Dec 3, 1993 - N,N,N-trimethylammoniummethylsulfate (Boehringer Mannheim) ac- ..... Gross, E., Goldberg, D., and Levitzki, A. (1992) Nature 360, 762-765.
Communication
THE
JOU~A OFLBIOMGDAL CHEWSTRY
Vol. 269, No. 7, Issue of February 18, pp. 4717-4720, 1994 0 1994 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.
Satoh et al., 1990; Burgering et al., 1991; Medema et al., 1991; Thomas et al., 1992; Wood et al., 1992). Stimulation of the tyrosine kinase activities of the receptors results in the rapid release of Ras-bound guanosine diphosphate, which is catanucleotide exchange lyzed by a class of proteins, the guanosine factors. Formation of biologically active Rasoccurs by the subsequent binding ofGTP. The first guanosine nucleotide ex(Received forpublication, November 4, 1993, and in revised form, change factoridentified wasthe Saccharomyces cerevisiae December 3, 1993) CDC25 protein (Broek et al., 1987). In higher eukaryotes, two different typesof proteins with homology to CDC25 have been Andrew D. Cherniack#l,Jes K. KlarlundO, and Michael P. Czech found. One includes the p140 Ras GRF-like proteins, which in human, rat, and mouse are found primarily if not exclusively in From the Program in Molecular Medicine and the et al., 1992; Shou et al.,1992; Wei et al., brain tissue (Martegani Department of Biochemistry and Molecular Biology, University of Massachusetts Medical Center, 1992). These exchange factors have not yetbeen implicated in Worcester, Massachusetts 01605 any tyrosine kinase receptor signaling pathway. The second Son of sevenless proteins(Sos).Sos was first Son of sevenless-1 and-2 (Sos-1 and-2) are guanosine group includes the identified in Drosophila melanogaster, in which geneticstudies nucleotide exchange factors implicated in the activation of Ras by both the insulin and epidermal growth factorshowed that Sos is downstream of both the Sevenless and EGF signal transduction pathways.Ras appears to function receptor tyrosine kinases (Rogge et al., 1991). One human and by initiating the activation of cellular protein kinases two murine homologues of Sos have been cloned (Bowtell et al., 1992; Chardin et al., 1993), and unlike theGRF exchange facincluding mitogen-activated protein ( M A P ) kinases. Sos tor, Sos is ubiquitously expressed in mouse and human tissues. proteins contain numerous sequences in their carboxylimplicated Sos as partof the A great dealof recent data have terminal regions which correspond to consensus sites for MAP kinase phosphorylation. To examine whether EGF receptor signalingcomplex (Buday andDownward, 1993; these sites are substrates for MAP kinases, the cDNA Egan et al., 1993; Rozakis-Adcock et al., 1993; Li et al., 1993; encoding Drosophila Sos (dSos)wastaggedwith se- Gale et al., 1993). Stimulation of the EGF receptor tyrosine quences encoding the major antigenic epitope of inthe kinase results in the formation of a complex between EGF fluenza virus hemagglutinin ( H A ) to create a dSosHA receptor, Sos, and the adapter proteinGrb2. The Grb2 protein fusion construct. dSosHA was transiently expressed in contains an SH2 domain,which is believed to bind to the EGF COS-1 cells and immunoprecipitated with anti-HA anti- receptor autophosphorylation site Y1068, flanked by two SH3 bodies. When immune complexes were incubated with domains, which bind to proline-rich sequences at the COOH purified MAP kinase and [ys2P]ATP, a phosphorylated terminus of Sos (Rozakis-Adcock et al., 1993; Li et al., 1993). band of 180 kDa was observed when analyzed by SDSThe formationof this complex does not measurably increase the polyacrylamide gel electrophoresis. This band was not guanosine nucleotide exchange activity that Sos has for Ras i n present in immunoprecipitations fromcells