolonged progression through G1-phase of cell cycle in comparison with wild type Hepa1c1c7 cells. This effect is reversed upon transfection of cells with exogenous AhR, and it is similar to that observed in Hepa1c1c7 cells exposed to TCDD or in Jurkat T cells expressing CA-AhR [261,262]. These results have indicated that AhR might play an important role especially in G1-phase of cell cycle [250,262]. Further studies suggested that AhR directly interacts with an important regulator of cell cycle, retinoblastoma protein (pRB) [263]. This tumor suppressor controls cell cycle progression through G1-phase and differentiation [264]. pRB functions are tightly regulated by phosphorylation of specific residues, which is regulated by mitogens or growth inhibitory factors, and directly mediated by e.g. cyclins D (D1, D2, D3) in complex with cyclin-dependent kinases 2 and 4 (CDK2, CDK4) [265]. Hypophosphorylated pRB inactivates E2F-driven gene expression. After proliferation stimuli, CycD/CDK4/2 complex hyperphosphorylates pRB, thereby resulting in E2F dissociation from pRB/E2F complex and induction of E2F-mediated expression of genes controlling cell cycle progression. Interaction of ligand-activated AhR with pRB has been sufficient for repression of E2F-dependent trancription resulting in cell cycle arrest in Hepa1c1c7 cells [266], and it is also required for -32-

1. Introduction maximal TCDD-induced Cyp1a1 expression in 5L cells [267]. Moreover, cAMP, which induces hyperphosphorylation and thereby activation of pRB, has been also speculated to transform Ah receptor to its active signaling form [268]. When the precise mechanism of pRB/AhR interaction and function has been further investigated, overexpression of p300 suppressed pRB-dependent gene repression and this effect could be reversed in TCDD-treated Hepa1c1c7 cells. TCDD-induced displacement of p300 is accompanied with recruitment of AhR to E2F-driven promoters [262]. However, several lines of evidence strongly support the existence of another regulatory mechanism besides the proposed AhR-pRB model. Additional data obtained from 5L cells imply the involvement of ARNT protein in TCDD-induced cell cycle arrest and inhibition of proliferation [269]. Another AhR role in cell cycle signaling could be the induction of p27Kip1 CDK inhibitor expression leading to inhibition of cell proliferation [270]. In contrast, a novel AhR-target gene, hairy and enhancer of split homologue-1 (Hes-1), has been reported to control cell proliferation via the transcriptional repression of p27Kip1 in mouse embryonal carcinoma F9 cells [271,272]. In conclusion, ARNT-independent AhR/pRB interaction, ARNT-dependent AhRmediated induction of p27KIP1 expression, AhR/p300 interaction, AhR-associated regulation of TGFβ expression or cAMP-induced pRB activation are some of the hypothetical mechanisms regulated by AhR in cell cycle inhibition [92,267]. Nevertheless, effects other that cell cycle inhibition should be also studied. In contrast to data obtained from hepatoma cells, AhR ligands like TCDD, PCB 126 and various PAHs, such as B[a]A, B[b]F, induce cell cycle progression in an in vitro model of contact-inhibited oval WB-F344 cells and thus indicating that action of AhR in regulation of cell cycle could be tissue- and cell type-specific [63,65]. 1.4.1.4 AhR crosstalk with other signaling pathways AhR signaling may interfere with androgen receptor (AR) [273], estrogen receptor (ER) [90], thyroid receptor (TR) [274], glucocorticoid receptor (GR) [275], or retinoic acid receptor (RAR/RXR) [276] signaling. Besides NRs, AhR may also either directly or indirectly communicate with many other cellular signaling patways, including mitogen-activated protein kinases-pathway (MAPK) [115,193], or with nuclear factor κB pathway (NF-κB) [277].

-33-

1. Introduction 1.4.1.4.1 AhR and ER Some of the known AhR ligands behave as endocrine disruptors and modulate formation or growth of endocrine-dependent tumors [278]. The AhR-agonist TCDD can both induce ovarian and uterine carcinomas in Sprague-Dawley female rats [279], and reduce incidence of mammary gland carcinoma [201]. TCDD and related compounds have been found to exhibit antiestrogenic effects in Sprague-Dawley rat uterus and in human breast cancer cells, and they induce estrogen receptor (ER) degradation and decrease its activity [280]. Both TCDD and AhR antagonists, like 6-methyl-1,3,8-trichlorodibenzofuran (MCDF), may exhibit strong antiestrogenic activity in the

Fig.10 - Schematic model of possible AhR-ER crosstalk. AhR has been reported to interfere with ER signaling at multiple steps, including regulation of estrogen synthesis and metabolism, induction of ER degradation, synthesis of inhibitory proteins, competitions for coreceptors and other transcriptional factors, such as ERAP140, or a direct inhibition of ER-driven gene expression through binding to inhibitory DREs in the same promoters. (Scheme is adopted from [1]). same rat model, thus suggesting that many other dioxin-like compounds and/or structurally diverse AhR ligands may also function as selective estrogen receptor modulators, which are currently being studied for their potential in breast cancer therapy [281].

-34-

1. Introduction Antiestrogens can be divided into two major classes: Type I antiestrogens like tamoxifen, its metabolites and analogues possess mixed estrogenic/antiestrogenic activity. Type II antiestrogens like 17β-estradiol (E2)-derivative ICI 164,384 or its more potent analogue ICI 182,780 are classified as “pure” antiestrogens with no estrogen-like capacity in laboratory assays [282,283]. The characteristic feature of antiestrogens is the competitive inhibition of estrogen-binding to ER. Type I antiestrogens bind to ER and cause incomplete conversion of its cytosolic complex into inactive form and decrease receptor shuttling. “Pure” antiestrogens may block dimerization of estrogen receptors and thus either prevent their binding to estrogen responsive elements (EREs) located in enhancer regions of ER-target genes or to inactivate the transcriptional complex [284,285]. This type of antiestrogens has been reported to cause ER degradation and repression of tumor cell proliferation [286]. Experiments performed in TCDD-exposed ER-positive MCF-7 or ER-negative MDA-MB231 cells revealed an existence of an inhibitory AhR-ER crosstalk mediated by direct interaction of AhR with ER or indirect interaction of these two receptors by their interaction with GC-box specific transcription factor Sp1 [90]. Furthermore, the existence of inhibitory DRE elements (iDRE) in promoter regions of ER-target genes; competition between both receptors for common transcription factors like ERAP140, NF1 or Sp1; synthesis of hypothetical proteins acting as inhibitors of ER transcriptional acitivity or deregulation of estrogen synthesis by enzymes involved in xenobiotic metabolism may all represent alternative mechanims, by which AhR modulates action of ER [1,90] (see Fig.10). E2 has been shown to induce proliferation of MCF7 cells accompanied with rapid cyclin D1 upregulation, increase in cdk4- and cdk2-activity and pRB-inactivation by phosphorylation. Cotreatment of E2-exposed cells with TCDD resulted in suppression of E2 functions [287]. Similar indications supporting mutual AhR-ER inhibitory crosstalk were reported for cathepsin D gene expression in MCF-7 and MDA-MB-231 cells [287], or for the TCDDinduced Cyp1a1 gene expression, which is repressed in E2-exposed MCF-7 cells by recruitment of ER as a trasncriptional corepressor to the promoter region and by AhR-ER competition for nuclear factor 1 (NF1) [288,289]. TCDD and other AhR ligands have no effects on ERα mRNA transcription, thus indicating that observed receptor degradation probably occurs at posttranslational level [90]. These results strongly support the role of AhR in ERα degradation mediated by of proteasome [290]. This is further supported by the recent finding that AhR is a ligand-dependent E3 ubiquitin ligase mediating steroid receptor degradation [291].

-35-

1. Introduction In conclusion, the crosstalk between AhR and ER signaling pathways is very complex and further investigations are necessary to explain the precise role of ligand-occupied or unoccupied AhR in ER signaling, with an aim to understand, how xenobiotics do modulate cancer development in steroid hormone-sensitive tissues. 1.5

Cell-to-cell communication Communication between cells is essential for tissue homeostasis and its deregulation is

one of the first steps occurring during cancer development. The surface molecules involved in cell-cell communication can be classified according to their structure, function, signal character and transducing specifity into four types of cell-cell junctions: i) adherens junctions, composed of surface glycoproteins called cadherins and cytosolic proteins catenins, connected to actin filaments [292], ii) desmosomes, composed of cadherins, plakoglobin (PKG), desmoplakins (DP), desmogleins (DSG) and connected to intermediate filaments [293], iii) tight junctions, mediated predominantly by claudins, occludins and connected to cytoskeleton [294] and iv) gap junctions, mediated by connexins [295] (see Fig. 11). The primary focus of this chapter are cadherin- and catenin-mediated types of intercellular communication, adherens junctions and desmosomes. 1.5.1

Cadherin superfamily

Cadherin superfamily encompasses a number of specific surface molecules, which can be classified into 4 groups: i) classical cadherins like E-cadherin (epithelial) or N-cadherin (neural); ii) protocadherins like µ-protocadherin, CNR cadherins (cadherin-related neuronal receptor family) or R-cadherin (retinal); iii) desmosomal cadherins represented by desmocollin (DSC) and desmoglein (DSG) subfamilies; and iv) other cadherin-like protein families and unusual cadherins like T-cadherin (truncated). Classical cadherins are usually composed of: i) five N-terminal extracellular binding repeats (EC 1-5) mediating calciumdependent homophilic cell-cell adhesion between cadherins of adjacent cells; ii) a transmembrane domain (TM); and iii) a cytoplasmic domain associated with cytoplasmic proteins catenins, serving as a linker between cadherins and actin filaments [296]. Experiments using chelaton agents like ethylene glycol tetraacetic acid (EGTA) and mutants with defective cytoplasmic domains have revealed the important role of Ca2+ ions and

-36-

1. Introduction A)

B)

C)

D)

Fig.11 - Schematic presentation of cell-cell communication mediated by different intercellular junctions. A) Adherens junctions enabling transduction of extracellular signal to intercellular space through connection between cadherins, catenins and actin filaments; B) desmosomes mediating intercellular communication by transducting extracellular signals into intracellular space through connection between DSC, DG, PKG and intermediate filaments; C) tight junctions mediating intercellular communications through claudins, occludins and their

connection

to

actin

cytoskeleton;

D)

gap

junctions

enabling

intercellular

communications mediated by connexins. Figures were adopted from the following web sites: http://anatomy.iupui.edu/courses/histo_D502/D502f04/lecture.f04/cell.f04/cellf04.html http://en.wikipedia.org/wiki/Gap_junction

association of cadherins with cytoskeleton in cell adhesion and suppression of cancer cell motility [297-299]. Cadherins are expressed in all tissues and they play pivotal roles during embryogenesis, morphogenesis, angiogenesis or neurogenesis and in related biological processes like cell agregation, polarization, differentiation, migration and carcinogenesis [296]. Deregulated growth, migration and metastatic invasion of tumor cells are commonly associated with disruption of contact inhibition and intercellular and cell-extracellular matrix junctions. Polymorphisms, mutations and epigenetic changes like methylations located in -37-

1. Introduction gene encoding E-cadherin (Cdh1) and decreased expression of this tumor suppressor in several types of metastatic carcinomas have been shown to correlate with progression of cancer development [300]. In conclusion, cadherins represent important regulators of “normal” cell development and their deregulation or inactivation is one of critical step involved in carcinogenesis [8]. 1.5.1.1 Cadherins expressed in liver Members of cadherin superfamily found in liver tissues include E-cadherin, T-cadherin, LI-cadherin, N-cadherin and VE-cadherin. E-cadherin represents probably the most frequent type of cadherin in liver adherens junctions, and it has been demonstrated to be downregulated in dysplastic nodules and HCC [301,302]. E-cadherin deregulation and/or gene inactivation is usually detected during later stages of hepatocarcinogenesis and it is accompanied with poor prognosis. During liver development, E-cadherin is primarily expressed in hepatic primordia, in single hepatocytes and in the periportal zones of adult liver [303,304]. Rather surprisingly, N-cadherin has been also found to be expressed in adult hepatocytes and in HCC-derived cell lines, and complementary to E-cadherin expression during liver development, also in perivenous zones [303,305]. As a member of classical cadherins family, N-cadherin associates with catenins and contributes to forming of adhesive plaques not only in cells of central nervous system and during neurogenesis, but also in endothelial cells, where it plays key roles in maturation, stabilization and morphogenesis of the vasculature [306,307]. Overexpression of N-cadherin has been shown to mediate contact inhibition of ovarian cell growth, but also to stimulate cell migration and invasion, while dismantling of N-cadherin– mediated cell-cell contacts has been reported to be accompanied with enhanced proliferation of smooth muscle cells [307-309]. Another cadherin found to be expressed in liver is vascular endothelial cadherin (VEcadherin), which has been first reported to be specifically expressed in the endothelial cells and endothelial cell progenitors, where it participates in control of vascular permeability and integrity [310]. This classical cadherin associates with catenins and forms typical adherens junctions, however its binding to PG and DP in desmosomal plaques has been also observed [311]. However, as in the case of N-cadherin, VE-cadherin expression is not endotheliumspecific, and it can be transiently detected e.g. in fetal liver hematopoietic stem cells [312]. Furthermore, VE-cadherin has been demonstrated to play an important role in tumor

-38-

1. Introduction neoangiogenesis and it may act as an anti-cancer therapy agent [306]. In comparison with other cancer tissues, stronger hepatic VE-cadherin expression was detected in sinusoidal endothelium of subjects suffering from chronic hepatitis, cirrhosis or HCC [313]. In 1994, liver-intestine cadherin (LI-cadherin), a novel member of cadherin family has been cloned from rat liver [314]. As indicated by its name, LI-cadherin is expressed in hepatocytes, enterocytes and, to a small extent, also in spleen. In contrast to classical cadherins, LI-cadherin does not associate with either catenins nor cytoskeleton, but it still mediates homophilic cell adhesion [315]. Moreover, while rat LI-cadherin is expressed predominantly in intestine and liver, mouse LI-cadherin has been detected only in intestine, co-expressed with E-cadherin [316]. It has been suggested that LI-cadherin is expressed only in hepatic tumor tissues but not in the normal liver, thus making this cadherin a potential HCC marker [317]. LI-cadherin upregulation is also observed in gastric intestinal metaplasia or in other specific adenocarcinomas, which is associated with poor prognosis [318]. The mechanisms leading to LI-cadherin overexpression during e.g. liver, gastric and pancreatic carcinogenesis seem to be regulated by alternative mRNA splicing and nucleotide polymorphism [319]. Experiments performed in chick embryo brain have revealed the existence of nonclassical truncated cadherin (T-cadherin; also designated as heart H-cadherin of cadherin-13), being involved in axon growth and cell-cell adhesion in nervous system. Similar to LIcadherin, T-cadherin also lacks transmembrane and cytoplasmic domains, being attached to plasma membrane through glycosyl phosphatidylinositol (GPI) anchor. It mediates homophilic Ca2+-dependent cell adhesion in neural and non-neural tissues, such as heart, endothelium or skin keratinocytes [320-322]. T-cadherin can be found in form of two distinct protein forms: i) uncleaved T-cadherin precursor and ii) mature cadherin, both apically and/or diffusely expressed on cell surface and mediating signal transduction [321,323]. Deregulation of T-cadherin expression caused by promoter methylation and/or allelic loss was observed during progression and invasion of liver, skin or non-small cell lung carcinomas [324-326]. Interestingly, sequence analysis has revealed DRE motives being located in promoter region of T-cadherin encoding gene, cdh13. Moreover, AhR ligands like TCDD or B[a]P have been reported to supress T-cadherin mRNA levels in vascular smooth muscle cells, thus indicating AhR being involved in control of T-cadherin expression [327]. As GPI-protein, T-cadherin might also act as coreceptor of other surface receptors or as an integrator modulating signal transduction [328].

-39-

1. Introduction In conclusion, cadherins expressed in liver mediate both homophilic cell-cell adhesion and some still not fully defined cellular processes involved in control of cell proliferation, differentiation and carcinogenesis. 1.5.2

Catenins Although some cadherins may lack cytoplasmic domain, all classical cadherins located

in adherens plaques or desmosomes (see chapter 1.5.1) transduce extracellular signals to the inner space of cell through direct association with a wide group of proteins called catenins. These act as essential molecules forming a bridge between cadherins and cell cytoskeleton, namely F-actin and intermediate filaments [9,329]. As critical players of cell adhesion, catenins participate in embryogenesis, morphogenesis, development, cell signaling or carcinogenesis [330,331]. The basic members of catenin group, α-, β- and PKG, were identified in 1989 by Ozawa, which proposed nomenclature based on latin catena-chain [332]. The primary structures of all three catenins typicaly contain armadillo motif [333,334]. α-catenin is able to form homodimers as well as heterodimers and play an essential role in linking cadherins to cytoskeleton. Other members of catenin group have been later classified as p120 catenin family, which has been shown to also play important roles in cadherin turnover, sensoring of synaptic activity and regulation of Rho GTPase activity and cytoskeletal organization [335]. Catenins have been further shown to directly or indirectly modulate cell adhesion-independent gene expression, cadherin-mediated and even integrinmediated signaling through their interactions with various protein partners like vinculin, talin, α-actinin, small GTPases of Rho/Rac family, kinases, phosphatases and other proteins involved in regulation of cell motility and cell signaling [336]. In further text, the primary focus will be on β-catenin and PKG (also known as γ-catenin), and their possible relationship to AhR signaling pathway. 1.5.2.1 β-catenin β-catenin performs two apparently unrelated intracellular functions: i) regulation of cell adhesion and/or ii) participation in wingless/Wnt signaling pathway [337,338]. The role of βcatenin in cell adhesion has been discovered first, in connection with identification of cytosolic proteins directly interacting with cytoplasmic domain of E-cadherin immediately after cadherin synthesis [332,339]. β-catenin knockout mice die early during embryogenesis -40-

1. Introduction

Diagram 1 - Schematic representation of β-catenin and plakoglobin. Figure depicts schematic structures of both catenins, percentage of individual domain homology, positions of amino acid residues phosphorylated by kinases and impact of postranslational modification on β-catenin and plakoglobin action. Grey arrows depict regions, where catenins interact with various protein partners. (Scheme modified according to [6-10]). and PKG expression is insufficient to compensate for β-catenin absence [340]. Contrary to PKG, which has been shown to co-localize with both desmosomes and adherens junctions, β-

-41-

1. Introduction catenin is found only in adherens junctions, where it might function as a negative regulator of E-cadherin/catenin cell adhesion [341-343]. The activity of cadherin-catenin complexes seems to depend on specific type of phosphorylation of each component. It has been reported that β-catenin can be phosphorylated by E-cadherin-interacting kinase EGFR in response to EGF or by v-Src kinase, thus resulting in suppression of strenght of cadherins-mediated junctions, whereas phosphorylation of E-cadherin by casein kinase II (CKII) and/or GSK3β is accompanied with increased affinity of β-catenin to cadherin cytoplasmic domain [344-346]. Likewise, other components of adherens junctions might also undergo phosphorylation, thus indicating a dynamic nature of cadherin-mediated cell-cell interactions based on current status of phosphorylation. Mitogens and/or other proliferation signals induce destabilization of cadherin-catenin complexes and repression of intercellular communication mediated by adherens junctions, accompanied with degradation of released β-catenin by phosphorylationdependent mechanism [347,348]. Stabilization of cytosolic β-catenin complex is mediated by scaffold protein axin and its PP1 (protein phosphatase 1)-mediated phosphorylation, which contributes to interactions between phosphorylated N-terminus of β-catenin and ubiqutin ligases like β-TRPC1, and which therefore functions as a negative regulator of Wnt signaling pathway [349]. Other proteins known as APC (adenomatous polyposis coli) and phosphatase 2C play also a role in β-catenin turnover, however their precise mode of action in cytosolic degradation complex is not yet fully elucidated [350]. As mentioned above, β-catenin plays essential role in Wnt signaling and its degradation is suppressed by Wnt signals through inhibition of PKC-mediated GSK3β kinase activity [351,352]. Once stabilized by GSK3β inactivation, unphosphorylated β-catenin accumulates and translocates to the nucleus where it controls expression of target genes through association with high mobility group (HMG)-like transcription factors Lef/Tcf (lymphoid enhancer factor/ T cell factor) [353]. Transactivation capacity of β-catenin can be reversed by overepression of cadherins and vice versa, overexpression of Lef leads to nuclear localization of β-catenin and activation of gene expression [354,355]. Cyclin D1, c-Myc, c-jun represent some of Tcf/Lef-target genes involved in regulation of both development and hepatocarcinogenesis [356,357]. The βcatenin-mediated gene expression may be modulated i) by competition of various members of Tcf/Lef family for binding of β-catenin and cofactors like p300 and/or CBP, ii) by direct interaction of β-catenin with transcription factor AP1 and/or iii) by growth factor signaling, such as the case of PDGF (platelet derived growth factor), TGFβ or EGF [358-360].

-42-

1. Introduction β-catenin signaling is dynamic process regulated by many stimuli, which is often targeted in cancer development. Uncontrolled activation of β-catenin mediated by epigenetic changes and/or mutations in genes encoding β-catenin, APC and other components of βcatenin signaling pathway is suggested to contribute to tumor progression in colon, prostate, ovarian and liver cancers, as well as in melanomas and medulloblastomas [8,341,361-363]. 1.5.2.1.1 β-catenin in liver development and AhR signaling Wnt/β-catenin signaling pathway has been shown to play an essential role in both liver development and liver regeneration [331,364,365]. Expression of β-catenin is increased during early liver development (E10-E16) and its overexpression or aberant activation in liver may result in hepatocyte proliferation, increase in liver weight, hepatomegaly and development of HCC [366,367]. Furthermore, both genetic and epigenetic changes in Wnt signaling pathway are commonly detected in various liver diseases [357,368,369]. Studies perfomed in prostate cancer cells have revealed an unexpected capacity of Wnt/β-catenin pathway to regulate AhR expression. Sequence analysis of 5´ upstream sequence of AhR promoter found putative binding sites for β-catenin/TCF transcription complex, however cells with increased expression of AhR induced by activation of Wnt pathway by Wnt-3a ligand did not manifest intense β-catenin nuclear staining [370]. Thus, the mechanism of β-catenin-mediated increase of AhR both at mRNA and protein levels remains unclear. Contrary to that, AhR ligands like TCDD and B[a]P caused decrease of β-catenin levels in human uterine cells [371]. Another evidence supporting potential role of β-catenin in AhR signaling pathway is based on observation that constitutively active β-catenin induces transcriptional activation of CYP1A isoenzymes in mouse liver tumors [372]. However, further investigations are needed to understand mechanisms of β-catenin/AhR crosstalk and the role of β-catenin in carcinogenesis induced by enviromental pollutants, such as TCDD. 1.5.2.2 Plakoglobin (γ-catenin) PKG has been originally identified as a desmosomal 83 kDa polypeptide occurring in adherens junctions, which has been later asigned into catenin family as γ-catenin [6,332]. Desmosomal PKG interacts with desmogleins (DSG), desmoplakins (DPs), desmocollins (DCs) and other cadherins to mediate desmosomes assembly and intercellular communication

-43-

1. Introduction [726]. Besides its functions in desmosomal interactions, PKG has been also shown to be a key regulator of crosstalk between adherens junctions and desmosomes and to be a common component of adherens junctions, where it interacts with both α-catenin and cytoplasmic domains of classical cadherins [373,374]. As in the case of β-catenin, phosphorylation status of PKG is crucial for its cellular effects and it can be regulated by various factors, such as EGF [375]. Due to their close homology, PKG may affect β-catenin functions and vice versa [376,377]. Similar to β-catenin, PKG is able to act as a mediator and transcription factor in Wnt signaling and in cytoplasm, it is targeted to proteasomal degradation by axin-APC complex [377,378]. Interestingly, inhibition of proteasomal PKG degradation has little effect on PKG action, but it strongly increases β-catenin levels in nuclei through competition for ubiquitin ligase β-TrCP, whereas overexpression of PKG leads to β-catenin degradation [379,380]. Although PKG is able to bind with Tcf/Lef trancription factors to promoter regions of target genes, transactivation capacity of this complex is much lower than in case of βcatenin-mediated transcription [378,381]. The absence of PKG can be temporarily, but not fully, replaced by β-catenin recruitment to desmosomal plaques. However PKG null-mutant mice die during embryogenesis thus indicating the essential role of PKG in early development and futher in regulation of apoptosis and cancer development [382-384]. Mutations in PKG phosphorylation site, loss of heterozygozity in gene encoding PKG (Jup) and decrease in PKG expression represent aberant changes detected in breast, ovarian, endometrial and gastric cancers [385-388], and PKG has been suggested to be a tumor suppressor [389]. Interestingly, a recent study suggested a possibility of AhR-dependent PKG regulation in rat liver cells [390]. Taken together, similar to β-catenin, PKG plays a critical role in regulation of proliferation and cellcell adhesion, however the precise mechanisms and additional PKG functions are still not fully known.

-44-

2. Aims 2

MAIN AIMS OF STUDY In the last century, a massive industrial progress has brought us multiple and daily used

conveniences in e.g. engineering, agriculture, health service or public traffic. However, as an integral part of the progress, many toxic and harmful chemical compounds like polyaromatic hydrocarbons (PAHs), polychlorinated biphenyls (PCBs), dioxins or dibenzofurans have contaminated our environment. These toxic enviromental contaminants have been documented to affect immune system, reproduction and development, and to contribute to some diseases, including cancer. As a number of these toxic effects are mediated by AhR, the identification and detailed description of toxic processes being regulated by this transcription factor are of utmost importance. The principal aim of this study was to investigate the AhR signaling in the model of contact-inhibited rat hepatic WB-F344 cells, an in vitro model of „stem-like“ oval cells, which are considered to be one of the cell populations targeted during liver carcinogenesis. The study focused on the following aspects of AhR-mediated signaling: •

To determine capacity of synthetic flavones, representing model AhR agonists and/or antagonists (BNF and 3M4NF), to activate AhR signaling or to prevent TCDD action in WB-F344 cells.

•

To describe effects of potential endogenous AhR ligand, indirubin, on AhR signaling in WB-F344 cells.

•

To study the impact of various exogenous AhR ligands, such as TCDD, PCB 126, BNF and 3M4NF, and indirubin on deregulation of cell proliferation and cell cycle progression in model rat liver cell lines.

•

To elucidate the potential of model AhR ligands to disrupt contact inhibition and cellto-cell communication in WB-F344 cells, and to clarify the role of AhR and ARNT in these processess.

•

To study the effects of model AhR ligands on expression of molecules mediating cellto-cell contacts in rat hepatoma cells, 5L and BP8.

-45-

3. Materials and methods 3

MATERIALS AND METHODS

3.1 Chemicals 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) was purchased from Cambridge Isotope Laboratories (Andover, MA). β-Naphthoflavone (BNF) and α-naphthoflavone (ANF) were purchased from Sigma-Aldrich (Prague, Czech Republic). 3´-Methoxy-4´-nitroflavone (3M4NF) was kindly provided by Thomas A. Gasiewicz (University of Rochester School of Medicine and Dentistry, NY) and Josef Abel (Heinrich Heine University, Düsseldorf, Germany). 3,3',4,4',5-Pentachlorobiphenyl (PCB 126) was purchased from Promochem (Wesel, Germany). In response to previously reported experimental data [62,65], we used two model concentrations for dioxin (1 nM and 5 nM), for synthetic flavones (1 µM and 10 µM) and three concentrations for PCB 126 (50 nM, 100 nM and 1µM). Indirubin treatment were performed at four concentrations (50 pM, 100 pM, 1 nM, 10 nM), which represent endogenous concentrations or concentrations sufficient for AhR activation [178]. All stock solutions (TCDD 5 µM; BNF/ 3M4NF 1 mM and 10 mM; PCB 126 1 mM and 50 µM) were prepared in dimethylsulfoxide (DMSO; Sigma-Aldrich, Prague, Czech Republic) and kept at ambient temperature in the dark. Other chemical compounds were purchased, diluted and stored as referred below. 3.2

Cell cultures and treatment

3.2.1 Rat oval epithelial „stem-like“ cell line- WB-F344 The rat hepatic oval WB-F344 cells (kindly provided by J.E.Trosko, MSU, MI) were grown in Dulbecco´s Modified Eagle´s Medium/ Nutrient Mixture F-12 Ham medium (Invitrogen, Carlsbad, CA) supplemented with sodium pyruvate (110 mg/ml), 15 mM HEPES, L-Glutamine, gentamycin (50 mg/ml) or penicilin/streptomycin (100,000 units/l and 100mg/l respectively) and 5% heat-inactivated fetal bovine serum (FBS). The cells were incubated in a humidified atmosphere of 5% CO2/ 95% room air at 37°C. Cells were maintained in 75 cm2 flasks, grown until they reached confluency and sub-cultured twice a week. Only cells from passage numbers 15-22 were used throughout the study. Plates, dishes and flasks used for cell cultivation were purchased from TPP (Trasadingen, Switzerland) or NUNC (Roskilde, Denmark). -46-

3. Materials and methods Based on the type of experiment, WB-F344 cells were seeded at initial density 20-30,000 cells per cm2 and grown until reaching confluency. The medium was changed, and after another 24 h, the tested compounds were applied as further specified. 3.2.2 Rat hepatoma cell lines- 5L and BP8 Rat hepatoma 5L and BP8 cell lines were grown in Dulbecco´s Modified Eagle´s Medium/ Nutrient Mixture F-12 Ham medium supplemented with sodium pyruvate (110 mg/ml), 15 mM HEPES, L-Glutamine, penicilin/streptomycin (100,000 units/l and 100mg/l respectively), and 10% heat-inactivated fetal bovine serum (FBS). The cells were incubated in a humidified atmosphere of 5% CO2/ 95% room air at 37°C. Cells were maintained in 75 cm2 flasks (TPP or NUNC), grown until they reached semi-confluency and sub-cultured twice or three-times a week. Only cells from passage numbers 2-9 were used throughout the study. Based on the type of experiment, 5L and BP8 cells were seeded at initial density 10,000 cells per cm2 and grown for 24h. The medium was then changed and tested compounds were added as further specified. 3.3 Cell proliferation assay 3.3.1 Coulter Counter WB-F344, 5L and BP8 cells were grown in 35-mm cell culture dishes (TPP). The tested compounds were applied for 24 h to 72 h period. Cells were collected by trypsinization, washed with phosphate-buffered saline (PBS; 170 mM NaCl, 3.3 mM KCl, 4 mM Na2HPO4.12H2O, 1.8 mM KH2PO4) and counted with Coulter Counter (Model ZM, Coulter Electronics, Luton, UK) as described previously {Vondracek, 2006 #18}. 3.3.2 CyQUANT NF cell proliferation assay WB-F344, WB-F344/∆7, WB-F344/pcDNA (vector), WB-F344/∆B16 and WBF344/Neo12 (vector) cells were seeded and grown as described in section 3.2.1. Confluent cells were treated with DMSO (0.1%), TCDD (5 nM) and PCB 126 (100 nM) for 48 h, dispensed in 1x dye solution and incubated at 37°C for 30-60 min (according to the manual of CyQUANT® FN Cell Proliferation Assay). Fluorescence intensity were measured by FluoStar reader, using excitation at 485 nm and measuring emission at 530 nm. -47-

