bs_bs_banner
Austral Entomology (2019) 58, 76–84
Phylogenetic placement and redescription of Aleochara blackburni Bernhauer & Scheerpeltz, 1926 (Coleoptera: Staphylinidae) from coastal Australia Jeong-Hun Song,1 Andrew W Osborn,2 Mario Elgueta3 and Kee-Jeong Ahn1* 1
Department of Biology, Chungnam National University, Daejeon 34134, Korea. Honorary Research Associate, Queen Victoria Museum and Art Gallery, 2 Invermay Road, Launceston, TAS 7250, Australia. 3 Area of Entomology, Chilean National Museum of Natural History, Casilla 787, Santiago, Chile. 2
Abstract
Aleochara blackburni Bernhauer & Scheerpeltz (Aleocharinae) is a little-known coastal rove beetle, not studied since a specimen was collected from coasts in Port Lincoln, South Australia, in 1888. We report the discovery of additional specimens, which were collected at sites distributed between the central-east and south-east coasts of Tasmania, Australia. Habitus photographs, a redescription, host records and illustrations of diagnostic characters are provided. To investigate the phylogenetic placement of A. blackburni and taxonomic problems within the Emplenota and Triochara clade, we studied 34 populations of 13 coastal and one inland species and generated a molecular phylogeny of the genus Aleochara Gravenhorst based on three partial mitochondrial genes (COI, tRNA leucine and COII). Our results showed that A. blackburni was the sister group of the bilineata clade + curtula clade and suggested that A. curtidens Klimaszewski (Vancouver, Canada) and A. trisulcata Weise (Chiba, Japan) used in a previous study were misidentifications of A. fucicola Sharp and A. zerchei (Assing), respectively. Five independent origins of specialisation to coastal habitat in the genus Aleochara (clades A–E) are hypothesised, of which A. blackburni has independently colonised the Southern Australian coast (clade E).
Key words
coastal habitat colonisation, host record, molecular phylogeny, taxonomy.
I N T R O DU C T I O N During repeated collecting trips to both central-eastern and south-eastern Tasmanian littoral zones, one of us (AWO) found the emergence of unusual Aleochara Gravenhorst beetles from kelp fly pupae (Diptera: Coelopidae). The larvae of coastal Aleochara species were known to be ectoparasitoids of kelp fly pupae (Maus et al. 1998; Yamazaki 2008, 2012; Schooler et al. 2012; Song & Ahn 2013, 2014) and were generally found in fly-infested habitats, such as decaying seaweeds and carrion (Frank & Ahn 2011). We compared these Aleochara specimens with the type specimens of species of this genus deposited in the National History Museum (NHM, London) and identified these as Aleochara blackburni Bernhauer & Scheerpeltz. Since the sole-type specimen was collected some 130 years ago, no additional specimen of A. blackburni had been reported until the present study. Bernhauer and Scheerpeltz (1926) classified A. blackburni within the subgenus Eucharina Casey, which was synonymised under the subgenus Coprochara Mulsant & Rey by Klimaszewski (1984). Later, Maus (1998) suggested that it should be transferred from the subgenus Coprochara to the subgenus Aleochara Gravenhorst due to the following: a broader and more flattened body shape, incomplete mesoventral carina and internal sac of the median lobe. However, the phylogenetic position still remains unclear.
In this study, we focus on a taxonomic study and phylogenetic placement of A. blackburni. In the taxonomic section, we redescribe A. blackburni with illustrations of habitus photographs and diagnostic characters. Some of these specimens yielded DNA, from which we amplified three mitochondrial genes (COI, COII and tRNA leucine). To investigate the phylogenetic placement and discuss the seashore colonisation of the genus, we added 34 populations of 13 coastal and one inland Aleochara species to a previous phylogenetic analysis of the genus (Song & Ahn 2013). This new analysis was used to determine the taxonomic placement of A. blackburni and to discuss the evolution of coastal habitat colonisation in the Aleochara lineage.
MATERIALS AND METHODS All A. blackburni specimens used in this study are deposited in the Queen Victoria Museum and Art Gallery (QVMAG), Launceston, Tasmania, Australia. To identify them more reliably, we compared them with the type specimen deposited in the Natural History Museum (NHM, London). Digital habitus images were merged using image stacking software (Helicon focus v.6.7.1). The terms used here followed Sawada (1972) and Ashe (1984).
Taxon sampling for phylogenetic analysis *
[email protected] Early view version of record published on 3 October 2017. © 2017 Australian Entomological Society
We used the same sequences and taxonomic representations as Maus et al. (2001) and Song and Ahn (2013) but added 34 doi: 10.1111/aen.12310
Systematics of Aleochara blackburni populations of 13 coastal and one inland species. In total, 17 coastal species were included in the dataset with eight out-groups chosen from previous studies (Maus et al. 2001; Song & Ahn 2013). The taxa studied are listed in Table 1. The newly sequenced species in this study – A. blackburni, A. segregata Yamamoto & Maruyama, A. hayamai Yamamoto & Maruyama, A. signaticollis Fairmaire & Germain and A. yamato Yamamoto & Maruyama, were collected from Australia within Tasmania and nearby islands, Chile, Japan and Korea. Aleochara blackburni included four populations from Tasmanian seacoasts. To test thoroughly taxonomic issues within the ET clade (Emplenota + Triochara), we added populations of the following species: A. fucicola – four populations; A. nubis (Assing) – one; A. puetzi (Assing) – four; A. segregata – nine; A. trisulcata Weise – three; and A. zerchei (Assing) – two that were collected from Japan, Korea and Russia (Primorsky Krai and Kamchatka). For four coastal species, A. grisea Kraatz, A. obscurella Gravenhorst, A. punctatella Motschulsky and A. sulcicollis Mannerheim, we added one more population each, collected along beaches in England and Chile.