transfected vitro (Buday andDownward, 1993).However, EGF stimulation with vector alone. No phosphorylation of the 180 kDa results in the translocation of Sos from cytoplasmic to particubandwas seen whenimmunoprecipitateswereincubated with [yS2P]ATP in the absence of MAP kinase. late fractions. This suggests that EGF stimulation results ain change in the intracellular location of Sos, bringing it in contact T w o dimensionalanalysisoftrypticpeptidesfrom dSosHA phosphorylated by MAP kinase in vitro revealed with membrane-associated Ras (Buday andDownward, 1993). of the insulinreceptor two major phosphorylated species that were also foundIn contrast to EGF signaling, activation in dSosHA isolated from COS-1 cells labeled with 32Pi. tyrosine kinase results in association of Sos-GRB2 complexes These results are consistent with the hypothesis that a with tyrosine-phosphorylated IRS-1(insulin receptor subfeedbackloop exits whereingrowthfactor-activated strate-1) and Shc (Baltensperger et al., 1993; Skolnik et al., MAP kinases phosphorylate and regulate Sos proteins. 1993). Thus in the insulin signaling pathway, Sos guanosine nucleotideexchange activity may be regulated through the translocation of IRS-1 and Shc proteins. We have recently shown thatCOS-1 cells cotransfected with The Ras proteinis believed to play a key role in signal transDrosophila Sos (dSos)cDNAand human H-Ras cDNAcontain 10 duction pathways initiated by a number of tyrosine kinase of GTP-bound R a s than cells transfected with receptors such as the receptors for insulin, epidermal growth times the amount factor (EGF),l and nerve growth factor (Gibbs et al., 1990; H-Ras alone. Furthermore, dSos binds to IRS-1 only when an active insulin receptor tyrosine kinase is present (Baltensperger * This research was supported by Grant DK30648 from the National et al.,1993). The dSos cDNAwas also foundto transform Rat-1 Institutes of Health. The costs of publication of this article were de- cells (Egan et al., 1993). Taken together these results indicate frayed inpart by the payment of page charges. This article must there- that dSos protein is functionalin mammalian cells. fore be hereby marked “advertisement” in accordance with 18 U.S.C. Phosphoamino acid analysis showed that thedSos protein is Section 1734 solely to indicate this fact. phosphorylated on serine and threonine but not tyrosine resi$ Recipient of a postdoctoral fellowship from the Juvenile Diabetes Foundation International. dues in COS-1 cells (Baltensperger et al., 1993). This indicates 5 The two first authors contributed equally to this work. that Sos is not a substrate of the insulin receptor itself, but it The abbreviations used are: EGF, epidermal growth factor; GRF, guaninenucleotide-releasing factor; IRS-1, insulin receptor sub- may be a substrate of serine-threonine kinases downstreamof strate-1; M A P , mitogen-activated protein; PAGE,polyacrylamide gel Ras. One group of serine-threonine kinases that are activated electrophoresis; GDS, guanine nucleotide dissociation stimulation. by tyrosine kinase signaling pathways through Ras are M A P
Phosphorylation of the Ras Nucleotide Exchange Factor Son of Sevenless by Mitogenactivated Protein Kinase*
4717
4718
"-2
Kinase Phosphorylation of Ras Activator
kinases(de Vries-Smits et al., 1992; Medema et al., 1991; Thomas et al., 1992; Wood et al., 1992). The consensus sequence for MAP kinase phosphorylation(Clark-Lewis et al., 1991; Gonzalez et al., 1991) exists seven to nine times in the COOHterminal domains of all Sos proteins. This study addresses whether dSos is a substrate of MAP kinase. The results reported here demonstrate that dSos is in fact phosphorylated by MAP kinase in vitro and suggest this reaction also occurs in intact cells.