3. Materials and methods 3.4 Cell cycle analysis WB-F344, 5L and BP8 cells were grown as described above. The tested compounds were added for 24 h or 48 h and 72 h. Cells were collected by trypsinization and fixed in 70% ethanol at 4°C overnight. Fixed cells were then washed once with PBS and stained with propidium iodide as described previously [66]. Cells were then analyzed with FACSCalibur, using 488 nm (15 mM) air-cooled argon-ion laser for propidium iodide excitation (Becton Dickinson, San Jose, CA). A minimum of 15,000 cells were collected per each sample. Data were analyzed using ModFit LT software (Verify Software House, Topsham, ME). 3.5 Indirect fluorescence In order to investigate the effects of tested compounds on AhR-translocation, WB-F344 cells were grown on glass cover slips in four-well cell-culture plates until they reached confluency. The medium was changed, and 24 h later, the tested compounds (TCDD, 3M4NF, BNF) were added for indicated time period. Cell were washed with PBS (4°C) and fixed with cold methanol:acetone mix (1:1) for 15 min at -20°C. Cells were then washed three times with wash buffer (see chapter 3.7.), and incubated 2 h with the anti-AhR antibody (Biomol, Butler Pike, PA). Cells were again washed three times and incubated for 1 h with the anti-rabbit fluorescein-isothiocyanate (FITC)-conjugated antibody (GE Healthcare, Little Chalfont, UK). Cells were washed once with wash buffer containing RNAse (20 µg/ml) and once with wash buffer without RNAse, and mounted in 5 µl of Mowiol (Calbiochem, San Diego, CA) solution (10% Mowiol 4-88 was prepared in 25% glycerol, 100 mM Tris-HCl, pH 8.5) for observation with Olympus IX70 fluorescence microscope. 3.6 RNA isolation and real-time PCR Total RNA was isolated using NucleoSpin RNA II Purification Kit (Macherey-Nagel, Düren, Germany), according to the manufacturer’s instructions. The sequences of primers and probes for rat Cyp1a1, Cyp1b1, PBGD have been either published previously [66], or are listed in Table 3 (Jup, Ccna2, Cdh13, Nqo1). For Ctnnb1 quantification PCR assay kit was used (Generi-Biotech, Hradec Králové, Czech Republic). The amplifications of samples were carried out in a final volume of 20 µl of reaction mixture containing 10 µl of QuantiTect Probe RT−PCR Master Mix, 0.2 µl of QuantiTect RT Mix (Qiagen, Valencia, CA), 2 µl of

-48-

3. Materials and methods solution of primers and probe (Generi-Biotech, Hradec Králové, Czech Republic), 5.8 µl of water and 2 µl of RNA sample. The final concentration of each primer was 0.4 µM and probe was 0.1 µM. The amplifications were run on the RotorGene3000 or RotorGene6000 with RotorGene Real-Time Analysis Software (Corbett Research, Sydney, Australia), using the following program:

primer and

oligonucleotide

probe

product

accession

length (bp)

rCcna2

F603

5´-CACGTACCTTAGGGAAATGGAGGTTA-3´

R727

5´-AATCTTCTCCCACTTCAACTAGCCAG -3´

P699

5´-CACAAGGATGGCCCGCATACTGTTAGTG-3´

F374

5´-TCAGTTCCCATTGTATTGGTTTGG-3´

R509

5´-AAGCAAGGTCTTCTTATTCTGGAA-3´

P400

5´-TGCCCGCCATTCTGAAAGGCTGGTTT-3´

F1951

5´- CCCTGATAAAGTCTGGAAGA -3´

125

XM_342229

136

NM_017000

89

NM_138889

127

NM_031047

(CyclinA)

rNqo1 (NQO1)

rCdh13 (T-cadherin)

R2021 5´- GGTTGTAGTTCGCCTTGTT -3´

rJup

P1984

5´- CAACACCCACGCCCTCGTGAGCCT -3´

F2212

5´-ACGAACCCTATGCAGACGACA-3´

(Plakoglobin) R2338 5´-CCGTCGCTGTAGGTGTCCAT-3´ P2310

5´-CGCCATCCATGTCCATGTGCATATCCAGG-3´

Table 3- Primers and probes are identified by letters designating the forward (F), the reverse (R) primer or the probe (P), and a number corresponding to the position of the base at the 5´ end of the positive strand of the primer or probe in the gene reference sequences, according to number of GenBank accession. 50°C for 30 min for reverse transcription and 95°C for 15 min for denaturation of cDNA, followed by Cycling (30-40 repeats) 94°C for 15 sec and 60°C for 60 sec acquiring -49-

3. Materials and methods fluorescence. Optimalized RT-PCR conditions for PBGD detection corresponded with the recommendations of the producer of primers and probes (Generi Biotech, Hradec Králové, Czech Republic) - cycling mode 94°C for 10 sec and 60°C for 40 sec. All PCR reactions were performed in triplicates and changes in gene expression were calculated using the comparative threshold cycle method [391]. 3.7 Western blotting Cells were washed with PBS (4°C), lysed in SDS sample buffer (4°C) (1% SDS, 10% glycerol, 100 mM Tris, pH 7.4) supplemented with protease inhibitor coctail (Sigma-Aldrich, Prague, Czech Republic), sodium fluoride (Fluka) and sodium orthovanadate (Fluka, Prague, Czech Republic), and freezed at -20°C overnight. Cell lysates were then incubated at 90°C for 10 min, cooled on ice, sonicated by Branson Sonifier B-12 (Branson Ultrasonics Corporation, Danbury, CT) and protein concentrations were estimated using Bio-Rad DC Protein Assay (Bio-Rad Laboratories, Inc., Hercules, CA). 10-20 µg of the total cell lysates or nuclear extracts were separated by 10% SDS-PAGE (see Table 4) on Mini-Protean electrophoresis system (Bio-Rad Laboratories, Prague, Czech Republic) using running buffer (200 mM Glycine; 25 mM Tris; 3.5 mM SDS; pH 8.3). Proteins were then transferred by semi-dry blotting (Omnibio, Brno, Czech Republic) in transfer buffer (192 mM Glycine; 25 mM Tris; 20% methanol v/v) to polyvinylidene difluoride membrane (PVDF, Millipore, Prague, Czech Republic). Blocking was performed with 5% nonfat dry milk in wash buffer 1xTBS-T (200 mM Tris-HCl; 1.4 M NaCl; 0.1% Tween 20; pH 7.4). Blots were washed three times in 1xTBS-T and specific proteins were detected with following antibodies diluted in 2.5% nonfat milk: anti-AhR (Biomol, Butler Pike, PA), anti-Cyclin A, (Santa Cruz Biotechnology, Santa Cruz, CA), anti-CYP1A1 (Daiichi Pure Chemicals Co., Tokyo, Japan) and antiCYP1B1 (Daiichi Pure Chemicals Co., Tokyo, Japan), anti-β-actin (Sigma-Aldrich), anti-Ecadherin (BD Biosciences, San Jose, CA), anti-β-catenin (Cell Signaling, Danvers, MA), antip-β-catenin (Cell Signaling), anti-β-catenin-ABC (Upstate), anti-PARP (Santa Cruz Biotechnology), anti-T-cadherin (Santa Cruz Biotechnology) and anti-plakoglobin (BD Biosciences). After overnight incubation with primary antibody at 4°C, blots were washed three times in 1x TBS-T, incubated with anti-rabbit, anti-mouse or anti-goat horse radish peroxidase-conjugated secondary antibodies (GE Healthcare) for 1 h at ambient temperature, three times washed in 1x TBS-T. ECL-Plus reagent (GE Healthcare) was used for visualization of selected proteins according to manufacturer’s instructions. -50-

3. Materials and methods % Acrylamide (AA)

10%

4%

1.575 ml

200 µl

1.5 M Tris-HCl, pH 8.8

1.575 ml

-

1 M Tris-HCl, pH 6.8

-

500 µl

H2O

3.150 ml

1.3 ml

20 µl

10 µl

4 µl

2 µl

40% AA-Bisacrylamide (37.5:1)

10% Ammonium persulfate (APS) N,N,N′,N′Tetramethylethylenediamine (TEMED)

Tab. 4 - Specifications for preparation of polyacrylamide gels-separating 10% gel and focusing 4% gel 3.8 Electrophoretic mobility shift assay (EMSA) 3.8.1 Preparation of nuclear extracts WB-F344 cells were treated with TCDD (5 nM), 3M4NF (1 µM or 10 µM), BNF (1 µM or 10 µM) or their combination for 1 h prior to harvest. BP8 and 5L cells were treated with TCDD (5 nM) and PCB 126 (50 nM) for 1 h prior to harvest. Cells were then washed and lysed with lysis buffer (Tris-HCl 10 mM; KCl 60 mM; EDTA 1.2 mM; (D,L)-1,4dithiothreitol [DTT] 1 mM, pH 8.0), supplemented with 100 µM phenylmethylsulfonyl fluoride (PMSF) and 1 mM Nonidet P-40 (NP-40), for 10 min on ice and centrifuged. Pellets were rinsed with lysis buffer without PMSF and NP-40, centrifuged and incubated for 25 min in 50 µl of nuclear extraction buffer (Tris-HCl 20 mM, NaCl 420 mM, MgCl2 0.7 mM, EDTA 0.25 mM with glycerol 25% v/v) on ice. After final centrifugation, supernatants were collected and stored frozen in aliquots at -80°C. The amount of proteins in nuclear extracts was quantified using the Bradford assay [392].

-51-

3. Materials and methods 3.8.2 EMSA DNA probe was labeled with

32

P-γ-ATP (MP Biomedicals, Illkirke, France) by T4-

polynucleotide kinase (New England BioLabs, Ipswich, MA) and purified by Mini QuickSpin columns (Roche Diagnostics, Mannheim, Germany), according to the manufacturer´s instruction. Nuclear extracts (11 µg per sample) were pre-incubated for 10 min at room temperature in binding buffer (Tris 50 mM, EDTA 6 mM, DTT 0.5mM, with glycerol 50% v/v) with 0.017 units of polydI.dC (Roche Diagnostics). Binding reactions were then performed for 25 min at room temperature with 1 µl of [γ32P]-ATP labeled DRE-DNA (DNA 25 ng/µl; 40,000 CPM). To confirm the specificity of binding to the oligonucleotide, parallel samples were also incubated with excess of unlabeled wild-type DRE probe (competitive control), with nonspecific DNA (mutated DRE), or with labeled wild-type DRE probe and 1 µg of anti-ARNT1 antibody (BD Biosciences; San Jose, CA) in supershift sample. For the DRE sequences used see [151]. AhR/ARNT1/DRE complexes were separated under nondenaturing conditions on 6% polyacrylamide gel. The gels were dried and the DNA-protein complexes were visualized using the STORM phosphoimager (GE Healthcare, Little Chalfont, UK). 3.9

Chromatin immunoprecipitation (ChIP) WB-F344 cells were seeded in 100-mm diameter cell culture dishes (Nunc) and grown

until reaching confluency. The medium was changed, and after another 24 h, TCDD (5nM) and 3M4NF (10µM) were added for 30, 60, 90 or 120 min. Cells were fixed with 37% formaldehyde solution (Sigma-Aldrich, Prague, Czech Republic), washed with PBS and collect into 1.5 ml microtube. After highspeed centrifugation (13,000 g/ 1 min), cell pelets were freezed with dry ice for 15 min, thawed by Buffer C (20 mM HEPES, pH 7.9; 25% glycerol; 420 mM NaCl; 1.5 mM MgCl2; 0.2 mM EDTA) and cooled for 20 min on ice. After centrifugation, nuclei were resuspend in Breaking Buffer (50 mM Tris-HCl, pH 8.0; 1 mM EDTA; 150 mM NaCl; 1% SDS; 2% Triton X-100) and sonicated in bath sonicator for 10-20 min. Nuclei were then incubated with Protein A-Sepharose (Sigma-Aldrich, Prague, Czech Republic) in Triton buffer (50 mM Tris-HCl, pH 8.0; 1mM EDTA; 150 mM NaCl; 0.1% Triton X-100) at 4°C overnight. The proteins were then incubated with or without (input control) anti-AhR antibody (Biomol, Butler Pike, CA) for 6 h and washed three times with cold PBS. After final centrifugation, SDS-NaCl-DTT buffer (62.5 mM Tris-HCl, pH 6.8;

-52-

3. Materials and methods 200 mM NaCl; 2% SDS; 10 mM DTT) was added to precipitates and incubated at 65°C overnight. Next day, DNA was isolated by phenol-chlorophorm extraction and cleaned by ethanol extraction. Air-dried DNA was resuspended in DNase-free water and quantified by Nanodrop (NanoDrop Technologies, Wilmington, DE). PCR reaction were performed using Ready-TO-Go PCR beads (GE Healthcare Amersham) with primers (see Table 5) corresponding to rat Cyp1a1 promoter region (Sogawa et al., 1986) and run on the PTC-200 cycler (MJ Research, Waltham, MA). Optimalized RT-PCR conditions used the following program: initial denaturation of DNA template was performed at 95°C for 5 min and followed by PCR reaction (35-40 repeats) 95°C for 15 sec, 60°C for 1 min and 72°C for 1 min for extension. Amplified DNA was separated by 2 % agarose electrophoresis (see chapter 3.10.2.2.1.), stained with ethidium bromide (Fluka) and visualised by UltraLum (UltraLum, Claremont, CA).

region

primer

Cyp1a1 Forward Reverse

oligonucleotide 5´- CAGGCCTTTGCTCTCAGG -3´

product length (bp) 232

accession Sogawa et al., 1986

5´- CACCCAGCTACCCAACTCAC -3´

Tab. 5 - Sequences of primers used in chIP assay, designed by Primer3 software, according to the sequence of rat Cyp1a1 promoter region published by Sogawa. 3.10 RNA interference (RNAi) 3.10.1 Cell transfections with short interfering RNA (siRNA) WB-F344 cells were plated at density of 20,000 cells/cm2 in 24-well plates in DMEM/F12 medium without antibiotics. After 24 h cultivation, transfections were performed, using the previously described siRNA duplexes directed against rat AhR mRNA sequence or control siRNA directed against mRNA encoding the red fluorescence protein DsRed [115]. The transfections were carried out in a total volume of 600 µl containing 20 pmol siRNA and 1 µl of Lipofectamine 2000 (Invitrogen, Carlsbad, CA), according to the manufacturer’s instructions. Transfection mix was removed 24 h later and cells were cultivated for another 24 h in DMEM/F12 medium with antibiotics, followed by exposure to DMSO (0.1%), TCDD (5 nM) or 3M4NF (10µM) for 48 h.

-53-

3. Materials and methods 3.10.2 Short hairpin RNA (shRNA) 3.10.2.1 Design of shRNA Short hairpin shRNA was designed according to the published recommendations [393395] by using Block-iTTM RNAi Designer freeware (Invitrogen), using either siRNA-shRNA mode to design shRNA from published siRNA targeted against AhR [115], termed SI, or shRNA mode to design original shRNA sequence, termed INV (see Table 6). cDNA sequence for shRNA targeted against β-galactosidase (β-gal), supplied as a part of Block-iTTM Inducible H1 RNAi Entry vector kit (Invitrogen), was used as a negative control in shRNA experiments. 3.10.2.2 Preparation of tetracycline-inducible vector system for shRNA 3.10.2.2.1 DNA agarose electrophoresis 2 g of agarose (Fluka, Buchs, Switzerland) were boiled in 100 ml of 1x TAE buffer (40 mM Tris-base; 1.14% v/v glacial acetic acid; 1 mM Na2EDTA; pH 7.6), cooled to 5060°C, poured into gel tank with combs (Omnibio, Brno, Czech Republic) and left to reach ambient temperature (1 h). DNA samples (up to 1 µg) or DNA standards (Fermentas, Burlington, Canada and New England Biolabs, Ipswich, MA) were mixed with DNAse-free water and 1 µl of 10x loading dye buffer to obtain 10 µl of reaction mix, which was then. loaded onto gel and separated at 5V/cm in 1xTAE buffer. 3.10.2.2.2 DNA polyacrylamide electrophoresis (DNA-PAGE) Sample DNA (up to 0.5 µg) or DNA standards (Fermentas, Burlington, Canada and New England Biolabs, Ipswich, MA) were mixed with DNAse-free watter and 1 µl of 10x loading dye buffer to obtain 10 µl of reaction mix. 20% Polyacrylamide gel was prepared as shown in Table 4 and DNA samples were separated on vertical electrophoresis system MiniProtean II (BioRad) at 5V/cm in 1x TAE buffer.

-54-

3. Materials and methods 3.10.2.2.3 Cloning of shRNA cDNAs into pENTR/H1/TO vector Designed shRNA sequences were synthesized as cDNA (Generi-Biotech, Hradec králové, Czech Republic) and, together with β-gal shRNA, further processed as described in Block-iTTM Inducible H1 RNAi Entry vector kit´s manual (document avaible on Invitrogen website): Synthetised cDNAs were first annealed in 10x annealing buffer, separated by DNAPAGE (see chapter 3.10.2.2.2.) and visualised by Syber Green I (Molecular Probes) staining to assess ratio of single stranded (ss) and double stranded (ds) DNA for preparation of appropriate ligation mix. After ligation into the pENTR/H1/TO vector (for further details see Block-iTTM Inducible H1 RNAi Entry vector kit´s manual), plasmids pENTR/H1/TO/LacZ, pENTR/H1/TO/INV and pENTR/H1/TO/SI were isolated by QIAprep Spin Miniprep kit (Qiagen, Hilden, Germany) according to the manufacturer´s instructions, quantified by Nanodrop (NanoDrop Technologies) and 500 ng of each plasmid DNA were digested by 1020 units of restriction enzyme Bam HI (Fermentas, Burlington, Canada) at 37°C overnight. DNA fragments were separated by 2% agarose electrophoresis, stained by Syber Green I and visualized by UltraLum. 3.10.2.3 Transient cell transfections with shRNA constructs WB-F344 cells were plated at density of 20,000 cells/cm2 in 24-well plates in DMEM/F12 medium without antibiotics. After 24 h cultivation, transfections were performed, using the previously described plasmids expressing shRNA directed against rat AhR mRNA sequence or control plasmid expressing shRNA directed against β-gal mRNA. The transfections were carried out in a total volume of 600 µl containing 1 µM shRNA- plasmids and 1 µl of Lipofectamine 2000 (Invitrogen, Carlsbad, CA), according to the manufacturer’s instructions. Transfection mix was removed 24 h later and cells were cultivated for another 24 h in DMEM/F12 medium with antibiotics, followed by exposure to DMSO (0.1%), TCDD (5 nM) for 48 h with or without addition of tetracycline (1 µg/ml, Invitrogen). 3.11 Statistical analysis The mRNA data were analyzed by nonparametric Mann-Whitney U-test or ANOVA followed by Tukey test. Cell proliferation data were expressed as means ± standard deviation

-55-

3. Materials and methods of at least three independent experiments and, similar to flow cytometry data, analyzed by non-parametric Mann-Whitney U-test.

A P value of less than 0.05 was considered

significant.

-56-

4. Results 4

RESULTS

4.1

AhR-mediated signaling in rat oval ´stem-like´ cells, WB-F344 In order to investigate the capacity of various classes of AhR ligands to activate AhR in

WB-F344 cell line, a model of rat hepatic progenitor cells, we treated confluent WB-F344 cells with DMSO (0.1%), TCDD (5 nM), 3M4NF (1 µM, 10 µM), BNF (1 µM, 10 µM), their combinations with dioxin; with indirubin (50 pM, 100 pM, 1 nM, 10 nM) or with PCB 126 (50 nM, 1 µM) and examined AhR cellular localization and AhR mRNA and protein levels, in nuclear, cytoplasmic or total cell extracts. 4.1.1

Cellular localization of AhR in WB-F344 cells Both growing and confluent WB-F344 cells were exposed to either DMSO or to model

AhR ligands for 0.5 h. In subconfluent population, AhR was found to be localized both in cytoplasm and in nucleus. On the other hand, we detected predominantly cytoplasmic AhR localization in confluent cells. All tested ligands induced translocation of AhR from cytosol into the nucleus in a dose-dependent manner. This effect was detectable from 0.5 h up to 72 h after treatment exposure (Fig. 12A,B; data not shown). The ligand-induced translocation of AhR was further confirmed by detection of increased AhR protein levels in nuclear extracts prepared from cells treated with test compounds for 0.5 h or 1 h (Fig. 13). 4.1.2

Ligand-induced AhR protein degradation AhR is known to become a substrate of 26S proteasome following its activation by its

ligands, such as TCDD [137]. Therefore, we next determined receptor levels in total protein lysates isolated from WB-F344 cells exposed to AhR ligands for 1, 6, 24 or 48 h. We observed that ligands like TCDD or PCB 126 (1 µM) (Fig. 14-16; data not shown) were able to induce a rapid and a long-term AhR degradation, while other tested compounds, such as flavones, or potential endogenous ligand indirubin, were found to cause distinct individual changes in AhR degradation, which seemed to depend both on a ligand structure and its concentration. For example, BNF at 1 µM concentration induced a decrease of AhR levels only during the first 24 h after treatment, whereas exposure of cells to higher (10 µM) concentration led to a prolonged duration of receptor degradation (Fig. 14A).

-57-

B)

A)

4. Results

-58-

4. Results C)

Fig. 12 - Cellular localization of AhR. Localization of AhR was assessed by indirect immunofluorescence using staining with anti-AhR antibody in confluent WB-F344 cells treated with TCDD, 3M4NF, BNF (A); with indirubin and PCB 126 for 0.5 h (B); or in untreated subconfluent and confluent WB-F344 cells (C). DMSO (0.1%) was used as a control. The data are representative of three independent experiments.

- 59-

4. Results Fig.13 - Ligand-induced nuclear translocation of AhR. AhR protein was detected by Western blotting in nuclear extracts isolated from WB-F344 exposed to AhR ligands for 1 h. Poly(ADP)-ribose polymerase (PARP), β-actin or nonspecific total protein staining by amidoblack (AB) were used as loading controls. The data are representative of two independent experiments. The presumed AhR antagonist 3M4NF did not change AhR protein levels at lower concentration; however, a transient decrease of receptor levels was observed when WB-F344 cells were treated with 10 µM concentration of 3M4NF. Furthermore, a significant part of total AhR pool was still detected in cytoplasm, thus suggesting that 3M4NF induces only a partial nuclear translocation of AhR (Fig. 14B). Interestingly, in cells co-treated with 3M4NF and TCDD, we observed an attenuation of AhR degradation. This indicated the capacity of 3M4NF, when used at 10 µM concentration, to abolish effects of TCDD on receptor degradation. These results seem to suggest that 3M4NF might act both as AhR antagonist and as agonist. Contrary to 3M4NF, BNF had no effect on kinetics or duration of TCDD-induced decrease of AhR protein level (Fig. 14A). AhR protein degradation was also determined in total protein lysates of WB-F344 cells treated with another AhR ligand, indirubin for 6 h. This potential endogenous AhR ligand induced a dose-dependent AhR degradation, with no detectable decrease of receptor protein level when the lowest 50 pM concentration was used (Fig. 15). A)

- 60-

4. Results B)

Fig. 14 - Detection of AhR degradation induced by synthetic flavones and/or TCDD. Total protein lysates (A), or cytoplasmic extracts (B) were isolated from WB-F344 cells exposed to DMSO (0.1%), TCDD (5 nM), 3M4NF (1 µM, 10 µM), BNF (1 µM, 10 µM) or to combinations of flavones with TCDD for 1, 6, 24 and 48 h. Levels of AhR protein were detected by Western blotting using anti-AhR antibody. β-actin was used as loading control. The data are representative of three independent experiments.

Fig. 15 - Detection of AhR degradation induced by indirubin in confluent WB-F344 cells. Total protein lysates were isolated from WB-F344 cells exposed to DMSO (0.1%), TCDD (5 nM; positive control), indirubin (50 pM, 100 pM, 1 nM, 10 nM) for 6 h. Levels of AhR protein were detected by Western blotting using anti-AhR antibody. β-actin was used as loading control. The data are representative of three independent experiments.

- 61-

4. Results Fig. 16 - Detection of AhR degradation induced by TCDD and PCB 126 in confluent WB-F344 cells. Total protein lysates were isolated from WB-F344 cells exposed to DMSO (0.1%), TCDD (5 nM), PCB 126 (1 µM) for 6 h and 48 h. Levels of AhR protein were detected by Western blotting using antiAhR antibody. β-actin was used as loading control. The data are representative of three independent experiments. 4.1.3

Detection of AhR/ARNT1 complex bound to DRE sequences by EMSA assay Activation of AhR leads to formation of AhR/ARNT1 complex recognizing DRE

sequences localized in enhancer regions of AhR-target genes [182]. To investigate the capacity of various AhR ligands to induce formation of AhR/ARNT1/DRE complexes in WBF344 cells, we performed electrophoretic mobility shift assay (EMSA) with DRE sequences derived from enhancer region of Cyp1a1 gene (Fig. 17). TCDD, BNF and PCB 126 were found to induce formation of these complexes in nuclear extracts isolated from WB-F344 cells treated for 1 h. Again, 3M4NF did not induce formation of AhR containing complexes at any tested concentration. In contrast to BNF, 3M4NF was also able to prevent TCDD-induced formation of AhR/ARNT1/DRE complexes at both 1 and 10 µM concentrations. To verify the identification of specific band in EMSA samples, we co-incubated samples from AhR ligandtreated cells with unlabelled DRE sequences (wtDRE) or with unlabelled DRE sequences mutated in core region (mutDRE); we also performed supershift control sample assay using TCDD-treated nuclear extracts co-incubated with ARNT1 antibody. The same samples used in experiments with wtDRE sequences were incubated with mutDRE sequences, in order to test the specifity of AhR/ARNT1 binding to the used DRE oligonucleotide (Fig. 18).

- 62-

4. Results

Fig. 17 - EMSA assay with wtDRE sequences. WB-F344 cells were treated with DMSO (0.1%), TCDD (5 nM), 3M4NF (1 µM, 10 µM), BNF (1µM, 10 µM), combinations of both flavones with TCDD and with PCB 126 (1 µM) for 1h, then the nuclear extracts were isolated. Absence or presence of AhR/ARNT1/DRE complexes in each sample were assessed by EMSA assay with wtDRE. Competitive, specific and supershift controls were also performed. The data are representative of three independent experiments.

- 63-

4. Results

Fig. 18 - Control EMSA assay with mutDRE sequences. WB-F344 cells were treated with DMSO (0.1%), TCDD (5 nM), 3M4NF (1 µM, 10 µM), BNF (1µM, 10 µM), combinations of both flavones with TCDD for 1h, then the nuclear extracts were isolated. Purity of AhR/ARNT1/DRE complexes in each sample (Fig. 17) was verified by EMSA assay with mutDRE. The data are representative of three independent experiments.

- 64-

4. Results 4.1.4

Expression of Cyp1a1 gene Next, we determined expression of Cyp1a1 gene at both mRNA and protein levels in

confluent WB-F344 cells treated with model AhR ligands. TCDD, BNF and PCB 126 induced a massive increase of Cyp1a1 mRNA levels 6 h and/or 48 h after treatment (Fig. 19; Fig. 21). TCDD induced the highest elevation of Cyp1a1 mRNA (this was further used as a positive control, 100%), which was consistent throughout 48 h (Fig. 19). In contrast to stable AhR ligands, TCDD and/or PCB 126 (100% and/or 72% upon 48 h treatment, respectively) (Fig. 21), the BNF-induced increase of Cyp1a1 mRNA was only transient, as it was reduced to 4% upon 48 h treatment. Surprisingly, WB-F344 cells treated with 10 µM concentration of BNF exhibited a lower increase in Cyp1a1 mRNA (27%) upon 6 h treatment, when compared with 1 µM concentration. Moreover, BNF was found to attenuate the dioxin-induced elevation of Cyp1a1 mRNA levels after 6 h cultivation. 3M4NF increased Cyp1a1 mRNA levels by 16% and 8% upon 6 h treatment with 1 and 10 µM concentrations of 3M4NF, respectively. Although lower than the TCDD- or BNF- induced mRNA expression, these findings indicated that ability of this flavone to act also as an AhR agonist. Similar to AhR degradation, 3M4NF effectively reduced TCDD-induced increase of Cyp1a1 mRNA expression (to 31 and 7% upon 6 h co-treatment of cells with TCDD and 3M4NF used at 1 and 10 µM concentrations, respectively), but only the 10 µM concentration of 3M4NF effectively suppressed Cyp1a1 mRNA levels (32%) after 48 h, thus indicating again the role of metabolic rate of 3M4NF. Indirubin did not induce Cyp1a1 expression at mRNA level, with exception of the highest 10 nM concentration (Fig. 22). The mRNA data largely corresponded with the results of detection of CYP1A1 protein levels performed by Western blotting (Fig. 20; Fig. 21; Fig. 22). However, few notable exceptions were observed. PCB 126 and BNF were shown to be as potent CYP1A1 protein inducers as TCDD, and moreover BNF at 10 µM did not inhibit TCDD-induced increase of CYP1A1 protein. Although 3M4NF used in 1 µM concentration was shown to be able to prevent TCDD effects on AhR activation, we still detected increased levels of CYP1A1 protein in WB-F344 cells co-treated with 3M4NF and TCDD. Short half-life of Cyp1a1 mRNA could be a possible explanation of the observed discrepancies between mRNA and protein data as reported from other cell lines [396]. Indirubin had no effect on CYP1A1 protein expression (Fig. 22).

- 65-

4. Results

Fig. 19 - Detection of Cyp1a1 mRNA levels in confluent WB-F344 cells treated with TCDD and/or flavones. Confluent WB-F344 cell were exposed to DMSO (0.1%), TCDD (5 nM), 3M4NF (1 and 10 µM), BNF (1 and 10 µM) or to combinations of flavones with TCDD for 6 and 48 h. Total mRNA was isolated and Cyp1a1 mRNA was quantified by RT-PCR. mRNA data were analyzed using ANOVA followed by Tukey test. Symbol ´#´ denotes a significant difference between negative control (DMSO 0.1%) and treated samples (P < 0.05). Symbol ´*´ denotes a significant difference between positive control (TCDD 5 nM) and treated samples (P < 0.05).

- 66-

4. Results

Fig. 20 - Detection of CYP1A1 protein level in confluent WB-F344 cells. Confluent WBF344 cell were exposed to DMSO (0.1%), TCDD (5 nM), 3M4NF (1 and 10 µM), BNF (1 and 10 µM) and flavones combinations with TCDD for 6 h and 48 h. Total protein lysates were isolated and analyzed using anti-CYP1A1 antibody. β-actin was used as loading control. The data are representative of three independent experiments.

A)

B)

Fig. 21 - Detection of CYP1A1 expression in confluent WB-F344 cells treated with TCDD and PCB 126. A) Confluent WB-F344 cells were exposed to DMSO (0.1%), TCDD (5 nM) or PCB 126 (1 µM) for 48 h. Total mRNA was isolated and Cyp1a1 mRNA was quantified by RT-PCR. mRNA data were analyzed using ANOVA followed by Tukey test. Symbol ´#´ denotes a significant difference between negative control (DMSO 0.1%) and treated samples (P < 0.05). B) Confluent WB-F344 cells were exposed to DMSO (0.1%), TCDD (5 nM) or PCB 126 (50 nM) for 48 h. Total protein lysates were isolated and analyzed

- 67-

4. Results using anti-CYP1A1 antibody. β-actin was used as loading control. The data are representative of three independent experiments.

Fig. 22 - Detection of CYP1A1 expression in confluent WB-F344 cells treated with TCDD and indirubin. A) Confluent WB-F344 cells were exposed to DMSO (0.1%), TCDD (5 nM) or indirubin (50 pM, 100 pM, 1 nM, 10 nM) for 6 h. Total mRNA was isolated and Cyp1a1 mRNA was quantified by RT-PCR. mRNA data were analyzed using ANOVA followed by Tukey test. Symbol ´*´ denotes a significant difference between negative control (DMSO 0.1%) and treated samples (P < 0.05). B) Confluent WB-F344 cells were exposed to DMSO (0.1%), TCDD (5 nM) or indirubin (50 pM, 100 pM, 1 nM, 10 nM) for 6 h. Total protein lysates were isolated and analyzed using anti-CYP1A1 antibody. β-actin was used as loading control. The data are representative of three independent experiments. 4.1.5

Detection of AhR/ARNT1 complex bound to DRE sequences by ChIP assay As described above, 3M4NF did not induce binding of AhR/ARNT1 complex to

synthetic DRE oligonucleotides as revealed by EMSA assay, however, when Cyp1a1 mRNA expression was measured, 3M4NF was demostrated to increase cytochrome mRNA levels. Therefore, we next tested formation of AhR/ARNT1/DRE complex by chromatin immunoprecipitation assay (ChiP). First, we investigated TCDD-induced occupation of DRE sequences located at -1040 bp and -1271 bp upstream from the first exon of Cyp1a1 gene [128]. TCDD was able to induce AhR binding 0.5 h and 1 h after treatment exposure, but no - 68-

4. Results complex formation was detected after 2 h (Fig. 23). Therefore, 1h treatment with 3M4NF (1 and 10 µM) was used in further immunoprecipitation studies. 3M4NF was found to induce formation of AhR/ARNT1/DRE complex in the ChIP assay.