Table 1
77
DNA extraction and sequencing Total genomic DNA was extracted using the Qiagen DNeasy Blood and Tissue kit (Qiagen, Hilden, Germany) according to the protocol for animal tissue. In most cases, the abdomen was removed to avoid possible contamination from the gut contents and to retain segment VIII, which contains taxonomically informative genital structures. Two mitochondrial protein-coding genes COI and COII (including the tRNA leucine gene between them) were used, as in Maus et al. (2001) and Song and Ahn (2013). Typical polymerase chain reaction (PCR) was conducted using AccuPower PCR Premix (Bioneer, Daejeon, Korea) containing 1 U Top DNA polymerase, 250 μM dNTP, 10 mM Tris–HCl (pH 9.0), 30 mM KCl, 1.5 mM MgCl2, stabiliser and tracking dye, 1–3 μL template, 1 μL each primer (5 pmol) and 15–17 μL distilled water, for a total volume of 20 μL. Amplification of CO gene regions was accomplished by amplifying five smaller fragments. All primers and protocols used in this study are listed in Tables 2, 3. The PCR products were visualised via gel electrophoresis, purified using the Exo-AP PCR Clean-Up Mix (Doctor Protein,
List of species with their locality data and GenBank accession numbers newly investigated in this study
Species
Voucher code (CNUIC)
Collection locality
A. blackburni AUS A. blackburni AUS A. blackburni AUS
0352 0478 0485
A. blackburni AUS A. fucicola KOR A. fucicola KOR A. fucicola JPN A. fucicola RUS A. grisea ENG A. hayamai JPN A. nubis RUS A. obscurella ENG A. puetzi JPN A. puetzi JPN A. puetzi RUS A. puetzi RUS A. punctatella ENG A. segregata KOR A. segregata KOR A. segregata KOR A. segregata KOR A. segregata KOR A. segregata KOR A. segregata KOR A. segregata JPN A. segregata JPN A. signaticollis CL A. sulcicollis CL A. trisulcata KOR A. trisulcata JPN A. trisulcata JPN A. yamato JPN A. zerchei KOR A. zerchei KOR
0486 0238 0243 0278 0331 0375 0170 0151 0271 0197 0212 0261 0332 0376 0204 0205 0206 0207 0208 0209 0210 0211 0272 0477 0487 0378 0270 0377 0283 0257 0258
Maria Is., Tasmania, Australia Redbill Beach, Tasmania, Australia Hopground Beach, Maria Island, Tasmania, Australia Shelly Point, Tasmania, Australia Seogwipo, Jeju, Korea Dokdo Is., Gyeongbuk, Korea Fukuoka, Kyushu, Japan Telyakovskogo Bay, Primorsky, Russia Wemburg Beach, Devon, England Nagahashi-chô, Fukui, Japan Petropavlovsk-Kamchatsky, Kamchatka, Russia Wemburg Beach, Devon, England Shiribeshi, Hokkaido, Japan Oshima, Hokkaido, Japan Petropavlovsk-Kamchatsky, Kamchatka, Russia Telyakovskogo Bay, Primorsky, Russia Bantham Beach, Devon, England Haenam, Jeonnam, Korea Boryeong, Chungnam, Korea Seogwipo, Jeju, Korea Pohang, Gyeongbuk, Korea Uljin, Gyeongbuk, Korea Goseong, Gangwon, Korea Kobe, Hyogo, Japan Oshima, Hokkaido, Japan Fukuoka, Kyushu, Japan Chigualoco, N Los Vilos, Coquimbo, Chile San Carlos, San Antonio, Valparaiso, Chile Dangjin, Chungnam, Korea Fukuoka, Kyushu, Japan Kagoshima, Kyushu, Japan Nagahashi-chô, Fukui, Japan Pohang, Gyeongbuk, Korea Goseong, Gangwon, Korea
COI (including tRNA leucine)
COII
KY769617 KY769618 KY769619
KY769650 KY769651 KY769652
KY769620 KJ186618 + KY769590 KJ186615 + KY769591 KJ186620 + KY769592 KX892294 + KY769593 KX892363 + KY769594 KJ186621 + KY769595 KX892331 + KY769596 KX892316 + KY769597 KJ186626 + KY769598 KJ186627 + KY769599 KJ186624 + KY769600 KX182318 + KY769601 KY434069 + KY769602 KJ186631 + KY769603 KJ186632 + KY769604 KJ186633 + KY769605 KJ186636 + KY769606 KJ186637 + KY769607 KJ186638 + KY769608 KJ186643 + KY769609 KJ186644 + KY769610 KJ186645 + KY769611 KY769623 KY769621 KY769622 KX892340 + KY769612 KX892341 + KY769613 KJ186648 + KY769614 KX892351 + KY769615 KX892351 + KY769616
KY769653 KY769624 + KJ186653 KY769625 + KJ186655 KY769626 + KJ186655 KY769627 + KX892376 KY769628 + KX892446 KY769629 + KJ186656 KY769630 + KX892413 KY769631 + KX892398 KY769632 + KJ186661 KY769633 + KJ186662 KY769634 + KJ186659 KY769635 + KX892400 KY769636 + KY434070 KY769637 + KJ186666 KY769638 + KJ186667 KY769639 + KJ186668 KY769640 + KJ186671 KY769641 + KJ186672 KY769642 + KJ186673 KY769643 + KJ186678 KY769644 + KJ186679 KY769645 + KJ186680 KY769656 KY769654 KY769655 KY769646 + KX892423 KY769647 + KX892424 KJ186683 KY769648 + KX892434 KY769649 + KX892434
© 2017 Australian Entomological Society
78
J-H Song et al.