rated by electrophoresis a t pH 1.9 in 88% formic acidacetic acidwater (25:78:897) at 750 V for 2 h. The plates were dried and subjected to chromatography in 2-butanol/pyridin/acetic acidwater (15:10:3:12) in the second dimension. To determine the phosphoamino acid content of tryptic peptides, relevant areas of cellulose were scraped from thin-layer plates and placed in microcentrifuge tubes. The peptides were eluted by addition of 1ml of 10 m~ NH4COOH and agitatingon an end-over-end mixerfor 1 h. Thecellulose was spun down by centrifugation for5 min in a microcentrifuge; the supernatantswere lyophilized, and phosphoamino acids were analyzed a s described above. I n Vitro Labeling of dSosHA-Material from eight6-cm plates transEXPERIMENTAL. PROCEDURES fected with PCMV5-dSos and from four 6-cm plates transfected with Construction ofpCMV5-dSosHA-A cDNA clone of the D. melanogas- PCMV5 was immunoprecipitated a s described above. The pellets were ter Sos gene (dSos) (Bonfini et al., 1992) in Bluescript was a gift of Utpal suspended in1ml of Hepes buffer (20mM Hepes, pH 7.4,lOOmM NaCl, and 1mM diothiothreitol) with 1 m~ MgC1, and 0.1 m~ ZnCl,, divided Banejee. Sequences encodingthe 9-amino acid peptide sequenceof the in six tubes, centrifuged, and excess fluid carefully aspirated from the major antigenic epitope of influenza virus hemagglutinin (YPYDVPpellets. To dephosphorylate dSosHA, the pellets were incubated with 25 DYA) were added to the 3' end of the dSos coding sequence by the for 30 min a t room polymerase chain reaction (Saiki etal. 1988). This was conducted with units of calf intestine alkaline phosphatase (Sigma) 1 ml of dSosdigestedwithHindIIIandthe following two primers: 5'-TC- temperature. The samples were then washed three times with Hepesbuffercontaining 10 m~ nitrophenylphosphateand10 nm TAGAGGATCCTAAGCGTAATCTGGAACATATGGATATTCT GTACTTG and 5'-GACGCAGTCGCGCTCGTC.- A 195-base pair frag- MgCl,. The samples were then incubated with purified human p41 ment was generated and digested with BglI and BamHI. The resultingisoform of MAP kinase (kindly provided by Roger J. Davis) and250 pCi 130-base pair BglI-BamHI fragment was ligated to a 5.5-kilobase pair of [y-32PlATP(3000 Ci/mmol) for a n additional 30 min at room temperature. To stop the reactions, the samples were washed once with 1ml HindIII-BglI fragment of Sos, which contains the 5' end of the dSos of Hepes buffer and SDS-PAGE sample buffer was added. gene, and to pCMV5 (Andersson et al. 1989) cut with HindIII and To test the efficacy of dephosphorylation, two control and two transBamHI. The resulting constructis denoted pCMV5-dSosHA. To verify the presence of the influenza virus tag in the construct, the 3' of the end fected plates were labeled for 4 h with 2 mCi of 32Pi, immunoprecipicoding sequence of pCMV5-dSosHA was determined by the dideoxy tated, and treated with phosphatase as describedabove. method (Sanger etal. 1977) using the Sequenase version 2.0 kit (U.S. Biochemical Corp.) with both primers describedabove. RESULTS 'Dansfection, Cell Labeling, and Immunoprecipitation-Plates (6 cm) The consensussequence for phosphorylation by MAP kinase of COS-1 cells were transfected using N-[1-(2, 3 dioleoyloxy)propyl]N,N,N-trimethylammoniummethylsulfate(Boehringer Mannheim) ac- has been determined to be Pro-X,-Ser/Thr-Pro where X is a cording to the manufacturer's instructions using 5 pg of plasmid DNA neutral or basic amino acid and n = 1 or 2 (Clark-Lewis et al., per plate.Two days after transfection, the cells were washed twice with 1991; Gonzalez et al., 1991). There are seven potential MAP 3 ml of serum-free Dulbecco's modified Eagle's medium and once with kinase phosphorylation sites in the primary sequence of the phosphate-buffered saline (1.8 m~ KH,PO,, pH 7.2, 171 m~ NaCl, 1.0 dSos protein. To test whetherdSos protein is phosphorylated by m~ Na,HPO,, and 3.4 m~ KCl). The cells were labeled for 4 h with 10 MAP kinase, dSos was partially purified by immunoprecipitamCi of 32Piin 1.5 ml serum-free Krebs-Ringer bicarbonate Hepes buffer tion and used as a substrate for purified MAP kinase in vitro. (10 m~ Hepes, pH 7.5,120m~ NaCl, 4.7m~ KCl, 1.2 m~ MgCl,, 1.2 m~ In orderto immunoprecipitate dSos protein, constructPCMV5CaC12, and 24 m~ NaHC03). The plates