Fig. 23 - ChIP assay of the TCDD-and 3M4NF-induced occupation of Cyp1a1 enhancer region. Confluent WB-F344 cells were exposed to DMSO (0.1%), TCDD (5 nM) or 3M4NF (1 and 10 µM) for 0.5 h, 1 h and 2 h, and further processed by chromatin immunoprecipitation analysis. The data are representative of two independent experiments. 4.1.6

Effects of AhR ligands on expression of other AhR-regulated genes Despite a wide use of Cyp1a1 gene as a model AhR target gene, it has been reported

that expression of cytochrome P450 1A1 can be regulated by other, AhR-independent, signaling pathways [28]. Therefore, we next studied three additional gene targets regulated by AhR (Fig. 24): i) Cyp1b1, which is known to be induced in response to various AhR ligands in a cell-specific manner; ii) Nqo1, gene reported to be regulated by AhR, or by its target gene, Nrf2, which can be also activated by oxidative stress; iii) Cdh13, gene encoding protein T-cadherin, which has been reported to be downregulated by several AhR ligands. We treated WB-F344 cells with DMSO (0.1%), TCDD (5 nM), 3M4NF (1 µM) or BNF (1 µM), and quantified mRNA levels of Cyp1b1, Nqo1 after 24 h exposure and T-cadherin mRNA levels after 48 h treatment. Cyp1a1 mRNA levels of after 24 h were also measured, in order to compare inducibility of various AhR gene targets. TCDD-treated cells exhibited 158-fold induction of Cyp1a1 mRNA, 23-fold induction of Cyp1b1 mRNA, 3.5-fold induction of

- 69-

4. Results Nqo1 mRNA, while expression of T-cadherin mRNA was reduced to 90% when compared to control level (DMSO). 3M4NF-treated cells exhibited only 7-fold induction of Cyp1a1 mRNA, but 11-fold induction of Cyp1b1 mRNA and 3-fold induction of Nqo1 mRNA, while T-cadherin mRNA level was reduced to 41% when compared to DMSO. In BNF-treated cells we detected 104-fold induction of Cyp1a1 mRNA, 21-fold induction of Cyp1b1 mRNA, 4fold induction of Nqo1 mRNA and reduction of T-cadherin mRNA to 76% of control. When Cdh13 expression was studied in WB-F344 cells treated with PCB 126 (50 nM), we also observed significant decrease of T-cadherin mRNA (Fig. 24). Thus, 3M4NF efficiently induced other AhR-target genes than Cyp1a1 and, together with PCB 126, it was the most potent downregulator of Cdh13 expression. In agreement with our previous results, indirubin was a weak inducer of Cyp1b1 expression after 6 h after treatment at the highest concentration.

- 70-

4. Results

Fig. 24 - Induction of expression of AhR target genes by model AhR ligands in WB-F344 cells. Confluent WB-F344 cells were exposed to DMSO (0.1%), TCDD (5 nM), 3M4NF (1 µM), BNF (1 µM), PCB 126 (50 nM) or indirubin (50 pM, 100 pM, 1 nM, 10 nM) for 6 h, 24 h or 48 h. Total mRNA was isolated and Cyp1a1, Cyp1b1, Nqo1 and T-cadherin mRNAs were quantified by RT-PCR. mRNA data were analyzed using ANOVA followed by Tukey test. The data are representative of three independent experiments. Symbols ´*´ and ´**´ denote a significant difference between negative control (DMSO 0.1%) and treated samples (P < 0.05 and P < 0.01, respectively). 4.1.7

Capacity of various AhR ligands to induce degradation of ERα Besides activation of AhR signaling, a number of AhR ligands, like PAHs, TCDD or

natural occuring flavones were reported to interfere with ERα signaling pathway and thus affect expression of ER-dependent genes in both AhR-independent and AhR-dependent manner. Therefore, we examined ERα degradation induced by model AhR ligands in WBF344 cells. Total protein lysates obtained from confluent WB-F344 cells treated with DMSO (0.1%), TCDD (5 nM), 3M4NF (10 µM), BNF (10 µM) and indirubin (50 pM, 100 pM, 1 nM, 10 nM) for 6 h were analyzed by Western blotting, using a specific anti-ERα antibody. Only cells treated with TCDD and 10 nM indirubin exhibited decreased ERα protein levels. This indicated that this receptor is either directly activated by TCDD and indirubin, or degraded via ligand-specific AhR activation in the in vitro model of oval cells (Fig. 25).

- 71-

4. Results

Fig. 25 - Degradation of ERα induced by AhR ligands. Confluent WB-F344 cells were treated with DMSO (0.1%), TCDD (5 nM), 3M4NF (10 µM), BNF (10 µM) or indirubin (50 pM, 100 pM, 1 nM, 10 nM) for 6 h. Total protein lysates were separated by PAGE and transferred to PVDF membrane followed by incubation with anti-ERα antibody. β-actin was used as loading control. The data are representative of two independent experiments. 4.2

Analysis of cytokinetic parameters of contact-inhibited WB-F344 cells exposed to AhR ligands In order to investigate the effects of selected AhR ligands on cell proliferation and cell

cycle, we treated confluent WB-F344 cells with DMSO (0.1%), TCDD (5 nM), 3M4NF (1 and 10 µM), BNF (1 and 10 µM), combination of both flavones with dioxin, PCB 126 (50 nM) or indirubin (50 pM, 100 pM, 1 nM, 10 nM) for 24 h (cell cycle analysis), or 72 h (cell numbers).

- 72-

4. Results

Fig. 26 - Effect of TCDD and flavones on proliferation of WB-F344 cells. Confluent WBF344 cells were exposed to DMSO (0.1%), TCDD (5 nM), 3M4NF (1 and 10 µM), BNF (1 and 10 µM) and combination of both flavones with TCDD. After 72 h treatment, cells were counted with Coulter Counter. The results represent means ± S.D. of three independent experiments. Data were analyzed using non-parametric Mann-Whitney U-test. Symbol ´*´ denotes a significant difference between negative control (DMSO) and treated samples (P < 0.05).

Fig. 27 - Effects of TCDD, PCB 126 and indirubin on proliferation of WB-F344 cells. Confluent WB-F344 cells were exposed to DMSO (0.1%), TCDD (5 nM), PCB 126 (50 nM) or indirubin (50 pM, 100 pM, 1 nM, 10 nM). After 72 h treatment, cells were counted with - 73-

4. Results Coulter Counter. The results represent means ± S.D. of three independent experiments. Data were analyzed using non-parametric Mann-Whitney U-test. Symbol ´*´ denotes a significant difference between negative control (DMSO) and treated samples (P < 0.05). 4.2.1 Induction of proliferation in confluent WB-F344 cells by AhR ligands TCDD has been shown to have direct effects on proliferation rate of various cell lines, including the WB-F344 cells. Therefore,

we tested various classes of AhR ligands for

capacity to modulate proliferation of confluent WB-F344 cells. Both dioxin and other AhR agonists, such as BNF and PCB 126, induced cell proliferation as reflected by 1.7-fold increase in cell numbers. Surprisingly, also AhR antagonist 3M4NF was found to increase of numbers of WB-F344 cells, when compared to DMSO-treated control. Combination of both flavones with TCDD had the same effects on cell numbers, as when each compound was used individually (Fig. 26; Fig. 27). Only one of the tested AhR ligands, indirubin, had no effect on proliferation of confluent WB-F344 cells (Fig. 27). 4.2.2 Cell cycle progression of confluent WB-F344 cells exposed to AhR ligands In order to confirm the proliferation data, we performed flow cytometric cell cycle analysis on WB-F344 cells after 24 h treatment with selected AhR ligands. Cell cycle analysis revealed an increased percentage of cells in S-phase of cell cycle induced by 24 h treatment of confluent WB-F344 cells with TCDD, PCB 126, 3M4NF and BNF at all tested concentrations. Again, cells treated with combination of flavones and TCDD almost did not differ in percentage of cells in S-phase from individual compounds. Indirubin used in various concentrations had no effect on percentage of cells entering S-phase (Fig. 28; Fig. 29).

- 74-

4. Results

Fig. 28 - Cell cycle progresion of TCDD- and flavone-treated WB-F344 cells. Confluent WB-F344 cells were exposed to DMSO (0.1%), TCDD (5 nM), 3M4NF (1 and 10 µM), BNF (1 and 10 µM) or combination of both flavones and TCDD. After 24 h treatment, cells were fixed with 70% ethanol and analyzed by flow cytometry. The results represent means ± S.D. of three independent experiments. Data were analyzed using non-parametric Mann-Whitney U-test. Symbol ´*´ denotes a significant difference between negative control (DMSO) and treated samples (P < 0.05).

Fig. 29 - Cell cycle progresion of TCDD-, PCB 126- and indirubin-treated WB-F344 cells. Confluent WB-F344 cells were exposed to DMSO (0.1%), TCDD (5 nM), PCB 126 (50 nM) or indirubin (50 pM, 100 pM, 1 nM, 10 nM). After 24 h treatment, cells were fixed with 70% ethanol and analyzed by flow cytometry. The results represent means ± S.D. of three - 75-

4. Results independent experiments. Data were analyzed using non-parametric Mann-Whitney U-test. Symbol ´*´ denotes a significant difference between negative control (DMSO) and treated samples (P < 0.05). 4.2.3

Expression of Ccna2 gene Since the progression of cells through cell cycle is accompanied with expression of

Ccna2 gene encoding protein cyclin A and contact inhibition has been also shown to be a key regulator of cyclin A expression [397], we further investigated, whether observed increase in percentage of cells in S-phase correlated with Ccna2 expression. TCDD-, 3M4NF- and BNF-treated cells expressed significantly higher levels of Cyclin A2 mRNA (2-3-fold), when compared to DMSO (negative control), with 3M4NF (10 µM) inducing even higher Cyclin A2 mRNA levels (3-fold) than DMSO, significantly higher than TCDD and BNF (Fig. 30). Cyclin A2 mRNA levels detected in cells co-treated with flavones and TCDD did not differ from individual compounds. mRNA data were confirmed by observation of a sustained elevation of Cyclin A protein in cells treated with both individual AhR ligands and their combinations, with 3M4NF again being the most effective compound (Fig. 31). Like TCDD, PCB 126 was found to be a potent inducer of Ccna2 expression 24 h after treatment (Fig. 38).

Fig. 30 - Detection of Cyclin A2 mRNA levels in confluent WB-F344 cells treated with TCDD and flavones. Confluent WB-F344 cell were exposed to DMSO (0.1%), TCDD (5 nM), 3M4NF (1 and 10 µM), BNF (1 and 10 µM) or flavones in combination with TCDD for

- 76-

4. Results 48 h. Total mRNA was isolated and Cyclin A2 mRNA was quantified by RT-PCR. mRNA data were analyzed using ANOVA followed by Tukey test. Symbol ´#´ denotes a significant difference between negative control (DMSO 0.1%) and treated samples (P < 0.05). Symbol ´*´ denotes a significant difference between positive control (TCDD 5 nM) and treated samples (P < 0.05).

Fig. 31 - Detection of Cyclin A protein levels in confluent WB-F344 cells. Confluent WBF344 cell were exposed to DMSO (0.1%), TCDD (5 nM), 3M4NF (1 and 10 µM), BNF (1 and 10 µM) or flavones in combination with TCDD for 6 h and 48 h. Total protein lysates were isolated and analyzed by Western blotting. β-actin was used as loading control. The data are representative of three independent experiments. 4.3

AhR activation in rat BP8 and 5L hepatoma cells Effects of various AhR ligands, TCDD especially, on cell proliferation and cell cycle

have been widely studied in hepatoma cells, being used as a model of mature hepatocytes. Therefore, we next used rat hepatoma cell lines BP8 and 5L to study activation of AhR induced by TCDD (5 nM) and PCB 126 (50 nM) in these cells, in order to compare the role of these ligands in cell kinetics of hepatoma cells and in vitro model of rat liver progenitor cells. 4.3.1 Cellular localization and ligand-induced degradation of AhR protein in rat hepatoma cells BP8 and 5L cells were exposed to vehicle control DMSO (0.1%), or model AhR ligands described above, for 6 h, 24 h and 48 h. As expected, TCDD and PCB 126 induced a

- 77-

4. Results sustained receptor degradation and AhR translocation to the nucleus only in 5L cells, while AhR-deficient BP8 exhibited no detectable AhR (Fig. 32, Fig. 33).

Fig. 32 - AhR degradation in rat hepatoma cells. 5L and BP8 cells were treated with DMSO (0.1%), TCDD (5 nM) or PCB 126 (50 nM) for 6 h, 24 h and 48 h, then total protein lysates were isolated and analyzed by Western blotting. The data are representative of two independent experiments.

Fig. 33 - Nuclear translocation of AhR induced by TCDD and PCB 126 in 5L cells. Rat hepatoma cells were treated with DMSO (0.1%), TCDD (5 nM) and PCB 126 (50 nM) for 48 h and both nuclear and cytoplasmic extracts were isolated. Detection of AhR protein level was performed by Western blotting. PARP and amidoblack (AB) staining were used for control of samples loading. The data are representative of two independent experiments.

- 78-

4. Results 4.3.2 Expression of AhR-target genes in rat hepatoma cells In order to compare the effects of AhR ligands on the AhR-dependent gene expression in hepatoma and WB-F344 cells, we determined expression of AhR-target genes Cyp1a1 and Cyp1b1 in both rat hepatoma cell lines treated with DMSO (0.1%), TCDD (5 nM) and PCB 126 (50 nM) for 6 h, 24 h and 48 h. Both TCDD and PCB 126 induced a strong increase of CYP1A1 and CYP1B1 protein level in 5L cells (Fig. 34), while neither of these two CYP isoforms was detected in BP8 cells (data not shown). In order to compare amount of CYPs and AhR protein, we further analyzed lysates isolated from 5L and WB-F344 cells exposed to the same treatment for 24 h and 48 h (Fig. 34; data not shown). Interestingly, WB-F344 cells exhibited stronger increase in CYP1B1 protein level and weaker increase in CYP1A1 protein level when compared to 5L cells, whereas the increase of CYP1A1 protein in 5L cells was extremely high. Moreover, 5L cells exhibited a generally lower expression of AhR, as compared to WB-F344 cells (Fig. 35).

Fig. 34 - Expression of AhR-target genes in 5L cells. Protein levels of CYP1A1 and CYP1B1 were visualised by specific antibodies in 5L cells treated with DMSO (0.1%), TCDD (5 nM) or PCB 126 (50 nM) for 6 h, 24 h and 48 h. β-actin was used as loading control. The data are representative of two independent experiments.

- 79-

4. Results

Fig. 35 - Comparison of AhR levels and its target genes expression in 5L and WB-F344 cells. Protein levels of AhR, CYP1A1 and CYP1B1 were visualised by specific antibodies in 5L and WB-F344 cells treated with DMSO (0.1%), TCDD (5 nM) or PCB 126 (50 nM) for 24 h. β-actin was used as loading control. The data are representative of two independent experiments. 4.4

Analysis of cytokinetic parameters of exponentially-growing rat hepatoma cells exposed to AhR ligands In order to investigate the effects of selected AhR ligands on cytokinetic parameters

(cell proliferation and cell cycle) in hepatoma cells, we treated growing 5L and BP8 cells with DMSO (0.1%), TCDD (5 nM) or PCB 126 (50 nM) for 24 h or 72 h. 4.4.1 Repression of proliferation in rat hepatoma cells exposed to AhR ligands TCDD has been reported to inhibit proliferation rate of 5L cells, while having no effect on BP8 cells [76]. Therefore, we verified the ability of TCDD and PCB 126 (50 nM) to inhibit proliferation of rat hepatoma cells in our cultivation conditions. Both AhR agonists significantly reduced 5L cell number by 1.5-fold and 4-fold as measured 24 h and 72 h after treatment of cells in exponential growth phase. Neither TCDD, nor PCB 126 had any effect on proliferative rate of BP8 cells (Fig. 36).

- 80-

4. Results

Fig. 36 - Effects of AhR ligands on proliferation of exponentially-growing rat hepatoma cells. 5L and BP8 cells were exposed to DMSO (0.1%), TCDD (5 nM) or PCB 126 (50 nM). After 6 h, 24 h and 48 h treatment, cells were counted using Coulter Counter. The results represent means ± S.D. of three independent experiments. Data were analyzed using nonparametric Mann-Whitney U-test and t-test. Symbol ´*´ denotes a significant difference between negative control (DMSO) and treated samples (P < 0.05). 4.4.2 Cell cycle analysis of rat hepatoma cells exposed to AhR ligands Next, we performed flow cytometric analysis of cell cycle at 6 h, 24 h and 48 h after treatment with DMSO (0.1%), TCDD (5 nM) and PCB 126 (50 nM). Both tested AhR ligands significantly decreased percentage of cells in S-phase and increased percentage of cells in G1phase already after 6 h treatment. We observed a decreased percentage of cells in S-phase (7-fold) and G2/M-phase (5-fold), as well as an increased percentage of cells G1-phase (2.1fold) of cell cycle upon 24 h and/or 48 h treatment of growing 5L cells. AhR ligands had no effect on cell cycle of BP8 cells (Fig, 37; data not shown).

- 81-

4. Results

Fig. 37 - Cell cycle analysis of TCDD- and PCB 126-treated rat hepatoma cells. Exponentially-growing 5L and BP8 cells were exposed to DMSO (0.1%), TCDD (5 nM) or PCB 126 (50 nM). After 6 h or 24 h treatment, cells were fixed with 70% ethanol and analyzed by flow cytometry. The results represent means ± S.D. of three independent experiments. Data were analyzed using non-parametric Mann-Whitney U-test and t-test. Symbol ´*´ denotes a significant difference between negative control (DMSO) and treated samples (P < 0.05). 4.4.3 Comparison of Cyclin A expression in hepatoma cells and in WB-F344 cells In contrast to a sustained elevation of Cyclin A protein in confluent WB-F344 cells treated with AhR ligands, a significant reduction of Cyclin A levels was observed in 5L cells. Both cell lines were treated with DMSO (0.1%), TCDD (5 nM) or PCB 126 (50 nM) for 24 h and 48 h (Fig. 38; data not shown). Again, BP8 cells exhibited no significant changes of Cyclin A protein, when exposed to either dioxin or PCB 126 (Fig. 38).

- 82-

4. Results

Fig. 38 - Detection of Cyclin A protein level in rat oval and hepatoma cells exposed to TCDD and PCB 126. Confluent WB-F344 cells and exponentially-growing 5L and BP8 cells were exposed to DMSO (0.1%), TCDD (5 nM) or PCB 126 (50 nM) for 24 h. Total protein lysates were isolated and analyzed by Western blotting. β-actin was used as loading control. The data are representative of two independent experiments. 4.5 Deregulation of cell-to-cell communication Disruption of cell-to-cell communication is an integral part of a release from contact inhibition [72]. Therefore, we analyzed protein and/or mRNA levels of cadherins and catenins, which form a part of adherens and desmosomal junctions in liver cells. Confluent WB-F344 cells and growing 5L and BP8 cells were exposed to DMSO (0.1%), TCDD (5 nM), 3M4NF (10 µM), BNF (10 µM), or combinations of flavones with TCDD, or with PCB 126 (50 nM and 1 µM) for 6 h, 24 h and 48 h. 4.5.1

AhR ligands suppress expression of cadherins and catenins in confluent WB-F344 cells Confluent WB-F344 cells were treated as described previously and analyzed for levels

of γ-catenin (PKG), β-catenin and T-cadherin mRNAs. T-cadherin expression was reduced upon 48 h treatment of cells with BNF, 3M4NF or PCB 126 (Fig. 24). WB-F344 cells exhibited decreased PKG mRNA levels (5-fold) after 48 h treatment with TCDD (5nM) and PCB 126 (50 nM). No significant changes of β-catenin mRNA levels were found either 24 h or after 48 h treatment (Fig. 39; data not shown).

- 83-

4. Results

Fig. 39 - Quantification of PKG and β-catenin mRNA levels in confluent WB-F344 cells. Confluent WB-F344 cells were exposed to TCDD (5 nM) and PCB 126 (50 nM) for 24 h and 48 h. Total mRNA was isolated and β-catenin and PKG mRNAs were quantified by RT-PCR. Data were analyzed using ANOVA followed by Tukey test. Symbol ´*´ denotes a significant difference between negative control (DMSO 0.1%) and treated samples (P < 0.05). Similar to mRNA data, analysis of PKG protein expression had revealed decreased PKG levels 6 h, 24 h and 48h after treatment of confluent WB-F344 cells with TCDD or PCB 126 (50 nM) (Fig. 41). Moreover, 3M4NF (10 µM) and its combination with TCDD also decreased PKG levels, while BNF (10 µM), surprisingly, had no effect on PKG expression after 48 h treatment (Fig. 40). Although neither TCDD nor PCB 126 changed expression of βcatenin mRNA, we detected a reduction of total β-catenin protein in protein lysates isolated from cell treated for 48 h. We next investigated expression of another protein playing a key role in formation of adherens junctions, E-cadherin. TCDD, PCB 126 and 3M4NF were found to reduce Ecadherin protein levels, while BNF again did not reduce its expression. When various time intervals of treatment were tested, only 48 h and 72 h treatments led to a reduced E-cadherin expression (Fig. 40, Fig. 41). Taken together, all tested ligands were shown to be potent modulators of T-cadherin expression and with the exception of BNF, they were also able to downregulate PKG, β-catenin and E-cadherin expression in confluent WB-F344 cells (Fig. 24, Fig. 40, Fig. 41).

- 84-

4. Results

Fig. 40 - Flavones and TCDD downregulate expression of plakoglobin and E-cadherin in confluent WB-F344 cells. Confluent WB-F344 cells were exposed to DMSO (0.1%), TCDD (5 nM), 3M4NF (10 µM), BNF (10 µM) or combinations of flavones with TCDD for 48 h. Total protein lysates were isolated and analyzed using anti-PKG and anti-E-cadherin antibodies. β-actin was used as loading control. The data are representative of three independent experiments.

Fig. 41 - TCDD and PCB 126 reduce expression of plakoglobin, β-catenin and Ecadherin in confluent WB-F344 cells. Confluent WB-F344 cells were exposed to DMSO (0.1%), TCDD (5 nM) or PCB 126 (50 nM) for 24 h and 48 h. Total protein lysates were isolated and analyzed with anti-PKG, anti-β-catenin and anti-E-cadherin antibodies. β-actin was used as loading control. The data are representative of three independent experiments.

- 85-

4. Results Expression of other liver specific cadherins, such as LI-cadherin and N-cadherin was also tested, however we found no basal expression of these molecules in WB-F344 cells (data not shown). In order to describe effects of AhR ligands on localization pattern of β-catenin and plakoglobin, we treated confluent WB-F344 cells grown on microscopic slides with DMSO (0.1%), TCDD (5 nM), PCB 126 (50 nM) or 3M4NF (10 µM) for 48 h, fixed cells and visualised the proteins with specific antibodies. Both TCDD and PCB 126 changed visulization pattern of active (dephosphorylated) β-catenin localization, predominantly in those regions, where cell monolayers were replaced with multiple layers of cells as indicated by DAPI staining (Fig. 42A). However, in contrast to these findings, when immunocytochemistry staining of total β-catenin was performed, both TCDD and PCB 126 induced disruption of β-catenin staining in cell membranes and formation of cellular regions, where β-catenin staining was not detectable (Fig. 42B). Similar results were obtained, when PKG immunocytochemistry staining was performed; TCDD, PCB 126 and 3M4NF again induced a loss of PKG positive staining in specific regions of cell monolayer (Fig. 42C). A)

- 86-

4. Results B)

C)

Fig. 42 - Immunocytochemistry of active form and total levels of β-catenin and plakoglobin in confluent WB-F344 cells in response to AhR ligands. Confluent WB-F344 cells were exposed to DMSO (0.1%), TCDD (5 nM), PCB 126 (50 nM) and 3M4NF (10 µM) for 48 h. Cells were fixed with methanol:aceton mix, incubated with A) anti-ABC-β-catenin, B) anti-β-catenin and C) anti-plakoglobin antibodies and visualized with anti-mouse or antirabbit specific Alexa Fluor 488 antibodies. Nuclei of WB-F344 cells stained by anti-ABC-βcatenin were visualized by DAPI. Images of cells were also taken in bright light (BL). The data are representative of two independent experiments.

- 87-

4. Results 4.5.2

Comparison of expression profiles of adhesive molecules in rat hepatoma cells and in WB-F344 cells Confluent WB-F344 cells and growing rat hepatoma 5L and BP8 cells were exposed to

DMSO (0.1%), TCDD (5 nM) and PCB 126 (50 nM) for 24 h and then analyzed for protein levels of T-cadherin, E-cadherin, active β-catenin, phosphorylated-β-catenin and PKG. We used different β-catenin antibodies: i) ABC-β-catenin antibody detecting only active βcatenin form, dephosphorylated on S37 and T41 residues; ii) antibody specific for β-catenin with phosphorylated S33, S37 and T41 residues, which is supposed to be the substrate of proteasomal degradation – p-β-catenin; and iii) antibody detecting total β-catenin levels. We observed differences in basal levels of E-cadherin, ABC-β-catenin and p-β-catenin between hepatoma and oval cells. In summary, WB-F344 cells exhibited lower protein levels of Ecadherin and both phosphorylated and active forms of β-catenin, in comparison to both rat hepatoma cell lines (Fig. 43). Moreover, BP8 cells exhibited no changes in protein levels of any tested adhesive molecule in reponse to AhR ligands. As expected, expression of Ecadherin was not affected by AhR ligands either in oval or hepatoma cells analyzed after 24 h treatment. T-cadherin levels were decreased in response to TCDD and PCB 126 exposure only at pro-T-cadherin level in 5L cells. We did not detect any decrease in T-cadherin protein level in WB-F344 cells. Contrary to that, plakoglobin level was strongly reduced in WB-F344 cells, while a moderate decrease in protein level was also observed in 5L cells. Finally, expression of active ABC-β-catenin form was enhanced in 5L cells and reduced in oval cells in response to both TCDD and PCB 126.

- 88-

4. Results

Fig. 43 - AhR ligands- induced changes in expression profile of adhesive molecules in rat oval cells and in hepatoma cells. Confluent WB-F344 cells, and exponentially-growing 5L and BP8 cells were exposed to DMSO (0.1%), TCDD (5 nM) or PCB 126 (50 nM) for 24 h. Total protein lysates were isolated and analyzed by Western blotting. β-actin was used as loading control. These results represent preliminary data. 4.5.3 Effect of EGF-induced proliferation on β-catenin expression Confluent WB-F344 cells were treated with EGF (10 ng/ml), TCDD (5 nM) and PCB 126 (50 nM) and analyzed for levels of ABC-β-catenin. ABC-β-catenin expression was reduced upon 24 h treatment of cells with AhR ligands TCDD and PCB 126, and also with mitogenic stimulus in form of EGF (Fig. 44).

- 89-

4. Results

Fig. 44 - TCDD, PCB 126 and EGF reduce levels of active form of β-catenin in confluent WB-F344 cells. Confluent WB-F344 cells were exposed to DMSO (0.1%), TCDD (5 nM), PCB 126 (50 nM) and EGF (10 ng/ml) for 24 h. Total protein lysates were isolated and analyzed with anti-ABC-β-catenin antibody for elucidating protein level. β-actin was used as loading control. The data are representative of two independent experiments. 4.6 Alternative approaches for studying AhR function To understand the role of AhR in proliferation, cell cycle regulation and xenobiotic metabolism in hepatic oval cells WB-F344 upon treatment with various classes of AhR ligands, we decided to modulate expression of AhR in these cells by RNA interference techniques. We used short interfering RNA (siRNA) and short hairpin RNA (shRNA) to repress expression of AhR and to study effects of model AhR ligands on WB-F344 cytokinetics. As an alternative approach, we also examined effects of dominant negative AhR and ARNT mutants in WB-F344 cells. 4.6.1 AhR-specific siRNA RNA interference mediated by siRNA is one of the most frequent methods used for silencing of specific target genes. Short interfering RNA (siRNA) sequences targeted against AhR mRNA were used as described previously [115,398]. Confluent WB-F344 cells were seeded and transfected as described in Materials and Methods, and 48 h after transfection treated with DMSO (0.1%), TCDD (1 nM and 5 nM) or 3M4NF (10 µM) for 24 h, 48 h or 72 h. Cells were then processed for determining of cell numbers and cell cycle analysis, or for Western blotting analysis of protein expression.

- 90-

4. Results

4.6.1.1

The role of AhR in TCDD effects on PKG expression in WB-F344 cells

WB-F344 cells with downregulated AhR were exposed to DMSO (0.1%) and TCDD (5 nM) for 6 h (Fig. 45A). Total protein lysates were further analyzed with anti-AhR and antiCYP1A1 antibodies to determine the degree of AhR silencing. As expected, silencing of AhR led to prevention of TCDD-induced CYP1A1 expression (Fig. 45A). Moreover, when WBF344 cells transfected with siRNA were treated with TCDD (1 nM) for 48 h, we did not observed a decrease of PKG protein (Fig. 45b). Actually, downregulation of AhR in control cells led to an increased PKG protein expression. However, effects of siRNA were diminished at 48 h, probably due to the siRNA degradation (Fig. 45B; data not shown). 4.6.1.2

Role of AhR in the effects of 3M4NF on WB-F344 cells

We next used siRNA knock-down of AhR expression to investigate, if the proliferation of oval cells induced by AhR antagonist 3M4NF is AhR-dependent. Cells transfected with AhR–specific siRNA and treated with 3M4NF (10 µM) for 48 h were analyzed for cell numbers, cell cycle progression and protein levels of AhR, Cyclin A and CYP1A1. The transfection with anti-AhR siRNA fully prevented the 3M4NF-induced increase in cell numbers, and it partially reversed cell cycle progression induced by 3M4NF (Fig. 46A,B). The downregulation of AhR also reduced the 3M4NF-induced Cyclin A and CYP1A1 protein levels (Fig. 46C). These data confirmed that the effects of 3M4NF in WB-F344 cells are mediated by AhR.

- 91-

4. Results

A)

B)

Fig. 45 - Effects of AhR downregulation on basal expression and TCDD-induced downregulation of PKG. WB-F344 cells were transfected with AhR-specific siRNA and nonspecific siRNA (DsRed) and treated with TCDD (1 nM and 5 nM). A) After 6 h, transfectants were processed for Western blotting detection of CYP1A1 and AhR. β-actin was used as loading control. B) After 24 h and 48 h treatments, total protein lysates were processed and PKG protein levels were analyzed by western blotting. PARP was used as loading control.