Table 2
Sequence information for primers of mitochondrial COI and COII gene regions (including tRNA leucine) for PCR and sequencing
Primer
Direction
Sequences (50 to 30 )
Reference
LCO1490 HCO2198 C1-902 C1-J-2092 COJ 2680 C1-J-2441 TL2-N 3020 C1-J-2993 C2-N-3431 C2-J-3400 TKN 3782
Forward Reverse Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
GGTCAACAAATCATAAAGATATTGG TAAACTTCAGGGTGACCAAAAAATCA GCTARTCATCTAAAAATTTTAATTCC AGTTTTAGCAGGAGCAATTACTAT GAATCATTGAATAATTCCTGCT CCAACAGGAGGAATTAAAATTTTTAGATGATTAGC GGAGCTTAAATCCAATACACTATTCTGCC CWCCWGCWGAACATAGATATTCWGAACTTCC GTWGGAATTATATATGAATCAAATTC ATTGGTCATCAATGATACTGA GAGACCATTACTTGCTTTCAGTCATCT
Hebert et al. (2003) Hebert et al. (2003) This study UEA5 in Lunt et al. (1996) Jeon et al. (2012) Simon et al. (1994) Dobler and Müller (2000) Dobler and Farrell (1999) Maus et al. (2001) Simon et al. (1994) Emerson et al. (1999)
Table 3
Polymerase chain reaction thermal cycling conditions for recommended protocols (abbreviations: s = second, min = minute)
Gene COI
Fragment
Primer
Amplifications profiles 1 min 94°C; 5 cycles: 1 min 94°C, 1.5 min 45–47°C, 1.5 min 72°C; 35 cycles: 1 min 94°C, 45 s–1.5 min 50°C, 1–3 min 72°C; 5–10 min 72°C. 2 min 94°C; 35 cycles: 45 s 94°C, 1 min 45–48°C, 2 min 72°C; 5 min 72°C.
3rd 1st (with tRNA leucine)
LCO1490–HCO2198 (or C1-902) C1-J-2092–COJ2680 (or TL2-N 3020) C1-J-2441–TL2-N3020 C1-J-2993–C2-N-3431
2nd
C2-J-3400–TKN3782
1st 2nd
COII
Seoul, Korea). Sequencing was performed commercially by Genotech (Daejeon, Korea), and all sequences were generated in both directions and confirmed with sense and anti-sense strands.
2 min 94°C; 35 cycles: 45 s 94°C, 1 min 45–48°C, 2 min 72°C; 5 min 72°C. 1 min 94°C; 5 cycles: 1 min 94°C, 1.5 min 47°C, 1.5 min 72°C; 35 cycles: 1 min 94°C, 45 s 50°C, 1–3 min 72°C; 10 min 72°C. 2 min 94°C; 35 cycles: 45 s 94°C, 1 min 48°C, 2 min 72°C; 5 min 72°C.
1000 replications and tree-bisection-reconnection branchswapping (TBR), holding 10 trees during each replication. To estimate clade support, bootstrap support was evaluated using TNT 1.5 with 1000 replicates, each of which comprised 10 random additions per replicate in the heuristic search options.
Alignment and phylogenetic analyses Sequence chromatograms and alignments were performed in MEGA 7.0 (Kumar et al. 2016). Alignment of the protein-coding genes according to the amino acid translation is straightforward. The best-fit partitioning scheme and appropriate substitution models for the codon positions of each gene were determined in PartitionFinder v.1.1.1 (Lanfear et al. 2012) using the Bayesian information criterion (BIC), linked branch lengths and the ‘greedy’ heuristic algorithm. MrBayes v.3.2 analyses (BA; Ronquist et al. 2012) were run using two runs of four chains for 7 million generations. Trees were sampled at intervals of 1000 generations for a total of 7000 trees, and convergence was judged by stabilisation of the standard deviation of the split frequencies at approximately 0.01. The burn-in region (i.e. the initial 25% of the samples; 1750 in total) was discarded, and the remaining trees were summarised in 50% majority-rule consensus trees in MrBayes. Maximum likelihood (ML) phylogenetic analyses were run using RAxML-HPC v.8 on XSEDE (Stamatakis 2014) on CIPRES Science Gateway 3.3 (Miller et al. 2010). A rapid bootstrap analysis and search for the best-scoring ML tree (-f a) was conducted using the GTRGAMMA model with 1000 bootstrap replicates. Parsimony analyses (PA) were conducted in TNT 1.5 (Goloboff & Catalano 2016) using a ‘traditional search’ with © 2017 Australian Entomological Society
R E S U L TS Molecular phylogeny In total, 67 new sequences from 14 coastal Aleochara species (three genes from 34 populations) were generated (~1378 bp of COI, ~577 bp of COII and ~66 bp of tRNA leucine). All new sequences were deposited in GenBank (Table 1). The resulting concatenated alignment (115 taxa) was 2021 bases in length and contained about 3% missing data. The partitioning scheme and corresponding models selected by PartitionFinder were as follows: (1) position 1 of COI and COII—GTR + I + G; (2) position 2 of COI and COII—GTR + I + G; (3) position 3 of COI and COII—GTR + I + G; and (4) tRNA leucine – HKY + I + G. Model-based analyses (ML and BA) recovered A. blackburni as a sister to the remaining bilineata and curtula clades with high nodal support values (MB = 81, PP = 1.00; Fig. 1). In our study, the phylogenetic relationships among Aleochara species almost corresponded to the ML tree in Song and Ahn (2013) except for the position of A. laevigata Gyllenhal within the bilineata clade. Accordingly, phylogenetic relationships were not discussed in detail here in order to avoid redundancy with the previous study (Song & Ahn 2013).