were washed once with 5 ml of dSosHA was engineered by fusing dSos cDNA to sequences cold phosphate-buffered saline, and cells were lysed in 1ml cold lysis buffer (20 m~ Hepes, pH 7.9, 50 nm (NH4),S04, 50 mM NaF, 1 mM encoding the major influenza virus hemagglutinin antigenic Na3V04, 1 m~ EDTA, 10% glycerol, 1% Triton X-100, 0.1% Tween 20, 1 epitope. This wassubcloned into mammalianexpression vector m~ dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 5 pg/ml each PCMVS (Anderson et al., 1989) to create construct PCMV5leupeptin, aprotinin, and pepstatin, and 1 m~ benzamidine). The lysates were spun in a microcentrifugea t 15,000 x g for 10 min a t 4 "C. dSosHA. COS-1 cells were transfected with PCMVS-dSosHA, an anti-HA The supernatants were precleared by addition of 10 p1of protein A- and dSosHA protein was immunoprecipitated with Sepharose (Pharmacia LKB Biotechnology Inc.) and incubated on a n monoclonal antibody. The immunoprecipitates were incubated end-over-end mixer a t 4 "C for 1 h. The samples were then centrifuged with purified MAP kinase and [Y-~~PIATP, and the reaction at 15,000 x g for 2 minat 4 "C, and the supernatants were incubatedon mixture was analyzed by SDS-PAGE. Fig. lA shows that a a n end-over-end mixer with20 pl of 12CA5 antibody (Wilson et al. 1984) prominent 180-kDa band is labeled in this reaction. This band and 30 pl of protein A-Sepharose (Pharmacia)for 16 h. The Sepharose was pelleted by centrifugation at 15,000 x g for 2 min at 4 "C. Pellets is not present in immunoprecipitates from cells transfected with PCMVS alone, nor is it present in dSosHA immunoprewere washed five times with cold lysis buffer, and the protein was cipitates incubated only with [y3'P1ATP. These data strongly dissolved in SDS-PAGE sample buffer. Phosphoamino Acid Analysis and Pyptic Mapping-After separa- suggest that the 180-kDa band phosphorylated by MAP kinase tion by SDS-PAGE, the protein was transferred to Immobilon-P mem- is dSosHA. branes (Millipore). The locationof Sos was visualized by autoradiograSince some sites in proteinsisolated from cells may already phy. For phosphoamino acid analysis, protein was hydrolyzed directly on the membrane (Kamps and Sefton, 1989). Relevant pieces were cut bephosphorylated, the precipitated dSosHA was treated in some experiments with alkaline phosphatase prior to phosfrom the membranes and heated in 100 pl of 6 N HCl to 110 "C for 1h. The supernatants were lyophilized and dissolved in 5-10 pl of water phorylation with MAP kinase. As seen in the lasttwo lanes of with non-radioactive phosphoamino acid markers (1 mg/ml each), and Fig. l A , treatment of immunoprecipitates with phosphatase they were applied tocellulose thin-layer plates (Machery-Nagel).Elec- prior to the kinase reaction resulted in an increased phosphotrophoresis was for 1.5 h a t 1000 V (Hunter and Sefton, 1980). The rylation of dSosHA by MAP kinase. The efficacy of the phospositions of the markers were determinedby ninhydrin staining. phatase treatment was verified by examining its effecton For tryptic mapping, excess protein binding sites were blocked by incubating the membranes in0.05% Tween 20 in waterfor 15-30 min, dSosHA immunoprecipitated from cells that had been labeled followed by washing three times in water. Relevant pieces were cut from with 32Pi(Fig. 1B).Phosphatase treatmentcompletely removed the membranes and incubated overnight with 1mg of trypsin in 100pl the radioactivity that hadbeen incorporated into dSosHA from of 50 m~ NH4COOH. Theelutedpeptideswere lyophilized; excess intact 32Pi-labeledcells. NH,COOH was removedby redissolving the pellet in water and lyophiPhosphoamino acid analysis was conducted on the 180-kDa lizing repeatedly. The peptides were dissolved i n 5 pl of water and band phosphorylatedby MAP kinase. As seen in Fig. lC, MAP applied to 20 x 20-cm cellulose thin-layer plates. Amounts of radioackinase phosphorylated dSosHA on both serines and threonines. tivity applied to the plates were determined by Cerenkovcounting However, treatment of dSosHA with phosphatase prior to inbefore and after loading. For the first dimension, peptides were sepa-
"-2
C
B
A dSosHA
Kinase Phosphorylation Activator of Ras
-
i0
dSosHA
-
e
2
- -++++
- -+ -+-
'9
eo
.-
-,-
+ + - - ++ -+-+-+
+ +
Rase
?.