- 92-

4. Results

A)

B)

C)

Fig. 46 - Effects of siRNA targeting AhR on 3M4NF activity. Confluent WB-F344 cells were transfected with AhR-specific or non-specific (DsRed) siRNAs for 24 h and then treated with DMSO (0.1%) and 3M4NF (10 µM) for 48 h. A) Cells were harvested by trypsinization and counted with Coulter Counter. B) Cells were harvested by trypsinization, fixed with 70% ethanol and analyzed by flow cytometry. C) Total protein lysates were analyzed by Western blotting. β-actin was used as loading control. The results represent means ± S.D. of three independent experiments. Data were analyzed using non-parametric Mann-Whitney U-test. Symbol ´*´ denotes a significant difference between negative control (0.1% DMSO) and - 93-

4. Results treated samples (P < 0.05). Symbol ´#´ denotes a significant difference between effect of 3M4NF in non-transfected cells and in cells transfected with siRNA (P < 0.05). 4.6.2

AhR-specific shRNA Downregulation of AhR mediated by siRNA is only transient and level of target protein

is restored when siRNA is degraded. In order to study effects of long-term AhR deficiency in rat hepatic oval cells, we attempted to downregulate AhR by using shRNA mediating both constitutive and inducible repression of AhR. 4.6.2.1 Design of shRNAs targeted against rat AhR mRNA and their cloning into the expression vector- pENTR/H1/TO Sequences of model shRNA were designed as cDNAs to interfere with rat AhR mRNA. SI-shRNA/AhR sequence was derived from siRNA targeted against rat AhR mRNA by Block-iTTM

RNAi

Designer

(mode

siRNA-shRNA)

(http://rnaidesigner.invitrogen.com/rnaiexpress/). INV sequence was designed originally by Block-iT TM RNAi Designer (mode shRNA Sense-Loop-Antisense) from AhR mRNA sequence (NM_013149.1) (Tab. 6). Sequences were designed to be compatible with BlockiTTM Inducible RNAi Entry Vector kit and synthesized as single stranded (ss) oligonucleotides. Annealing of ss-cDNAs was performed according to the instructions described in Block-iTTM Inducible RNAi Entry Vector kit and its efficiency was checked by DNA-PAGE (Fig. 47). Although annealing of both cDNA types was not complete, it was sufficient for cloning into pENTR/H1/TO vector as described in manual of Block-iTTM Inducible RNAi Entry Vector kit. In order to verify the purity of cloned pENTR/H1/TO-SI and pENTR/H1/TO-INV constructs, specific digestion with BamHI restriction enzyme was performed. Together with designed AhR-specific shRNAs, control (shRNA targeted against β-galactosidase) shRNA supplied with Block-iTTM Inducible RNAi Entry Vector kit was also cloned into the pENTR/H1/TO vector and final construct was again verified by BamHI digestion, where specific 3 700 bp and 215 bp fragments were detected (Fig. 48). Sequence analysis of cloning site in all three plasmid DNA were further performed (VBC Genomics), in order to exclude the presence of mutated bases in cloned inserts encoding shRNAs and/or in plasmid regulatory regions of promoter and terminator. - 94-

4. Results Name

Sequences 5´ - 3´

SI- shRNA/AhR

CACCGCGTTAGATGTTCCTCTGTGCGAA CACAGAGGAACATCTAACG

(siRNA- shRNA)

INVshRNA/AhR (shRNA-SLA)

Source

siRNA/ AhR

AAAACGTTAGATGTTCCTCTGTGTTCGC ACAGAGGAACATCTAACGC CACCGGAATTAAGTCAAACCCTTCTCGA AAGAAGGGTTTGACTTAATTCC AAAAGGAATTAAGTCAAACCCTTCTTTC GAGAAGGGTTTGACTTAATTCC

NM_013149.1

Tab. 6 - shRNAs designed for AhR-downregulation. Sequences of cDNAs used for shRNA were designed by Block-iTTM RNAi Designer freeware. An additional „G“ base was added to the shRNA sequence, in order to enable efficient transcription initiation by the RNA polymerase III. Purple typed bases represent linker for proper cloning into the pENTR/H1/TO vector, green typed bases represent sense sequences, while the red ones represent antisense sequences. Black typed bases represent loop, single stranded sequence typical for each shRNA. The sequences used by Block-iTTM RNAi Designer as matrix are depicted in table as Source.

Fig. 47 - Annealing of ss-cDNAs encoding shRNA targeted against rat AhR mRNA. Designed and synthesized ss-cDNAs enconding two AhR-specific shRNAs, INV and SI, were

- 95-

4. Results annealed according to Block-iTTM Inducible RNAi Entry Vector kit and separated by DNAPAGE. Ultra Low Range (Fermentas) and 50 bp ladder (BioLabs) were used as DNA standards.

Fig. 48 - Purity of expression plasmids.

pENTR/H1/TO-LacZ,

pENTR/H1/TO-INV pENTR/H1/TO-SI

and plasmids

were

digested with BamHI at 37°C for 18 h and

separated

electrophoresis.

by

agarose

MassRuler

ladder

was used as DNA standard.

4.6.2.2 Transient transfection of confluent WB-F344 cells with shRNA constructs Confluent WB-F344 cells were transfected with pENTR/H1/TO-SI, pENTR/H1/TOINV and pENTR/H1/TO-LacZ plasmids and treated with DMSO (0.1%) and TCDD (5 nM) for 24 h. Neither INV shRNA nor SI shRNA were able to provide a major reduction endogenous AhR protein level in DMSO-treated WB-F344 cells. However, when AhR and CYP1A1 expression was tested in TCDD-treated WB-F344 cells, a decrease in AhR and CYP1A1 protein levels was detected in pENTR/H1/TO-SI- and pENTR/H1/TO-INVtransfected cells, with the latter being the more efficient in reduction of AhR level (Fig. 49). However, when compared to siRNA-mediated downregulation of AhR, both shRNAs were much less efficient. As expected, the cells transfected with pENTR/H1/TO-LacZ construct exhibited the same levels of AhR and CYP1A1 as control non-transfected cells.

- 96-

4. Results

Fig. 49 - Efficiency of AhR downregulation by shRNA-expressing constructs. Confluent WB-F344 cells were transfected with shRNA expressing constructs, pENTR/H1/TO-SI and pENTR/H1/TO-INV, and treated with DMSO (0.1%) and TCDD (5 nM) for 24 h. Total protein lysates were analyzed by Western blotting. pENTR/H1/TO-LacZ construct was used as nonspecific RNAi control. β-actin was used as loading control. The data are representative of two independent experiments. 4.6.3 AhR dominant-negative mutants To confirm the results obtained from siRNA experiments, WB-F344 clones expressing dominant negative AhR (obtained from dr. C.Dietrich, JGU, Mainz) were used for determining the effects of TCDD and PCB 126 on cytokinetic parameters (WB-F344 ∆7 cells). WB-F344 cells transfected with empty pcDNA3 vector, were used as a transfection control (WB-F344 vector). The presence of mutated AhR prevented TCDD- and PCB 126induced increase in proliferation rate of WB-F344 cells detected 48 h after treatment (Fig. 50A). These cells was shown to express the same protein level of AhR as wild-type WB-F344 cells. Again, treatment of cells with both AhR ligands resulted in receptor protein degradation. As a next step, expression of AhR-target gene Cyp1a1 was tested in order to confirm the capacity of dominant negative AhR variant to inhibit induction of Cyp1a1 expression 24h and 48h after treatment. Both TCDD- and PCB 126-induced Cyp1a1 gene - 97-

4. Results expression was abrogated in WB-F344 cells expressing dominant negative AhR (Fig. 50B,D). As the increased cell number were associated with elevated expression of S-phase specific Cyclin A, we also tested expression of Ccna2 gene 24 h and 48 h after exposure of cells to DMSO, TCDD and PCB 126 (Fig. 30; Fig. 38; Fig. 50C). Expression of dominant negative AhR mutant was found to prevent induction of both mRNA and Cyclin A protein (Fig. 50C,D). Althogether, these data confirmed that AhR is essential for both TCDD- and PCB 126-induced release of WB-F344 cells from contact inhibition, which is associated with an increased expression of Cyclin A. 4.6.4 ARNT dominant negative mutants We next explored the effect of bHLH domain-deficient ARNT [399] on AhR signaling in WB-F344 treated with TCDD (5 nM) or PCB 126 (100 nM) for 24 h and 48 h. We detected a significant reduction of both TCDD- and PCB 126-induced Cyp1a1 expression in cells expressing dominant negative form of ARNT protein (WB-F344 ∆B16) as compared to wild type cells (Fig. 51B). Next, we tested capacity of both AhR ligands to induce proliferation of confluent WB-F344 ∆B16 cells, 48 h after treatment, and compared it with proliferation rate of wild type cells and WB-F344 cells transfected only with pSV2Neo vector conferring resistance to G418 selection antibiotic (Neo12). Expression of AhR and its TCDD- and PCB 126-induced degradation in WB-F344 ∆B16 cells was similar as in wild type WB-F344 cells (Fig. 51D). Surprisingly, cells expressing mutated ARNT were still responsive to proliferative stimuli of TCDD and PCB 126, although when compared to wt cells or Neo12 clone WBF344 cells, the maximum cell numbers were partly decreased (Fig. 51A). In agreement with these data, presence of bHLH-deficient ARNT in WB-F344 cells had no effect on Ccna2 gene expression (Fig. 51C,D). These experiments indicated a possible ARNT-independent role of AhR in deregulation of contact inhibition.

- 98-

4. Results A)

B)

C)

D)

Fig. 50 - Effects of dominant negative variant of AhR protein on AhR signaling. WBF344 stably transfected with pcDNA3 vector (vector control) or dominant negative AhR (∆7) were used for the following experiments. 48 h after treatment of cells with DMSO (0.1%), TCDD (5 nM) or PCB 126 (50 nM) we determined cell numbers by CyQuant assay (A) and detected expression of AhR, CYP1A1 and Cyclin A by Western blotting (D). Induction of Cyp1a1 (B) and Cyclin A2 mRNAs (C) were detected after 24 h treatment. Proliferation and mRNA data were analyzed by non-parametric Mann-Whitney U-test. With exception of preliminary Western blotting data, proliferation and mRNA data are representative of three independent experiments. Symbol ´*´ denotes a significant difference between negative control (DMSO 0.1%) and treated samples (P < 0.05). Symbol ´#´ denotes a significant difference between treated samples isolated from WB-F344-vector cells and treated samples isolated from WB-F344 transfected with dnAhR (∆7) (P < 0.05). - 99-

4. Results

A)

B)

C)

D)

- 100-

4. Results Fig. 51 - Effects of dominant negative ARNT mutant on AhR signaling in WB-F344 cells. WB-F344 were stably transfected with pSV2Neo plasmid (vector control; Neo12) or with dominant negative ARNT (∆B16). Cell numbers were analyzed by CyQuant (A) and AhR, CYP1A1 and Cyclin A levels were analyzed by Western blotting (D), after 48 h treatment of cells with DMSO (0.1%), TCDD (5 nM) or PCB 126 (50 nM). Induction of Cyp1a1 (B) and Cyclin A2 mRNAs (C) were detected after 24 h treatment. Proliferation and mRNA data were analyzed by non-parametric Mann-Whitney U-test.

Symbol ´*´ denotes a significant

difference between negative control (DMSO 0.1%) and treated samples (P < 0.05). Symbol ´#´ denotes a significant difference between treated samples isolated from WB-F344-vector cells (Neo12) and treated samples isolated from WB-F344 transfected with dnARNT (∆Β16) (P < 0.05).

- 101-

5. Discussion 5

DISCUSSION Carcinogenesis is a multistep process of transformation of normal diploid cells into

malignant cancer cells, which are self-sufficient in growth signals, insensitive to growthinhibitory signals, evade cell death, have limitless replicative potential and sustained angiogenesis, finally leading to tissue invasion and metastasis [400]. Over the past decades, it has become apparent that some environmental pollutants might act as effective carcinogens, possibly contributing to human cancer development [189]. In vertebrates, one of the most affected organs during the exposure to environmental chemicals is the liver. Toxic chemical stress may contribute to development of multiple liver disorders, such as cirrhosis, steatosis or fibrosis, thus representing conditions, which may futher develop into preneoplastic stages and into hepatocellular carcinoma (HCC). Although hepatocytes and billiary epithelial cells represent cell populations most frequently affected by xenobiotics, other liver cell populations can be also targeted by enviromental carcinogens. These include so-called oval cells, which retain the capacity of pluripotent ´stem-like´ cells, and which play a dual role both in liver regeneration and in liver cancer development [51,203]. Among the chemicals known to induce liver cancer in experimental animals, persistent ligands of the aryl hydrocarbon receptor (AhR) seem to play a prominent role. As it is becoming increasingly apparent that deregulation of AhR physiological roles may affect cellular differentiation, proliferation or apoptosis [92,131,199], it seems important to study these processes in individual liver cell populations. Several studies have suggested that AhR agonists may disrupt cell proliferation control in tissue model of liver oval cells, which is a mechanism possibly contributing to tumor promotion [62,63,66]. Therefore, the present study had three principal aims. First, to describe AhR signaling leading to AhR-dependent gene expression and deregulated cell growth, triggered by both AhR agonists and partial AhR antagonists in model rat liver cell line exhibiting properties of liver oval cells – WB-F344 cell line. Second, to analyze the effects of AhR ligands on regulation of expression of proteins involved in formation of cellto-cell contacts, in order to provide a more detailed description of processes leading to disruption of contact inhibition. And finally, to develop or implement techniques enabling to confirm the role of AhR in deregulation of contact inhibition and/or modulation of cell-to-cell communication. Apart from PAHs or HAHs, many natural compounds, such as flavonoids have been found to be potent AhR agonists and/or antagonists usually in concentration-dependent -102-

5. Discussion manner [224]. These plant metabolites have been also shown to prevent toxic effects of TCDD and some of their synthetic analogues have been reported to inhibit cell proliferation in e.g. rat hepatoma cells in AhR-independent manner [226,246,401-403]. Therefore, we chose for our studies β-naphthoflavone (BNF), which is a synthetic flavone commonly used as AhR agonist and which reportedly acts as tumor promoter in rat liver exposed to DEN [236,237], and 3´-methoxy-4´-nitroflavone (3M4NF), which has been designed to act as AhR antagonist and is commonly used as an inhibitor of AhR signaling [4,114,239,242,243,248]. As the vast majority of known AhR ligands are exogenous chemical compounds, identification of endogenous ligands is becoming required for a precise understanding of the role that AhR plays in animal development and metabolism. Among these, indirubin, which is a metabolite of tryptophane, has received a wide attention due to its high affinity for AhR [178]. Therefore, in a first set of experiments, we studied the effects of different classes of AhR ligands on AhR signaling in WB-F344 cells. In the absence of ligand, AhR is localized in cytoplasm in a multiprotein complex consisting of hsp90 dimer, immunophilin-like protein XAP2 and co-chaperon p23 [103,106,112]. Ligand-binding induces Ah receptor nuclear translocation, heterodimerization with ARNT protein and binding of AhR/ARNT complex to DNA motifs known as dioxin responsive elements (DRE) or xenobiotic responsive elements (XRE) (for review see [92]). AhR nuclear uptake represents a crucial step in AhR signaling upon its activation by model AhR agonists, such as TCDD [404]. Nevertheless, it has been demostrated that AhR localization

is

also

cell

density-dependent

[113].

In

the

present

study,

both

immunocytochemistry staining of WB-F344 cells (Fig. 12) and Western blotting analysis of nuclear extracts (Fig. 13) revealed that AhR changes its localization pattern both in response to cell density-dependent regulation and in response to exogenous ligand. Similar to immortalized human keratinocytes [113], AhR was present both in the cytoplasm and in the nucleus of growing WB-F344 cells, whereas in confluent WB-F344 cells AhR was predominantly localized in cytoplasm, although a minor part of this transcription factor still remained in the nucleus. This minor nuclear pool of AhR was detectable only by Western blotting assay of nuclear extracts (data not shown). All tested exogenous and endogenous AhR ligands (with the exception of the lowest used indirubin concentration – 50 pM), induced AhR translocation to the nucleus. TCDD and PCB 126 were the most potent long-term inducers of AhR nuclear localization, probably due to a combination of their high affinity for AhR ligand binding site (LBS) and their general metabolic resistance [150,182,189]. -103-

5. Discussion Importantly, although the TCDD-induced AhR translocation has been reported to be inhibited by 3M4NF in e.g. MCF-7 or Hepa1c1c7 cells, we observed that 3M4NF itself induced nuclear uptake of AhR in WB-F344 cells and that it had no inhibitory effect on AhR translocation induced by TCDD (Fig. 12, Fig. 13) [242,243]. Another characteristic feature of AhR signaling, as well as signaling mediated by other nuclear receptors, is the degradation of ligand-activated receptor [136]. AhR protein degradation has been observed e.g. in hepatoma cells exposed to model AhR agonists, TCDD and BNF [137,405,406]. Therefore, both cytoplasmic and total protein extracts isolated from WB-F344 were further analyzed to determine AhR protein level upon its activation by model AhR ligands. We observed that both TCDD and PCB 126 induce AhR degradation in confluent WB-F344 cells. In line with the evidence that they are AhR agonists, both BNF and indirubin effectively induced AhR degradation (Fig. 14A, Fig. 15, Fig. 16). In contrast to these results, the 3M4NF-induced AhR degradation was quite low (Fig. 14A) and a large part of AhR still remained detectable in cytoplasm (Fig. 14B). Moreover, 3M4NF was found to inhibit the TCDD-induced AhR degradation in confluent WB-F344 cells (Fig. 14A). Since the proteasomal degradation of AhR may depend on proportion of AhR translocation to the nucleus and AhR transformation to its active form capable to bind enhancer/promoter regions of AhR target genes [136], the lack of AhR degradation after 3M4NF treatment could be attributed to inefficient transformation of AhR to its active conformation. To verify this possibility, we performed electrophoretic mobility shift assay and detected no binding of AhR/ARNT complex to synthetic oligonucleotide containing DRE sites in WB-F344 cells treated with 3M4NF (Fig. 17). Furthermore, 3M4NF was able to prevent TCDD-induced binding of AhR/ARNT complex to DRE, while BNF had no such effect (Fig. 17). Comparable results have been observed in MCF7 and Hepa1c1c7 cells, where 3M4NF has also prevented TCDD-induced AhR/ARNT binding to DRE [239,242]. The duration of suppressive effects of 3M4NF depended on flavone concentration and it was probably faciliated by effective competition of both ligands, TCDD and 3M4NF, for AhR binding, as decribed previously [242,248]. The purely antagonistic effects of 3M4NF had become questionable, when it has been described that 3M4NF may induce expression of a model AhR-dependent gene, Cyp1a1, in mouse hepatoma cells, which indicated that 3M4NF antagonism may depend on species, concentration and the promoter context of a particular AhR-target gene [248,407]. In the present study, we also detected 3M4NF-induced Cyp1a1 expression at both mRNA (Fig. 19) -104-

5. Discussion and protein levels (Fig. 20; Fig. 46). However, when compared with Cyp1a1 expression level detected in TCDD- and BNF- treated cells, the 3M4NF-induced expression of Cyp1a1 was minimal at the mRNA level and almost undetectable at the protein level. Again, 3M4NF efficiently reduced the TCDD-induced Cyp1a1 expression at both mRNA and protein levels in a dose-dependent manner (Fig. 19, Fig. 20). These findings are in a agreement with observations in MCF7 and Hepa1c1c7 cells, where 3M4NF also has been found to reduce the TCDD-induced EROD activity, although in these cells 3M4NF itself failed to induce Cyp1a1 expression [242,243]. BNF is widely used as a model AhR agonist inducing Cyp1a1 expression in various organs of rats [408,409]. In the present study, BNF induced Cyp1a1 expression also in WB-F344 cells. However, surprisingly, when 10 µM concentration was used, an inhibitory effect of BNF on TCDD-induced Cyp1a1 mRNA was observed, similar to 3M4NF. These results indicated, to our knowledge for the first time, that BNF might also act as partial AhR antagonist in a concentration-dependent manner, like the isomeric αnaphthoflavone (ANF) [239,240]. The inhibitory effect of BNF was not observed at CYP1A1 protein level, which might be due to the lower sensitivity of Western blotting analysis in comparison with RT-PCR assay. In contrast to data obtained with model flavones, although indirubin was found to induce AhR translocation and degradation when used at 100 pM and 1 nM concentrations, it had no effect on Cyp1a1 expression both at mRNA and protein levels (Fig. 12, Fig. 13, Fig. 15, Fig. 22). Only the highest used concentration of indirubin (10 nM) was sufficient to induce, in addition to AhR nuclear translocation and AhR protein degradation, also a significant induction of Cyp1a1 expression. Therefore, the effects of indirubin on Cyp1a1 expression seem to depend on cell type as indicated by experiments performed in human hepatoma HepG2 cells, where expression of Cyp1a1 mRNA was induced by indirubin, when used in more than one order lower concentration [178]. Since 3M4NF induced CYP1A1 expression despite failing to induce AhR/ARNT binding to synthetic oligonucleotides containing DRE sequences, ChIP assays were performed using the samples isolated from 3M4NF-treated WB-F344 cells, in order to explain the discrepancies between EMSA results and Cyp1a1 mRNA expression data. We found, that TCDD induced formation of AhR-containing complexes on DREs 0.5 h and 1 h after dioxin treatment, while no AhR-containing complex was detected in 2 h-treated WB-F344 cells. These observations were in a good agreement with previously reported results, where changes of chromatin structure of enhancers located upstream of Cyp1a1 gene and induction of Cyp1a1 expression have been detected 0.5 h and 1 h after eposure of hepatoma cells to TCDD -105-

5. Discussion [123,410,411]. Based on these results, we selected time intervals (0.5 h and 1h) for studying effects of 3M4NF on AhR signaling in WB-F344 cells. Although we did not detect formation of 3M4NF-induced AhR/ARNT/DRE complex in EMSA assay, we detected this complex with ChIP assay. This might be caused by a limited sensitivity of EMSA assay or by formation of transient and unstable AhR/ARNT complexes inefficient to bind synthetic DRE in the absence of chromatin context. Similar discrepancies between EMSA and ChIP results have been observed, when e.g. Stat5 binding sites were analyzed in human breast cancer cells [412]. Taken together, the chromatin immunoprecipitation experiments confirmed that 3M4NF induced formation of AhR-containing complexes in enhancer regions of rat Cyp1a1 gene. Apart from Cyp1a1, AhR regulates expression of other target genes like e.g. Cyp1a2, Ugt1a6, Cyp1b1, Nqo1, cdh13, p21 etc. [182,327] and vice versa, Cyp1a1 expression can be regulated by other, AhR-independent, pathways [28]. However, in past, effects of 3M4NF on AhR signaling have been demonstrated only in the context of Cyp1a1 gene expression or using luciferase reporter construct with cloned fragments of Cyp1a1 promoter region [114,242,248]. Therefore, nothing is currently known about the impact of 3M4NF on expression profile of other AhR-target genes. We therefore selected Cyp1b1, Nqo1 and Cdh13 genes in order to investigate the effects of TCDD, PCB 126, 3M4NF, BNF and indirubin on their expression in WB-F344 cells. Both TCDD and BNF induced a similar expression of Cyp1b1 and Nqo1 genes (Fig. 24). Surprisingly, 3M4NF was also found to be a potent inducer of these genes (Fig. 24). It has been reported previously that TCDD, B[a]P and 7,12dimethylbenzanthracene (DMBA) repress T-cadherin mRNA levels in vascular smooth muscle cells and that this effect could be reverted by other AhR ligands, like ANF [327]. However, we did not detect significant TCDD-induced repression of T-cadherin mRNA level in WB-F344 cells. In contrast, we detected 3M4NF-induced, BNF-induced and PCB 126induced decrease of T-cadherin mRNA level after 48-h treatment (Fig. 24). When effects of indirubin on AhR-target gene expression was tested, this hypothetical endogenous AhR ligand did not induce any changes in Cyp1b1 or T-cadherin mRNA levels (Fig. 24; data not shown). However, as indirubin is rapidly degraded and it did not induce proliferation of confluent WB-F344 cells, one might conclude that effect of this possible AhR endogenous ligand on Cdh13 expression would be rather minor in this cell line. Interestingly, in contrast to our data, indirubin has been shown to induce both Cyp1a1 and Cyp1b1 expression in MCF7 cells 6 h

-106-

5. Discussion after treatment [413]. Thus, effect of indirubin on expression of CYP genes seems to be yet again cell type-specific. As mentioned above, carcinogenesis is a multistep process, which involves deregulation of cell proliferation. TCDD induces cell cycle arrest in e.g. human hepatoma HepG2 cells, mouse hepatoma Hepa1c1c7 cells, rat primary hepatocytes or in rat hepatoma 5L cells [75,249,262]. In contrast to these findings, both we and others have observed that TCDD induces increased proliferation of confluent WB-F344 cells, which is accompanied with accumulation of cells in S-phase of cell cycle and an increased expression of Cyclin A (Fig. 26, Fig. 28) [62,63]. Similar results have been obtained with other suspected carcinogens such as benzo[b]fluoranthene, benz[a]anthracene or PCB 126 (this study, [63,65]). The enhanced Cyclin A expression correlates with an increased Cdk2/CycA activity in WB-F344 cells treated with various PAHs or HAHs, [398]. These effects are presumably mediated by AhR, which is known to participate in regulation of cell cycle, apoptosis and cell proliferation [91,92,131,398,414]. Therefore, we next examined the effects of model flavones and indirubin on cell proliferation and compared them with model persistent AhR ligands – TCDD and PCB 126. Both synthetic flavones induced cell proliferation (Fig. 26) and cell cycle progression (Fig. 28) accompanied with elevated expression of Cyclin A at both mRNA (Fig. 30) and protein levels (Fig. 31). In contrast, we detected no effect of indirubin on these cytokinetic parameters (Fig. 27, Fig. 29). These results seem to suggest that indirubin is not able to induce WB-F344 cell proliferation, either due to an insufficient AhR activation, or due to the ability of indirubin to inhibit activity of cyclin-dependent kinases or other proteins involved in cell cycle regulation [173,176]. Due to their structural similarity with natural occurring ligands of estrogen receptor (ER), several flavonoids have been found to behave as phytoestrogens [222]. Thus, like other AhR ligands including TCDD, they may bind to both AhR and ER and to either augment or repress ER signaling [415]. For example, quercetin and genistein have been shown to activate ER signaling and stimulate proliferation of breast cancer cells [416]. One of the events occuring during activation of ER signaling is ERα/β degradation [417], although some specific ER ligands like e.g. tamoxifen may activate ER signaling without inducing ER degradation [418]. The nature of ERα degradation induced by dioxins and related compounds is still an issue of a considerable controversy. As the expression of ERβ was not detected in

-107-

5. Discussion confluent WB-F344 cells, we therefore investigated ERα protein degradation, in order to find out, if selected flavones might also affect cell proliferation and cell cycle progression of WBF344 cells in other than AhR-dependent manner. We detected ERα protein degradation only in WB-F344 cells treated with TCDD or PCB 126, but not with any of tested flavones (Fig. 25). These results seemingly excluded the possibility that effects of both flavones on cytokinetic parameters of WB-F344 cells could be mediated by ERα. Surprisingly, when indirubin-induced ERα degradation was analyzed, we also detected decreased ERα protein level in WB-F344 cells treated with indirubin 10 nM (Fig. 25), thus suggesting that it may also interfere with ERα signaling. To our knowledge, this is the first time, when any influence of indirubin on ERα protein degradation was observed. In order to resolve, whether the 3M4NF-induced changes in cell proliferation, cell cycle progression and cyclin A expression are directly mediated by AhR activation, we further performed targeted downregulation of AhR mRNA by specific short interfering RNA (siRNA AhR; Fig. 46C) [115]. Downregulation of AhR levels by siRNA largely prevented proliferative effects of 3M4NF. The cells with downregulated AhR protein level also exhibited a partial reversion of 3M4NF-induced accumulation of cells in S-phase of cell cycle (Fig. 46B). When Cyclin A protein levels were studied in 3M4NF-treated WB-F344 cells with downregulated AhR, we detected protein levels comparable to those of control DMSOtreated cells. Taken together, these experiments demonstrated that 3M4NF-induced effects on proliferation of confluent WB-F344 cells depends on presence of a functional AhR. This is in a sharp contrast with the previous reports describing 3M4NF as a pure AhR antagonist [239,242]. As these results again demonstrated the crucial role of AhR in deregulation of contact inhibition, we were further interested if these events are dependent not only on functional AhR, but also on its dimerization partner, ARNT. Therefore, in addition to siRNA approach, we attempted to downregulate AhR expression by shRNA sequences targeted against rat AhR mRNA (SI, INV). However, despite the successful AhR donwregulation mediated by siRNA, specific shRNAs did not sufficiently downregulated expression of AhR in WB-F344 cells (Fig. 49). Therefore, we further used WB-F344 cells expressing dominant negative form of AhR (∆495-805 aa, dnAhR-∆7), which lacks the transactivation domain (TAD) [419] or expressing dominant negative mutants of ARNT, which is devoid of basic region within the

-108-

5. Discussion basic helix-loop-helix DNA binding domain [420,421], in order to distinguish between those AhR functions, which are dependent or independent on ARNT. Similar to siRNA data, expression of dnAhR led to a loss of ability of model AhR ligands, TCDD and PCB 126, to induce Cyp1a1 expression or to disrupt contact inhibition in WB-F344 cells (Fig. 50). TCDD and PCB 126 had no effect on cell numbers, cell cycle or Cyclin A expression in confluent WB-F344 cells expressing dnAhR. In a sharp contrast, the AhR-dependent loss of contact inhibition induced by TCDD and PCB 126 seems to be ARNT-independent (Fig. 51). In the confluent WB-F344 cells expressing dnARNT, both TCDD and PCB 126 were still able to induce cell proliferation, cell cycle progression and expression of Cyclin A; however, both AhR ligands failed to induce Cyp1a1 expression. Therefore, whereas the classical AhR signaling regulating Cyp1a1 expression is dependent on presence of functional AhR and ARNT, the loss of contact inhibition in confluent WB-F344 cells induced by AhR ligands is probably an ARNT-independent process. Taken together, this part of the study demonstrated that both AhR agonists and partial AhR antagonists may disrupt cell proliferation control in WB-F344 cells, a model of rat liver progenitor cells. A detailed analysis of AhR signaling induced by different classes of AhR ligands revealed striking differences in regulation of various AhR target genes. This suggested that AhR signaling should be always studied in a specific gene promoter and cell type context. The general conclusions based just on few model target genes, typically Cyp1a1, may indeed lead to false interpretation of impact of various AhR ligands on cell signaling. Given the role of AhR regulation in carcinogenesis, a carefull characterization of different AhR targets in tissues prone to AhR-mediated carcinogenesis seems to be a necessary prerequisite of estimation of risks and hazards related to human exposure to environmental contaminants activating AhR. In the second part of the study we studied the impact of AhR ligands on proteins mediating cell-to-cell communication, which are possibly involved also in the loss of contact inhibition [72,422]. Although both we and others have demonstrated that AhR ligands, including TCDD, PCB 126, BNF or 3M4NF, may cause deregulation of contact inhibition in an in vitro model of oval cells, the precise mechanisms underlying this phenomenon still remain to be elucidated [62,63,65]. Very little is currently known about the impact of 3M4NF exposure on expression or localization of molecules involved in regulation of cell-to-cell communication. Therefore, we studied expression profiles of plakoglobin (PKG; γ-catenin), -109-

5. Discussion β-catenin and E-cadherin in WB-F344 cells treated with model AhR ligands, whose impact on AhR signaling was studied in the first part of the study. It has been shown previously, that TCDD induces degradation of PKG (γ-catenin) in confluent WB-F344 cells, while no changes in expression and/or localization pattern of βcatenin have been found [390,423]. We found that PCB 126, TCDD and 3M4NF decreased PKG and E-cadherin protein level in WB-F344 cells (Fig. 40). In contrast with some of reported data, we found that both TCDD and PCB 126 induced a decrease of β-catenin at protein level in confluent WB-F344 cells 24 h and 48 h after treatment, whereas its mRNA levels were not significantly affected (Fig. 39, Fig. 41). β-catenin localization was changed in TCDD- and PCB 126-treated confluent WB-F344 cells. Enhanced staining of active β-catenin was found in cytoplasm, while disorganized localization of total β-catenin was observed both in the cytoplasm and in cell membranes (Fig. 42A, 42B). Similar trends were observed when PKG localization patterns and protein degradation were studied. Both TCDD and PCB 126 induced disorganization of PKG localization and formation of PKG-deficient foci within the cell monolayer (Fig. 42C). These data are in a strong agreement with findings reported by Dietrich et al., where TCDD has been shown to induce PKG-degradation in confluent WBF344 cells [390]. Thus, both PKG and β-catenin seem to be dowregulated at protein level in cells treated with AhR ligands. However, when analyzing mRNA expression, a significant decrease of only plakoglobin mRNA was observed after exposure of confluent WB-F344 cells to TCDD and PCB 126 (Fig. 39, 41), thus suggesting that PKG and β-catenin are differentially regulated in WB-F344 cells. Apart from changes detected in expression profiles of both studied catenins, we further studied deregulation of E-cadherin expression at protein level. PCB 126, as well as TCDD or 3M4NF, induced a decrease of E-cadherin protein levels (Fig. 40, 41). These findings indicated that TCDD- and PCB 126-induced disruption of contact inhibition is accompanied with deregulation of cell-to-cell communication mediated by E-cadherin, PKG and β-catenin. The essential role of AhR in TCDD and PCB 126 action has been discussed above. We therefore performed siRNA assay targeted against AhR (Fig. 45A) and found out that TCDDinduced decrease of PKG expression is AhR-dependent and, moreover, that downregulation of AhR itself is sufficient for upregulation of PKG expression, while β-catenin expression remained unaffected (Fig. 45B; data not shown). In order to further clarify the role of AhR-110-

5. Discussion independent and AhR-dependent proliferation in turnover of both proteins, we used epidermal growth factor (EGF), in order to induce proliferation of confluent WB-F344 cells without simultaneously activating the AhR signaling. Interestingly, EGF induced a decrease in activeβ-catenin protein levels, but not in PKG protein levels (Fig. 44, data not shown). Taken together, these data demonstrated that while the TCDD- and PCB 126-induced decrease in PKG protein level is AhR-dependent, the decrease of β-catenin protein levels seems to be a consequence of induction of cell proliferation. The published data seem to suggest that βcatenin localization might depend on cell density [423,424]. In subconfluent cells, β-catenin is localised in cytoplasmatic membrane, in cytoplasm and in some cases such as e.g. HCT116 cells, nuclear localization has been also detected [423,424]. In confluent cells, predominant membrane localization of β-catenin has been observed [423]. Nevertheless, no specific relocalization of β-catenin has been observed in the present study. In order to study the role of AhR in regulation of cell adhesion molecules in more detail, we also performed several experiments with rat hepatoma 5L cells and BP8 cells, in order to distinguish between AhR-dependent and independent events occurring during TCDD and PCB 126 exposure. As reported in the literature, TCDD and PCB 126 both induced rapid and long-term AhR nuclear translocation, degradation (Fig. 32, Fig. 33) and AhR-dependent induction of target gene expression in 5L cells (Fig. 34). Interestingly, when compared to WB-F344 cells, 5L cells exhibited lower levels of AhR. However, when Cyp1a1 expression was tested, we observed substantially higher amount of CYP1A1 protein in 5L cells than in WB-F344 cells both treated with model AhR ligands (Fig. 35), which might be related to tumorigenicity of 5L cells [425]. A basal level of CYP1A1 protein has been also higher in untreated 5L cells, which again might correspond with their status of hepatoma cells [426]. Although expression of Cyp1b1 has been reported to be much higher in tumor cells when compared to normal cells and to contribute to malignant progression, 5L cells has been found to express significantly lower levels of this cytochrome in comparison with WB-F344 cells (Fig. 35) [427,428]. Taken together, expression of both model AhR-target genes, Cyp1a1 and Cyp1b1, was confirmed to be an AhR-dependent event in hepatoma cells, as no basal and/or ligand-induced signals has been detected in AhR-deficient BP8 cells at protein level. Therefore, we further proceeded to use these cells to characterize levels of PKG, β-catenin protein and E-cadherin proteins upon AhR ligand exposure.

