Physiological character and molecular mapping of leaf ... - Springer Link

Genes & Genomics (2010) 32: 123-128 DOI 10.1007/s13258-009-0794-y

RESEARCH ARTICLE

Physiological character and molecular mapping of leaf-color mutant wyv1 in rice (Oryza sativa L.) Xian-chun Sang · Li-kui Fang · Yuenyong Vanichpakorn · Ying-hua Ling · Peng Du · Fang-ming Zhao · Zheng-lin Yang · Guang-hua He 1)

Received: 2 August 2009 / Accepted: 8 January 2010 / Published online: 30 April 2010 © The Genetics Society of Korea and Springer 2010

Abstract The seed of an excellent indica restorer line Jinhui10 (Oryza sativa L. ssp. indica) was treated by ethyl methanesulfonate (EMS); a leaf-color mutant displaying distinct phenotype throughout development grown in paddy field was identified from the progeny. The mutant leaf showed white-yellow at seedling stage and then turned to yellow-green at tillering stage, after that, virescent color appeared until to maturity. The mutant was thus temporarily designed as wyv1. The chlorophyll contents decreased significantly and the changing was consistent with the chlorotic level of wyv1 leaves. Chlorophyll fluorescence kinetic parameters measured at the seedling stage showed that co-efficiency of photochemical quenching (qP), actual photosystem II efficiency (ΦPS II), electron transport rate (ETR) and initial chlorophyll fluorescence level (Fo), net photosynthetic rate (Pn) and maximum photochemical efficiency (Fv / Fm) significantly decreased in severe chlorotic leaf of the mutant compared with that of wild type. However, no significant differences were observed for Pn and Fv/Fm between virescent leaf and normal green leaf. Genetic analysis suggested that the mutant phenotype was controlled by a single recessive nuclear gene which was finally mapped between SSR marker Y7 and Y6 on rice chromosome 3 based on F2 population of Xinong1A / wyv1. Genetic distances were 0.06 cM and 0.03 cM respectively, and the physical distance was 84 kb according to the sequence of indica rice 9311. The results must facilitate map-based cloning and functional analysis of X. Sang and L. Fang contributed equally to this work. X. Sang · L. Fang · Y. Vanichpakorn · Y. Ling · P. Du · F. Zhao · Z. Yang · G. He ( ) Rice Research Institute, Key Laboratory of Biotechnology and Crop Quality Improvement of Ministry of Agriculture, College of Agronomy and Biotechnology, Southwest University, Chongqing 400716, P. R. China e-mail: [email protected]

WYV1 gene.

Keywords Chlorophyll deficient; Fine mapping; Rice (Oryza sativa L.); white-yellow-virescent 1 (wyv1)

Introduction Every year, up to 109 tons of chlorophyll is synthesized and degraded on our globe (Eckhardt et al., 2004). Chlorophyll is essential material responsible for harvesting solar energy in photosynthetic antenna systems, charging separation and electron transport within reaction centers (Ayumi and Ryouichi, 2006). As the strong photosensitizes, when present in excess, chlorophyll will generate reactive oxygen species (ROS) promoting growth retardation or cell death. Therefore, to maintain healthy growth, plants must finely control the entire chlorophyll metabolic process. Thus, the chlorophyll biosynthetic and degradative pathways are the most significant biochemical pathways known on the earth and have received much attention from physiologists and breeders (Liu et al., 2007). Leaf color mutants involving in chlorophyll deficiency are excellent materials in the research of chlorophyll biosynthesis and chloroplast development. Large number of such mutants have been identified in higher plants such as Arabidopsis (Hoeberichts et al., 2008), sunflower (Yue et al., 2009), sweetclover (Bevins et al., 1993), barley (Liu et al., 2008) and maize (Pasini et al., 2005). Recently, the chlorophyll metabolic pathway has been defined by identifying the major genes of the process in Arabidopsis (Beale, 2005). The preliminary information was also discovered about the mechanism governing the trafficking of chlorophyll metabolic intermediates in plant (Hörtensteiner, 2009). However, only few genes related to the process were cloned in rice up to now.

124

As an essential food crop and model monocot plant, at least 70 leaf-color mutants have been identified in rice (Kurata et al., 2005), of which, the color-revertible mutants are more important both in leaf-color marked breeding and in mechanical research. One gene mutation can affect leaf coloration viability by inhibiting chlorophyll biosynthesis and metabolism. Why and how the inhibition are reduced or relieved with the development? Abundant works are required and necessary for answering these questions. A green-revertible albino mutant gra(t), showing the albino in seedling stage and recovering at mature stage (Chen et al., 2007), was caused by one base substitution C to T in the coding region of Gra(t) gene encoding the chloroplast protein synthesis elongation factor Tu in the gra(t) mutant (Chen et al., 2009). However, the functional mode is still unknown. The v3 mutant was also green-revertible under field conditions; insufficient activity of ribonucleotide reductase (RNR) caused plastid DNA synthesis was preferentially arrested to allow nuclear genome replication in developing leaves and then led to mutational phenotype (Yoo et al., 2009). Genetic purity, a critical factor in yield-increasing, has been paid more and more attentions in hybrid rice production. Molecular marker can be used for identifying seed purity rapidly, but can’t be used for eliminating off-types from hybrid seed. Leaf-color marked plants showing distinct phenotype can be easily identified and removed, thus leaf-color became more suitable marker in keeping genetic purity of hybrid rice (He et al., 2006). Such varieties as “FENGHUAYOU No.2” have been bred and used for production in rice (Bao et al., 2006). A novel color-revertible mutant was discovered in our lab by treating an excellent restorer line Jinhui10 seed with EMS, which changed the phenotype from white-yellow into yellow green and then virescent during development under field conditions, temporarily designed as wyv1 (white yellow virescent leaf 1). This paper reported its physiological character and molecular mapping, and the results not only promote map-based cloning of WYV1 gene but also facilitate the application in hybrid rice production.