A
0
dSOsHA Rase MAPK
4719
+
+
P-ser P-thr P-tyr
-
FIG.2. Tryptic phosphopeptide map of dSosHk A and B,COS-1 cells were transfected withPCMV5-dSosHA and theexpressed protein was immunoprecipitated. In B,the precipitated dSosHA was pretreated with alkaline phosphatase, and in both A and B,immunoprecipitates the vector alone a s indicated. The expressed protein was immunoprewere then phosphorylated with MAP kinase. Immunoprecipitates were cipitated, and the indicated samples were treated with calf intestine separated by SDS-PAGE, and dSosHA was treated with trypsin overalkaline phosphatase. Aftera 30-min incubation, the phosphatase was night. The released peptides were separated by electrophoresis (horiwashed from the beads and dSosHAwas phosphorylated by MAP kinase zontal)andchromatography(vertical),andtheplatesweresubsein thepresence of nitrophenyl phosphate,a phosphatase inhibitor.After quentlysubjectedtoautoradiography.Thesites of application are a 30-minincubation,thebeadswerewashed once andthe bound indicated by the crosses. C , transfected COS-I cells were labeled with dSosHA was analyzed by SDS-PAGE and subsequent autoradiography. "Pi for 4 h, and the labeled dSosHA wasimmunoprecipitatedand B,PCMV5-dSosHAtransfected in COS-1 cells was labeled in intact cells analyzed by tryptic mapping.D,982 cpm of the material shown Binand with nzPi and immunoprecipitated. In the indicated samples, the pre- 1041 cpm of the material shown in C were mixed and separated as cipitates were treated with alkaline phosphatase.C , dSosHA was par- before. The two species (indicatedby 1 and 2 )exhibit identical migratially hydrolyzed with HCI and analyzed by thin-layer electrophoresis tion whether they are derivedfrom dSos labeled in intactcells or from at pH 3.5 as described under "Experimental Procedures." The positionsdSos phosphorylated by MAP kinase in immunoprecipitates. of the non-radioactive phosphoamino acids are indicated. FIG.1. Phosphorylation by purified MAP kinase of isolated dSosHA.A,COS-I cells were transfected withPCMVB-dSosHAor with
A cubation with MAP kinase slightlyincreased the overall amount of serine phosphorylation incorporated into dSosHA. To further characterize dSosHA phosphorylation sites, the 180-kDa protein phosphorylated by MAP kinase in immunoprecipitates was isolated and digested with trypsin. Tryptic peptides were first separated by electrophoresis and then by chromatography in the second dimension. Two-dimensional maps of tryptic peptides isolated from dSosHA with and without treatmentof phosphatase priorphosphorylation are shown in Fig. 2 (A and B).Comparison of peptides derived from both conditions revealed several species appearing a t identical positions (Fig. 2, A and B). However, some differences in the pattern of peptides are evident; in particular, peptide 1 (Fig. 2 B ) was absent in tryptic maps prepared from dSosHA that were not treated with phosphatase (Fig. 2 A ) . This species probably represents a site that is completely phosphorylated in intact cells, and so no further phosphorylation can occur when incubated with MAP kinase. The identities of species were confirmed in mixing experiments in which peptides obtained from phosphatase treated and untreateddSosHA were applied to the same plate andanalyzed by two-dimensional separation (data not shown). The phosphorylation pattern of dSosHA in intact cells was also examined by labeling PCMV5-dSosHA-transfectedCOS-1 cells with 32Piand isolating dSosHA by immunoprecipitation. Tryptic maps exhibited four major phosphorylated species and several minorspecies. Two of the major species (peptides 1 and 2 in Fig. 2C) appeared at positions similar totwo phosphopeptides thatwere seen afterMAP kinase phosphorylation of phosphatase-treated dSosHA. To further substantiate this, equal amounts of radioactivity from phosphopeptides obtained from both in vitro and intact cell labelings were mixed and spotted on a thin-layer plate. As seen inFig. 2 0 , this analysisrevealed that the migrations of peptides 1 and 2 obtained by both sources are identical,which strongly suggests that theyrepresent the samephosphorylation sites. The phosphoamino acid content of the more prominent phosphopeptide species from 32P-labeled dSosHA was determined. Phosphopeptides were eluted from thin-layer plates, partially hydrolyzed with HCl, and analyzed by thin-layer electrophoresis. As illustrated in Fig. 3 A , peptides 1 and 2, derived from either dSosHA labeled in intact cells or phosphorylated with
I Spot 1
lPlabeling
o b
1 2 2
FIG.3. Phosphoamino acid contentof the tryptic peptides.A, peptides 1 and 2 labeled in intact cells or in immunoprecipitates were eluted from the plates and their phosphoamino acid content was determined a s described under "Experimental Procedures." B, summary of the phosphoamino acid content of the major species labeled intact cells or in immunoprecipitates. The crosses represents the sites of application. Shading indicates relative intensity of the species. S designates serine phosphorylation. T designates threonine phosphorylation.