-111-

5. Discussion TCDD is known to inhibit cell cycle progression of 5L cells. Both PCB 126 and TCDD induced cell cycle arrest and inhibited proliferation of 5L rat hepatoma cells (Fig. 36, Fig. 37), which was accompanied with a diminished expression of Cyclin A in an AhR-dependent manner, as none these effects were observed in AhR-deficient BP8 cells (Fig. 38). As a next step, we examined effects of TCDD and PCB 126 on PKG, β-catenin protein and E-cadherin protein levels in 5L and BP8 cells. We did not detect any significant changes in protein level of E-cadherin. We observed increased levels of active form of β-catenin (ABC-β-catenin; Fig. 43) and decreased levels of PKG in 5L cells, but not in BP8 cells. Moreover, both BP8 and 5L cells exhibited higher basal levels of active and phosphorylated β-catenin (p-β-catenin), when compared to WB-F344 cells, where p-β-catenin was almost undetectable. It has been reported previously, that cellular pool of β-catenin is regulated by ubiquitin-dependent degradation processes based on formation of β-catenin destruction complex [350]. This complex consists of kinases, which phosphorylate β-catenin on specific amino acid residues (CK1 or GSK3β), protein phosphatase (PP2A) and scaffold and adaptor proteins like axin or adenomatous polyposis coli (APC). The experiments with GSK3β inhibitors and specific APC protein mutants has confirmed the important role of these two proteins in the processes regulating pβ-catenin cellular pool [350]. Inhibition of GSK3β as well as mutation of APC at specific amino acid residue (1555) have been found to contribute to downregulation of p-β-catenin cellular level, while another specifically mutated form of APC has been shown to be associated with high accumulation of p-β-catenin [347]. These observations might represent one of the explanations, why both rat hepatoma BP8 and 5L cells contain much higher level of p-β-catenin in comparison with non-tumorigenic WB-F344 cells. An alternative explanation might be simply a different Ctnnb1 gene expression. Unfortunately, nothing is currently known about mutation status of APC protein in rat hepatoma cell lines or about differences in β-catenin mRNA expression in BP8, 5L and WB-F344 cells. Another component of cell-to-cell communication, which has been found to be deregulated by AhR ligands in confluent WB-F344 cells was T-cadherin (Fig. 24). This atypical member of cadherin family is found on cell surface as a mature T-cadherin mediating homophilic interactions and signal transduction, or in its precursor form pro-T-cadherin, whose function remains unclear [323,328,429]. T-cadherin expression can be downregulated during cancer development [430,431]. Our findings that T-cadherin expression at mRNA level is downregulated by some AhR ligands in WB-F344 cells therefore seems to favour the -112-

5. Discussion hypothesis suggesting that T-cadherin expression may depend on cell density and it negatively regulates cell growth [432,433]. However, when we investigated T-cadherin protein levels in WB-F344 cells, we detected only TCDD-induced decrease of T-cadherin, but no effect of PCB 126, while levels of pro-T-cadherin also remained unchanged (Fig. 43). In hepatoma cells, a decrease of pro-T-cadherin protein in 5L cells in response to AhR activation was detected. Surprisingly, T-cadherin protein expressed in both hepatoma cell lines seemed to be different from that of expressed in WB-F344 cells. We detected distinct molecular sizes of T-cadherin protein in ´normal´ and cancer cells. This might be related to possible mutation of Cdh13 gene in hepatoma cells; however, nothing is currently known about this phenomenon. In tumor tissues, expression of E-cadherin has been shown to be downregulated and it significantly correlates with poor prognosis and metastatic potential of a tumor [434,435]. The deregulation of E-cadherin expression in cancer development is generally linked to deregulation of expresssion of other components playing a crucial role in cell-to-cell communication mediated by adherens junctions, catenins. Survival of patients with diagnosed HCC has been strongly decreased in cases, when tumor tissues exhibited E-cadherin and PKG downregulation simultaneously with upregulated expression of β-catenin, which has been correlated with vascular invasion [434]. Moreover, all changes observed in deregulation of cadherin-catenin function have been reported to occurr

during the early stages of

carcinogenesis [435]. Our in vitro experiments have also revealed a deregulation of cadherins and catenins expression induced by toxic AhR ligands such as TCDD and PCB 126, in liver cells. Various mechanisms might be involved in the observed effects. Some of these changes might be related to status of cell cycle and cell proliferation, such as in the case of growing HaCaT cells, which express lower levels of β-catenin, PKG and E-cadherin, in contrast to confluent cells [390]. In our experimental models, cells with minimal proliferation rate are represented by confluent WB-F344 cells, whereas exponentially growing and growth-arrested cells are represented by untreated and AhR ligand-treated 5L cells, respectively. Therefore, upregulation of active form of β-catenin found in TCDD- and PCB 126-treated 5L cells might be simply a response of cells to cell cycle arrest. In an agreement with this hypothesis, AhR ligand-induced proliferation and cell cycle progression are probably responsible for observed downregulation of expression of PKG, β-catenin and E-cadherin observed 48 h after exposure in confluent WB-F344 cells (Fig. 41; Fig. 43). These efects of TCDD and PCB 126 are indeed AhR-dependent, as confirmed by analysis of

AhR-deficient BP8 cells and siRNA

-113-

5. Discussion experiments in WB-F344 cells. However, as the decrease of β-catenin protein level was also observed in confluent WB-F344 cells treated with EGF (Fig. 44), AhR ligand per se may not be a necessary component of their downregulation during cell proliferation. This could be a rather general mechanism observed in growing cells, which is not necessarily AhRdependent. In contrast, our present data seem to suggest that downregulation of PKG mRNA reflects a specific AhR-dependent toxic event in nontransformed cells. In conclusion, the present studz confirmed that AhR signaling pathway plays a crucial role in regulation of contact inhibition, cell proliferation, cell cycle progression and cell-tocell communication in an in vitro model of oval cells, WB-F344 cells. As all of these processes are targeted and deregulated during carcinogenesis and AhR mediates toxic responses of an organism to numerous environmental contaminants, like TCDD and PCB 126, deregulation of AhR signaling and cell cycle control in epithelial cells may contribute to cancer development, especially during stages of tumor promotion and progression. These carcinogenic effects of persistent AhR ligands may arise from the deregulation of a proper physiological role of AhR in various organs, such as liver or lungs. Definition of mechanisms involved in deregulation of cell proliferation by xenobiotics affecting AhR signaling may also help to study potential beneficial, chemopreventive effects of many natural compounds, interacting with AhR.

-114-

6. Summary 6

SUMMARY Due to the massive industrial development occurring during the last century, various

chemical compounds and xenobiotics have been produced and widely distributed in the environment. The production of pesticides, herbicides, painting colours and/or various adhesives, or imperfect combustion processes, are only a part of sources of numerous aromatic contaminants, commonly found in surface and fresh water, river sediments, soil and/or air. One of the notorious environmental toxicants, made infamous during the ´Seveso´ incident, is 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), a highly potent tumor promoter, which has been shown to induce reproductive and skin toxicity, neurotoxicity, immunotoxicity and to deregulate lipid metabolism. Apart from these negative effects observed both in humans and in animals, the development of tumors in different target tissues, especially in the liver or lungs, has led international authorities, such as the IARC and WHO, to list TCDD as a group 1 human carcinogen. At the cellular level, the major part of TCDD effects are seemingly mediated predominantly through AhR activation, which is generally associated with xenobiotic metabolism via regulation of cytochrome P450 enzymes expression. AhR is also a known mediator of toxicities induced by exogenous compounds, including PAHs or PCBs. Additionally, many natural compounds, such as flavonoids, may behave as AhR agonists and/or antagonists. Several compounds, such as indigoids or tryptophan metabolites have been speculated to act as hypothetical endogenous AhR ligands, thus indicating the physiological role of AhR in development and maintenance of homeostasis. The present study aimed to characterize AhR signaling in WB-F344 cells, an in vitro model of oval liver ´stem-like´cells. Our principal goal was to study the role of AhR in the phenomenon of contact-inhibition with respect to mechanisms being involved in liver tumor promotion. Therefore, we chose specific chemical compounds, representing different classes of AhR ligands: i) known exogenous toxic AhR agonists TCDD and PCB126; ii) model synthetic flavonoids acting in agonistic and/or antagonistic manner - β-naphthoflavone (BNF) and 3´-methoxy-4´-nitroflavone (3M4NF); and iii) a hypothetical endogenous AhR ligand indirubin. Among other principal findings, our results suggest that, similar to TCDD and PCB126, both synthetic flavones BNF and 3M4NF induce cell proliferation and cell cycle progression of contact-inhibited WB-F344 cells, accompanied with enhanced Cyclin A expression. In contrast to that, indirubin has no effect on proliferation of WB-F344 cells. -115 --

6. Summary The ability of PCB126, BNF, 3M4NF and indirubin to activate AhR signaling in WB-F344 cells (AhR cellular localization, AhR-DNA interaction, CYPs and other AhR-target gene expression) has been tested and compared with the effects of TCDD. Futhermore, both flavones have been shown to modulate TCDD responses in these cells and to induce expression of AhR-target genes (Cyp1a1, Cyp1b1, Cdh13, Nqo1). Although AhR translocation and degradation has been shown to be induced also by the potential endogenous ligand indirubin, we did not detected any changes in expression of genes induced by exogenous ligands of AhR, thus indicating possible existence of other gene battery being regulated by AhR upon its activation by endogenous ligands. The second part of this study aimed to investigate the role of AhR in deregulation of contact-inhibition and cell cycle control. For this purpose we used WB-F344 variants with knockout AhR or ARNT, WB-F344 cells with AhR downregulated by shRNA or siRNA and rat hepatoma cells expressing (5L) or deficient for AhR (BP8). We have shown, that TCDD and PCB126 are inducers of AhRdependent, but ARNT-independent loss of contact inhibition, which probably involves deregulation of gene expression and cellular localization of proteins involved in adherens and desmosomal junctions such as β-catenin, plakoglobin, E-cadherin and T-cadherin. Both model flavones have been also shown to be potent modulators of cell-to-cell communication mediated by cadherins and catenins. Taken together, the present study suggests a significant role of AhR activation in deregulation of cell cycle, contact inhibition and cell-to-cell communication in model of liver progenitor cells, all being characteristic features commonly targeted during carcinogenesis.

-116 --

7. Shrnutí 7 SHRNUTÍ Díky mohutnému rozvoji průmyslu během minulého století bylo naše životní prostředí znečištěno různými chemickými látkami. Za hlavní zdroje znečistění povrchové a pitné vody, říčních sedimentů, půdy i vzduchu lze považovat především procesy spojené s nedokonalým spalováním organických materiálů nebo také produkcí pesticidů, herbicidů, nátěrových a lepících hmot apod. Typickým příkladem environmentálního toxikantu se stal 2,3,7,8-tetrachlorodibenzo-pdioxin (TCDD), známý především díky ekologické havárii v italském městě Seveso. Tato látka je velmi silným nádorovým promotorem a působí mimo jiné toxicky na kožní, nervový, imunitní či reprodukční systém a výrazně se podílí na deregulaci metabolismu tuků. Vzhledem k faktu, že TCDD způsobuje u člověka a zvířat vývoj nejrůznějších nádorových onemocnění, především jater a plic, byl označen komisemi IARC a WHO jako lidský karcinogen třídy 1. Na buněčné úrovni jsou efekty TCDD zprostředkovány především pomocí transkripčního faktoru AhR, jehož funkce je spjata s regulací metabolismu xenobiotik a genové exprese enzymů cytochromu P450. Mimo to, toxicita dalších exogenních látek jako jsou PAHy a PCB je také zprostředkována Ah receptorem. Ligandy AhR však mohou být i různé přírodní látky jako jsou např. flavonoidy, které se mohou chovat nejen jako jeho agonisté ale také jako antagonisté. Protože všechny zmíněné látky představují exogenní ligandy AhR spekuluje se také o existenci tzv. endogenních ligandů (např. indigoidy nebo metabolity tryptofanu), což částečně přispívá k vysvětlení role AhR během vývoje a při udržení buněčné homeostáze. Předkládaná práce si klade za cíl charakterizovat signální dráhu AhR v buněčné linii WB-F344, která představuje in vitro model jaterních oválných buněk. Především jsme se zabývali studiem role AhR ve fenoménu kontaktní inhibice, a to s ohledem na studium mechanismů zahrnutých v nádorové promoci jaterní tkáně. Z tohoto důvodu jsme vybrali chemické látky představující odlišné skupiny ligandů AhR: i) toxické exogenní ligandy TCDD a PCB126; ii) syntetické flavonoidy, z nichž β-naphthoflavone (BNF) představuje model agonistického ligandu AhR a 3´-methoxy-4´-nitroflavonu (3M4NF), který představuje model antagonistického ligandu AhR; a iii) hypotetický endogenní ligand AhR, indirubin. Mezi zásadní patří zjištění, že oba syntetické flavony BNF a 3M4NF, podobně jako TCDD či PCB126, indukují proliferaci a progresi buněčného cyklu buněk WB-F344 nacházejících se v kontaktní inhibici, což je spojeno s posílenou expresí Cyklinu A. Indirubin naproti tomu neměl žádný vliv na proliferaci buněk WB-F344. Dále byla testována schopnost PCB126, -117 --

7. Shrnutí BNF, 3M4NF a indirubinu aktivovat AhR signalizaci v buňkách WB-F344 a srovnat ji s aktivačním potenciálem TCDD (sledovanými parametry mj. byli: buněčná lokalizace AhR, interakce AhR s DNA, exprese genů kódujících enzymy cytochromu P450 a jiných cílových genů AhR). Oba modelové flavony navíc ve zmíněné buněčné linii modulovali efekty TCDD a indukovali expresi cílových genů AhR (Cyp1a1, Cyp1b1, Cdh13, Nqo1). Ačkoli indirubin indukoval translokaci i degradaci AhR, nedetekovali jsme žádné změny v expresi výše zmíněných genů, což může naznačovat existenci odlišné genové baterie, která je pravděpodobně regulována AhR aktivovaným endogenními ligandy. V druhé části studie jsme se zabývali objasňováním role AhR v deregulaci kontaktní inhibice a kontroly buněčného cyklu. Pro tento účel jsme využili jednak WB-F344 buněk, kterým byl pomocí metod genového inženýrství odstraněn AhR nebo ARNT, dále WB-F344 buněk s potlačenou expresí AhR pomocí RNA interference a také buněk odvozených z krysího hepatomu, které exprimovaly (5L) či nikoli (BP8) AhR. Podařilo se nám prokázat, že TCDD i PCB126 indukují ztrátu kontaktní inhibice a to mechanismem, který je závislý na přítomnosti funkčního AhR, ale nezávislý na ARNT. Takto indukovaná deregulace kontaktní inhibice je také spojena s modulací genové exprese a buněčné lokalizace proteinů (β-catenin, plakoglobin, E-cadherin, T-cadherin), které jsou přítomny v adherentním či desmosomálním typu mezibuněčného spojení.

Oba modelové flavony se také ukázali být účinnými

modulátory mezibuněčné komunikace zprostředkované kadheriny a kateniny. Závěrem můžeme říci, že předkládaná studie částečně objasňuje roli signální dráhy AhR v charakteristických procesech karcinogeneze tj. v deregulaci buněčného cyklu, kontaktní inhibice a mezibuněčné komunikace, v modelu jaterních progenitorových buněk.

-118 --

8. References 8 REFERENCES 1. 2. 3. 4. 5. 6. 7. 8. 9. 10.

11. 12. 13. 14. 15. 16. 17. 18. 19. 20.

Matthews, J.,Gustafsson, J.A. (2006) Estrogen receptor and aryl hydrocarbon receptor signaling pathways. Nucl Recept Signal, 4, e016. Fausto, N.,Campbell, J.S. (2003) The role of hepatocytes and oval cells in liver regeneration and repopulation. Mech Dev, 120, 117-30. Porter, T.D.,Coon, M.J. (1991) Cytochrome P-450. Multiplicity of isoforms, substrates, and catalytic and regulatory mechanisms. J Biol Chem, 266, 13469-72. Haag-Gronlund, M., Johansson, N., Fransson-Steen, R., et al. (1998) Interactive effects of three structurally different polychlorinated biphenyls in a rat liver tumor promotion bioassay. Toxicol Appl Pharmacol, 152, 153-65. Kewley, R.J., Whitelaw, M.L.,Chapman-Smith, A. (2004) The mammalian basic helix-loop-helix/PAS family of transcriptional regulators. Int J Biochem Cell Biol, 36, 189-204. Cowin, P., Kapprell, H.P., Franke, W.W., et al. (1986) Plakoglobin: a protein common to different kinds of intercellular adhering junctions. Cell, 46, 1063-73. Solanas, G., Miravet, S., Casagolda, D., et al. (2004) beta-Catenin and plakoglobin Nand C-tails determine ligand specificity. J Biol Chem, 279, 49849-56. Nollet, F., Berx, G.,van Roy, F. (1999) The role of the E-cadherin/catenin adhesion complex in the development and progression of cancer. Mol Cell Biol Res Commun, 2, 77-85. Kemler, R. (1993) From cadherins to catenins: cytoplasmic protein interactions and regulation of cell adhesion. Trends Genet, 9, 317-21. Miravet, S., Piedra, J., Castano, J., et al. (2003) Tyrosine phosphorylation of plakoglobin causes contrary effects on its association with desmosomes and adherens junction components and modulates beta-catenin-mediated transcription. Mol Cell Biol, 23, 7391-402. Baynes, J.W.D., Marek H. (2005) Medical Biochemistry. Elsevier Mosby. Kmiec, Z. (2001) Cooperation of liver cells in health and disease. Adv Anat Embryol Cell Biol, 161, III-XIII, 1-151. Sherlock, S.D., James (2002) Diseases of the liver and biliary system. Blackwell Publishing. Sell, S. (2001) Heterogeneity and plasticity of hepatocyte lineage cells. Hepatology, 33, 738-50. Farber, E. (1956) Similarities in the sequence of early histological changes induced in the liver of the rat by ethionine, 2-acetylamino-fluorene, and 3'-methyl-4dimethylaminoazobenzene. Cancer Res, 16, 142-8. Grisham, J.W.,Coleman, W.B. (2002) Molecular regulation of hepatocyte generation in adult animals. Am J Pathol, 161, 1107-10. Bisgaard, H.C., Holmskov, U., Santoni-Rugiu, E., et al. (2002) Heterogeneity of ductular reactions in adult rat and human liver revealed by novel expression of deleted in malignant brain tumor 1. Am J Pathol, 161, 1187-98. Dabeva, M.D.,Shafritz, D.A. (1993) Activation, proliferation, and differentiation of progenitor cells into hepatocytes in the D-galactosamine model of liver regeneration. Am J Pathol, 143, 1606-20. Malouf, N.N., Coleman, W.B., Grisham, J.W., et al. (2001) Adult-derived stem cells from the liver become myocytes in the heart in vivo. Am J Pathol, 158, 1929-35. Shafritz, D.A.,Dabeva, M.D. (2002) Liver stem cells and model systems for liver repopulation. J Hepatol, 36, 552-64. --

119 --

8. References 21. 22. 23. 24. 25.

26. 27. 28. 29. 30. 31.

32. 33. 34. 35. 36. 37. 38. 39.

Qin, A.L., Zhou, X.Q., Zhang, W., et al. (2004) Characterization and enrichment of hepatic progenitor cells in adult rat liver. World J Gastroenterol, 10, 1480-6. Josephy, P.D.,Mannervik, B. (2006) Molecular toxicology. Oxford University Press, New York. Nebert, D.W.,Dalton, T.P. (2006) The role of cytochrome P450 enzymes in endogenous signalling pathways and environmental carcinogenesis. Nat Rev Cancer, 6, 947-60. Nebert, D.W.,Gonzalez, F.J. (1987) P450 genes: structure, evolution, and regulation. Annu Rev Biochem, 56, 945-93. Kamataki, T., Maeda, K., Yamazoe, Y., et al. (1983) Sex difference of cytochrome P450 in the rat: purification, characterization, and quantitation of constitutive forms of cytochrome P-450 from liver microsomes of male and female rats. Arch Biochem Biophys, 225, 758-70. Rodriguez-Antona, C.,Ingelman-Sundberg, M. (2006) Cytochrome P450 pharmacogenetics and cancer. Oncogene, 25, 1679-91. Nebert, D.W.,Russell, D.W. (2002) Clinical importance of the cytochromes P450. Lancet, 360, 1155-62. Delescluse, C., Lemaire, G., de Sousa, G., et al. (2000) Is CYP1A1 induction always related to AHR signaling pathway? Toxicology, 153, 73-82. Godard, C.A., Goldstone, J.V., Said, M.R., et al. (2005) The new vertebrate CYP1C family: cloning of new subfamily members and phylogenetic analysis. Biochem Biophys Res Commun, 331, 1016-24. Jonsson, M.E., Orrego, R., Woodin, B.R., et al. (2007) Basal and 3,3',4,4',5pentachlorobiphenyl-induced expression of cytochrome P450 1A, 1B and 1C genes in zebrafish. Toxicol Appl Pharmacol, 221, 29-41. Uno, S., Dalton, T.P., Dragin, N., et al. (2006) Oral benzo[a]pyrene in Cyp1 knockout mouse lines: CYP1A1 important in detoxication, CYP1B1 metabolism required for immune damage independent of total-body burden and clearance rate. Mol Pharmacol, 69, 1103-14. Nebert, D.W., Dalton, T.P., Okey, A.B., et al. (2004) Role of aryl hydrocarbon receptor-mediated induction of the CYP1 enzymes in environmental toxicity and cancer. J Biol Chem, 279, 23847-50. Pascussi, J.M., Gerbal-Chaloin, S., Duret, C., et al. (2007) The Tangle of Nuclear Receptors that Controls Xenobiotic Metabolism and Transport: Crosstalk and Consequences. Annu Rev Pharmacol Toxicol. Tirona, R.G.,Kim, R.B. (2005) Nuclear receptors and drug disposition gene regulation. J Pharm Sci, 94, 1169-86. Waxman, D.J. (1999) P450 gene induction by structurally diverse xenochemicals: central role of nuclear receptors CAR, PXR, and PPAR. Arch Biochem Biophys, 369, 11-23. Benoit, G., Cooney, A., Giguere, V., et al. (2006) International Union of Pharmacology. LXVI. Orphan nuclear receptors. Pharmacol Rev, 58, 798-836. Zhang, Z., Burch, P.E., Cooney, A.J., et al. (2004) Genomic analysis of the nuclear receptor family: new insights into structure, regulation, and evolution from the rat genome. Genome Res, 14, 580-90. Glass, C.K.,Rosenfeld, M.G. (2000) The coregulator exchange in transcriptional functions of nuclear receptors. Genes Dev, 14, 121-41. Hankinson, O. (2005) Role of coactivators in transcriptional activation by the aryl hydrocarbon receptor. Arch Biochem Biophys, 433, 379-86.

-120 --

8. References 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55.

56. 57. 58. 59.

Maglich, J.M., Stoltz, C.M., Goodwin, B., et al. (2002) Nuclear pregnane x receptor and constitutive androstane receptor regulate overlapping but distinct sets of genes involved in xenobiotic detoxification. Mol Pharmacol, 62, 638-46. Desvergne, B.,Wahli, W. (1999) Peroxisome proliferator-activated receptors: nuclear control of metabolism. Endocr Rev, 20, 649-88. Keller, H., Givel, F., Perroud, M., et al. (1995) Signaling cross-talk between peroxisome proliferator-activated receptor/retinoid X receptor and estrogen receptor through estrogen response elements. Mol Endocrinol, 9, 794-804. Tien, E.S., Matsui, K., Moore, R., et al. (2007) The nuclear receptor constitutively active/androstane receptor regulates type 1 deiodinase and thyroid hormone activity in the regenerating mouse liver. J Pharmacol Exp Ther, 320, 307-13. Tien, E.S.,Negishi, M. (2006) Nuclear receptors CAR and PXR in the regulation of hepatic metabolism. Xenobiotica, 36, 1152-63. Pang, R., Tse, E.,Poon, R.T. (2006) Molecular pathways in hepatocellular carcinoma. Cancer Lett, 240, 157-69. Pineau, P.,Buendia, M.A. (2000) Studies of genetic defects in hepatocellular carcinoma: recent outcomes and new challenges. J Hepatol, 33, 152-6. Tannapfel, A.,Wittekind, C. (2002) Genes involved in hepatocellular carcinoma: deregulation in cell cycling and apoptosis. Virchows Arch, 440, 345-52. Gerbes, A.L.,Caselmann, W.H. (1993) Point mutations of the P53 gene, human hepatocellular carcinoma and aflatoxins. J Hepatol, 19, 312-5. Staib, F., Hussain, S.P., Hofseth, L.J., et al. (2003) TP53 and liver carcinogenesis. Hum Mutat, 21, 201-16. Fearon, E.R.,Vogelstein, B. (1990) A genetic model for colorectal tumorigenesis. Cell, 61, 759-67. Dumble, M.L., Croager, E.J., Yeoh, G.C., et al. (2002) Generation and characterization of p53 null transformed hepatic progenitor cells: oval cells give rise to hepatocellular carcinoma. Carcinogenesis, 23, 435-45. Lazaro, C.A., Rhim, J.A., Yamada, Y., et al. (1998) Generation of hepatocytes from oval cell precursors in culture. Cancer Res, 58, 5514-22. Thorgeirsson, S.S.,Grisham, J.W. (2003) Overview of recent experimental studies on liver stem cells. Semin Liver Dis, 23, 303-12. Tsao, M.S., Smith, J.D., Nelson, K.G., et al. (1984) A diploid epithelial cell line from normal adult rat liver with phenotypic properties of 'oval' cells. Exp Cell Res, 154, 3852. Coleman, W.B., McCullough, K.D., Esch, G.L., et al. (1997) Evaluation of the differentiation potential of WB-F344 rat liver epithelial stem-like cells in vivo. Differentiation to hepatocytes after transplantation into dipeptidylpeptidase-IVdeficient rat liver. Am J Pathol, 151, 353-9. Evarts, R.P., Nagy, P., Nakatsukasa, H., et al. (1989) In vivo differentiation of rat liver oval cells into hepatocytes. Cancer Res, 49, 1541-7. Couchie, D., Holic, N., Chobert, M.N., et al. (2002) In vitro differentiation of WBF344 rat liver epithelial cells into the biliary lineage. Differentiation, 69, 209-15. Tsao, M.S.,Grisham, J.W. (1987) Hepatocarcinomas, cholangiocarcinomas, and hepatoblastomas produced by chemically transformed cultured rat liver epithelial cells. A light- and electron-microscopic analysis. Am J Pathol, 127, 168-81. Zhang, X., Wang, T., Batist, G., et al. (1994) Transforming growth factor beta 1 promotes spontaneous transformation of cultured rat liver epithelial cells. Cancer Res, 54, 6122-8.

-121 --

8. References 60. 61. 62. 63. 64. 65. 66.

67. 68. 69. 70. 71. 72. 73. 74. 75. 76. 77. 78. 79.

Hooth, M.J., Coleman, W.B., Presnell, S.C., et al. (1998) Spontaneous neoplastic transformation of WB-F344 rat liver epithelial cells. Am J Pathol, 153, 1913-21. Yao, P., Zhan, Y., Xu, W., et al. (2004) Hepatocyte growth factor-induced proliferation of hepatic stem-like cells depends on activation of NF-kappaB. J Hepatol, 40, 391-8. Dietrich, C., Faust, D., Budt, S., et al. (2002) 2,3,7,8-tetrachlorodibenzo-p-dioxindependent release from contact inhibition in WB-F344 cells: involvement of cyclin A. Toxicol Appl Pharmacol, 183, 117-26. Chramostova, K., Vondracek, J., Sindlerova, L., et al. (2004) Polycyclic aromatic hydrocarbons modulate cell proliferation in rat hepatic epithelial stem-like WB-F344 cells. Toxicol Appl Pharmacol, 196, 136-48. Svihalkova-Sindlerova, L., Machala, M., Pencikova, K., et al. (2007) Dibenzanthracenes and benzochrysenes elicit both genotoxic and nongenotoxic events in rat liver 'stem-like' cells. Toxicology, 232, 147-59. Vondracek, J., Machala, M., Bryja, V., et al. (2005) Aryl hydrocarbon receptoractivating polychlorinated biphenyls and their hydroxylated metabolites induce cell proliferation in contact-inhibited rat liver epithelial cells. Toxicol Sci, 83, 53-63. Vondracek, J., Svihalkova-Sindlerova, L., Pencikova, K., et al. (2006) 7HDibenzo[c,g]carbazole and 5,9-dimethyldibenzo[c,g]carbazole exert multiple toxic events contributing to tumor promotion in rat liver epithelial 'stem-like' cells. Mutat Res, 596, 43-56. Wieser, R.J., Renauer, D., Schafer, A., et al. (1990) Growth control in mammalian cells by cell-cell contacts. Environ Health Perspect, 88, 251-3. Gustincich, S.,Schneider, C. (1993) Serum deprivation response gene is induced by serum starvation but not by contact inhibition. Cell Growth Differ, 4, 753-60. Holley, R.W.,Kiernan, J.A. (1968) "Contact inhibition" of cell division in 3T3 cells. Proc Natl Acad Sci U S A, 60, 300-4. Pani, G., Colavitti, R., Bedogni, B., et al. (2000) A redox signaling mechanism for density-dependent inhibition of cell growth. J Biol Chem, 275, 38891-9. Gradl, G., Faust, D., Oesch, F., et al. (1995) Density-dependent regulation of cell growth by contactinhibin and the contactinhibin receptor. Curr Biol, 5, 526-35. Fagotto, F.,Gumbiner, B.M. (1996) Cell contact-dependent signaling. Dev Biol, 180, 445-54. Chamuleau, R.A.,Bosman, D.K. (1988) Liver regeneration. Hepatogastroenterology, 35, 309-12. Moore, E.E.,Weiss, M.C. (1982) Selective isolation of stable and unstable dedifferentiated variants from a rat hepatoma cell line. J Cell Physiol, 111, 1-8. Wiebel, F.J., Klose, U.,Kiefer, F. (1991) Toxicity of 2,3,7,8-tetrachlorodibenzo-pdioxin in vitro: H4IIEC3-derived 5L hepatoma cells as a model system. Toxicol Lett, 55, 161-9. Gottlicher, M., Cikryt, P.,Wiebel, F.J. (1990) Inhibition of growth by 2,3,7,8tetrachlorodibenzo-p-dioxin in 5L rat hepatoma cells is associated with the presence of Ah receptor. Carcinogenesis, 11, 2205-10. Sonnenfeld, M., Ward, M., Nystrom, G., et al. (1997) The Drosophila tango gene encodes a bHLH-PAS protein that is orthologous to mammalian Arnt and controls CNS midline and tracheal development. Development, 124, 4571-82. Taylor, B.L.,Zhulin, I.B. (1999) PAS domains: internal sensors of oxygen, redox potential, and light. Microbiol Mol Biol Rev, 63, 479-506. Hahn, M.E. (2002) Aryl hydrocarbon receptors: diversity and evolution. Chem Biol Interact, 141, 131-60. --

122 --

8. References 80.

81. 82. 83. 84. 85. 86. 87. 88. 89.