Systematics of Aleochara blackburni
79
Fig. 1. Maximum likelihood tree with maximum likelihood bootstrap (MLB) values (left), Bayesian posterior probabilities (BPP, middle) and parsimony analysis bootstrap (PAB) values (right) for clades based on COI and COII (including tRNA leucine). The species marked in blue inhabit the seashore. Asterisks indicate BPP ≥ 0.95 and bootstrap values (MLB and PAB) ≥ 80. The scale bar indicates the expected number of substitutions per site.
We identified five monophyletic groups including coastal species on the tree (clades A–E) and presented a full explanation of the phylogenetic relationships and habitat evolution among them as in Song and Ahn (2013). Within the bilineata clade, two subgenera, Emplenota and Triochara (clade A, ET clade), formed a strongly supported monophyletic group and were sister groups with each other.
Within the ET clade, A. curtidens Klimaszewski and A. trisulcata of Maus et al. (2001) were grouped within A. fucicola populations and A. zerchei populations, respectively, in all of our analyses (highlighted in red in Fig. 1). However, A. curtidens newly added from this study was recovered as a sister group to A. litoralis, and individuals of A. trisulcata newly added here were strongly supported as a single lineage (Fig. 1). Aleochara puetzi © 2017 Australian Entomological Society
80
J-H Song et al.
and A. segregata were not clearly separated in any of our analyses (highlighted in red in Fig. 1).
T A X O NO M Y Genus Aleochara Gravenhorst, 1802 Aleochara Gravenhorst, 1802, p. 67.
Aleochara blackburni Bernhauer & Scheerpeltz, 1926 Aleochara laeta Blackburn, 1888, p. 46 [homonym]. Aleochara blackburni Bernhauer & Scheerpeltz, 1926, p. 795 [replacement name]; Maus 1998, p. 95.
Material examined Holotype
♂ (Fig. 2): ‘T. 919’ [in Blackburn’s writing at base of cardmount, ‘T.’ is written in black ink and ‘919’ is written in red ink] ‘Seaweeds’ [in Blackburn’s writing on underside of cardmount] // Type [round label with orange border] // Australia. [red underline] Blackburn Coll. B.M.1910-236. // Aleochara laeta, Blackb [in Blackburn’s writing] // Holotype ♂ Aleochara blackburni Bernhauer & Scheerpeltz, 1926, Det. Jeong-Hun Song 2017. Specimen mounted on card, length 4.5 mm, male (NHM). Other material
Australia, Tasmania: 43 exx, Redbill Beach, 24.vi.2011, A.W. Osborn (QVM:12:53384–533387, 53391–53392, 53447– 53448, 53455–53461); 1 ex, Friendly Beaches, 24.vi.2011, A.