MAP kinase in immunoprecipitates, contained phosphoserine but no phosphothreonine. The slower migrating labeled species represent partialhydrolysis products. As expected, this pattern generally differs for each phosphorylation site in a given protein (Cooper et al., 1983;Martensen, 1984).Interestingly, the patterns of partial hydrolysis products determinedfor species 1 from both methodsof labeling are identical. This isalso true for species 2. These data confirm that phosphopeptide species 1 and 2 derived from dSosHA labeled in intactcells represent the same sites that are phosphorylated by purified MAP kinase in dSosHA immunoprecipitates. One prominent labeled phosphopeptide species labeled in immunoprecipitates contained only threonine (Fig. 3, B and D ) . Since only one consensus site for MAP kinase phosphorylation in dSosHA contains threonine (Thr-1481), it islikely that this species represents that site. This species did not appear in material derived from dSosHA labeled in intact cells, and its labeling did not requiredephosphorylation prior to phosphorylation by MAP kinase. This site,therefore, does not seem to be phosphorylated in intactcells. A summary of the phosphoamino acid content of these and otherlabeled peptides is given in Fig.
3B.
4720
MAP-2 Kinase Phosphorylation of Ras Activator DISCUSSION
The Son of sevenless proteins arebelieved to be involved in theactivation of Ras by tyrosinekinase receptors (Baltensperger et al., 1993; Buday and Downward, 1993; Li et al., 1993; Rozakis-Adcock et al., 1993; Skolniket al., 1993). In this communication, we have shown that the Drosophila Son of sevenless protein is a substrate for MAP kinase in vitro. Some of the same sites that are phosphorylated by MAP kinase in vitro are apparently also phosphorylated in intactcells. This is unambiguously demonstrated for phosphopeptide 1(Fig. 2) because phosphorylation of this peptidein vitro only occurs after dephosphorylation of in vivophosphorylated dSos. MAP kinase has beenshown to be part of a large numberof signaling pathways and has numerous targets located in different cellular compartments (Blenis,1993;Davis, 1993). Proteinssuch as c-Myc (Seth et al., 1992), p9OrSk (Sturgill et al., 1988), and cytoplasm phospholipase Az (Lih-Ling et al., 1993) are targets of MAP kinase phosphorylation that are downstream in its signal transduction pathway. However, as in the case of Sos, MAP kinase also phosphorylates proteins upstream from it such as MAP kinase kinase (Matsuda et al., 1993), RAF (Anderson et al., 1991; Lee et al., 19911, and EGFreceptor (Northwood et al., 1991; Takishima et al., 1991). The functions of MAP kinase-mediated phosphorylations of upstream targets have yet to be elucidated. However, in S. cerevisiae there is some a MAP kinase homologue, FUSS, evidence tosuggestthat down-regulates its own phosphorylation pathway (Gartner et al., 1992). Thus, it is possible that phosphorylations or dephosphorylations could be involved in either negative or positive feedback mechanisms. It has been suggested that Sos is phosphorylated on serine or insulin stimulaand threonine residues in response to EGF tion (Li et al., 1993; Rozakis-Adcock et al., 1993; Skolnik et al., 1993). We have similarly observed a decreased electrophoretic mobility of Sos-1 in 3T3-Ll adipocytes stimulated with insulin or phorbol ester.' In the COS-1 cell system, we have not been able toidentify an increase of Sos phosphorylation in response to insulin (Baltensperger, et al., 1993). COS-1 cells have been observed to have high basallevels of MAP kinase activity, and transfection of insulin receptorcDNA into COS-1 cells and subsequent stimulationof insulin leads to no detectable increaseof MAP kinase activity in cell extract^.