90. 91. 92. 93. 94. 95. 96. 97.

Poland, A., Glover, E.,Kende, A.S. (1976) Stereospecific, high affinity binding of 2,3,7,8-tetrachlorodibenzo-p-dioxin by hepatic cytosol. Evidence that the binding species is receptor for induction of aryl hydrocarbon hydroxylase. J Biol Chem, 251, 4936-46. Poland, A.G., E. (1975) Genetic Expression of Aryl Hydrocarbon Hydroxylase by 2,3,7,8-Tetrachlorodibenzo-p-dioxin: Evidence for a Receptor Mutation in Genetically Non-responsive Mice. Molecular Pharmacology, 111, 389-398. Emmons, R.B., Duncan, D., Estes, P.A., et al. (1999) The spineless-aristapedia and tango bHLH-PAS proteins interact to control antennal and tarsal development in Drosophila. Development, 126, 3937-45. Harstad, E.B., Guite, C.A., Thomae, T.L., et al. (2006) Liver deformation in Ahr-null mice: evidence for aberrant hepatic perfusion in early development. Mol Pharmacol, 69, 1534-41. Lahvis, G.P., Pyzalski, R.W., Glover, E., et al. (2005) The aryl hydrocarbon receptor is required for developmental closure of the ductus venosus in the neonatal mouse. Mol Pharmacol, 67, 714-20. Mathew, L.K., Andreasen, E.A.,Tanguay, R.L. (2006) Aryl hydrocarbon receptor activation inhibits regenerative growth. Mol Pharmacol, 69, 257-65. Mitchell, K.A., Lockhart, C.A., Huang, G., et al. (2006) Sustained aryl hydrocarbon receptor activity attenuates liver regeneration. Mol Pharmacol, 70, 163-70. Sahlberg, C., Pohjanvirta, R., Gao, Y., et al. (2002) Expression of the mediators of dioxin toxicity, aryl hydrocarbon receptor (AHR) and the AHR nuclear translocator (ARNT), is developmentally regulated in mouse teeth. Int J Dev Biol, 46, 295-300. Qin, H.,Powell-Coffman, J.A. (2004) The Caenorhabditis elegans aryl hydrocarbon receptor, AHR-1, regulates neuronal development. Dev Biol, 270, 64-75. Abbott, B.D., Perdew, G.H., Buckalew, A.R., et al. (1994) Interactive regulation of Ah and glucocorticoid receptors in the synergistic induction of cleft palate by 2,3,7,8tetrachlorodibenzo-p-dioxin and hydrocortisone. Toxicol Appl Pharmacol, 128, 13850. Safe, S.,Wormke, M. (2003) Inhibitory aryl hydrocarbon receptor-estrogen receptor alpha cross-talk and mechanisms of action. Chem Res Toxicol, 16, 807-16. Elferink, C.J. (2003) Aryl hydrocarbon receptor-mediated cell cycle control. Prog Cell Cycle Res, 5, 261-7. Marlowe, J.L.,Puga, A. (2005) Aryl hydrocarbon receptor, cell cycle regulation, toxicity, and tumorigenesis. J Cell Biochem, 96, 1174-84. Nebert, D.W., Roe, A.L., Dieter, M.Z., et al. (2000) Role of the aromatic hydrocarbon receptor and [Ah] gene battery in the oxidative stress response, cell cycle control, and apoptosis. Biochem Pharmacol, 59, 65-85. Puga, A., Xia, Y.,Elferink, C. (2002) Role of the aryl hydrocarbon receptor in cell cycle regulation. Chem Biol Interact, 141, 117-30. Harper, P.A., Riddick, D.S.,Okey, A.B. (2006) Regulating the regulator: factors that control levels and activity of the aryl hydrocarbon receptor. Biochem Pharmacol, 72, 267-79. Spink, B.C., Fasco, M.J., Gierthy, J.F., et al. (1998) 12-O-tetradecanoylphorbol-13acetate upregulates the Ah receptor and differentially alters CYP1B1 and CYP1A1 expression in MCF-7 breast cancer cells. J Cell Biochem, 70, 289-96. Lahvis, G.P.,Bradfield, C.A. (1998) Ahr null alleles: distinctive or different? Biochem Pharmacol, 56, 781-7.

-123 --

8. References 98. 99. 100. 101. 102. 103. 104.

105. 106. 107. 108. 109.

110. 111. 112. 113. 114.

Shimizu, Y., Nakatsuru, Y., Ichinose, M., et al. (2000) Benzo[a]pyrene carcinogenicity is lost in mice lacking the aryl hydrocarbon receptor. Proc Natl Acad Sci U S A, 97, 779-82. Schmidt, J.V., Su, G.H., Reddy, J.K., et al. (1996) Characterization of a murine Ahr null allele: involvement of the Ah receptor in hepatic growth and development. Proc Natl Acad Sci U S A, 93, 6731-6. Andersson, P., McGuire, J., Rubio, C., et al. (2002) A constitutively active dioxin/aryl hydrocarbon receptor induces stomach tumors. Proc Natl Acad Sci U S A, 99, 9990-5. Moennikes, O., Loeppen, S., Buchmann, A., et al. (2004) A constitutively active dioxin/aryl hydrocarbon receptor promotes hepatocarcinogenesis in mice. Cancer Res, 64, 4707-10. Meyer, B.K., Pray-Grant, M.G., Vanden Heuvel, J.P., et al. (1998) Hepatitis B virus X-associated protein 2 is a subunit of the unliganded aryl hydrocarbon receptor core complex and exhibits transcriptional enhancer activity. Mol Cell Biol, 18, 978-88. Kazlauskas, A., Poellinger, L.,Pongratz, I. (1999) Evidence that the co-chaperone p23 regulates ligand responsiveness of the dioxin (Aryl hydrocarbon) receptor. J Biol Chem, 274, 13519-24. Enan, E.,Matsumura, F. (1996) Identification of c-Src as the integral component of the cytosolic Ah receptor complex, transducing the signal of 2,3,7,8-tetrachlorodibenzo-pdioxin (TCDD) through the protein phosphorylation pathway. Biochem Pharmacol, 52, 1599-612. Bell, D.R.,Poland, A. (2000) Binding of aryl hydrocarbon receptor (AhR) to AhRinteracting protein. The role of hsp90. J Biol Chem, 275, 36407-14. Kazlauskas, A., Sundstrom, S., Poellinger, L., et al. (2001) The hsp90 chaperone complex regulates intracellular localization of the dioxin receptor. Mol Cell Biol, 21, 2594-607. Ogiso, H., Kagi, N., Matsumoto, E., et al. (2004) Phosphorylation analysis of 90 kDa heat shock protein within the cytosolic arylhydrocarbon receptor complex. Biochemistry, 43, 15510-9. Chen, H.S., Singh, S.S.,Perdew, G.H. (1997) The Ah receptor is a sensitive target of geldanamycin-induced protein turnover. Arch Biochem Biophys, 348, 190-8. Dittmar, K.D., Demady, D.R., Stancato, L.F., et al. (1997) Folding of the glucocorticoid receptor by the heat shock protein (hsp) 90-based chaperone machinery. The role of p23 is to stabilize receptor.hsp90 heterocomplexes formed by hsp90.p60.hsp70. J Biol Chem, 272, 21213-20. Meyer, B.K.,Perdew, G.H. (1999) Characterization of the AhR-hsp90-XAP2 core complex and the role of the immunophilin-related protein XAP2 in AhR stabilization. Biochemistry, 38, 8907-17. Petrulis, J.R., Kusnadi, A., Ramadoss, P., et al. (2003) The hsp90 Co-chaperone XAP2 alters importin beta recognition of the bipartite nuclear localization signal of the Ah receptor and represses transcriptional activity. J Biol Chem, 278, 2677-85. Kazlauskas, A., Poellinger, L.,Pongratz, I. (2000) The immunophilin-like protein XAP2 regulates ubiquitination and subcellular localization of the dioxin receptor. J Biol Chem, 275, 41317-24. Ikuta, T., Kobayashi, Y.,Kawajiri, K. (2004) Cell density regulates intracellular localization of aryl hydrocarbon receptor. J Biol Chem, 279, 19209-16. Henry, E.C.,Gasiewicz, T.A. (2003) Agonist but not antagonist ligands induce conformational change in the mouse aryl hydrocarbon receptor as detected by partial proteolysis. Mol Pharmacol, 63, 392-400.

-124 --

8. References 115. 116. 117. 118. 119. 120. 121. 122. 123. 124. 125. 126. 127. 128. 129.

130. 131.

Weiss, C., Faust, D., Durk, H., et al. (2005) TCDD induces c-jun expression via a novel Ah (dioxin) receptor-mediated p38-MAPK-dependent pathway. Oncogene, 24, 4975-83. Yim, S., Oh, M., Choi, S.M., et al. (2004) Inhibition of the MEK-1/p42 MAP kinase reduces aryl hydrocarbon receptor-DNA interactions. Biochem Biophys Res Commun, 322, 9-16. Dolwick, K.M., Swanson, H.I.,Bradfield, C.A. (1993) In vitro analysis of Ah receptor domains involved in ligand-activated DNA recognition. Proc Natl Acad Sci U S A, 90, 8566-70. Swanson, H.I. (2002) DNA binding and protein interactions of the AHR/ARNT heterodimer that facilitate gene activation. Chem Biol Interact, 141, 63-76. Park, S., Henry, E.C.,Gasiewicz, T.A. (2000) Regulation of DNA binding activity of the ligand-activated aryl hydrocarbon receptor by tyrosine phosphorylation. Arch Biochem Biophys, 381, 302-12. Pongratz, I., Stromstedt, P.E., Mason, G.G., et al. (1991) Inhibition of the specific DNA binding activity of the dioxin receptor by phosphatase treatment. J Biol Chem, 266, 16813-7. Chapman-Smith, A.,Whitelaw, M.L. (2006) Novel DNA binding by a basic helixloop-helix protein. The role of the dioxin receptor PAS domain. J Biol Chem, 281, 12535-45. Beischlag, T.V., Wang, S., Rose, D.W., et al. (2002) Recruitment of the NCoA/SRC1/p160 family of transcriptional coactivators by the aryl hydrocarbon receptor/aryl hydrocarbon receptor nuclear translocator complex. Mol Cell Biol, 22, 4319-33. Hestermann, E.V.,Brown, M. (2003) Agonist and chemopreventative ligands induce differential transcriptional cofactor recruitment by aryl hydrocarbon receptor. Mol Cell Biol, 23, 7920-5. Nguyen, T.A., Hoivik, D., Lee, J.E., et al. (1999) Interactions of nuclear receptor coactivator/corepressor proteins with the aryl hydrocarbon receptor complex. Arch Biochem Biophys, 367, 250-7. Wang, S., Ge, K., Roeder, R.G., et al. (2004) Role of mediator in transcriptional activation by the aryl hydrocarbon receptor. J Biol Chem, 279, 13593-600. Rowlands, J.C., McEwan, I.J.,Gustafsson, J.A. (1996) Trans-activation by the human aryl hydrocarbon receptor and aryl hydrocarbon receptor nuclear translocator proteins: direct interactions with basal transcription factors. Mol Pharmacol, 50, 538-48. Wang, S.,Hankinson, O. (2002) Functional involvement of the Brahma/SWI2-related gene 1 protein in cytochrome P4501A1 transcription mediated by the aryl hydrocarbon receptor complex. J Biol Chem, 277, 11821-7. Sogawa, K., Fujisawa-Sehara, A., Yamane, M., et al. (1986) Location of regulatory elements responsible for drug induction in the rat cytochrome P-450c gene. Proc Natl Acad Sci U S A, 83, 8044-8. Hu, W., Sorrentino, C., Denison, M.S., et al. (2007) Induction of cyp1a1 is a nonspecific biomarker of aryl hydrocarbon receptor activation: results of large scale screening of pharmaceuticals and toxicants in vivo and in vitro. Mol Pharmacol, 71, 1475-86. Fujii-Kuriyama, Y.,Mimura, J. (2005) Molecular mechanisms of AhR functions in the regulation of cytochrome P450 genes. Biochem Biophys Res Commun, 338, 311-7. Bock, K.W.,Kohle, C. (2006) Ah receptor: dioxin-mediated toxic responses as hints to deregulated physiologic functions. Biochem Pharmacol, 72, 393-404.

-125 --

8. References 132. 133. 134. 135.

136. 137. 138. 139. 140. 141. 142. 143. 144. 145. 146. 147. 148.

Sun, Y.V., Boverhof, D.R., Burgoon, L.D., et al. (2004) Comparative analysis of dioxin response elements in human, mouse and rat genomic sequences. Nucleic Acids Res, 32, 4512-23. Tijet, N., Boutros, P.C., Moffat, I.D., et al. (2006) Aryl hydrocarbon receptor regulates distinct dioxin-dependent and dioxin-independent gene batteries. Mol Pharmacol, 69, 140-53. Vezina, C.M., Walker, N.J.,Olson, J.R. (2004) Subchronic exposure to TCDD, PeCDF, PCB126, and PCB153: effect on hepatic gene expression. Environ Health Perspect, 112, 1636-44. Pollenz, R.S. (1996) The aryl-hydrocarbon receptor, but not the aryl-hydrocarbon receptor nuclear translocator protein, is rapidly depleted in hepatic and nonhepatic culture cells exposed to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Mol Pharmacol, 49, 3918. Pollenz, R.S. (2002) The mechanism of AH receptor protein down-regulation (degradation) and its impact on AH receptor-mediated gene regulation. Chem Biol Interact, 141, 41-61. Prokipcak, R.D.,Okey, A.B. (1991) Downregulation of the Ah receptor in mouse hepatoma cells treated in culture with 2,3,7,8-tetrachlorodibenzo-p-dioxin. Can J Physiol Pharmacol, 69, 1204-10. Conaway, R.C., Brower, C.S.,Conaway, J.W. (2002) Emerging roles of ubiquitin in transcription regulation. Science, 296, 1254-8. Lusska, A., Wu, L.,Whitlock, J.P., Jr. (1992) Superinduction of CYP1A1 transcription by cycloheximide. Role of the DNA binding site for the liganded Ah receptor. J Biol Chem, 267, 15146-51. Brauze, D., Widerak, M., Cwykiel, J., et al. (2006) The effect of aryl hydrocarbon receptor ligands on the expression of AhR, AhRR, ARNT, Hif1alpha, CYP1A1 and NQO1 genes in rat liver. Toxicol Lett, 167, 212-20. Pollenz, R.S.,Buggy, C. (2006) Ligand-dependent and -independent degradation of the human aryl hydrocarbon receptor (hAHR) in cell culture models. Chem Biol Interact, 164, 49-59. Ma, Q.,Baldwin, K.T. (2000) 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced degradation of aryl hydrocarbon receptor (AhR) by the ubiquitin-proteasome pathway. Role of the transcription activaton and DNA binding of AhR. J Biol Chem, 275, 8432-8. Song, Z.,Pollenz, R.S. (2003) Functional analysis of murine aryl hydrocarbon (AH) receptors defective in nuclear import: impact on AH receptor degradation and gene regulation. Mol Pharmacol, 63, 597-606. Haarmann-Stemmann, T.,Abel, J. (2006) The arylhydrocarbon receptor repressor (AhRR): structure, expression, and function. Biol Chem, 387, 1195-9. Mimura, J., Ema, M., Sogawa, K., et al. (1999) Identification of a novel mechanism of regulation of Ah (dioxin) receptor function. Genes Dev, 13, 20-5. Evans, B.R., Karchner, S.I., Allan, L.L., et al. (2007) Repression of aryl hydrocarbon receptor (AHR) signaling by AHR repressor (AHRR): Role of DNA binding and competition for ARNT. Mol Pharmacol. Yamamoto, J., Ihara, K., Nakayama, H., et al. (2004) Characteristic expression of aryl hydrocarbon receptor repressor gene in human tissues: organ-specific distribution and variable induction patterns in mononuclear cells. Life Sci, 74, 1039-49. Ikuta, T., Kobayashi, Y.,Kawajiri, K. (2004) Phosphorylation of nuclear localization signal inhibits the ligand-dependent nuclear import of aryl hydrocarbon receptor. Biochem Biophys Res Commun, 317, 545-50.

-126 --

8. References 149.

Kawajiri K, I.T. (2004) Regulation of nucleo-cytoplasmic transport of the aryl hydrocarbon receptor. journal of health science, 50, 215-219. 150. Backlund, M.,Ingelman-Sundberg, M. (2004) Different structural requirements of the ligand binding domain of the aryl hydrocarbon receptor for high- and low-affinity ligand binding and receptor activation. Mol Pharmacol, 65, 416-25. 151. Denison, M.S., Pandini, A., Nagy, S.R., et al. (2002) Ligand binding and activation of the Ah receptor. Chem Biol Interact, 141, 3-24. 152. Ema, M., Ohe, N., Suzuki, M., et al. (1994) Dioxin binding activities of polymorphic forms of mouse and human arylhydrocarbon receptors. J Biol Chem, 269, 27337-43. 153. Pandini, A., Denison, M.S., Song, Y., et al. (2007) Structural and functional characterization of the aryl hydrocarbon receptor ligand binding domain by homology modeling and mutational analysis. Biochemistry, 46, 696-708. 154. Bonati, L., Fraschini, E., Lasagni, M., Palma Modoni, E., and Pitea,,D. (2005) A hypothesis on the mechanism of PCDD biological activity based on molecular electrostatic potential modeling. . J. Mol. Struct. (Theochem) 340, 83-95. 155. Henry, E.C., Rucci, G.,Gasiewicz, T.A. (1989) Characterization of multiple forms of the Ah receptor: comparison of species and tissues. Biochemistry, 28, 6430-40. 156. Poland, A.,Knutson, J.C. (1982) 2,3,7,8-tetrachlorodibenzo-p-dioxin and related halogenated aromatic hydrocarbons: examination of the mechanism of toxicity. Annu Rev Pharmacol Toxicol, 22, 517-54. 157. Kim, S.H., Henry, E.C., Kim, D.K., et al. (2006) Novel compound 2-methyl-2Hpyrazole-3-carboxylic acid (2-methyl-4-o-tolylazo-phenyl)-amide (CH-223191) prevents 2,3,7,8-TCDD-induced toxicity by antagonizing the aryl hydrocarbon receptor. Mol Pharmacol, 69, 1871-8. 158. Murray, I.A., Reen, R.K., Leathery, N., et al. (2005) Evidence that ligand binding is a key determinant of Ah receptor-mediated transcriptional activity. Arch Biochem Biophys, 442, 59-71. 159. Ramadoss, P., Marcus, C.,Perdew, G.H. (2005) Role of the aryl hydrocarbon receptor in drug metabolism. Expert Opin Drug Metab Toxicol, 1, 9-21. 160. Denison, M.S.,Nagy, S.R. (2003) Activation of the aryl hydrocarbon receptor by structurally diverse exogenous and endogenous chemicals. Annu Rev Pharmacol Toxicol, 43, 309-34. 161. Vrzal, R., Zdarilova, A., Ulrichova, J., et al. (2005) Activation of the aryl hydrocarbon receptor by berberine in HepG2 and H4IIE cells: Biphasic effect on CYP1A1. Biochem Pharmacol, 70, 925-36. 162. Helferich, W.G.,Denison, M.S. (1991) Ultraviolet photoproducts of tryptophan can act as dioxin agonists. Mol Pharmacol, 40, 674-8. 163. Rannug, A., Rannug, U., Rosenkranz, H.S., et al. (1987) Certain photooxidized derivatives of tryptophan bind with very high affinity to the Ah receptor and are likely to be endogenous signal substances. J Biol Chem, 262, 15422-7. 164. Seidel, S.D., Winters, G.M., Rogers, W.J., et al. (2001) Activation of the Ah receptor signaling pathway by prostaglandins. J Biochem Mol Toxicol, 15, 187-96. 165. Schaldach, C.M., Riby, J.,Bjeldanes, L.F. (1999) Lipoxin A4: a new class of ligand for the Ah receptor. Biochemistry, 38, 7594-600. 166. Phelan, D., Winter, G.M., Rogers, W.J., et al. (1998) Activation of the Ah receptor signal transduction pathway by bilirubin and biliverdin. Arch Biochem Biophys, 357, 155-63. 167. Heath-Pagliuso, S., Rogers, W.J., Tullis, K., et al. (1998) Activation of the Ah receptor by tryptophan and tryptophan metabolites. Biochemistry, 37, 11508-15. --

127 --

8. References 168. 169. 170. 171. 172. 173. 174. 175. 176. 177. 178. 179. 180. 181. 182. 183. 184. 185.

Gambone, C.J., Hutcheson, J.M., Gabriel, J.L., et al. (2002) Unique property of some synthetic retinoids: activation of the aryl hydrocarbon receptor pathway. Mol Pharmacol, 61, 334-42. Gradelet, S., Astorg, P., Pineau, T., et al. (1997) Ah receptor-dependent CYP1A induction by two carotenoids, canthaxanthin and beta-apo-8'-carotenal, with no affinity for the TCDD binding site. Biochem Pharmacol, 54, 307-15. Henry, E.C., Bemis, J.C., Henry, O., et al. (2006) A potential endogenous ligand for the aryl hydrocarbon receptor has potent agonist activity in vitro and in vivo. Arch Biochem Biophys, 450, 67-77. McMillan, B.J.,Bradfield, C.A. (2007) The aryl hydrocarbon receptor is activated by modified low-density lipoprotein. Proc Natl Acad Sci U S A, 104, 1412-7. Song, J., Clagett-Dame, M., Peterson, R.E., et al. (2002) A ligand for the aryl hydrocarbon receptor isolated from lung. Proc Natl Acad Sci U S A, 99, 14694-9. Hoessel, R., Leclerc, S., Endicott, J.A., et al. (1999) Indirubin, the active constituent of a Chinese antileukaemia medicine, inhibits cyclin-dependent kinases. Nat Cell Biol, 1, 60-7. Adachi, J., Mori, Y., Matsui, S., et al. (2001) Indirubin and indigo are potent aryl hydrocarbon receptor ligands present in human urine. J Biol Chem, 276, 31475-8. Knockaert, M., Blondel, M., Bach, S., et al. (2004) Independent actions on cyclindependent kinases and aryl hydrocarbon receptor mediate the antiproliferative effects of indirubins. Oncogene, 23, 4400-12. Marko, D., Schatzle, S., Friedel, A., et al. (2001) Inhibition of cyclin-dependent kinase 1 (CDK1) by indirubin derivatives in human tumour cells. Br J Cancer, 84, 283-9. Nam, S., Buettner, R., Turkson, J., et al. (2005) Indirubin derivatives inhibit Stat3 signaling and induce apoptosis in human cancer cells. Proc Natl Acad Sci U S A, 102, 5998-6003. Adachi, J., Mori, Y., Matsui, S., et al. (2004) Comparison of gene expression patterns between 2,3,7,8-tetrachlorodibenzo-p-dioxin and a natural arylhydrocarbon receptor ligand, indirubin. Toxicol Sci, 80, 161-9. Kim, S.A., Kim, Y.C., Kim, S.W., et al. (2007) Antitumor activity of novel indirubin derivatives in rat tumor model. Clin Cancer Res, 13, 253-9. Sugihara, K., Kitamura, S., Yamada, T., et al. (2004) Aryl hydrocarbon receptormediated induction of microsomal drug-metabolizing enzyme activity by indirubin and indigo. Biochem Biophys Res Commun, 318, 571-8. Eisenbrand, G., Hippe, F., Jakobs, S., et al. (2004) Molecular mechanisms of indirubin and its derivatives: novel anticancer molecules with their origin in traditional Chinese phytomedicine. J Cancer Res Clin Oncol, 130, 627-35. Okey, A.B., Riddick, D.S.,Harper, P.A. (1994) The Ah receptor: mediator of the toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and related compounds. Toxicol Lett, 70, 1-22. Andrieux, L., Langouet, S., Fautrel, A., et al. (2004) Aryl hydrocarbon receptor activation and cytochrome P450 1A induction by the mitogen-activated protein kinase inhibitor U0126 in hepatocytes. Mol Pharmacol, 65, 934-43. Hoagland, M.S., Hoagland, E.M.,Swanson, H.I. (2005) The p53 inhibitor pifithrinalpha is a potent agonist of the aryl hydrocarbon receptor. J Pharmacol Exp Ther, 314, 603-10. Horikawa, K., Oishi, N., Nakagawa, J., et al. (2006) Novel potential of tunicamycin as an activator of the aryl hydrocarbon receptor -- dioxin responsive element signaling pathway. FEBS Lett, 580, 3721-5.

-128 --

8. References 186. 187. 188. 189. 190. 191. 192. 193.

194. 195. 196. 197. 198. 199. 200. 201. 202.

Joiakim, A., Mathieu, P.A., Palermo, C., et al. (2003) The Jun N-terminal kinase inhibitor SP600125 is a ligand and antagonist of the aryl hydrocarbon receptor. Drug Metab Dispos, 31, 1279-82. Courtney, K.D.,Moore, J.A. (1971) Teratology studies with 2,4,5trichlorophenoxyacetic acid and 2,3,7,8-tetrachlorodibenzo-p-dioxin. Toxicol Appl Pharmacol, 20, 396-403. Steenland, K., Bertazzi, P., Baccarelli, A., et al. (2004) Dioxin revisited: developments since the 1997 IARC classification of dioxin as a human carcinogen. Environ Health Perspect, 112, 1265-8. Mandal, P.K. (2005) Dioxin: a review of its environmental effects and its aryl hydrocarbon receptor biology. J Comp Physiol [B], 175, 221-30. Gierthy, J.F.,Crane, D. (1984) Reversible inhibition of in vitro epithelial cell proliferation by 2,3,7,8-tetrachlorodibenzo-p-dioxin. Toxicol Appl Pharmacol, 74, 918. Kwon, M.J., Jeong, K.S., Choi, E.J., et al. (2003) 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD)-induced activation of mitogen-activated protein kinase signaling pathway in Jurkat T cells. Pharmacol Toxicol, 93, 186-90. Ray, S.S.,Swanson, H.I. (2003) Alteration of keratinocyte differentiation and senescence by the tumor promoter dioxin. Toxicol Appl Pharmacol, 192, 131-45. Shibazaki, M., Takeuchi, T., Ahmed, S., et al. (2004) Suppression by p38 MAP kinase inhibitors (pyridinyl imidazole compounds) of Ah receptor target gene activation by 2,3,7,8-tetrachlorodibenzo-p-dioxin and the possible mechanism. J Biol Chem, 279, 3869-76. Silbergeld, E.K. (1991) Carcinogenicity of dioxins. J Natl Cancer Inst, 83, 1198-9. Hoffer, A., Chang, C.Y.,Puga, A. (1996) Dioxin induces transcription of fos and jun genes by Ah receptor-dependent and -independent pathways. Toxicol Appl Pharmacol, 141, 238-47. Park, S.J., Yoon, W.K., Kim, H.J., et al. (2005) 2,3,7,8-Tetrachlorodibenzo-p-dioxin activates ERK and p38 mitogen-activated protein kinases in RAW 264.7 cells. Anticancer Res, 25, 2831-6. Vogel, C.F., Zhao, Y., Wong, P., et al. (2003) The use of c-src knockout mice for the identification of the main toxic signaling pathway of TCDD to induce wasting syndrome. J Biochem Mol Toxicol, 17, 305-15. NTP (2006) NTP technical report on the toxicology and carcinogenesis studies of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) (CAS No. 1746-01-6) in female Harlan Sprague-Dawley rats (Gavage Studies). Natl Toxicol Program Tech Rep Ser, 4-232. Bock, K.W.,Kohle, C. (2005) Ah receptor- and TCDD-mediated liver tumor promotion: clonal selection and expansion of cells evading growth arrest and apoptosis. Biochem Pharmacol, 69, 1403-8. Bralet, M.P., Pichard, V.,Ferry, N. (2002) Demonstration of direct lineage between hepatocytes and hepatocellular carcinoma in diethylnitrosamine-treated rats. Hepatology, 36, 623-30. Kociba, R.J., Keyes, D.G., Beyer, J.E., et al. (1978) Results of a two-year chronic toxicity and oncogenicity study of 2,3,7,8-tetrachlorodibenzo-p-dioxin in rats. Toxicol Appl Pharmacol, 46, 279-303. Pitot, H.C., Goldsworthy, T., Campbell, H.A., et al. (1980) Quantitative evaluation of the promotion by 2,3,7,8-tetrachlorodibenzo-p-dioxin of hepatocarcinogenesis from diethylnitrosamine. Cancer Res, 40, 3616-20.

-129 --

8. References 203. 204. 205. 206.

207. 208. 209. 210. 211. 212. 213. 214. 215. 216. 217. 218. 219. 220. 221. 222.