Fig. 2. Habitus of Aleochara blackburni: (a) male, 4.4 mm; (b) female, 4.6 mm; (c) label data of the holotype. © 2017 Australian Entomological Society
W. Osborn (QVM:12:53534); 1 ex, Isaacs Point, 3.vii.2014, A. W. Osborn (QVM:2014:12:100); 1 ex, Maria Island, 12. iv.2014, A.W. Osborn (QVM:2014:12:101); 30 exx, Maria Island, 27.viii.2014, A.W. Osborn (QVM:2014:12:103, 105– 110, 121); 4 exx, Redbill Beach, 10.ix.2011, A.W. Osborn (QVM:2014:12:110, 114–116); 2 exx, Redbill Beach, 20. ix.2014, A.W. Osborn (QVM:2014:12:118); 1 ex, Coswell Beach, 5.x.2014, A.W. Osborn (QVM:2014:12:120); 1 ex, Coal Point, Bruny Island, 10.v.2014, A.W. Osborn & J.W. Early (QVM:2016:12:0001); 1 ex, 26.v.2014, A.W. Osborn & J. W. Early (QVM:2016:12:0002); 1 ex, Coswell Beach, 20. x.2014, A.W. Osborn (QVM:2016:12:0003); 1 ex, Friendly Beaches, 9.xi.2014, A.W. Osborn (QVM:2016:12:0006); 1 ex, 23.iii.2015, A.W. Osborn (QVM:2016:12:0010); 1♂, 2♀, 24.iv.2015, A.W. Osborn (QVM:2016:12:0012); 4♂, 6♀, Isaacs Point, 1.ii.2014, A.W. Osborn (QVM:2016:12:0013); 1♀, 9.v.2014, A.W. Osborn (QVM:2016:12:0016); 2♂, 2♀, Hopground Beach, Maria Island, 16.xi.2014, A.W. Osborn (QVM:2016:12:0061, 63, 202–203); 2♂, 1♀, 2.xii.2014, A.W. Osborn (QVM:2016:12:0064–66); 1♀, 20.xii.2014, A. W. Osborn (QVM:2016:12:0067); 2♀, 21.xii.2014, A.W. Osborn (QVM:2016:12:0068–69); 2♂, 1♀, 22.xii.2014, A.W. Osborn (QVM:2016:12:0070–72); 1♂, 23.xii.2014, A.W. Osborn (QVM:2016:12:0073); 3♂, 2♀, 24. xii.2014, A.W. Osborn (QVM:2016:12:0074–78); 6♂, 6♀, 25.xii.2014, A.W. Osborn (QVM:2016:12:0079–90); 1♂, 1♀, 26.xii.2014, A.W. Osborn (QVM:2016:12:0091– 92); 2♂, 1♀, 27.xii.2014, A.W. Osborn (QVM:2016: 12:0093–95); 4♂, 3♀, 28.xii.2014, A.W. Osborn (QVM:2016:12:0096–102); 4♂, 2♀, 29.xii.2014, A.W. Osborn (QVM:2016:12:0103–108); 1♂, 2♀, 30.xii.2014, A.W. Osborn (QVM:2016:12:0109–111); 1♀, Maria Island, 23.iv.2015, A.W. Osborn, spent from the seaweed fly Gluma musgravei REF. McAlpine pupa (QVM:2016: 12:0112); 1♀, 29.iv.2015, A.W. Osborn, spent from G. musgravei pupa (QVM:2016:12:0113); 1♂, 30.iv.2015, A.W. Osborn, spent from G. musgravei pupa (QVM:2016:12:0114); 1♂, 6.v.2015, A.W. Osborn, spent from G. musgravei pupa (QVM:2016:12:0115); 1♀, 8. v.2015, A.W. Osborn, spent from G. musgravei pupa (QVM:2016:12:0116); 2♂, Darlington Beach, Maria Island, 6.v.2015, A.W. Osborn (QVM:2016:12:0116); 1♂, Redbill Beach, 1.v.2015, A.W. Osborn (QVM:2016:12:0120); 1♂, 19.v.2015, A.W. Osborn (QVM:2016:12:0131); 1♂, 10.vi.2015, A.W. Osborn (QVM:2016:12:0134); 3♂, 10.v.2015, A.W. Osborn (QVM:2016:12:0135); 2♂, 19.v.2015, A.W. Osborn (QVM:2016:12:0136–137); 2♂, 1♀, 23.vi.2015, A.W. Osborn (QVM:2016:12:0139); 2♂, 1♀, 24.vi.2015, A.W. Osborn (QVM:2016:12:0140–142); 1♀, 26.vi.2015, A.W. Osborn (QVM:2016:12:0143); 1♀, 28.vi.2015, A.W. Osborn (QVM:2016:12:0144); 1♂, 3♀, 2.vii.2015, A.W. Osborn (QVM:2016:12:0145–148); 2♂, 4.vii.2015, A.W. Osborn (QVM:2016:12:0149–150); 1♂, 2♀, 5.vii.2015, A.W. Osborn (QVM:2016:12:0151–153); 1♀, 8.vii.2015, A.W. Osborn (QVM:2016:12:0154); 4♂, 10.vii.2015, A. W. Osborn (QVM:2016:12:0155–158); 1♂, 1♀, 12.
Systematics of Aleochara blackburni
81
vii.2015, A.W. Osborn (QVM:2016:12:0159–160); 3♂, 13.vii.2015, A.W. Osborn (QVM:2016:12:0161–163); 1♀, 14.vii.2015, A.W. Osborn (QVM:2016:12:0164); 2♂, 19.vii.2015, A.W. Osborn (QVM:2016:12:0165– 166); 2♂, 2♀, 21.vii.2015, A.W. Osborn (QVM:2016:12:0169); 1♂, 1♀, 23.vii.2015, A.W. Osborn (QVM:2016:12:0171–172); 2♀, 24.vii.2015, A.W. Osborn (QVM:2016:12:0173–174); 1♂, 3♀, 26.vii.2015, A.W. Osborn (QVM:2016:12:0175–178); 1♂, 28. vii.2015, A.W. Osborn (QVM:2016:12:0179); 1♂, 1♀, 4.viii.2015, A.W. Osborn (QVM:2016:12:0180, 182); 2♂, 11.viii.2015, A.W. Osborn (QVM:2016:12:0183– 184); 1♂, 2♀, 18.viii.2015, A.W. Osborn (QVM:2016: 12:0185–187); 3♂, 25.viii.2015, A.W. Osborn (QVM: 2016:12:0188–190); 1♂, 24.ix.2015, A.W. Osborn (QVM:2016:12:0191); 3♂, 2♀, Shelly Point, Beaumaris, 12.ix.2015, A.W. Osborn (QVM:2016:12:0193); 3♂, 11♀, 13.x.2015, A.W. Osborn (QVM:2016:12:0194); 1♂, 8♀, 14.x.2015, A.W. Osborn (QVM:2016:12:0195); 1♂, 2♀, 7.xi.2015, A.W. Osborn (QVM:2016:12:0196); 2♀, 5.xii.2015, A.W. Osborn (QVM:2016:12:0198, 200).
