Phenylethanol promotes adhesion and biofilm ... - Wiley Online Library

RESEARCH ARTICLE

Phenylethanol promotes adhesion and biofilm formation of the antagonistic yeast Kloeckera apiculata for the control of blue mold on citrus Liu Pu1,2, Fang Jingfan1, Chen Kai1, Long Chao-an1 & Cheng Yunjiang1 1 National Center of Citrus Breeding, Key Laboratory of Horticultural Plant Biology of Ministry of Education, Huazhong Agricultural University, Wuhan, China; and 2Key Laboratory of Pomology, Anhui Agricultural University, Hefei, China

Correspondence: Long Chao-an, National Center of Citrus Breeding, Key Laboratory of Horticultural Plant Biology of Ministry of Education, Huazhong Agricultural University, Wuhan 430070, China. Tel.: +86 27 87280499; fax: +86 27 87282010; e-mail: [email protected] Received 25 October 2013; revised 17 January 2014; accepted 17 January 2014. Final version published online 18 February 2014. DOI: 10.1111/1567-1364.12139 Editor: Richard Calderone Keywords adhesion; antagonist–pathogen interaction; biofilm; biological control; phenylethanol; quorum-sensing.

Abstract The yeast Kloeckera apiculata strain 34-9 is an antagonist with biological control activity against postharvest diseases of citrus fruit. In a previous study it was demonstrated that K. apiculata produced the aromatic alcohol phenylethanol. In the present study, we found that K. apiculata was able to form biofilm on citrus fruit and embed in an extracellular matrix, which created a mechanical barrier interposed between the wound surface and pathogen. As a quorumsensing molecule, phenylethanol can promote the formation of filaments by K. apiculata in potato dextrose agar medium, whereas on the citrus fruit, the antagonist remains as yeast after being treated with the same concentration of phenylethanol. It only induced K. apiculata to adhere and form biofilm. Following genome-wide computational and experimental identification of the possible genes associated with K. apiculata adhesion, we identified nine genes possibly involved in triggering yeast adhesion. Six of these genes were significantly induced after phenylethanol stress treatment. This study provides a new model system of the biology of the antagonist–pathogen interactions that occur in the antagonistic yeast K. apiculata for the control of blue mold on citrus caused by Penicillium italicum.

YEAST RESEARCH

Introduction Penicillium digitatum and Penicillium italicum (P.I), the causal agent of green and blue mold decay, are important postharvest diseases of citrus fruit that cause heavy losses around the world. Traditionally, control of this pathogen has relied mainly on the use of chemical fungicides; however, the development of fungicide resistance and increasing consumer demands for reduction in residues on fruit have emphasized the need for alternative disease control strategies (Janisiewicz & Korsten, 2002). As a potential alternative to fungicide, more than 30 yeast species have been reported to effectively reduce postharvest diseases over the past three decades, including members of the genera Kloeckera, Cryptococcus, Candida and Pichia. For example, Kloeckera apiculata (K.A) can inhibit the growth of green and blue mold on citrus fruit and protect against fungal pathogen attack (McLaughlin et al., 1992; Long et al., 2005, 2007). Several mechanisms ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved

for their effects have been proposed, including successful mycoparasitism and competition for nutrients (Long & Gao, 2009; Liu et al., 2013). The ability to form biofilms has been proposed as an effective mechanism of action in some biological control yeasts (Giobbe et al., 2007; Fiori et al., 2008; Bojsen et al., 2012; Vero et al., 2013). Little is known about the development and architecture of yeast biofilm in K.A. Biofilms are structured microbial communities that are attached to a surface and are encased in an extracellular matrix (ECM; Donlan, 2002; Bais et al., 2004). Biofilm formation is observed in Saccharomyces and Candida species (Reynolds & Fink, 2001; Bojsen et al., 2012) and many factors that can affect yeast biofilm formation. One of the most important issues of biofilm is the initial attachment of microorganisms, since yeast attachment is a necessary first step for biofilm formation. Their activity is often mediated by specific cell wall adhesive glycophosphatidyl inositol (GPI)-anchored proteins (Finkel & FEMS Yeast Res 14 (2014) 536–546