Hailey, J.R., Walker, N.J., Sells, D.M., et al. (2005) Classification of proliferative hepatocellular lesions in harlan sprague-dawley rats chronically exposed to dioxin-like compounds. Toxicol Pathol, 33, 165-74. Schwarz, M., Buchmann, A.,Bock, K.W. (1995) Role of cell proliferation at early stages of hepatocarcinogenesis. Toxicol Lett, 82-83, 27-32. Baker, T.K., Kwiatkowski, A.P., Madhukar, B.V., et al. (1995) Inhibition of gap junctional intercellular communication by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in rat hepatocytes. Carcinogenesis, 16, 2321-6. Lucier, G.W., Tritscher, A., Goldsworthy, T., et al. (1991) Ovarian hormones enhance 2,3,7,8-tetrachlorodibenzo-p-dioxin-mediated increases in cell proliferation and preneoplastic foci in a two-stage model for rat hepatocarcinogenesis. Cancer Res, 51, 1391-7. Silberhorn, E.M., Glauert, H.P.,Robertson, L.W. (1990) Carcinogenicity of polyhalogenated biphenyls: PCBs and PBBs. Crit Rev Toxicol, 20, 440-96. Hsu, S.T., Ma, C.I., Hsu, S.K., et al. (1985) Discovery and epidemiology of PCB poisoning in Taiwan: a four-year followup. Environ Health Perspect, 59, 5-10. Miyata, H., Fukushima, S., Kashimoto, T., et al. (1985) PCBs, PCQs and PCDFs in tissues of yusho and yu-cheng patients. Environ Health Perspect, 59, 67-72. Hennig, B., Meerarani, P., Slim, R., et al. (2002) Proinflammatory properties of coplanar PCBs: in vitro and in vivo evidence. Toxicol Appl Pharmacol, 181, 174-83. Kimbrough, R.D.,Linder, R.E. (1974) Induction of adenofibrosis and hepatomas of the liver in BALB-cJ mice by polychlorinated biphenyls (Aroclor 1254). J Natl Cancer Inst, 53, 547-52. Pereg, D., Robertson, L.W.,Gupta, R.C. (2002) DNA adduction by polychlorinated biphenyls: adducts derived from hepatic microsomal activation and from synthetic metabolites. Chem Biol Interact, 139, 129-44. Hansen, L.G. (1998) Stepping backward to improve assessment of PCB congener toxicities. Environ Health Perspect, 106 Suppl 1, 171-89. Machala, M., Blaha, L., Vondracek, J., et al. (2003) Inhibition of gap junctional intercellular communication by noncoplanar polychlorinated biphenyls: inhibitory potencies and screening for potential mode(s) of action. Toxicol Sci, 76, 102-11. Safe, S.H. (1994) Polychlorinated biphenyls (PCBs): environmental impact, biochemical and toxic responses, and implications for risk assessment. Crit Rev Toxicol, 24, 87-149. Oenga, G.N., Spink, D.C.,Carpenter, D.O. (2004) TCDD and PCBs inhibit breast cancer cell proliferation in vitro. Toxicol In Vitro, 18, 811-9. Dean, C.E., Jr., Benjamin, S.A., Chubb, L.S., et al. (2002) Nonadditive hepatic tumor promoting effects by a mixture of two structurally different polychlorinated biphenyls in female rat livers. Toxicol Sci, 66, 54-61. Walker, N.J., Crockett, P.W., Nyska, A., et al. (2005) Dose-additive carcinogenicity of a defined mixture of "dioxin-like compounds". Environ Health Perspect, 113, 43-8. Van den Berg, M., Birnbaum, L., Bosveld, A.T., et al. (1998) Toxic equivalency factors (TEFs) for PCBs, PCDDs, PCDFs for humans and wildlife. Environ Health Perspect, 106, 775-92. Hodek, P., Trefil, P.,Stiborova, M. (2002) Flavonoids-potent and versatile biologically active compounds interacting with cytochromes P450. Chem Biol Interact, 139, 1-21. Hollman, P.C.,Katan, M.B. (1997) Absorption, metabolism and health effects of dietary flavonoids in man. Biomed Pharmacother, 51, 305-10. Harborne, J.B.,Williams, C.A. (2000) Advances in flavonoid research since 1992. Phytochemistry, 55, 481-504. --

130 --

8. References 223. 224. 225. 226. 227. 228.

229. 230. 231. 232. 233. 234. 235.

236.

237. 238.

Daskiewicz, J.B., Depeint, F., Viornery, L., et al. (2005) Effects of flavonoids on cell proliferation and caspase activation in a human colonic cell line HT29: an SAR study. J Med Chem, 48, 2790-804. Zhang, S., Qin, C.,Safe, S.H. (2003) Flavonoids as aryl hydrocarbon receptor agonists/antagonists: effects of structure and cell context. Environ Health Perspect, 111, 1877-82. Ashida, H., Fukuda, I., Yamashita, T., et al. (2000) Flavones and flavonols at dietary levels inhibit a transformation of aryl hydrocarbon receptor induced by dioxin. FEBS Lett, 476, 213-7. Fukuda, I., Sakane, I., Yabushita, Y., et al. (2005) Black tea theaflavins suppress dioxin-induced transformation of the aryl hydrocarbon receptor. Biosci Biotechnol Biochem, 69, 883-90. Palermo, C.M., Westlake, C.A.,Gasiewicz, T.A. (2005) Epigallocatechin gallate inhibits aryl hydrocarbon receptor gene transcription through an indirect mechanism involving binding to a 90 kDa heat shock protein. Biochemistry, 44, 5041-52. Wilhelmsson, A., Whitelaw, M.L., Gustafsson, J.A., et al. (1994) Agonistic and antagonistic effects of alpha-naphthoflavone on dioxin receptor function. Role of the basic region helix-loop-helix dioxin receptor partner factor Arnt. J Biol Chem, 269, 19028-33. Le Bail, J.C., Varnat, F., Nicolas, J.C., et al. (1998) Estrogenic and antiproliferative activities on MCF-7 human breast cancer cells by flavonoids. Cancer Lett, 130, 20916. Pelissero, C., Lenczowski, M.J., Chinzi, D., et al. (1996) Effects of flavonoids on aromatase activity, an in vitro study. J Steroid Biochem Mol Biol, 57, 215-23. Brzezinski, A.,Debi, A. (1999) Phytoestrogens: the "natural" selective estrogen receptor modulators? Eur J Obstet Gynecol Reprod Biol, 85, 47-51. Canada, A.T., Giannella, E., Nguyen, T.D., et al. (1990) The production of reactive oxygen species by dietary flavonols. Free Radic Biol Med, 9, 441-9. Stopper, H., Schmitt, E.,Kobras, K. (2005) Genotoxicity of phytoestrogens. Mutat Res, 574, 139-55. van der Woude, H., Alink, G.M., van Rossum, B.E., et al. (2005) Formation of transient covalent protein and DNA adducts by quercetin in cells with and without oxidative enzyme activity. Chem Res Toxicol, 18, 1907-16. Guengerich, F.P., Dannan, G.A., Wright, S.T., et al. (1982) Purification and characterization of liver microsomal cytochromes p-450: electrophoretic, spectral, catalytic, and immunochemical properties and inducibility of eight isozymes isolated from rats treated with phenobarbital or beta-naphthoflavone. Biochemistry, 21, 601930. Shoda, T., Mitsumori, K., Onodera, H., et al. (2000) Liver tumor-promoting effect of beta-naphthoflavone, a strong CYP 1A1/2 inducer, and the relationship between CYP 1A1/2 induction and Cx32 decrease in its hepatocarcinogenesis in the rat. Toxicol Pathol, 28, 540-7. Sinal, C.J., Webb, C.D.,Bend, J.R. (1999) Differential in vivo effects of alphanaphthoflavone and beta-naphthoflavone on CYP1A1 and CYP2E1 in rat liver, lung, heart, and kidney. J Biochem Mol Toxicol, 13, 29-40. Blank, J.A., Tucker, A.N., Sweatlock, J., et al. (1987) alpha-Naphthoflavone antagonism of 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced murine lymphocyte ethoxyresorufin-O-deethylase activity and immunosuppression. Mol Pharmacol, 32, 169-72.

-131 --

8. References 239. 240. 241. 242.

243.

244. 245. 246. 247. 248. 249. 250. 251. 252.

253. 254. 255.

Gasiewicz, T.A., Kende, A.S., Rucci, G., et al. (1996) Analysis of structural requirements for Ah receptor antagonist activity: ellipticines, flavones, and related compounds. Biochem Pharmacol, 52, 1787-803. Santostefano, M., Merchant, M., Arellano, L., et al. (1993) alpha-Naphthoflavoneinduced CYP1A1 gene expression and cytosolic aryl hydrocarbon receptor transformation. Mol Pharmacol, 43, 200-6. Merchant, M., Arellano, L.,Safe, S. (1990) The mechanism of action of alphanaphthoflavone as an inhibitor of 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced CYP1A1 gene expression. Arch Biochem Biophys, 281, 84-9. Lu, Y.F., Santostefano, M., Cunningham, B.D., et al. (1995) Identification of 3'methoxy-4'-nitroflavone as a pure aryl hydrocarbon (Ah) receptor antagonist and evidence for more than one form of the nuclear Ah receptor in MCF-7 human breast cancer cells. Arch Biochem Biophys, 316, 470-7. Henry, E.C., Kende, A.S., Rucci, G., et al. (1999) Flavone antagonists bind competitively with 2,3,7, 8-tetrachlorodibenzo-p-dioxin (TCDD) to the aryl hydrocarbon receptor but inhibit nuclear uptake and transformation. Mol Pharmacol, 55, 716-25. Davis, M.A., Ireton, R.C.,Reynolds, A.B. (2003) A core function for p120-catenin in cadherin turnover. J Cell Biol, 163, 525-34. Dertinger, S.D., Lantum, H.B., Silverstone, A.E., et al. (2000) Effect of 3'-methoxy-4'nitroflavone on benzo[a]pyrene toxicity. Aryl hydrocarbon receptor-dependent and independent mechanisms. Biochem Pharmacol, 60, 189-96. Reiners, J.J., Jr., Clift, R.,Mathieu, P. (1999) Suppression of cell cycle progression by flavonoids: dependence on the aryl hydrocarbon receptor. Carcinogenesis, 20, 1561-6. Nazarenko, D.A., Dertinger, S.D.,Gasiewicz, T.A. (2001) In vivo antagonism of AhRmediated gene induction by 3'-methoxy-4'-nitroflavone in TCDD-responsive lacZ mice. Toxicol Sci, 61, 256-64. Zhou, J.,Gasiewicz, T.A. (2003) 3'-methoxy-4'-nitroflavone, a reported aryl hydrocarbon receptor antagonist, enhances Cyp1a1 transcription by a dioxin responsive element-dependent mechanism. Arch Biochem Biophys, 416, 68-80. Hushka, D.R.,Greenlee, W.F. (1995) 2,3,7,8-Tetrachlorodibenzo-p-dioxin inhibits DNA synthesis in rat primary hepatocytes. Mutat Res, 333, 89-99. Ma, Q.,Whitlock, J.P., Jr. (1996) The aromatic hydrocarbon receptor modulates the Hepa 1c1c7 cell cycle and differentiated state independently of dioxin. Mol Cell Biol, 16, 2144-50. Fox, T.R., Best, L.L., Goldsworthy, S.M., et al. (1993) Gene expression and cell proliferation in rat liver after 2,3,7,8-tetrachlorodibenzo-p-dioxin exposure. Cancer Res, 53, 2265-71. Walker, N.J., Miller, B.D., Kohn, M.C., et al. (1998) Differences in kinetics of induction and reversibility of TCDD-induced changes in cell proliferation and CYP1A1 expression in female Sprague-Dawley rat liver. Carcinogenesis, 19, 142735. Elizondo, G., Fernandez-Salguero, P., Sheikh, M.S., et al. (2000) Altered cell cycle control at the G(2)/M phases in aryl hydrocarbon receptor-null embryo fibroblast. Mol Pharmacol, 57, 1056-63. Fung, T.K., Ma, H.T.,Poon, R.Y. (2007) Specialized roles of the two mitotic cyclins in somatic cells: cyclin A as an activator of M phase-promoting factor. Mol Biol Cell, 18, 1861-73. Glover, D.M., Hagan, I.M.,Tavares, A.A. (1998) Polo-like kinases: a team that plays throughout mitosis. Genes Dev, 12, 3777-87. --

132 --

8. References 256. 257. 258. 259. 260. 261. 262. 263. 264. 265. 266. 267. 268. 269. 270. 271. 272. 273.

Zaher, H., Fernandez-Salguero, P.M., Letterio, J., et al. (1998) The involvement of aryl hydrocarbon receptor in the activation of transforming growth factor-beta and apoptosis. Mol Pharmacol, 54, 313-21. Chang, X., Fan, Y., Karyala, S., et al. (2007) Ligand-Independent Regulation of Transforming Growth Factor-{beta}1 Expression and Cell Cycle Progression by the Aryl Hydrocarbon Receptor. Mol Cell Biol. Puga, A., Tomlinson, C.R.,Xia, Y. (2005) Ah receptor signals cross-talk with multiple developmental pathways. Biochem Pharmacol, 69, 199-207. Gottlicher, M.,Wiebel, F.J. (1991) 2,3,7,8-Tetrachlorodibenzo-p-dioxin causes unbalanced growth in 5L rat hepatoma cells. Toxicol Appl Pharmacol, 111, 496-503. Weiss, C., Kolluri, S.K., Kiefer, F., et al. (1996) Complementation of Ah receptor deficiency in hepatoma cells: negative feedback regulation and cell cycle control by the Ah receptor. Exp Cell Res, 226, 154-63. Ito, T., Tsukumo, S., Suzuki, N., et al. (2004) A constitutively active arylhydrocarbon receptor induces growth inhibition of jurkat T cells through changes in the expression of genes related to apoptosis and cell cycle arrest. J Biol Chem, 279, 25204-10. Marlowe, J.L., Knudsen, E.S., Schwemberger, S., et al. (2004) The aryl hydrocarbon receptor displaces p300 from E2F-dependent promoters and represses S phase-specific gene expression. J Biol Chem, 279, 29013-22. Ge, N.L.,Elferink, C.J. (1998) A direct interaction between the aryl hydrocarbon receptor and retinoblastoma protein. Linking dioxin signaling to the cell cycle. J Biol Chem, 273, 22708-13. Weinberg, R.A. (1995) The retinoblastoma protein and cell cycle control. Cell, 81, 323-30. Kato, J., Matsushime, H., Hiebert, S.W., et al. (1993) Direct binding of cyclin D to the retinoblastoma gene product (pRb) and pRb phosphorylation by the cyclin Ddependent kinase CDK4. Genes Dev, 7, 331-42. Puga, A., Barnes, S.J., Dalton, T.P., et al. (2000) Aromatic hydrocarbon receptor interaction with the retinoblastoma protein potentiates repression of E2F-dependent transcription and cell cycle arrest. J Biol Chem, 275, 2943-50. Elferink, C.J., Ge, N.L.,Levine, A. (2001) Maximal aryl hydrocarbon receptor activity depends on an interaction with the retinoblastoma protein. Mol Pharmacol, 59, 66473. Oesch-Bartlomowicz, B., Huelster, A., Wiss, O., et al. (2005) Aryl hydrocarbon receptor activation by cAMP vs. dioxin: divergent signaling pathways. Proc Natl Acad Sci U S A, 102, 9218-23. Huang, G.,Elferink, C.J. (2005) Multiple mechanisms are involved in Ah receptormediated cell cycle arrest. Mol Pharmacol, 67, 88-96. Kolluri, S.K., Weiss, C., Koff, A., et al. (1999) p27(Kip1) induction and inhibition of proliferation by the intracellular Ah receptor in developing thymus and hepatoma cells. Genes Dev, 13, 1742-53. Murata, K., Hattori, M., Hirai, N., et al. (2005) Hes1 directly controls cell proliferation through the transcriptional repression of p27Kip1. Mol Cell Biol, 25, 4262-71. Thomsen, J.S., Kietz, S., Strom, A., et al. (2004) HES-1, a novel target gene for the aryl hydrocarbon receptor. Mol Pharmacol, 65, 165-71. Morrow, D., Qin, C., Smith, R., 3rd, et al. (2004) Aryl hydrocarbon receptor-mediated inhibition of LNCaP prostate cancer cell growth and hormone-induced transactivation. J Steroid Biochem Mol Biol, 88, 27-36.

-133 --

8. References 274. 275. 276. 277. 278. 279. 280. 281. 282. 283. 284. 285. 286. 287. 288. 289. 290. 291. 292. 293.

Porterfield, S.P. (2000) Thyroidal dysfunction and environmental chemicals--potential impact on brain development. Environ Health Perspect, 108 Suppl 3, 433-8. Dvorak, Z., Vrzal, R., Pavek, P., et al. (2007) An evidence for regulatory cross-talk between aryl hydrocarbon receptor and glucocorticoid receptor in HepG2 cells. Physiol Res. Murphy, K.A., Quadro, L.,White, L.A. (2007) The Intersection Between the Aryl Hydrocarbon Receptor (AhR)- and Retinoic Acid-Signaling Pathways. Vitam Horm, 75, 33-67. Tian, Y., Rabson, A.B.,Gallo, M.A. (2002) Ah receptor and NF-kappaB interactions: mechanisms and physiological implications. Chem Biol Interact, 141, 97-115. Harris, M., Zacharewski, T.,Safe, S. (1990) Effects of 2,3,7,8-tetrachlorodibenzo-pdioxin and related compounds on the occupied nuclear estrogen receptor in MCF-7 human breast cancer cells. Cancer Res, 50, 3579-84. Davis, B.J., McCurdy, E.A., Miller, B.D., et al. (2000) Ovarian tumors in rats induced by chronic 2,3,7,8-tetrachlorodibenzo-p-dioxin treatment. Cancer Res, 60, 5414-9. Safe, S., Astroff, B., Harris, M., et al. (1991) 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) and related compounds as antioestrogens: characterization and mechanism of action. Pharmacol Toxicol, 69, 400-9. Pearce, S.T., Liu, H., Radhakrishnan, I., et al. (2004) Interaction of the aryl hydrocarbon receptor ligand 6-methyl-1,3,8-trichlorodibenzofuran with estrogen receptor alpha. Cancer Res, 64, 2889-97. MacGregor, J.I.,Jordan, V.C. (1998) Basic guide to the mechanisms of antiestrogen action. Pharmacol Rev, 50, 151-96. Wakeling, A.E., Dukes, M.,Bowler, J. (1991) A potent specific pure antiestrogen with clinical potential. Cancer Res, 51, 3867-73. Fawell, S.E., White, R., Hoare, S., et al. (1990) Inhibition of estrogen receptor-DNA binding by the "pure" antiestrogen ICI 164,384 appears to be mediated by impaired receptor dimerization. Proc Natl Acad Sci U S A, 87, 6883-7. Pink, J.J.,Jordan, V.C. (1996) Models of estrogen receptor regulation by estrogens and antiestrogens in breast cancer cell lines. Cancer Res, 56, 2321-30. Dauvois, S., White, R.,Parker, M.G. (1993) The antiestrogen ICI 182780 disrupts estrogen receptor nucleocytoplasmic shuttling. J Cell Sci, 106 ( Pt 4), 1377-88. Wang, F., Hoivik, D., Pollenz, R., et al. (1998) Functional and physical interactions between the estrogen receptor Sp1 and nuclear aryl hydrocarbon receptor complexes. Nucleic Acids Res, 26, 3044-52. Beischlag, T.V.,Perdew, G.H. (2005) ER alpha-AHR-ARNT protein-protein interactions mediate estradiol-dependent transrepression of dioxin-inducible gene transcription. J Biol Chem, 280, 21607-11. Ricci, M.S., Toscano, D.G., Mattingly, C.J., et al. (1999) Estrogen receptor reduces CYP1A1 induction in cultured human endometrial cells. J Biol Chem, 274, 3430-8. Wormke, M., Stoner, M., Saville, B., et al. (2003) The aryl hydrocarbon receptor mediates degradation of estrogen receptor alpha through activation of proteasomes. Mol Cell Biol, 23, 1843-55. Ohtake, F., Baba, A., Takada, I., et al. (2007) Dioxin receptor is a ligand-dependent E3 ubiquitin ligase. Nature, 446, 562-6. Hinck, L., Nathke, I.S., Papkoff, J., et al. (1994) Dynamics of cadherin/catenin complex formation: novel protein interactions and pathways of complex assembly. J Cell Biol, 125, 1327-40. Kowalczyk, A.P., Stappenbeck, T.S., Parry, D.A., et al. (1994) Structure and function of desmosomal transmembrane core and plaque molecules. Biophys Chem, 50, 97-112. --

134 --

8. References 294.

295. 296. 297. 298. 299. 300. 301. 302. 303. 304. 305. 306. 307. 308. 309. 310. 311. 312. 313. 314.

Nusrat, A., Turner, J.R.,Madara, J.L. (2000) Molecular physiology and pathophysiology of tight junctions. IV. Regulation of tight junctions by extracellular stimuli: nutrients, cytokines, and immune cells. Am J Physiol Gastrointest Liver Physiol, 279, G851-7. Vinken, M., Vanhaecke, T., Papeleu, P., et al. (2006) Connexins and their channels in cell growth and cell death. Cell Signal, 18, 592-600. Ivanov, D.B., Philippova, M.P.,Tkachuk, V.A. (2001) Structure and functions of classical cadherins. Biochemistry (Mosc), 66, 1174-86. Fedor-Chaiken, M., Meigs, T.E., Kaplan, D.D., et al. (2003) Two regions of cadherin cytoplasmic domains are involved in suppressing motility of a mammary carcinoma cell line. J Biol Chem, 278, 52371-8. Garrod, D.R., Berika, M.Y., Bardsley, W.F., et al. (2005) Hyper-adhesion in desmosomes: its regulation in wound healing and possible relationship to cadherin crystal structure. J Cell Sci, 118, 5743-54. Nagafuchi, A.,Takeichi, M. (1988) Cell binding function of E-cadherin is regulated by the cytoplasmic domain. Embo J, 7, 3679-84. Berx, G., Becker, K.F., Hofler, H., et al. (1998) Mutations of the human E-cadherin (CDH1) gene. Hum Mutat, 12, 226-37. Kanai, Y., Ushijima, S., Hui, A.M., et al. (1997) The E-cadherin gene is silenced by CpG methylation in human hepatocellular carcinomas. Int J Cancer, 71, 355-9. Kwon, G.Y., Yoo, B.C., Koh, K.C., et al. (2005) Promoter methylation of E-cadherin in hepatocellular carcinomas and dysplastic nodules. J Korean Med Sci, 20, 242-7. Doi, Y., Tamura, S., Nammo, T., et al. (2007) Development of complementary expression patterns of E- and N-cadherin in the mouse liver. Hepatol Res, 37, 230-7. Tsuchiya, B., Sato, Y., Kameya, T., et al. (2006) Differential expression of N-cadherin and E-cadherin in normal human tissues. Arch Histol Cytol, 69, 135-45. Nuruki, K., Toyoyama, H., Ueno, S., et al. (1998) E-cadherin but not N-cadherin expression is correlated with the intracellular distribution of catenins in human hepatocellular carcinomas. Oncol Rep, 5, 1109-14. Cavallaro, U., Liebner, S.,Dejana, E. (2006) Endothelial cadherins and tumor angiogenesis. Exp Cell Res, 312, 659-67. Derycke, L.D.,Bracke, M.E. (2004) N-cadherin in the spotlight of cell-cell adhesion, differentiation, embryogenesis, invasion and signalling. Int J Dev Biol, 48, 463-76. Levenberg, S., Yarden, A., Kam, Z., et al. (1999) p27 is involved in N-cadherinmediated contact inhibition of cell growth and S-phase entry. Oncogene, 18, 869-76. Uglow, E.B., Slater, S., Sala-Newby, G.B., et al. (2003) Dismantling of cadherinmediated cell-cell contacts modulates smooth muscle cell proliferation. Circ Res, 92, 1314-21. Dejana, E., Bazzoni, G.,Lampugnani, M.G. (1999) The role of endothelial cell-to-cell junctions in vascular morphogenesis. Thromb Haemost, 82, 755-61. Angst, B.D., Marcozzi, C.,Magee, A.I. (2001) The cadherin superfamily: diversity in form and function. J Cell Sci, 114, 629-41. Kim, I., Yilmaz, O.H.,Morrison, S.J. (2005) CD144 (VE-cadherin) is transiently expressed by fetal liver hematopoietic stem cells. Blood, 106, 903-5. Kato, K., Takada, T.,Fukusato, T. (2007) Expression of vascular endothelial-cadherin in human hepatocellular carcinoma tissues. Hepatol Res, 37, 444-53. Berndorff, D., Gessner, R., Kreft, B., et al. (1994) Liver-intestine cadherin: molecular cloning and characterization of a novel Ca(2+)-dependent cell adhesion molecule expressed in liver and intestine. J Cell Biol, 125, 1353-69.

-135 --

8. References 315. 316. 317. 318. 319. 320. 321. 322. 323. 324. 325. 326. 327. 328. 329. 330. 331. 332. 333. 334.

Kreft, B., Berndorff, D., Bottinger, A., et al. (1997) LI-cadherin-mediated cell-cell adhesion does not require cytoplasmic interactions. J Cell Biol, 136, 1109-21. Angres, B., Kim, L., Jung, R., et al. (2001) LI-cadherin gene expression during mouse intestinal development. Dev Dyn, 221, 182-93. Wong, B.W., Luk, J.M., Ng, I.O., et al. (2003) Identification of liver-intestine cadherin in hepatocellular carcinoma--a potential disease marker. Biochem Biophys Res Commun, 311, 618-24. Grotzinger, C., Kneifel, J., Patschan, D., et al. (2001) LI-cadherin: a marker of gastric metaplasia and neoplasia. Gut, 49, 73-81. Wang, X.Q., Luk, J.M., Leung, P.P., et al. (2005) Alternative mRNA splicing of liver intestine-cadherin in hepatocellular carcinoma. Clin Cancer Res, 11, 483-9. Ivanov, D., Philippova, M., Antropova, J., et al. (2001) Expression of cell adhesion molecule T-cadherin in the human vasculature. Histochem Cell Biol, 115, 231-42. Ranscht, B.,Dours-Zimmermann, M.T. (1991) T-cadherin, a novel cadherin cell adhesion molecule in the nervous system lacks the conserved cytoplasmic region. Neuron, 7, 391-402. Zhou, S., Matsuyoshi, N., Liang, S.B., et al. (2002) Expression of T-cadherin in Basal keratinocytes of skin. J Invest Dermatol, 118, 1080-4. Vestal, D.J.,Ranscht, B. (1992) Glycosyl phosphatidylinositol--anchored T-cadherin mediates calcium-dependent, homophilic cell adhesion. J Cell Biol, 119, 451-61. Kim, J.S., Han, J., Shim, Y.M., et al. (2005) Aberrant methylation of H-cadherin (CDH13) promoter is associated with tumor progression in primary nonsmall cell lung carcinoma. Cancer, 104, 1825-33. Riou, P., Saffroy, R., Chenailler, C., et al. (2006) Expression of T-cadherin in tumor cells influences invasive potential of human hepatocellular carcinoma. Faseb J, 20, 2291-301. Takeuchi, T., Liang, S.B.,Ohtsuki, Y. (2002) Downregulation of expression of a novel cadherin molecule, T-cadherin, in basal cell carcinoma of the skin. Mol Carcinog, 35, 173-9. Niermann, T., Schmutz, S., Erne, P., et al. (2003) Aryl hydrocarbon receptor ligands repress T-cadherin expression in vascular smooth muscle cells. Biochem Biophys Res Commun, 300, 943-9. Ivanov, D., Philippova, M., Tkachuk, V., et al. (2004) Cell adhesion molecule Tcadherin regulates vascular cell adhesion, phenotype and motility. Exp Cell Res, 293, 207-18. Pokutta, S.,Weis, W.I. (2002) The cytoplasmic face of cell contact sites. Curr Opin Struct Biol, 12, 255-62. Schneider, S., Herrenknecht, K., Butz, S., et al. (1993) Catenins in Xenopus embryogenesis and their relation to the cadherin-mediated cell-cell adhesion system. Development, 118, 629-40. Tan, X., Behari, J., Cieply, B., et al. (2006) Conditional deletion of beta-catenin reveals its role in liver growth and regeneration. Gastroenterology, 131, 1561-72. Ozawa, M., Baribault, H.,Kemler, R. (1989) The cytoplasmic domain of the cell adhesion molecule uvomorulin associates with three independent proteins structurally related in different species. Embo J, 8, 1711-7. Hazan, R.B., Kang, L., Roe, S., et al. (1997) Vinculin is associated with the Ecadherin adhesion complex. J Biol Chem, 272, 32448-53. Herrenknecht, K., Ozawa, M., Eckerskorn, C., et al. (1991) The uvomorulinanchorage protein alpha catenin is a vinculin homologue. Proc Natl Acad Sci U S A, 88, 9156-60. --

136 --

8. References 335. 336. 337. 338. 339. 340. 341. 342. 343. 344. 345. 346. 347. 348. 349. 350. 351. 352. 353. 354. 355.

Hatzfeld, M. (2005) The p120 family of cell adhesion molecules. Eur J Cell Biol, 84, 205-14. Lien, W.H., Klezovitch, O.,Vasioukhin, V. (2006) Cadherin-catenin proteins in vertebrate development. Curr Opin Cell Biol, 18, 499-506. Behrens, J. (1999) Cadherins and catenins: role in signal transduction and tumor progression. Cancer Metastasis Rev, 18, 15-30. Peifer, M. (1995) Cell adhesion and signal transduction: the Armadillo connection. Trends Cell Biol, 5, 224-9. Ozawa, M.,Kemler, R. (1992) Molecular organization of the uvomorulin-catenin complex. J Cell Biol, 116, 989-96. Haegel, H., Larue, L., Ohsugi, M., et al. (1995) Lack of beta-catenin affects mouse development at gastrulation. Development, 121, 3529-37. Cowin, P., Rowlands, T.M.,Hatsell, S.J. (2005) Cadherins and catenins in breast cancer. Curr Opin Cell Biol, 17, 499-508. Nagafuchi, A., Ishihara, S.,Tsukita, S. (1994) The roles of catenins in the cadherinmediated cell adhesion: functional analysis of E-cadherin-alpha catenin fusion molecules. J Cell Biol, 127, 235-45. Peifer, M., McCrea, P.D., Green, K.J., et al. (1992) The vertebrate adhesive junction proteins beta-catenin and plakoglobin and the Drosophila segment polarity gene armadillo form a multigene family with similar properties. J Cell Biol, 118, 681-91. Hoschuetzky, H., Aberle, H.,Kemler, R. (1994) Beta-catenin mediates the interaction of the cadherin-catenin complex with epidermal growth factor receptor. J Cell Biol, 127, 1375-80. Lickert, H., Bauer, A., Kemler, R., et al. (2000) Casein kinase II phosphorylation of Ecadherin increases E-cadherin/beta-catenin interaction and strengthens cell-cell adhesion. J Biol Chem, 275, 5090-5. Matsuyoshi, N., Hamaguchi, M., Taniguchi, S., et al. (1992) Cadherin-mediated cellcell adhesion is perturbed by v-src tyrosine phosphorylation in metastatic fibroblasts. J Cell Biol, 118, 703-14. Sadot, E., Conacci-Sorrell, M., Zhurinsky, J., et al. (2002) Regulation of S33/S37 phosphorylated beta-catenin in normal and transformed cells. J Cell Sci, 115, 2771-80. Yost, C., Torres, M., Miller, J.R., et al. (1996) The axis-inducing activity, stability, and subcellular distribution of beta-catenin is regulated in Xenopus embryos by glycogen synthase kinase 3. Genes Dev, 10, 1443-54. Luo, W., Peterson, A., Garcia, B.A., et al. (2007) Protein phosphatase 1 regulates assembly and function of the beta-catenin degradation complex. Embo J, 26, 1511-21. Kimelman, D.,Xu, W. (2006) beta-catenin destruction complex: insights and questions from a structural perspective. Oncogene, 25, 7482-91. Aberle, H., Bauer, A., Stappert, J., et al. (1997) beta-catenin is a target for the ubiquitin-proteasome pathway. Embo J, 16, 3797-804. Chen, R.H., Ding, W.V.,McCormick, F. (2000) Wnt signaling to beta-catenin involves two interactive components. Glycogen synthase kinase-3beta inhibition and activation of protein kinase C. J Biol Chem, 275, 17894-9. Huber, O., Korn, R., McLaughlin, J., et al. (1996) Nuclear localization of beta-catenin by interaction with transcription factor LEF-1. Mech Dev, 59, 3-10. Orsulic, S., Huber, O., Aberle, H., et al. (1999) E-cadherin binding prevents betacatenin nuclear localization and beta-catenin/LEF-1-mediated transactivation. J Cell Sci, 112 ( Pt 8), 1237-45. Sadot, E., Simcha, I., Shtutman, M., et al. (1998) Inhibition of beta-catenin-mediated transactivation by cadherin derivatives. Proc Natl Acad Sci U S A, 95, 15339-44. --

137 --

8. References 356. 357. 358. 359. 360. 361. 362. 363. 364. 365. 366. 367. 368. 369. 370. 371. 372. 373. 374. 375. 376. 377.