Diagnosis Aleochara blackburni can be distinguished from other coastal Aleochara species by the combination of the following characters: body glossy, parallel-sided; elytra red or rarely orange; mentum strongly transverse, broadly trapezoidal, anterior margin distinctly emarginate; pronotum widest at middle, two longitudinal, subparallel rows of impressions present on midline, punctures with macro setae, surface coarsely but deeply punctured; hypomeron not visible in lateral aspect; mesoventrite with incomplete longitudinal carina; mesoventral process broad, apex rounded, subequal in length to metaventral process. Male: head dorsally flattened; antennomeres 3–5 with many setae and 11 with three pores; median lobe (Fig. 4e,f) ovate and bulbous at base, apical process pointed apically in ventral aspect, without a pair of subapico-ventral projections (see Fig. 4j–l in Song & Ahn 2014), basal plate of flagellum long and large. Female: spermatheca not coiled, curved at right angle, bursa dilated apically (Fig. 4g).
Description Body (Fig. 2a–b). Parallel-sided; surface glossy, with microsculptures. Body usually reddish brown to dark brown; head darker than other parts; antennae and legs reddish brown; elytra red or rarely orange; pronotum black or reddish brown, often laterally reddish brown; each abdominal segment black anteriorly and reddish brown posteriorly. Length about 4.4–7.3 mm. Head. Subquadrate, 1.06 times as long as wide (dorsal aspect); eyes about 1.2 times as long as temple; gular sutures moderately separated, diverged basally; cervical, infraorbital and occipital carina complete; postoccipital suture complete. Antennae (Fig. 3a) long, antennomere 1 longest and slightly shorter than 2–3 combined, 2 and 3 elongate and dilated apically, 4–6 about
Fig. 3. Aleochara blackburni: (a) antenna; (b) male antennomeres 3–5; (c) labrum, dorsal aspect; (d) labium, ventral aspect; (e) mentum, ventral aspect; scales = 0.1 mm.
same length and slightly transverse, 7–9 about same length and slightly transverse, 10 slightly transverse, 11 longer than wide, about as long as preceding two combined, with three pores (Fig. 3a). Mouthparts. Labrum (Fig. 3c) transverse and anterior margin distinctly emarginate, with nine macrosetae present on each side of midline; α-sensillum relatively long and about 4.3 times as long as β-sensillum, ε-sensillum short, γ-sensillum reduced. Mandibles asymmetrical, pointed apically, left one with small internal tooth at apex, prostheca well developed. Labium (Fig. 3d) with ligula, narrowly divided into two lobes in basal half, inner curved; two medial setae widely separated; two basal pores widely separated, several median pseudopores and three to five lateral pseudopores present, one setal pore and three rear pores present on each side of prementum; palpus elongate with many setulae; palpomere 1 largest and longest, about 1.6–1.7 times as long as wide, with γ-setula distant to b-setula, distance from setulae b to γ about 1.25 times as long as setulae α to γ, 2 longer than 3, 3 parallel-sided and shortest, about 1.7 times as long as wide; length of lateral lobe of the premental apodeme about 1.8 times as long as labium. Mentum (Fig. 3e) strongly © 2017 Australian Entomological Society
82
J-H Song et al.
transverse, broad trapezoidal, anterior margin distinctly emarginate, five macrosetae present on each side of midline, w-seta longest, v-seta very short. Thorax. Pronotum slightly transverse, approximately 1.3 times as wide as long, widest around middle, five to six macrosetae present in lateral margin; two longitudinal, subparallel rows of impressions on midline, punctures with macrosetae, surface coarsely but deeply punctured; hypomeron not visible in lateral aspect; mesoventrite with incomplete longitudinal carina, less than half length of mesoventrite; mesoventral process broad, apex rounded, subequal in length to metaventral process; metaventral process rounded at apex; isthmus slightly present, length ratio of mesoventral process, isthmus and metaventral process 4.5:1:4.5; mesocoxal cavities moderately separated; elytra slightly wider than pronotum; elytron approximately 1.5 times longer than wide, pubescence directed postero-laterally; posterior margin weakly rounded. Legs. Long and slender; pro- and mesotibiae with small and blunt spines along outer surface; tarsomere 1 of legs longer than 2, with a pair of empodial setae between tarsal claws. Abdomen. Parallel-sided; surface glossy; tergites II–VII with three macrosetae on each side of midline. Median lobe (Fig. 4e,f) ovate and bulbous at base, apical process pointed apically in ventral aspect, flagellum longer than half of length of median lobe, basal plate of flagellum long and large. Spermatheca (Fig. 4g) curved at right angle, bursa dilated apically, duct about 1.27 times as long as bursa. Secondary sexual characteristics. Male head (Fig. 2a) dorsally flattened; antennomeres 3–5 (Fig. 3b) with many setae; tergite VIII (Fig. 4a) with six to seven macrosetae on each side of midline, posterior margin slightly emarginate; sternite VIII (Fig. 4b) with 13 macrosetae on each side of midline, posterior margin almost broadly rounded. Female tergite VIII (Fig. 4c) with six macrosetae on each side of midline, posterior margin weakly emarginate; sternite VIII (Fig. 4d) with 11 macrosetae on each side of midline, suture emarginate.