537

Phenylethanol induces adhesion and biofilm formation

Mitchell, 2011). Different yeast species carry different families of adhesins that reflect the species’ lifestyle (Verstrepen & Klis, 2006). Comparative genomics techniques, such as DNA microarrays, proteomic and transcriptomic analysis, fueled by the growing number of genome sequences, have helped to identify putative adhesin genes and families in these strains (Reynolds & Fink, 2001; Finkel & Mitchell, 2011). Five FLO (flocculation; FLO1, FLO5, FLO9, FLO10 and FLO11) genes, which share an N-terminal signal sequence, numerous internal repeats rich in serine and threonine, and a C-terminal GPI anchor attachment sequence, are responsible for adhesion in Saccharomyces cerevisiae (Smukalla et al., 2008). Genes such as FLO11-encoded flocculin play an important role in S. cerevisiae phenotypes, including flocculation, pseudohyphae formation, biofilm initiation and development (Halme et al., 2004; Zara et al., 2009; Flemming & Wingender, 2010; Vandenbosch et al., 2013). Adherence of fungal pathogen Candida albicans depends upon the agglutinin-like sequence (ALS) gene family, a family of eight genes whose products resemble Flo and Epa surface proteins, extracellular adherence protein (EAP) and hyphal wall protein (HWP) genes (Li et al., 2007; Vallejo et al., 2013). However, little is known about the genes involved in the adhesion of K.A. The ability to form biofilms and filamentous growth are often correlated (Krasowska et al., 2009; Ianiri et al., 2013). The morphological transition in yeast is usually controlled by quorum-sensing (QS) molecules (Chen et al., 2004). In C. albicans, farnesol and tyrosol together control the germ-tube formation of cells (Hornby et al., 2001; Ramage et al., 2002). A previous study demonstrated that different aromatic alcohols exert different effects on morphogenesis in S. cerevisiae and C. albicans (Chen & Fink, 2006). Recently, the aromatic alcohol phenylethanol was identified as a QS molecule stimulating pseudohyphal growth in S. cerevisiae and Debaryomyces hansenii (Gori et al., 2011). However, this aromatic alcohol inhibits the formation of germ-tubes and biofilm in C. albicans, suggesting different effects of phenylethanol in different species. Yeasts have evolved molecular signals that evoke species-specific behaviors (Chen & Fink, 2006). To the best of our knowledge, the effects of phenylethanol on K.A remain unknown. Kloeckera apiculata (teleomorph Hanseniaspora uvarum), which has a distinctive apiculata or lemon-shaped cell morphology, is a dominant yeast species in the early stages of wine fermentation and is widely distributed on natural fruit surfaces (Cadez et al., 2002; Sosa et al., 2008a, b; Ocon et al., 2010). The flocculent phenotype of K.A is mediated by galactose-specific lectins and activated by Ca2+ via the protein kinase A (cyclic AMP-dependent protein kinase) transduction pathway (Farias & Manca de FEMS Yeast Res 14 (2014) 536–546

Nadra, 2003; Sosa et al., 2008a). This property is of considerable importance to the brewing industry for the separation of cells from media in the downstream processing of fermentation products (Sosa & Farıas, 2012). The aim of this study was to investigate whether K.A forms biofilm on citrus fruit and, if so, to investigate the phenotypic effects on filamentous, adhesion and biofilm formation under phenylethanol stress.

Materials and methods Antagonist, fungal pathogens and culture conditions

Kloeckera apiculata strain 34-9 (CCTCC M204025) was isolated from the epiphytes of citrus roots (Long et al., 2005). The strain was grown in YPD medium (10 g L 1 yeast extract, 20 g L 1 peptone and 20 g L 1 dextrose). The yeast cell suspension was aseptically transferred from a 48-h-old starter culture to 50 mL new YPD medium. Erlenmeyer flasks were placed on an orbital shaker at 200 r.p.m. for 48 h at 28 °C. Yeast cells were collected by centrifugation at 4000 g for 10 min, washed twice with sterile distilled water, and suspended in sterile water to its initial volume. The cell suspension concentration was adjusted to 1.0 9 108 cells mL 1. A highly virulent strain of P.I was obtained from decaying Citrus sinensis (L.) Osbeck. The pathogen was cultured in PDA (200 g L 1 potato extract, 20 g L 1 dextrose and 20 g L 1 agar). Conidia of the fungi were obtained from a 7-day culture by flooding the cultures with sterile distilled water containing 0.05% (v/v) Tween 80. The conidial suspension was filtered through three layers of sterilized cheesecloth and adjusted to a concentration of 1.0 9 107 conidia mL 1 with a hemocytometer. Cell morphology analysis of K.A after application on the fruit surface

Newhall navel orange fruit (C. sinensis L. Osbeck cv. Newhall) at a commercially mature stage were harvested from the orchard in Yichang City, Hubei Province, China, and were transported to Huazhong Agricultural University, Wuhan City, Hubei Province, China. All fruits were uniform in size and color, and had no physical wounds or infections. Prior to use, the fruits were surface-sterilized with 2% (v/v) NaOCl solution for 2 min, rinsed with tap water and air-dried. The fruits were soaked in the cell suspension of K.A (1.0 9 108 cells mL 1) for 2 min, air-dried and stored in a ventilated warehouse. Samples were collected at 30 days post-inoculation (dpi) for scanning electron microscope (SEM) examination. ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved

538

Cell morphology analysis of K.A during the interaction of pathogen and antagonist on citrus tissue

Fruits were pretreated as described above and wounded at three locations in the equatorial region as described previously (Fiori et al., 2008). Immediately after wounding, each wound was inoculated with 10 lL of a cell suspension (1.0 9 108 cells mL 1) of K.A and 10 lL of a 1.0 9 107 spores mL 1 P.I spore suspension. After being air-dried, fruits were placed in plastic holders and stored as described. At each sample time (18 and 36 h post-inoculation, hpi), three fruits were selected and samples from the wounds taken a surgical knife for SEM detection. Cell morphology analysis of K.A after application with phenylethanol