^ Thus, it may not be possible to observe Sos phosphorylation changes in response to insulin in transiently transfectedCOS-1 cells. The effect of phosphorylation onSos function is not known. It is possible that phosphorylation directly effects Sos catalytic activity toward Ras. Wolfman and Macara (1990) report that purification of guanosine nucleotideexchange activity from brain requires the presence of phosphatase inhibitors.However, Sos and GRFexchange facsince brain tissue contains both the tors, itis not certainwhich Ras nucleotide exchange activity was measured. The Ral guanosine nucleotide exchange factor ralGDS is phosphorylated on serines, but treatment of ralGDS with phosphatase does not effect its activity (Albright et al., 1993).Nevertheless, it should be notedthat unlike Sos, neither GRF nor ralGDS containlong COOH-terminal proline-rich extensions where the potentialMAP kinase sites arelocated. Phosphorylation may also affect the association between Sos and GRB2 or other unidentified proteins. In this case, phosphorylation may change the conformation of Sos so that it changes its affinity for binding proteins. A change in phosphorylation state could then affect the intracellularlocation of Sos, which would then alterits ability to activate Ras. A similar mechanism may exist with CDC25 regulation in S. cerevisiae. A. D. Cherniack and M. P. Czech, unpublished results. J . K. Klarlund and M. P. Czech, unpublished results
The CDC25 becomes hyperphosphorylated, in responseto glucose starvation.Thishyperphosphorylation occurs concomicytoplasm, tantly witha partial relocalization of CDC 25 to the which reduces itsaccessibility to membrane-bound Ras. In this case it has been suggested thata downstream element,CAMPdependentproteinkinase,down-regulates CDC25 by phosphorylation (Gross et al., 1992). Further studies should determine whether MAP kinase effects Sos regulation in a similar manner. Acknowledgments-We thank Judy Kula for excellent assistance in preparing the manuscript and Dr. Utpal Banejee for providing the dSos cDNA and for helpful discussion. REFERENCES Albright, C. E, Giddings, B. W., Liu, J., Vito, M., and Weinberg, R. A. (1993)EMBO J. 12,339447 Anderson, N. G., Li, P., Marsden, L. A., Williams, N., Roberts, T. M., and Sturgill, T.W. (1991) Biochem. J. 277,573-576 Andersson, S., Davis, D. N., Dahlhack, H., Jornvall, H., and Rusell,D. W. (1989)J . B i d . Chem. 264,82224229 Baltensperger, K., Kozma, L. M., Cherniack, A. D., Klarlund, J. K., Chawla, A,, Banejee, U., and Czech, M. P. (1993) Science 260, 195&1952 Blenis, J. (1993)Proc. Natl. Acad. Sci. U. S. A. 90, 5889-5892 Bonfini, L., Karlovich, C. A,, Dasgupta, C., and Banejee, U. (1992) Science 255, 603406 Bowtell, D., Fu, P., Simon, M., and Senior, P. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 65114515 Broek, D., Toda, T., Michaeli, T., Levin, L., Birchmeier, C., Zoller, M., Powers, S., and Wigler, M. (1987) Cell 48,789-799 Buday, L., and Downward, J. (1993) Cell 73,611420 Burgering, B. M. T., Medema, R. H., Maasen,J. A., ven de Wetering,M. L., van der Eb, A. J., McCormick, F., and Bos, J. L. (1991)EMBO J. 10, 1103-1109 Chardin, P., Camonis, J. H., Gale, N. W., Van Aeist, L., Schlessinger, J., Wigler, M. H., and Bar-Sagi, D. (1993)Science 260, 1338-1343 Clark-Lewis, I., Sanghera, J. S., and Peloch, S. L. (1991) J. Biol.Chem. 266, 1518&15184 Cooper, J. A,, SeRon, B. M., and Hunter, T. (1983)Methods Enzymol. 