Host record Gluma musgravei McAlpine, 1991 (Diptera: Coelopidae).
Distribution Australia (South Australia and in the present study Tasmania).
D IS C U S S I O N Prior to this study, the systematic position of A. blackburni was poorly understood. For instance, Bernhauer and Scheerpeltz (1926) classified it into the subgenus Coprochara without evidence, and Maus (1998) placed A. blackburni in the Aleochara speculifera species group with seven Aleochara species in the Australian region and temporally classified it into © 2017 Australian Entomological Society
Fig. 4. Aleochara blackburni: (a) male tergite VIII, dorsal aspect; (b) male sternite VIII, ventral aspect; (c) female tergite VIII, dorsal aspect; (d) female sternite VIII, ventral aspect; (e) median lobe, dorsal aspect; (f) median lobe, lateral aspect; (g) spermatheca; scales = 0.1 mm.
the subgenus Aleochara regardless of phylogenetic relatedness. Contrary to these hypotheses, our phylogenetic analyses revealed that A. blackburni is not closely related to either subgenus Aleochara or Coprochara and supported the view that the A. speculifera species group could be described as a new subgenus (Maus 1998). However, further morphological and phylogenetic studies are needed using comprehensive sampling for this group to conclude the classification of the species. In this study, A. blackburni was found to be a sister group of the bilineata clade + curtula clade. If A. clavicornis L. Redtenbacher is not a member of the genus Aleochara as Maus et al. (2001) pointed out, A. blackburni is the most basally positioned species in the tree. On the contrary, most coastal Aleochara species are positioned most distally in the Aleochara phylogeny such as the ET clade. Aleochara puetzi and A. segregata were not resolved as a single lineage as in the previous study (Song & Ahn 2014, 2017). Although we expanded our dataset by about 1000 bp of COI (previously excluded regions), the results were unchanged. However, the nuDNA gene tree and concatenated tree (mtDNA and nuDNA) clearly resolved them as a single lineage (Song &
Systematics of Aleochara blackburni Ahn 2014, 2017). Song and Ahn (2017) tentatively hypothesised that such mito-nuclear discordance may be caused by hybridisation and mitochondrial introgression between populations of these two species in the sympatric zone. Our results support this hypothesis and provide another form of evidence that using mtDNA markers alone has limitations for systematic studies. Aleochara curtidens (Vancouver, Canada) and A. trisulcata (Chiba, Japan) (highlighted in red in Fig. 1) from the data set of Maus et al. (2001) are considered as misidentifications of A. fucicola and A. zerchei, respectively. Those two species formed a single lineage with A. fucicola and A. zerchei, respectively. Aleochara curtidens, newly added from California, USA, was grouped with other North American Emplenota species, and the populations of A. trisulcata were strongly supported as a single lineage with the exception of A. trisulcata from Maus et al. (2001). Our analysis recovered five independent origins of coastal habitat specialisation in the genus Aleochara (clades A–E, Fig. 1). In particular, within the subgenus Coprochara, two independent origins are identified. As distinct from others, the newly added coastal species, A. blackburni from Australia, have independently colonised the Pacific coast of Australia.
ACKNOWLEDGEMENTS We thank M. Ȏhara (Hokkaido University Museum, Sapporo), H. Hoshina (Fukui University, Fukui) and N. G. Klochkoba (Kamchatka State Technical University, PetropavlovskKamchatsky) for arranging the collecting trips. Clive Turner (England) kindly sent us European Specimens. We also thank M. V. L. Barclay (NHM, London) for arranging the loan of type specimen, and David Maynard (QVMAG, Tasmania, Australia) and Judy Rainbird (Collections Officer QVMAG, Tasmania) for all aspects associated with processing the specimens. In addition, we thank the following Tasmanian Parks and Wildlife Service officers for permission to collect the specimens studied and analysed herein: (1) Robert Connell, Ranger, Northern Region; (2) Pete Lingard, Senior Ranger, Maria Island National Park; and both (3) Bernard Edwards, Ranger, and Scott Thornton, Field Officer, Bruny Island National Park. Finally, we express our sincere appreciation to the Plomley Foundation for awarding the research grant (to AWO) that supported the requisite field work. This work was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF), which is funded by the Ministry of Education, Science and Technology (2016R1D1A1B03930178). We, the authors, have no conflict of interest to declare.
REFERENCES Ashe JS. 1984. Generic revision of the subtribe Gyrophaenina (Coleoptera: Staphylinidae: Aleocharinae) with a review of the described subgenera and major features of evolution. Quaestiones Entomologicae 20, 129–349.