In a previous study, it was demonstrated that K.A produced an aromatic alcohol phenylethanol (data not shown). The effect of phenylethanol on yeast morphology has been well described in numerous studies (Chen et al., 2004; Chen & Fink, 2006; Gori et al., 2011). To test the effect of this aromatic alcohol on K.A morphology, cell suspensions were grown for 5 days on PDA mixed with phenylethanol and microscopic evaluation was performed in vitro. The mid-exponential yeast cells were re-streaked on a PDA plate, and the PDA medium was mixed with phenylethanol at a concentration (v/v) of 0.13%, 0.2% and 0.26%. The phenylethanol concentration was determined after a preliminary experiment by comparing the influence on K.A and P.I using different concentrations. The spore germination and mycelial growth of P.I 0.2% (v/v) were inhibited completely, but not for K.A in PDA medium. After the treatment, the plates were incubated at 28 °C for 5 days. The cell morphology of yeast was observed and photographed using an optical microscope. Citrus fruits were soaked in vivo in 1.0 9 108 cells mL 1 of a K.A cell suspension with 0.26% (v/v) phenylethanol for 2 min. After being air-dried, the fruits were placed in plastic holders and collected as described at different time points (2 and 4 dpi) for SEM detection. Scanning electron microscope

Tissue sections (0.5 9 0.5 cm in size) to be observed by SEM were cut with a sterile surgical blade from inoculated fruit and fixed in 2.5% glutaraldehyde for 24 h at 4 °C, and then washed and postfixed in 1% OsO4 for 2 h. The samples were washed again, and then the samples were acetone-dehydrated with two successive 10-min

ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved

L. Pu et al.

washes in 25%, 50%, 70%, 80%, 95% and 100% acetone (v/v), respectively. Before OsO4 fixation, specimens including fruit wounds were cryo-fractured in liquid nitrogen to expose the internal cellular structures. After critical point drying using liquid CO2, the samples were sputter-coated with gold–palladium, examined and photographed using JSM-6390LV (JEOL, Japan). The interval between fruit inoculation and sample processing is indicated in the figure legends. Identification and phylogenetic analysis of adhesin-related genes in the K.A genome

According to the protein sequences of adhesin-related genes (such as FLO and ALS) in S. cerevisiae, Saccharomyces pastorianus, Komagataella (Pichia) pastoris and Candida species from the GenBank of NCBI database, the whole genome of K.A (K. Chen and C.A. Long, unpublished data) was scanned for homologous genes in this strain by BLAST. Adhesion proteins were identified by hidden Markov models (HMMER; http://hmmer.janelia.org/) searches of sequences (Finn et al., 2011). Any sequence that matched the adhesin-related domains was considered a candidate adhesin protein during the first round. The results were then submitted to the Pfam database (http:// pfam.sanger.ac.uk/) to confirm that the candidate sequences were adhesin-related genes (Punta et al., 2012). Similarity searches were performed using the BLAST P program at the NCBI (http://www.ncbi.nlm.nih.gov/blast/) to confirm the predictions. The phylogenetic and molecular evolutionary analysis of flocculin and PA14 domain of adhesin-related proteins was carried out by the neighbor-joining method in the MEGA 5 software (Tamura et al., 2011). Bootstrap analysis was performed using 1000 replicates. RNA extraction and real-time quantitative RTPCR (qRT-PCR) assays

After culturing K.A for 48 h in liquid YPD medium on a gyratory shaker (200 r.p.m.) at 28 °C, the cells were collected by centrifugation and suspended in 50 mL of YPD medium at a concentration of 1.0 9 107 cells mL 1. Flasks were incubated for 6 h to logarithmic phase, 0.2% (v/v) phenylethanol was applied for 0.5 and 1.5 h, separately, and distilled water was applied in the same manner for 1.5 h as a control. The total RNA of K.A was isolated using a Trizol reagent kit with three biological replicates for each treatment, and the first-strand cDNA transcribed using an MMLV First Strand Kit (Invitrogen) according to the manufacturer’s instructions. Primers were designed with PRIMER EXPRESS software (Applied Biosystems, Foster City, FEMS Yeast Res 14 (2014) 536–546

539


Table 1. Primers used for real-time quantitative RT-PCR Primer sequences (5′–3′)

KaFlo1 KaFlo2 KaFlo3 KaFlo4 KaFlo5 KaFlo6 KaFlo7 KaFlo8 KaFlo9 Actin

Forward

Reverse

ATTGCAACGCCAATTCCTAT AGGCCGGTGTTGTTGCTAAT ACCAAAAACCAGAAGACACTCCTT GCTCATCAACACCCGCTGTT TGCCGGAACTCAAAATAAAAGAAT GATGCTTCAACAGAACTTACCAAAAC ACTCCAACTGTTGTTGCTCCAA AATGTTACCCAAATGTCAACCAAA TCACAGCCACTGAGTTGTACTTTAGA ATGGTGTTTCCCACGTTGTT

GGTATTGCTGCTGTGCTCAA TGCATGGGTCATCATTTCTGA TGGCCGGTTTCAGAAGATG AGCAATGGGATAAATGGAGCTAGA ACCATGTAAGCTTCTTGTTCAGTAGAGA TGGACAAGGCAAACCAATTG GCCTTAGCGGCACCGTTT CAAACAAAACATCGGCAGTGA ACCAAACTTCACCATTACAATTACCA AGCAGTGGTGGTGAAGGAGT

CA) and are listed in Table 1. qRT-PCR for gene expression analysis was performed using the StepOne Real-time PCR System (Applied Biosystems). Briefly, the primers for the target gene were diluted in SYBER Mix (Applied Biosystems), and 20 lL of the reaction mix was added to each well. Reactions were performed using an initial incubation at 50 °C for 2 min and at 95 °C for 1 min, and then 40 cycles of 95 °C for 15 s and 60 °C for 1 min. The levels of gene expression were analyzed with STEPONE SOFTWARE v2.0. Zero template controls were included for each primer pair. Each PCR reaction was conducted in triplicate, and the data are indicated as the means SD.