He, T.C., Sparks, A.B., Rago, C., et al. (1998) Identification of c-MYC as a target of the APC pathway. Science, 281, 1509-12. Koch, A., Waha, A., Hartmann, W., et al. (2005) Elevated expression of Wnt antagonists is a common event in hepatoblastomas. Clin Cancer Res, 11, 4295-304. Ben-Ze'ev, A., Shtutman, M.,Zhurinsky, J. (2000) The integration of cell adhesion with gene expression: the role of beta-catenin. Exp Cell Res, 261, 75-82. Stadeli, R., Hoffmans, R.,Basler, K. (2006) Transcription under the control of nuclear Arm/beta-catenin. Curr Biol, 16, R378-85. Toualbi, K., Guller, M.C., Mauriz, J.L., et al. (2007) Physical and functional cooperation between AP-1 and beta-catenin for the regulation of TCF-dependent genes. Oncogene, 26, 3492-502. Fodde, R.,Brabletz, T. (2007) Wnt/beta-catenin signaling in cancer stemness and malignant behavior. Curr Opin Cell Biol, 19, 150-8. Morin, P.J. (1999) beta-catenin signaling and cancer. Bioessays, 21, 1021-30. Roose, J.,Clevers, H. (1999) TCF transcription factors: molecular switches in carcinogenesis. Biochim Biophys Acta, 1424, M23-37. Burke, Z.D.,Tosh, D. (2006) The Wnt/beta-catenin pathway: master regulator of liver zonation? Bioessays, 28, 1072-7. Monga, S.P., Pediaditakis, P., Mule, K., et al. (2001) Changes in WNT/beta-catenin pathway during regulated growth in rat liver regeneration. Hepatology, 33, 1098-109. Cadoret, A., Ovejero, C., Saadi-Kheddouci, S., et al. (2001) Hepatomegaly in transgenic mice expressing an oncogenic form of beta-catenin. Cancer Res, 61, 32459. Micsenyi, A., Tan, X., Sneddon, T., et al. (2004) Beta-catenin is temporally regulated during normal liver development. Gastroenterology, 126, 1134-46. Nishida, N., Nishimura, T., Nagasaka, T., et al. (2007) Extensive methylation is associated with beta-catenin mutations in hepatocellular carcinoma: evidence for two distinct pathways of human hepatocarcinogenesis. Cancer Res, 67, 4586-94. Wei, Y., Fabre, M., Branchereau, S., et al. (2000) Activation of beta-catenin in epithelial and mesenchymal hepatoblastomas. Oncogene, 19, 498-504. Chesire, D.R., Dunn, T.A., Ewing, C.M., et al. (2004) Identification of aryl hydrocarbon receptor as a putative Wnt/beta-catenin pathway target gene in prostate cancer cells. Cancer Res, 64, 2523-33. McGarry, M.A., Charles, G.D., Medrano, T., et al. (2002) Benzo(a)pyrene, but not 2,3,7,8-tetrachlorodibenzo-p-dioxin, alters cell adhesion proteins in human uterine RL95-2 cells. Biochem Biophys Res Commun, 294, 101-7. Loeppen, S., Koehle, C., Buchmann, A., et al. (2005) A beta-catenin-dependent pathway regulates expression of cytochrome P450 isoforms in mouse liver tumors. Carcinogenesis, 26, 239-48. Knudsen, K.A.,Wheelock, M.J. (1992) Plakoglobin, or an 83-kD homologue distinct from beta-catenin, interacts with E-cadherin and N-cadherin. J Cell Biol, 118, 671-9. Lewis, J.E., Wahl, J.K., 3rd, Sass, K.M., et al. (1997) Cross-talk between adherens junctions and desmosomes depends on plakoglobin. J Cell Biol, 136, 919-34. Yin, T., Getsios, S., Caldelari, R., et al. (2005) Mechanisms of plakoglobin-dependent adhesion: desmosome-specific functions in assembly and regulation by epidermal growth factor receptor. J Biol Chem, 280, 40355-63. McCrea, P.D., Turck, C.W.,Gumbiner, B. (1991) A homolog of the armadillo protein in Drosophila (plakoglobin) associated with E-cadherin. Science, 254, 1359-61. Zhurinsky, J., Shtutman, M.,Ben-Ze'ev, A. (2000) Plakoglobin and beta-catenin: protein interactions, regulation and biological roles. J Cell Sci, 113 ( Pt 18), 3127-39. --

138 --

8. References 378. 379. 380. 381. 382. 383. 384. 385. 386. 387.

388. 389. 390. 391. 392. 393. 394. 395. 396. 397.

Zhurinsky, J., Shtutman, M.,Ben-Ze'ev, A. (2000) Differential mechanisms of LEF/TCF family-dependent transcriptional activation by beta-catenin and plakoglobin. Mol Cell Biol, 20, 4238-52. Sadot, E., Simcha, I., Iwai, K., et al. (2000) Differential interaction of plakoglobin and beta-catenin with the ubiquitin-proteasome system. Oncogene, 19, 1992-2001. Salomon, D., Sacco, P.A., Roy, S.G., et al. (1997) Regulation of beta-catenin levels and localization by overexpression of plakoglobin and inhibition of the ubiquitinproteasome system. J Cell Biol, 139, 1325-35. Simcha, I., Shtutman, M., Salomon, D., et al. (1998) Differential nuclear translocation and transactivation potential of beta-catenin and plakoglobin. J Cell Biol, 141, 143348. Bierkamp, C., Schwarz, H., Huber, O., et al. (1999) Desmosomal localization of betacatenin in the skin of plakoglobin null-mutant mice. Development, 126, 371-81. Dusek, R.L., Godsel, L.M., Chen, F., et al. (2007) Plakoglobin deficiency protects keratinocytes from apoptosis. J Invest Dermatol, 127, 792-801. Shiina, H., Breault, J.E., Basset, W.W., et al. (2005) Functional Loss of the gammacatenin gene through epigenetic and genetic pathways in human prostate cancer. Cancer Res, 65, 2130-8. Aberle, H., Bierkamp, C., Torchard, D., et al. (1995) The human plakoglobin gene localizes on chromosome 17q21 and is subjected to loss of heterozygosity in breast and ovarian cancers. Proc Natl Acad Sci U S A, 92, 6384-8. Ashihara, K., Saito, T., Mizumoto, H., et al. (2002) Loss of gamma-Catenin expression in squamous differentiation in endometrial carcinomas. Int J Gynecol Pathol, 21, 246-54. Caca, K., Kolligs, F.T., Ji, X., et al. (1999) Beta- and gamma-catenin mutations, but not E-cadherin inactivation, underlie T-cell factor/lymphoid enhancer factor transcriptional deregulation in gastric and pancreatic cancer. Cell Growth Differ, 10, 369-76. Sommers, C.L., Gelmann, E.P., Kemler, R., et al. (1994) Alterations in beta-catenin phosphorylation and plakoglobin expression in human breast cancer cells. Cancer Res, 54, 3544-52. Ben-Ze'ev, A. (1997) Cytoskeletal and adhesion proteins as tumor suppressors. Curr Opin Cell Biol, 9, 99-108. Dietrich, C., Faust, D., Moskwa, M., et al. (2003) TCDD-dependent downregulation of gamma-catenin in rat liver epithelial cells (WB-F344). Int J Cancer, 103, 435-9. Livak, K.J.,Schmittgen, T.D. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 25, 402-8. Bradford, M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem, 72, 248-54. Carmichael, G.G. (2005) RNA silencing-methods and protocols. Grimm, D.,Kay, M.A. (2006) Therapeutic short hairpin RNA expression in the liver: viral targets and vectors. Gene Ther, 13, 563-75. Snove, O., Jr.,Rossi, J.J. (2006) Expressing short hairpin RNAs in vivo. Nat Methods, 3, 689-95. Lekas, P., Tin, K.L., Lee, C., et al. (2000) The human cytochrome P450 1A1 mRNA is rapidly degraded in HepG2 cells. Arch Biochem Biophys, 384, 311-8. Yoshizumi, M., Hsieh, C.M., Zhou, F., et al. (1995) The ATF site mediates downregulation of the cyclin A gene during contact inhibition in vascular endothelial cells. Mol Cell Biol, 15, 3266-72. --

139 --

8. References 398. 399. 400. 401. 402. 403. 404. 405.

406. 407.

408. 409. 410. 411. 412. 413. 414.

Andrysik, Z., Vondracek, J., Machala, M., et al. (2007) The aryl hydrocarbon receptor-dependent deregulation of cell cycle control induced by polycyclic aromatic hydrocarbons in rat liver epithelial cells. Mutat Res, 615, 87-97. Gradin, K., McGuire, J., Wenger, R.H., et al. (1996) Functional interference between hypoxia and dioxin signal transduction pathways: competition for recruitment of the Arnt transcription factor. Mol Cell Biol, 16, 5221-31. Hanahan, D.,Weinberg, R.A. (2000) The hallmarks of cancer. Cell, 100, 57-70. Ashida, H. (2000) Suppressive effects of flavonoids on dioxin toxicity. Biofactors, 12, 201-6. Tutel'yan, V., Gapparov, M., Telegin, L., et al. (2003) Flavonoids and Resveratrol as Regulators of Ah-Receptor Activity: Protection from Dioxin Toxicity. Bulletin of Experimental Biology and Medicine, 136, 553-539. Williams, S.N., Shih, H., Guenette, D.K., et al. (2000) Comparative studies on the effects of green tea extracts and individual tea catechins on human CYP1A gene expression. Chem Biol Interact, 128, 211-29. Pendurthi, U.R., Okino, S.T.,Tukey, R.H. (1993) Accumulation of the nuclear dioxin (Ah) receptor and transcriptional activation of the mouse Cyp1a-1 and Cyp1a-2 genes. Arch Biochem Biophys, 306, 65-9. Harris, M., Zacharewski, T., Astroff, B., et al. (1989) Partial antagonism of 2,3,7,8tetrachlorodibenzo-p-dioxin-mediated induction of aryl hydrocarbon hydroxylase by 6-methyl-1,3,8-trichlorodibenzofuran: mechanistic studies. Mol Pharmacol, 35, 72935. Swanson, H.I.,Perdew, G.H. (1993) Half-life of aryl hydrocarbon receptor in Hepa 1 cells: evidence for ligand-dependent alterations in cytosolic receptor levels. Arch Biochem Biophys, 302, 167-74. Zhou, J.G., Henry, E.C., Palermo, C.M., et al. (2003) Species-specific transcriptional activity of synthetic flavonoids in guinea pig and mouse cells as a result of differential activation of the aryl hydrocarbon receptor to interact with dioxin-responsive elements. Mol Pharmacol, 63, 915-24. Matsuda, T., Imaoka, S., Funae, Y., et al. (1995) Induction of CYP isoenzymes in various organs of rats by 3-methylcholanthrene or beta-naphthoflavone. Cancer Lett, 97, 137-43. Madan, A., Graham, R.A., Carroll, K.M., et al. (2003) Effects of prototypical microsomal enzyme inducers on cytochrome P450 expression in cultured human hepatocytes. Drug Metab Dispos, 31, 421-31. Israel, D.I.,Whitlock, J.P., Jr. (1984) Regulation of cytochrome P1-450 gene transcription by 2,3,7, 8-tetrachlorodibenzo-p-dioxin in wild type and variant mouse hepatoma cells. J Biol Chem, 259, 5400-2. Okino, S.T.,Whitlock, J.P., Jr. (1995) Dioxin induces localized, graded changes in chromatin structure: implications for Cyp1A1 gene transcription. Mol Cell Biol, 15, 3714-21. LeBaron, M.J., Xie, J.,Rui, H. (2005) Evaluation of genome-wide chromatin library of Stat5 binding sites in human breast cancer. Mol Cancer, 4, 6. Spink, B.C., Hussain, M.M., Katz, B.H., et al. (2003) Transient induction of cytochromes P450 1A1 and 1B1 in MCF-7 human breast cancer cells by indirubin. Biochem Pharmacol, 66, 2313-21. Weiss, C., Faust, D., Schreck, I., et al. (2007) TCDD deregulates contact inhibition in rat liver oval cells via Ah receptor, JunD and cyclin A. Oncogene.

-140 --

8. References 415. 416. 417. 418.

419. 420. 421. 422. 423. 424. 425.

426.

427. 428. 429. 430. 431. 432.

Seo, H.S., DeNardo, D.G., Jacquot, Y., et al. (2006) Stimulatory effect of genistein and apigenin on the growth of breast cancer cells correlates with their ability to activate ER alpha. Breast Cancer Res Treat, 99, 121-34. Maggiolini, M., Bonofiglio, D., Marsico, S., et al. (2001) Estrogen receptor alpha mediates the proliferative but not the cytotoxic dose-dependent effects of two major phytoestrogens on human breast cancer cells. Mol Pharmacol, 60, 595-602. Moutsatsou, P. (2007) The spectrum of phytoestrogens in nature: our knowledge is expanding. Hormones (Athens), 6, 173-93. Horner-Glister, E., Maleki-Dizaji, M., Guerin, C.J., et al. (2005) Influence of oestradiol and tamoxifen on oestrogen receptors-alpha and -beta protein degradation and non-genomic signalling pathways in uterine and breast carcinoma cells. J Mol Endocrinol, 35, 421-32. Chang, C.Y.,Puga, A. (1998) Constitutive activation of the aromatic hydrocarbon receptor. Mol Cell Biol, 18, 525-35. Mason, G.G., Witte, A.M., Whitelaw, M.L., et al. (1994) Purification of the DNA binding form of dioxin receptor. Role of the Arnt cofactor in regulation of dioxin receptor function. J Biol Chem, 269, 4438-49. Whitelaw, M., Pongratz, I., Wilhelmsson, A., et al. (1993) Ligand-dependent recruitment of the Arnt coregulator determines DNA recognition by the dioxin receptor. Mol Cell Biol, 13, 2504-14. Abercrombie, M. (1979) Contact inhibition and malignancy. Nature, 281, 259-62. Dietrich, C., Scherwat, J., Faust, D., et al. (2002) Subcellular localization of betacatenin is regulated by cell density. Biochem Biophys Res Commun, 292, 195-9. Davies, M.L., Roberts, G.T., Spiller, D.G., et al. (2004) Density-dependent location and interactions of truncated APC and beta-catenin. Oncogene, 23, 1412-9. Leung, Y.K., Lau, K.M., Mobley, J., et al. (2005) Overexpression of cytochrome P450 1A1 and its novel spliced variant in ovarian cancer cells: alternative subcellular enzyme compartmentation may contribute to carcinogenesis. Cancer Res, 65, 372634. Trombino, A.F., Near, R.I., Matulka, R.A., et al. (2000) Expression of the aryl hydrocarbon receptor/transcription factor (AhR) and AhR-regulated CYP1 gene transcripts in a rat model of mammary tumorigenesis. Breast Cancer Res Treat, 63, 117-31. Carnell, D.M., Smith, R.E., Daley, F.M., et al. (2004) Target validation of cytochrome P450 CYP1B1 in prostate carcinoma with protein expression in associated hyperplastic and premalignant tissue. Int J Radiat Oncol Biol Phys, 58, 500-9. Murray, G.I., Taylor, M.C., McFadyen, M.C., et al. (1997) Tumor-specific expression of cytochrome P450 CYP1B1. Cancer Res, 57, 3026-31. Stambolsky, D.V., Kuzmenko, Y.S., Philippova, M.P., et al. (1999) Identification of 130 kDa cell surface LDL-binding protein from smooth muscle cells as a partially processed T-cadherin precursor. Biochim Biophys Acta, 1416, 155-60. Lee, S.W. (1996) H-cadherin, a novel cadherin with growth inhibitory functions and diminished expression in human breast cancer. Nat Med, 2, 776-82. Lee, S.W., Reimer, C.L., Campbell, D.B., et al. (1998) H-cadherin expression inhibits in vitro invasiveness and tumor formation in vivo. Carcinogenesis, 19, 1157-9. Kuzmenko, Y.S., Kern, F., Bochkov, V.N., et al. (1998) Density- and proliferation status-dependent expression of T-cadherin, a novel lipoprotein-binding glycoprotein: a function in negative regulation of smooth muscle cell growth? FEBS Lett, 434, 183-7.

-141 --

8. References 433. 434.

435.

Kuzmenko, Y.S., Stambolsky, D., Kern, F., et al. (1998) Characteristics of smooth muscle cell lipoprotein binding proteins (p105/p130) as T-cadherin and regulation by positive and negative growth regulators. Biochem Biophys Res Commun, 246, 489-94. Endo, K., Ueda, T., Ueyama, J., et al. (2000) Immunoreactive E-cadherin, alphacatenin, beta-catenin, and gamma-catenin proteins in hepatocellular carcinoma: relationships with tumor grade, clinicopathologic parameters, and patients' survival. Hum Pathol, 31, 558-65. Joo, Y.E., Rew, J.S., Choi, S.K., et al. (2002) Expression of e-cadherin and catenins in early gastric cancer. J Clin Gastroenterol, 35, 35-42.

-142 --

9. Publications 9 PUBLICATIONS Conferences: Vondráček J., Andrysík Z., Zatloukalová J., Krčmář P., Dietrich C., Kranz A., Hofmanová J., Kozubík A., Machala M. (2005): The role of aryl hydrocarbon receptor (AhR) in cell cycle regulation. In: XXIII. Xenobiochemické sympózium, Valtice, pp. 21, lecture Zatloukalová J., Chramostová K., Krčmář P., Machala M., Kozubík A., Vondráček J. (2005): Effects of flavonoids on AhR-signal transduction pathway and cell cycle regulation of cell line WB-F344. In: XXIII. Xenobiochemické sympózium, Valtice, pp. 59, poster Vondráček J., Andrysík Z., Zatloukalová J., Krčmář P., Dietrich C., Kranz A., Faust D., Kozubík A., Machala M. (2005): Deregulation of cell cycle control by polycyclic aromatic hydrocarbons and flavonoids – the role of AhR? In: 6th Düsseldorf Symposium on Immunotoxicology – Biochemistry and Function of the Arylhydrocarbon Receptor and other PAS-bHLH Proteins, pp 58, poster Machala M., Pěnčíková K., Marvanová S., Topinka J., Švihálková-Šindlerová L., Chramostová K., Zatloukalová J., Vondráček J. (2005): The role of AhR-mediated activity in toxicity of methylated PAHs. In: 6th Düsseldorf Symposium on Immunotoxicology – Biochemistry and Function of the Arylhydrocarbon Receptor and other PAS-bHLH Proteins, pp 47, poster Machala M., Pěnčíková K., Polášková P., Andrysík Z., Neča J., Umannová L., Zatloukalová J., Krčmář P., Slavík J., Vondráček J. (2006): In vitro mechanistic studies on AhRdependent and –independent mechanisms of action of PCBs in liver progenitor cells. In:The 4th PCB Workshop: Recent Advances in the Environmental Toxicology and Health Effects of PCBs, Zakopane, Book of Abstracts, pp. 55, invited lecture Zatloukalová J., Kozubík A., Machala M., Vondráček J. (2006): Expression and localiztion pattern of cell adhesion molecules after PCB 126 and TCDD treatment in rat oval hepatic WB-F344 cells and in Madine Darby canine kidney cells. In:The 4th PCB Workshop: Recent Advances in the Environmental Toxicology and Health Effects of PCBs, Zakopane, Book of Abstracts, pp. 130, poster Machala M., Krčmář P., Skálová L., Szotáková B., Plíšková M., Bunček M., Holasová Š., Dostálová L., Zatloukalová J., Vondráček J. (2006): Expression of enzymes of metabolic activation of PAHs in rat liver cellular models. In: Proceedings from the XX. Biochemický zjazd, Piešťany, pp. 75, lecture Vondráček J., Marvanová S., Hrubá E., Krčmář P., Zatloukalová J., Andrysík Z., Kozubík A., Machala M. (2006): Controversies in the role of p53 protein in cellular response to polycyclic aromatic hydrocarbons. In: Proceedings from the XX. Biochemický zjazd, Piešťany, pp. 120, lecture Zatloukalová J., Krčmář P., Chramostová K., Kozubík A., Machala M., Vondráček J. (2006): Molecular mechanisms of flavone-induced effects on AhR in rat liver „stem-like“ cells. In: Proceedings from the XX. Biochemický zjazd, Piešťany, pp. 324, poster Zatloukalová J., Krčmář P., Chramostová K., Kozubík A., Machala M., Vondráček J. (2006): Effects of flavones on AhR-signaling pathway in rat oval stem-like cells. In: Abstracts of the EUROTOX 2006/6 CTDC Congress - 43rd Congress of the European Societies of Toxicology & 6th Congress of Toxicology in Developing Countries, Toxicol. Lett. 164S: S208-S209, ISSN: 0378-4274, poster -143 --

9. Publications Beneš P., Macečková V., Andrysík Z., Zatloukalová J., Šmarda J.(2006): Okadaická kyselina jako induktor diferenciace a apoptózy u monoblastů BM2. In X. pracovní setkání biochemiků a molekulárních biologů. Brno: Masarykova univerzita, ISBN 80-210-3942-6, s. 56-56, poster Beneš P., Macečková V., Andrysík Z., Zatloukalová J., Šmarda J.(2006): Retinoic acid affects the response of v-Myb-transformed monoblasts to okadaic acid. In Haematologica/the hematology journal. Pavia:Ferrata Storti Foundation, s. 469-469, 1 s. ISBN 0390-6078, poster Zatloukalová J., Machala M., Kozubík A., Vondráček J.(2007): Downregulation of Ah receptor expression using RNA interference in a model of liver progenitor cells. XXIV. Xenobiochemické sympózium, Liptovský Ján, Program and Abstract book, ISBN 978-80969688-5-5, str. 80, poster Vondráček J., Zatloukalová J., Andrysík Z., Ummanová L., Marvanová S., Polášková P., Krčmář P., Topinka J., Skálová L., Szotáková B., Kozubík A., Machala M.(2007): Liver progenitor cells as an alternative cellular model for studies on effects of Ah receptor ligands. XXIV. Xenobiochemické sympózium, Liptovský Ján, Program and Abstract book, ISBN 978-80-969688-5-5, str. 31, lecture Beneš P., Macečková V., Zatloukalová J., Kovářová L., Šmarda J.(2007): Interakce okadaické a retinové kyseliny při kontrole diferenciace monoblastů transformovaných onkogenem v-myb. In XI. Setkání biochemiků a molekulárních biologů. Brno: Masarykova univerzita, s. 3-3, 1 s. ISBN 978-80-210-42346, poster Zatloukalová J., Horváth V., Andrysík Z., Umannová L., Machala M., Kozubík A., Vondráček J. (2007): Cyclin A as a marker of disruption of contact inhibition in rat liver progenitor cells. Analytická Cytometrie IV., Brno, ISBN: 978-80-239-9591-6, s.144, poster Vaculová A., Hofmanová J., Zatloukalová J., Kozubík A.(2007): The role of an antiapoptotic Mcl-1 protein in regulation of colon cancer cell sensitivity to TRAIL-induced apoptosis. Analytická Cytometrie IV., Brno, ISBN: 978-80-239-9591-6, s.84, poster Machala M., Marvanová S., Pěnčíková K., Polášková P., Trilecová L., Vykopalová L., Ciganek M., Krčmář P., Neča J., Švihálková-Šindlerová L., Umannová L., Zatloukalová J., Andrysík Z., Topinka J., Šrám R.J., Valovičová Z., Gábelová A., Kozubík A., Vondráček J. (2007): A comprehensive system for determination of toxic potencies of complex environmental chemical mixtures and individual aromatic contaminants. In: Genetic Toxicology and Cancer Prevention, Book of Abstracts, Cancer Research Institute, Bratislava, pp. 5-6. lecture Articles: Vondráček J., Dietrich C., Andrysík Z., Zatloukalová J., Kranz A., Krčmář P., Kozubík A., Machala M. (2005) Disruption of cell cycle control in rat liver epithelial ‘stem-like’ cells by AhR ligands. Organohalogen Compounds 67: 2302-2305

-144 --

9. Publications Zatloukalova J., Svihalkova-Sindlerova L., Kozubik A., Krcmar P., Machala M., Vondracek J.: beta-Naphthoflavone and 3'-methoxy-4'-nitroflavone exert ambiguous effects on Ah receptor-dependent cell proliferation and gene expression in rat liver 'stem-like' cells. Biochem Pharmacol. 2007 May 15;73(10):1622-34, PMID: 17324381 Benes P., Maceckova V., Zatloukalova J., Kovarova L., Smardova J., Smarda J.: Retinoic acid enhances differentiation of v-myb-transformed monoblasts induced by okadaic acid. Leuk Res. 2007 Oct;31(10):1421-31, PMID: 17624428 Umannová L., Zatloukalová J., Machala M., Krčmář P., Májková Z., Hennig B., Kozubík A., Vondráček J.: Tumor necrosis factor-alpha modulates effects of aryl hydrocarbon receptor ligands on cell proliferation and expression of cytochrome P450 enzymes in rat liver "stemlike" cells. Toxicol Sci. 2007 Sep;99(1):79-89. PMID: 17557910 Weiss C., Faust D., Schreck I., Ruff A., Farweck T., Melenberg A., Schneider S., OeschBartlomowicz B., Zatloukalova J., Vondracek J., Oesch F., Dietrich C.: TCDD deregulates contact inhibition in rat liver oval cells via Ah receptor, JunD and cyclin A. Oncogene. 2007 Oct 22; PMID: 17952121

-145 --

10. Abbreviations 10

List of ABBREVIATIONS

AA – arachidonic acid AAF - 2-acetylaminofluorene AB – amidoblack AFNB1 - aflatoxin B1 AHF/AEF - hepatic/enzyme-altered foci AHH - aryl hydrocarbon hydrolase AhR - aryl hydrocarbon receptor AhRR - AhR repressor AIP - AhR interacting protein Aldh3a1 - aldehyde dehydrogenase 3a1 ANF - α-naphtoflavone (7,8-benzoflavone) AP-1 – activating protein 1 APC - adenomatous polyposis coli APS – ammonium persulfate AR - androgen receptor ARA9 - AhR activated protein 9 ARNT - AhR nuclear translocator ARVCF - Armadillo repeat gene deleted in Velo-Cardio-Facial syndrome ATP – adenosine triphosphate B[a]A – benzo[a]anthracene B[a]P - benzo[a]pyrene B[b]F – benzo[b]fluoranthene bHLH - basic helix-loop-helix bHLH/PAS - basic helix-loop-helix/ period-Arnt-Sim BNF - β-naphthoflavone (5,6-benzoflavone) Brg-1 - Brahma-related protein 1 CA-AhR - constitutively active AhR cAMP - cyclic adenosine monophosphate CAR - constitutive active/androstane receptor CARM - cofactor-associated arginine R methyltransferase CBP - CREB-binding protein CCl4 - carbon tetrachloride Ccna2 - gene enconding cyclin A CDE - choline deficient/ethionine-containg diet Cdh13 – gene encoding cadherin 13 CDK - cyclin-dependent kinase CKII - casein kinase II CML - chronic myeloid leukaemia CREB - cAMP-response elements binding protein Ctnnb1 – gene enconding β-catenin Cyp1a1 – cytochrome P450 1a1 Cyp1b1 – cytochrome P450 1b1 DBD - DNA-binding domain DEN - dimethylnitrosamine DMSO – dimethylsulfoxide DP – desmoplakin DR – dioxin receptor -146 --

10. Abbreviations DRE/XRE - dioxin response elements/ xenobiotic response elements DSC – desmocollin DSG – desmoglein DTT – dithiothreitol E1A- early region 1A E2 - 17β-estradiol ECM – extracellular matrix EDTA - diaminoethanetetraacetic acid EGF – epidermal growth factor EGFR - receptor for epidermal growth factor EGTA - ethylene glycol tetraacetic acid EMSA – electrophoretic mobility shift assay ER - estrogen recetor ERAP140 - estrogen receptor associating protein 140 ERE - estrogen responsive element FBS - fetal bovine serum FXR - farnesoid receptor GAC63 - GRIP1 associated coactivator 63 GalN - D-galactoseamin GAPDH – Glyceraldehyde-3-phosphate dehydrogenase GPI - glycosyl phosphatidylinositol GR - glucocorticoid receptor GSK3β - glycogen synthase kinase 3β HAH - polyhalogenated hydrocarbon HAT - histone acetyltransferase HBV - hepatitis B virus HBx – viral protein of hepatitis B virus HCC - hepatocellular carcinoma HDAC – histone deacetylase HEPES - 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid Hes-1 - hairy and enhancer of split 1 HIF – hypoxia inducible factor HMG – high mobility group HMT - histone methyltransferase HNF - hepatocytes nuclear factor HPC - hepatic progenitor cell hsp90 - chaperone 90 ChIP – chromatin immunoprecipitation IARC - International Agency for Research on Cancer iDRE - inhibitory DRE element IL-2 – interleukine 2 ITE - 2-(1′H-indole-3′-carbonyl)-thiazole-4-carboxylic acid JNK - Jun N-terminal kinase Jup – gene encoding PKG LBD - ligand binding domain LDL - low-density lipoprotein Lef/Tcf - lymphoid enhancer factor/ T cell factor LT – leucotrien LXR - liver X receptor MAPK - mitogen-activated protein kinase -147 --

10. Abbreviations MCDF - 6-methyl-1,3,8-trichlorodibenzofuran MEK-1 - mitogen-activated protein kinase kinase MMTV - mouse mammary tumor virus NADP - nicotineamide adenine dinucleotide phosphate NcoA - nuclear coactivator NCoR - nuclear receptor corepressor NES - nuclear export sequence NF-1 - nuclear factor 1 NFkB – nuclear factor kappa B NLS - nuclear localization sequence NPRAP - Neural plakophilin-related Armadillo protein Nqo1 - NAD(P)H quinone reductase1 NR – nuclear receptor Nrf2 – NF-E2-related factor-2 Nrf2 - nuclear factor-E2 p45-related factor 2 NSAID - nonsteroidal antiinflammatory drug p/CIP - p300/CBP cointegrator protein PAGE – polyacrylamide gel electrophoresis PAH - polyaromatic hydrocarbon PAPS - adenosine-3´-phosphate-5´-phosphosulfate PARP - poly(ADP)-ribose polymerase PB – phenobarbital PBB - polybrominated biphenyl PBGD – porphobilinogen deaminase PCB - polychlorinated biphenyl PCB 126 - 3,3',4,4',5-pentachlorobiphenyl PCDD - dibenzo-p-dioxin PCDF – dibenzofuran PCR – polymerase chain reaction PDGF - platelet derived growth factor PGC1α - PPARγ-coactivator-1α PH - partial hepatectomy PhIP - 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine PKC – protein kinase C PKG – plakoglobin PMSF - phenylmethylsulfonyl fluoride Pol II - RNA polymerase II PPAR - peroxisome proliferator-activate receptor pRB - retinoblastoma protein PRMT - protein arginine R transferase PUFA - polyunsaturated fatty acid PXR - pregnane X receptor RA – retinoic acid RAR - retinoic acid receptor RE - response element RET - retrorsine RIP140 - receptor-interacting protein 140 RNAi – RNA interference RT-PCR – real time / reverse transcription PCR RXR - retinoid X receptor -148 --

10. Abbreviations SDS – sodium dodecyl sulfate shRNA – short hairpin RNA SIM - single-minded protein siRNA – short interfering RNA SMRT - silencing mediator for retinoic acid and thyroid hormone receptor SRC-1 - steroid receptor coactivator 1 TAD - transactivation domain TBP – TATA binding protein TCDD - 2,3,7,8-tetrachlorodibenzo-p-dioxin TEF - toxicity equivalent factor TEMED - N,N,N',N'-tetramethylethylenediamine TEQ - total toxic equivalency TGFβ1 - tumor growth factor β1 TM – transmembrane domain TPA - 12-O-tetradecanoylphorbol-13-acetate TR - thyroid receptor TRD - transrepression domain UDP - uridine diphosphate Ugt1a1 – glucuronosyltransferase 1a1 Ugt1a6 - glucuronosyltransferase 1a6 VDR - vitamin D receptor WB – western blotting WHO - World Health Organization Wnt – wingless-type MMTV integration site family XAP1 - X-associated protein 1 XAP2 - immunophilin-like hepatitis B virus X- associated protein XME – xenobiotic metabolising enzyme XR – xenosensor 2,4,5-T - 2,4,5-trichlorophenoxyacetic acid 3M4NF - 3´-methoxy-4´-nitroflavone 3MC - 3-methylchloranthene

-149 --