83
Bernhauer M & Scheerpeltz O. 1926. Staphylinidae VI. In: Coleopterorum Catalogus Pars 82 (eds W Junk & S Schenkling), pp. 499–988. W. Junk, Berlin. Blackburn T. 1888. Notes of Australian Coleoptera, with description of new species. Transactions and Proceedings and Report of the Royal Society of South Australia 10, 36–51. Dobler S & Farrell BD. 1999. Host use evolution in Chrysochus milkweed beetles: evidence from behaviour, population genetics and phylogeny. Molecular Ecology 8, 1297–1307. Dobler S & Müller JK. 2000. Resolving phylogeny at the family level by mitochondrial cytochrome oxidase sequences: phylogeny of carrion beetles (Coleoptera, Silphidae). Molecular Phylogenetics and Evolution 15, 390–402. Emerson BC, Oromí P & Hewitt GM. 1999. MtDNA phylogeography and recent intra-island diversification among Canary Island Calathus beetles. Molecular Phylogenetics and Evolution 13, 149–158. Frank JH & Ahn K-J. 2011. Coastal Staphylinidae (Coleoptera): a worldwide checklist, biogeography and natural history. ZooKeys 107, 1–98. Goloboff PA & Catalano SA. 2016. TNT version 1.5, including a full implementation of phylogenetic morphometrics. Cladistics 32, 221–238. Gravenhorst JLC. 1802. Coleoptera Microptera Brunsvicensia nec non exoticorum quotquot exstant in collectionibus entomologorum Brunsvicensium in genera familias et species distribuit. Carolus Reichard, Brunsuigae, lxvi + 206 pp. Hebert PD, Cywinska A & Ball SL. 2003. Biological identifications through DNA barcodes. Proceedings of the Royal Society of London B: Biological Sciences 270, 313–321. Jeon M-J, Song J-H & Ahn K-J. 2012. Molecular phylogeny of the marine littoral genus Cafius (Coleoptera: Staphylinidae: Staphylininae) and implications for classification. Zoologica Scripta 41, 150–159. Klimaszewski J. 1984. A revision of the genus Aleochara Gravenhorst of America north of Mexico (Coleoptera: Staphylinidae, Aleocharinae). Memoirs of the Entomological Society of Canada 116, 3–211. Kumar S, Stecher G & Tamura K. 2016. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33, 1870–1874. Lanfear R, Calcott B, Ho SY & Guindon S. 2012. PartitionFinder: combined selection of partitioning schemes and substitution models for phylogenetic analyses. Molecular Biology and Evolution 29, 1695–1701. Lunt DH, Zhang DX, Szymura JM & Hewltt OM. 1996. The insect cytochrome oxidase I gene: evolutionary patterns and conserved primers for phylogenetic studies. Insect Molecular Biology 5, 153–165. Maus C. 1998. Taxonomical contributions to the subgenus Coprochara Mulsant & Rey, 1874 of the genus Aleochara Gravenhorst, 1802. Koleopterologische Rundschau 68, 81–100. Maus C, Mittmann B & Peschke K. 1998. Host records of parasitoid Aleochara Gravenhorst species (Coleoptera, Staphylinidae) attacking puparia of cyclorrhapheous Diptera. Deutsche Entomologische Zeitschrift 45, 231–254. Maus C, Peschke K & Dobler S. 2001. Phylogeny of the genus Aleochara inferred from mitochondrial cytochrome oxidase sequences (Coleoptera: Staphylinidae). Molecular Phylogenetics and Evolution 2, 202–216. Miller MA, Pfeiffer W & Schwartz T. 2010. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In: Gateway Computing Environments Workshop (GCE), 2010, pp. 1–8. IEEE, New Orleans, LA. Ronquist F, Teslenko M, van der Mark P et al. 2012. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61, 539–542. Sawada K. 1972. Methodological researsh in the taxonomy of Aleocharinae. Contributions from the Biological Laboratory, Kyoto University 24, 31–59. Schooler NK, Dugan JE & Page HM. 2012. First host record for the parasitoid rove beetle Aleochara sulcicollis Mannerheim, 1843 (Coleoptera: Staphylinidae) on the intertidal kelp fly, Fucellia rufitibia Stein, 1910 (Diptera: Anthomyiidae). Coleopterists Bulletin 66, 315–318. Simon C, Frati F, Beckenbach A, Crespi B, Liu H & Flook P. 1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87, 651–701. Song J-H & Ahn K-J. 2013. Molecular phylogeny reveals multiple origins of seashore colonisation in the genus Aleochara Gravenhorst © 2017 Australian Entomological Society
84
J-H Song et al.
(Coleoptera: Staphylinidae: Aleocharinae). Invertebrate Systematics 27, 239–244. Song J-H & Ahn K-J. 2014. Species delimitation in the Aleochara fucicola species complex (Coleoptera: Staphylinidae: Aleocharinae) and its phylogenetic relationships. Zoologica Scripta 43, 629–640. Song J-H & Ahn K-J. 2017. Species trees, temporal divergence and historical biogeography of coastal rove beetles (Coleoptera: Staphylinidae) reveal their early Miocene origin and show that most divergence events occurred in the early Pliocene along the Pacific coasts. Cladistics. https://doi.org/10.1111/cla.12206
© 2017 Australian Entomological Society
Stamatakis A. 2014. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30, 1312–1313. Yamazaki K. 2008. Aleochara fucicola and A. trisulcata (Coleoptera, Staphylinidae) as parasitoids of a kelp fly, Fucellia apicalis (Diptera, Anthomyiidae). Elytra 36, 151–152. Yamazaki K. 2012. Seasonal changes in seaweed deposition, seaweed fly abundance, and parasitism at the pupal stage along sandy beaches in central Japan. Entomological Science 15, 28–34. Accepted for publication 31 July 2017.