Results Cell morphology of K.A after application on the fruit surface

When inoculated into a wound fruit surface, K.A formed a dense biofilm composed of yeast-shaped cells (Fig. 1a) embedded within an ECM (Fig. 1a, arrow indicates the matrix) and built up a dense network of extracellular polymers. The citrus fruit never displayed symptoms of decay even after prolonged incubation at 28 °C and 95% relative humidity. Cell morphology of K.A during the pathogen and antagonist interaction on citrus tissue

Kloeckera apiculata rapid colonization was observed on citrus tissue in our previous study (Long et al., 2005); the antagonistic activity of yeast strain depends on the ratio of concentrations between pathogen and antagonist. An antagonistic yeast concentration of 108 CFU mL 1 gave a higher level of protection than did a lower concentration (106 CFU mL 1; Long et al., 2007). On the other hand, the efficacy was reduced when higher concentration spores of P.I were applied after yeast inoculation (Lahlali et al., 2004, 2005). FEMS Yeast Res 14 (2014) 536–546

To study the cell morphology of K.A during the pathogen and antagonist interaction, excess pathogenic spores (107 spores mL 1) were inoculated into citrus wounds. Kloeckera apiculata cells remained as yeast during the pathogen and antagonist interaction (Fig. 1b). In the early stage, K.A inhibited spore germination, and over half of necrotic spores were discovered in Fig. 1b at 18 hpi (arrow indicates spore deaths). If a germ tube formed, a considerable number of K.A cells adhered to the hyphae of the pathogen by secreting an abundant ECM (Fig. 1b, 36 hpi). At the point of attachment (Fig. 1b, 36 hpi, arrow), the mycelial surface appeared to be concave and there was partial degradation of the cell wall of P.I. In contrast, no pitting appearance in the hyphae cell wall was detected in the control fungus (Fig. 1b, 36 hpi). Cell morphology of K.A in the presence of phenylethanol

Recently, the aromatic alcohol phenylethanol was identified as an antifungal compound in K.A-postharvest pathogen interaction (data not shown). The effect of this aromatic alcohol on yeast morphology has been well described (Chen et al., 2004; Chen & Fink, 2006; Gori et al., 2011). To further evaluate the activity of phenylethanol on K.A morphology, samples from batch cultures with and without phenylethanol treatment (in vitro) were collected at stationary phase (5 days) and observed under the microscope. Figure 2a shows that phenylethanol had an effect on cell morphology, inducing the formation of hyphae and pseudohyphae. Cells undergo a dimorphic transition from the yeast form to an invasive form of growth, and chains of cells penetrated into the solid agar (data not shown). In addition, cell–cell adhesion occurred with the treatment with phenylethanol. In agreement with similar studies conducted in D. hansenii (Gori et al., 2011), phenylethanol only resulted in minor filamentous growth (Fig. 2a). ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved

540

L. Pu et al.

(a)

(b)

Fig. 1. Cell morphology of Kloeckera apiculata on the fruit surface. (a) Cell morphology of K. apiculata after application on the fruit. Fruit of sound citrus were stored in a ventilated warehouse after being soaked with 1.0 9 108 cells mL 1 K. apiculata cell suspension for 30 dpi. Arrow: ECM. (b) Cell morphology of K. apiculata during antagonist–pathogen interaction. Each citrus fruit wound was inoculated with 10 lL K. apiculata cell suspension (1.0 9 108 cells mL 1) and 10 lL Penicillium italicum spore suspension (1.0 9 107 spores mL 1). At each sample time (18 and 36 hpi), three fruits were selected and samples from the wounds were cut with a surgical knife. White arrow, the un-germinated spores; black arrow, attachment point of antagonist.

Unexpectedly, microscopic examination showed that the K.A cells that developed were composed only of yeast-shaped cells on the citrus surface (in vivo) in the presence of 0.26% (v/v) phenylethanol (Fig. 2b). Meanwhile, the citrus fruit were unaffected by the presence of K.A or K.A mixed with phenylethanol, consistent with previous results (Long et al., 2005, 2007). Identification of adhesin-related genes

Flocculin is required for a variety of important phenotypes in yeasts, including flocculation, adhesion to agar and plastic, invasive growth, pseudohyphae formation and biofilm development (Sosa & Farıas, 2012). The FLO gene family evolves and diverges very quickly, and each ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved

S. cerevisiae strain contains a different set of FLO alleles (Van Mulders et al., 2009). Based on the proteins of adhesin-related genes in S. cerevisiae, S. pastorianus, K. pastoris and Candida species, 23 genes were isolated from the whole genome of K.A (K. Chen and C.A. Long, unpublished data) by BLAST. These genes were further analyzed using the HMMER and Pfam database. The results indicated that nine genes (designated KaFlo1 to KaFlo9) have adhesin-related domains, including PA14_2 (GLEYA domain; pfam no. 10528), flocculin (pfam no. 00624), mannosyl_trans3 (pfam no. 11051), flocculin_t3 (pfam no. 13928) and flo11 (pfam no. 10182; Fig. 3a, Data S1). The length was highly polymorphic depending on each adhesin gene in K.A. As expected, this length polymorphism was due to the expansion or contraction of a FEMS Yeast Res 14 (2014) 536–546