99,387-402 Davis, R. J. (1993) J. Biol. Chem. 268, 14553-14556 de Vries-Smits, A. M. M., Burgering, B. M. Th., Levers,S. J., Marshall, C. J., and Bos, J. L. (1992)Nature 357,602404 Egan, S. E., Giddings, B. W., Brooks, M.W., Buday, L., Sizeland, A. M., and Weinberg, R. A. (1993) Nature 3 6 3 , 4 5 5 1 Gale, N.W., Kaplan, S., Lowenstein, E. J.,Schlessinger, J., and Bar-Sagi, D. (1993) Nature 363,8%92 Gartner, A,, Nasmyth, K., and Ammerer, G. (1992) Genes & Deu. 6, 128&1292 Gibbs, J. B., Marshall, M. S., Scolnick, E. M., Dixon, R. F., and Vogel, V. S. (1990) J. Biol. Chem. 265, 20437-20442 Gonzalez, F. A,, Raden, D. L., and Davis, R. J. (1991)J . B i d . Chem. 266,2215922163 Gross, E., Goldberg, D., and Levitzki, A. (1992) Nature 360, 762-765 Hunter, T., and SeRon, B. M. (1980)Proc. Natl. Acad. Sci. U. S. A. 77,1311-1315 Kamps, M. P., and SeRon, B. M. (1989)Anal. Biochem. 176.22-27 Lee, R. M., Cobb, M. H., and Blackshear, P. J. (199215. Biol. Chem.267,108%1092 Li, N., Batzer,A,, Daly, R., Yajnik, V., Skolnik, E., Chardin, P., Bar-Sagi, D., Margolis, B., and Schlessinger, J. (1993) Nature 363, 8 5 4 8 Lih-Ling, L., Wartmann, M., Lin, A. Y., Knopf, J. L., Seth, A,, and Davis, R. J. (1993) Cell 72 269-278 Martegani,E., Vanoni, M., Zippel, R., Coccetti, P., Brambilla, R., Ferrari,C., Sturani, E., andAlberghina, L. (1992)EMBO J 11,2151-2157 Martensen, T. D. (1984) Methods Enzymol. 107,3-23 Matsuda, S., Gotoh, Y., and Nishida, E. (1993) J. Biol. Chem. 268, 32773281 Medema, R. H., Wubbolts, R., and Bos, J. L. (1991)Mol. Cell. Biol. 11, 5963-5967 Northwood, I. C., Gonzalez, F. A., Wartmann, M., Raden, D. L., and Davis, R. J. (1991) J . Biol. Chem. 266, 15266-15285 Rogge, R. D., Karlovich, C. A., and Banejee, U. (1991) Cell 6 4 , 3 9 4 8 Rozakis-Adcock. M.. Fernlev. ~. R.,. Wade,. J.,. Pawson. T., and Bowtell,D. (1993) Nature 363,83-85 Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis, K. B., and Erlich, H. A. (1988) Science 239, 487491 Sanger, F., Nicklen, S., and Coulson, A. R. (1977)Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467 Satoh, T., Endo, M., Nakafuku, M., Akiyama, T., Yamamoto, T., and Kaziro, Y. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 7926-7929 Seth, A., Gonzalez, F. A,, Gupta, S., Raden, D. L., and Davis, R. J. (1992) J. Biol. Chem. 267,2479&24804 Shou, C., Farnsworth, C. L., Neel, B. G, and Feig, L. A. (1992) Nature 358,351-354 Skolnik, E. Y., Batzer. A,, Li, N., Lee, C:H., Lowenstein, E., Mohammadi, M., Margolis, B., and Schlessinger, J. (1993) Science 260, 1953-1955 Sturgill, T. W., Ray, L. B., Erikson, E., and Maller, J. L. (1988) Nature 334,715718 Takishima, K.., Griswold-Prenner, I., Ingebritsen, T., and Rosner, M. R. (1991) Proc. Natl. Acad. Sci. U. S. A. 88,252&2524 Thomas, S. M., DeMarco, M., DArcangelo, G., Halegoua, S., and Brugge, J. S. (1992) Cell 68, 1031-1040 Wei, W., Mosteller, R. D., Sanyal. P., Gonzales, E., McKinney, D., Dasgupta, C., Li, P., Liu, B. X., and Broek, D. (1992)Proc. Natl. Acad. Sci. U. S. A 89,710CL7104 Wilson, LA., Niman,H. L., Houghten,A. R.. Cherenson, M. L., Connolly, M. L., and Lerner, R. A. (1984) Cell 37,767-778 Wolfman, A,, and Macara, I. G. (1990) Science 2 4 8 , 6 7 4 9 Wood, K. W., Sarnecki, C., Roberts, T. M., and Blenis, J. (1992)Cell 68,1041-1050