541


(a)

(b)

Fig. 2. Effects of phenylethanol on Kloeckera apiculata morphology. (a) In vitro K. apiculata cell samples from batch cultures with and without phenylethanol treatment were collected after 5 dpi and observed under microscopy. (b) In vivo fruit soaked with 1.0 9 108 cells mL 1 K. apiculata cell suspension alone or mixed with 0.26% (v/v) phenylethanol. At each sample time point, three fruit were selected, and samples were cut from the wound with a surgical knife.

specific region of the KaFlos genes, and this difference in the lengths of repeated sequences in the KaFlos gene may be related to differences in biofilm-forming ability, just like FLO genes in S. cerevisiae (Zara et al., 2009). In addition, 32.8% of the amino acids of these genes are serine and threonine residues. These amino acids can exert extensive O-glycosylation during the posttranslational modification of the protein, and the O-linked oligosaccharide side-chains then enable the flocculins to attain a long, semi-rigid rod-like structure. Of these, the KaFlo1 gene was predicted to have 15 flocculin repeat domains. Longer adhesins generally confer greater adherence and smaller adhesins usually result in decreased adhesion (Verstrepen & Klis, 2006). Thus, we hypothesize that FEMS Yeast Res 14 (2014) 536–546

KaFlo1 plays a significant role in biofilm formation. In addition, no proteins have been found with three typical adhesin family domains, including an N-terminal, central and C-terminal domain. Phylogenetic relationship between different yeast adhesin members

Previous studies showed a highly variable adhesion phenotype, as they are able to adapt their adhesion properties quickly to new environments (Verstrepen & Klis, 2006), indicating that the adhesin genes quickly expanded in the genomes of different strains and species by frequent slippage and/or recombination during DNA replication ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved

L. Pu et al.

542

(b)

(a)

(c)

Fig. 3. Domain structure analysis of adhesin-related proteins. (a) Domain structure analysis using Pfam database (http://pfam.sanger.ac.uk). Green unlabeled boxes are flocculin. (b, c) Phylogenetic analysis of adhesin-related proteins of flocculin and PA14 domain. The phylogenetic tree of the flocculin and PA14 domain is constructed using the neighbor-joining method with MEGA 5.


FEMS Yeast Res 14 (2014) 536–546

543


(Verstrepen et al., 2003). To examine the phylogenetic relationship between KaFlos and other yeast adhesin family members, the flocculin and PA14 domain of adhesionrelated proteins was constructed from alignments of their protein sequences by NJ methods. As shown in Fig. 3, the adhesin proteins of the flocculin domain are clustered into two major groups. The flocculin domains of K.A were evenly separated into the two groups (Fig. 3b). Within KaFlo1, different flocculin domains are assigned to different flocculin groups, which is similar to Lg-Flo1 in S. pastorianus. Most of the experimentally characterized PA14-containing proteins are involved in carbohydrate binding and/or metabolism (Verstrepen & Klis, 2006). Compared with the flocculin domain, PA14 domain of KaFlo 2, KaFlo3 and KaFlo9 are more closely related to their putative PA14 orthologs from S. cerevisiae, which belongs to the same group (Fig. 3c), reflecting that PA14 is more conserved than the flocculin domain. Differential expression of KaFlos

Typically, the adhesin-encoding genes are not constitutively expressed in yeasts. Instead, adhesion is under the tight transcriptional control of several interacting regulatory pathways. The adhesin genes are activated by diverse environmental triggers, such as carbon and/or nitrogen starvation or the stress environment (Sampermans et al., 2005; Verstrepen & Klis, 2006). The switch from nonadherence to adherence most likely allows yeasts to adapt to various environmental stresses. To determine the expression level of KaFlos upon phenylethanol stress, qRT-PCR was performed with total RNA isolated from the K.A cells. Given the high degree of sequence identity between homologous pairs, it was challenging to design qRT-PCR primers that were specific for each gene. The expression level of the K.A actin gene was selected as an internal standard in the analysis. By comparing the control with the phenylethanol treatment group, qRT-PCR analysis revealed KaFlos genes were differentially expressed (Fig. 4).

Among these, the genes KaFlo3, KaFlo4, KaFlo6 and KaFlo8 displayed significant up-regulation in the cells upon activation with phenylethanol as compared with the control. KaFlo1 and KaFlo7 were strongly expressed in cells at the early stage of phenylethanol treatment (0.5 h), as compared with the control, whereas KaFlo2 and KaFlo5 displayed only weak differential expression in the phenylethanol-treated cells compared with the control (Fig. 4). KaFlo9 transcripts were significantly inhibited in the phenylethanol-treated cells as compared with the control cells (Fig. 4). The results indicated that the various adhesin-related genes are differentially expressed under phenylethanol stress conditions.

Discussion The adhesion properties of microorganisms are dependent on the characteristics of the cellular surface, usually the outer layer of the cell wall, whereas their modes of action differ. Adhesion can be divided into two main groups: lectin-like adhesion (sugar-sensitive) and sugar-insensitive adhesion (Verstrepen & Klis, 2006). In K.A, flocculin (pfam no. 00624) is the most common domain, followed by PA14_2 (GLEYA domain; pfam no. 10528), flocculin_t3 (pfam no. 13928), mannosyl_trans3 (pfam no. 11051) and flo11 (pfam no. 10182). Adhesion is an unusually complex and variable phenotype, including differential expression of adhesin genes, which enables yeasts to adapt their adhesive properties quickly to a particular environment (Fiori et al., 2012). Frequent recombination and/or slippage of adhesin-related genes triggers the formation of new adhesins with novel phenotypes, including the generation of chimeric forms and novel adhesion properties, and creating cell-surface variability. In addition, the frequent recombination events provide yeasts with an ever-changing outer coat. In this study, we found that K.A build up a dense network of extracellular polymers on fruit surfaces, and one yeast cell attached to another and enclosed within a selfproduced ECM. Our previous studies demonstrated that

Fig. 4. Real-time quantitative RT-PCR expression analysis of adhesin-related genes. Experiments were performed with three independent cultures for each strain and condition. The relative transcript levels are calculated relative to ACT1 as the standard. The data are the means SE of three separate measurements.

FEMS Yeast Res 14 (2014) 536–546


L. Pu et al.

544

K.A produces an aromatic alcohol, phenylethanol. Consistent with C. albicans, D. hansenii and S. cerevisiae (Chen & Fink, 2006), this aromatic alcohol production was highly influenced by environmental conditions. In minimal medium with 0.17% yeast nitrogen base without amino acids and ammonium sulfate (Difco), 2% dextrose and 2% L-phenylalanine, the maximum concentration phenylethanol can reach is 0.54 g L 1 (not shown). Phenylethanol was identified as a QS molecule in strains of C. albicans and S. cerevisiae (Ghosh et al., 2008). Biofilm formation has been shown to be controlled by alcohol-based QS in C. albicans (Gori et al., 2011). In the present study, K.A possessed the ability to form biofilms on the fruit surface of citrus and thus had the potential to be influenced by the aromatic alcohol phenylethanol. Phenylethanol stimulated adhesion development and biofilm formation. These results indicate that the potential biofilm formation of K.A is controlled by the presence of phenylethanol. Saccharomyces cerevisiae and Candida species biofilm studies indicate that biofilms require cell surface adhesins, such as FLO8, a gene that encodes a regulatory protein required for FLO11 expression. With respect to the expression of these genes in K.A, nine orthologs to these genes appear to be present. The adhesin genes of K.A vary in comparison with other species of yeast, which is in accordance with previous reports (Verstrepen & Klis, 2006). Our results are consistent with the hypothesis that the protein size is quite frequently polymorphic and is often associated with insertion/deletion (indel) events in the DNA that result in repeated regions rich in serine and threonine (flocculin domain) of S. cerevisiae (Bowen & Wheals, 2006). In S. cerevisiae, serine and threonine are prone to extensive O-glucosylation during the posttranslational modification of the protein and the O-linked oligosaccharide side-chains then enable the flocculins to attain a long, semi-rigid rod-like structure that could be stabilized by Ca2+ ions. A longer adhesion showing a stronger flocculation phenotype, and carbohydrate–carbohydrate interactions are important for cell adhesion phenomena (Linder & Gustafsson, 2008; Goossens & Willaert, 2010). The most experimentally characterized PA14-containing proteins are involved in carbohydrate binding and/or metabolism (Linder & Gustafsson, 2008). As mentioned before, in the S. cerevisiae flocculins, carbohydrate binding is associated with the N-terminal third of the protein. The flocculin N-terminal domain might, therefore, be considered one of the many PA14 domain variants (Goossens & Willaert, 2010). A multiple sequence alignment of various PA14 domains indicated that the VSWGT motif of Flo1 and Flo5 and the GG(S)AGG(A) motif of KaFlo2, KaFlo3 and KaFlo9 are found in precisely the same position, within a hypervariable region of PA14. ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved

As shown in Fig. 4, a strong up-regulation of KaFlo1, KaFlo3, KaFlo4, KaFlo6, KaFlo7 and KaFlo8 genes was observed compared with the control, especially for KaFlo8, containing 15 flocculin repeat domains that were up-regulated after induction with phenylethanol for 0.5 h; KaFlo8, which contains the flo11 domain, was directly up-regulated after phenylethanol treatment for 0.5 and 1.5 h. These results showed that phenylethanol promotes filamentous adhesion, and biofilm formation is likely to be regulated by induction of adhesin gene expression.

Conclusions Kloeckera apiculata was observed to adhere to and to form biofilm on the surface of citrus fruit. Phenylethanol as a potential QS molecule appeared to influence filamentous growth, adhesion and biofilm formation and biological control efficiency. Phenylethanol-induced adhesin gene up-regulated expression played an important role in this process. By understanding the formation of biofilm and the influence of QS molecules, it will be possible to better choose the optimum conditions for controlling postharvest diseases using antagonistic yeast.

Acknowledgements The current work was financially supported by the 973 Program of China (2013CB127100), the National Natural Science Foundation of China (31171773) and the Modern Agriculture (Citrus) Technology System (CARS-27). The authors declare that they have no conflicting interests.

Statement L.P. and F.J. are co-first author.

References Bais HP, Fall R & Vivanco JM (2004) Biological control of Bacillus subtilis against infection of Arabidopsis roots by Pseudomonas syringae is facilitated by biofilm formation and surfactin production. Plant Physiol 134: 307–319. Bojsen RK, Andersen KS & Regenberg B (2012) Saccharomyces cerevisiae – a model to uncover molecular mechanisms for yeast biofilm biology. FEMS Immunol Med Microbiol 65: 169–182. Bowen S & Wheals AE (2006) Ser/Thr-rich domains are associated with genetic variation and morphogenesis in Saccharomyces cerevisiae. Yeast 23: 633–640. Cadez N, Raspor P, de Cock AWAM, Boekhout T & Smith MT (2002) Molecular identification and genetic diversity within species of the genera Hanseniaspora and Kloeckera. FEMS Yeast Res 1: 279–289.

FEMS Yeast Res 14 (2014) 536–546


Chen H & Fink GR (2006) Feedback control of morphogenesis in fungi by aromatic alcohols. Genes Dev 20: 1150–1161. Chen H, Fujita M, Feng QH, Clardy J & Fink GR (2004) Tyrosol is a quorum-sensing molecule in Candida albicans. P Natl Acad Sci USA 101: 5048–5052. Donlan RM (2002) Biofilms: microbial life on surfaces. Emerg Infect Dis 8: 881–890. Farias ME & Manca de Nadra MC (2003) Flocculation and cell surface characterization of Kloeckera apiculata from wine. J Appl Microbiol 95: 457–462. Finkel JS & Mitchell AP (2011) Genetic control of Candida albicans biofilm development. Nat Rev Microbiol 9: 109–118. Finn RD, Clements J & Eddy SR (2011) HMMER web server: interactive sequence similarity searching. Nucleic Acids Res 39: W29–W37. Fiori S, Fadda A, Giobbe S, Berardi E & Migheli Q (2008) Pichia angusta is an effective biological control yeast against postharvest decay of apple fruit caused by Botrytis cinerea and Monilia fructicola. FEMS Yeast Res 8: 961–963. Fiori S, Scherm B, Liu J, Farrell R, Mannazzu I, Budroni M, Maserti BE, Wisniewski ME & Migheli Q (2012) Identification of differentially expressed genes associated with changes in the morphology of Pichia fermentans on apple and peach fruit. FEMS Yeast Res 12: 785–795. Flemming HC & Wingender J (2010) The biofilm matrix. Nat Rev Microbiol 8: 623–633. Ghosh S, Kebaara BW, Atkin AL & Nickerson KW (2008) Regulation of aromatic alcohol production in Candida albicans. Appl Environ Microbiol 74: 7211–7218. Giobbe S, Marceddu S, Scherm B, Zara G, Mazzarello V, Budroni M & Migheli Q (2007) The strange case of a biofilm-forming strain of Pichia fermentans, which controls Monilinia brown rot on apple but is pathogenic on peach fruit. FEMS Yeast Res 7: 1389–1398. Goossens K & Willaert R (2010) Flocculation protein structure and cell–cell adhesion mechanism in Saccharomyces cerevisiae. Biotechnol Lett 32: 1571–1585. Gori K, Knudsen PB, Nielsen KF, Arneborg N & Jespersen L (2011) Alcohol-based quorum sensing plays a role in adhesion and sliding motility of the yeast Debaryomyces hansenii. FEMS Yeast Res 11: 643–652. Halme A, Bumgarner S, Styles C & Fink GR (2004) Genetic and epigenetic regulation of the FLO gene family generates cell-surface variation in yeast. Cell 116: 405–415. Hornby JM, Jensen EC, Lisec AD, Tasto JJ, Jahnke B, Shoemaker R, Dussault P & Nickerson KW (2001) Quorum sensing in the dimorphic fungus Candida albicans is mediated by farnesol. Appl Environ Microbiol 67: 2982–2992. Ianiri G, Idnurm A, Wright SAI, Duran-Patr on R, Mannina L, Ferracane R, Ritieni A & Castoria R (2013) Searching for genes responsible for patulin degradation in a biological control yeast provides insights into the basis for resistance to this mycotoxin. Appl Environ Microbiol 79: 3101–3115. Janisiewicz WJ & Korsten L (2002) Biological control of postharvest diseases of fruits. Annu Rev Phytopathol 40: 411–441.

FEMS Yeast Res 14 (2014) 536–546

545

Krasowska A, Murzyn A, Dyjankiewicz A, Lukaszewicz M & Dziadkowiec D (2009) The antagonistic effect of Saccharomyces boulardii on Candida albicans filamentation, adhesion and biofilm formation. FEMS Yeast Res 9: 1312– 1321. Lahlali R, Serrhini MN & Jijakli MH (2004) Efficacy assessment of Candida oleophila (strain O) and Pichia anomala (strain K) against major postharvest diseases of citrus fruits in Morocco. Commun Agric Appl Biol Sci 64: 601–609. Lahlali R, Serrhini MN & Jijakli MH (2005) Development of a biological control methods against postharvest diseases of citrus fruits. Commun Agric Appl Biol Sci 70/3: 47–58. Li F, Svarovsky MJ, Karlsson AJ, Wagner JP, Marchillo K, Oshel P, Andes D & Palecek SP (2007) Eap1p, an adhesin that mediates Candida albicans biofilm formation in vitro and in vivo. Eukaryot Cell 6: 931–939. Linder T & Gustafsson CM (2008) Molecular phylogenetics of ascomycotal adhesins – a novel family of putative cell-surface adhesive proteins in fission yeasts. Fungal Genet Biol 45: 485–497. Liu P, Luo L & Long C (2013) Characterization of competition for nutrients in the biocontrol of Penicillium italicum by Kloeckera apiculata. Biol Control 67: 157–162. Long CA, Zhang W & Deng BX (2005) Biological control of Penicillium italicum of citrus and Botrytis cinerea of grape by strain 34-9 of Kloeckera apiculata. Eur Food Res Technol 211: 197–201. Long CA, Deng BX & Deng XX (2007) Commercial testing of Kloeckera apiculata, isolate 34-9, for biological control of postharvest diseases of citrus fruit. Ann Microbiol 57: 203–207. Long CA & Gao Y (2009) Kloeckera apiculata strain (34–9) to control Botrytis cinerea during the pre- and postharvest handling of strawberries. Ann Microbiol 59: 77–81. McLaughlin RJ, Wilson CL, Droby S, Ben-Arie R & Chalutz E (1992) Biological control of postharvest diseases of grape, peach, and apple with the yeasts Kloeckera apiculata and Candida guilliermondii. Plant Dis 76: 470–473. Ocon E, Gutierrez AR, Garijo P, Tenorio C, Lopez I, Lopez R & Santamaria P (2010) Quantitative and qualitative analysis of non-Saccharomyces yeasts in spontaneous alcoholic fermentations. Eur Food Res Technol 230: 885–891. Punta M, Coggill PC, Eberhardt RY et al. (2012) The Pfam protein families database. Nucleic Acids Res 40(Database Issue): D290–D301. Ramage G, Saville SP, Wickes BL & Lopez-Ribot JL (2002) Inhibition of Candida albicans biofilm formation by farnesol, a quorum-sensing molecule. Appl Environ Microbiol 67: 5459–5463. Reynolds TB & Fink GR (2001) Bakers’ yeast, a model for fungal biofilm formation. Science 291: 878–881. Sampermans S, Mortier J & Soares EV (2005) Flocculation onset in Saccharomyces cerevisiae: the role of nutrients. J Appl Microbiol 98: 525–531.


L. Pu et al.

546

Smukalla S, Caldara M, Pochet N et al. (2008) FLO1 is a variable green beard gene that drives biofilm-like cooperation in budding yeast. Cell 135: 726–737. Sosa OA & Farıas ME (2012) Influence of culture and nutritional conditions on self-flocculation of a Kloeckera apiculata wine strain. Food Technol Biotechnol 50: 66–72. Sosa OA, Manca de Nadra MC & Farias ME (2008a) Modification by glucose of the flocculent phenotype of a Kloeckera apiculata wine strain. J Ind Microbiol Biotechnol 35: 851–857. Sosa OA, Manca de Nadra MC & Farias ME (2008b) Behaviour of Kloeckera apiculata flocculent strain in coculture with Saccharomyces cerevisiae. Food Technol Biotechnol 46: 413–418. Tamura K, Peterson D, Peterson N, Stecher G, Nei M & Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28: 2731– 2739. Vallejo JA, Sanchez-Perez A, Martınez JP & Villa TG (2013) Cell aggregations in yeasts and their applications. Appl Microbiol Biotechnol 97: 2305–2318. Van Mulders SE, Christianen E, Saerens SM, Daenen L, Verbelen PJ, Willaert R, Verstrepen KJ & Delvaux FR (2009) Phenotypic diversity of Flo protein family-mediated adhesion in Saccharomyces cerevisiae. FEMS Yeast Res 9: 178–190.


Vandenbosch D, De Canck E, Dhondt I, Rigole P, Nelis HJ & Coenye T (2013) Genomewide screening for genes involved in biofilm formation and miconazole susceptibility in Saccharomyces cerevisiae. FEMS Yeast Res 13: 720–730. Vero S, Garmendia G, Gonzalez MB, Bentancur O & Wisniewski M (2013) Evaluation of yeasts obtained from antarctic soil samples as biocontrol agents for the management of postharvest diseases of apple (Malus 9 domestica). FEMS Yeast Res 13: 189–199. Verstrepen KJ & Klis FM (2006) Flocculation, adhesion and biofilm formation in yeasts. Mol Microbiol 60: 5–15. Verstrepen KJ, Derdelinckx G, Verachtert H & Delvaux FR (2003) Yeast flocculation: what brewers should know. Appl Microbiol Biotechnol 61: 197–205. Zara G, Zara S, Pinna C, Marceddu S & Budroni M (2009) FLO11 gene length and transcriptional level affect biofilm-forming ability of wild flor strains of Saccharomyces cerevisiae. Microbiology 155: 3838–3846.

Supporting Information Additional Supporting Information may be found in the online version of this article: Data S1. Sequence of adhesin-related genes in Kloeckera apiculata.

FEMS Yeast Res 14 (2014) 536–546