Genes & Genomics (2010) 32:123-128

male sterile line and Xinong1B is its maintainer, both show normal leaf color in the life under field conditions. Chlorophyll content measurement The target fresh leaf tissues were gathered and immersed into 80% acetone for 48 hrs, the product was then measured spectrophotometrically at 470 nm, 645 nm and 663 nm. Chlorophyll a (Chla), chlorophyll b (Chlb) and total chlorophyll were calculated following the description of Arnon (1949) and Wellburn (1994). Net photosynthetic rate (Pn) measurement At seedling stage, Pn was measured by a portable photosynthesis system (LiCor-6400; LiCor Inc. Lincoln, Nebraska, USA) at 8 : 30−10 : 00 a.m. in fine days. The targeted leaf was inserted into the chamber of LiCor-6400 and which was monitored until to steady state, each material repeated three times. Chlorophyll fluorescence kinetic parameters measurement Chlorophyll fluorescence kinetic parameters were also measured by the LiCor-6400 with fluorometer 6400-02 at 8 : 30−10 : 00 a.m in same fine days. The plants were firstly put into the darkness for twelve hours and then measured, after that, the plants were exposed into the sunlight for two hours, and the performance was conducted again. Each trial repeated three times. DNA isolation For the parents or ten F2 plants’ bulk, the modified CTAB method was used for isolating total genomic DNA (Murray and Thompson, 1980); for F2 single plant, the alkali-treated method was used to extract total genomic DNA for gene mapping (Sang et al., 2006). PCR analysis

Materials and Methods Plant materials Jinhui10 is an excellent restorer line bred in our institute, its seed was treated by EMS, and the wyv1 mutant was discovered in the progeny, which has inherited stably after four generations’ self-crossing. After that, the wyv1 was crossed with Xinong1B reciprocally for genetic analysis, and then crossed with Xinong1A for gene mapping. Xinong1A is a cytoplasmic

Total volume of PCR solution was 12.5 ㎕, containing 1.5 μL template, 1× PCR buffer, 1.5 mM MgCl2, 0.2 mM dNTPs, 1 μM primers, 0.5 U Taq DNA polymerase. PCR reaction system was as following: denaturizing at 94ﾟC for 3 min, followed by 35 cycles of 94ﾟC for 20 sec, 56ﾟC for 20 sec, 72ﾟC for 1 min, and with a final extension at 72ﾟC for 7 min. The PCR products were separated on 10% polyacrylamide gels. After that, the bandings were detected using rapid silver staining method. That is, the gel was firstly stained ten minutes by

Genes & Genomics (2010) 32:123-128

125

0.1% silver, washed twice by distilled water, each time 30 sec, and then emerged properly by 1.5% NaOH and 1% Formaldehyde. Linked primer selecting Linked primers were determined by bulked segregant analysis strategy (Michelmore et al., 1991; Yue et al., 2009). Data analysis The band-patterns of the Xinong1A and the wyv1 were recorded as A and B respectively, and H for the recombinants. Linkage analysis was conducted by Mapmaker / EXP 3.0 (Lander et al., 1987), and genetic distance (GD) was calculated by following formula: GD = (2A + H) / 2n, n was 1 in this study.

Results Characterization of the wyv1 mutant The wyv1 mutant exhibited a distinct phenotype throughout development under paddy field conditions in Chongqing city in P. R. China (106.5E, 29.5N). At the seedling stage, newly developed leaf showed virescent color, and the first fully elongated leaf displayed yellow or yellow-green in the mutant (Fig. 1). From elongating to heading stage, the wyv1 showed yellow green except for newly developed leaf, and then appeared virescent until to maturity. This was very interesting for the molecular studies of chloroplast development and chlorophyll metabolism. Chlorophyll content Compared with that of the wild type, the content of Chla and

Figure 2. Chlorophyll contents of wyv1 mutant during development. Chlorophyll contents were measured every fifteen days after the wyv1 was transplanted into paddy field in Chongqing in 2007. Date 1 represents 7 May, date 2 represents 22 May; date 3 represents 6 June; date 4 represents 21 June; date 5 represents 6 July; date 6 represents 21 July; date 7 represents 5 August; date 8 represents 20 August.

Chlb decreased significantly throughout the wyv1 development with the lowest values 0.20 mg and 0.22 mg of chlorophyll per gram of fresh tissues respectively at the seedling stage. Increased ratio of Chla/Chlb suggested that Chlb content declined more severely than Chla content in the wyv1 mutant (Fig. 2). These indicated that the wyv1 was a total chlorophyll deficient mutant and changed the chlorophyll contents with leaf development in the life. Pn and chlorophyll fluorescence kinetic parameters No significant difference was detected on the values of Pn and Fv / Fm on the newly developed leaf between the wyv1 and the wild type. However, significant differences were observed between the first fully developed leaf and newly developed leaf. Other parameters such as qP, ΦPSⅡ, ETR and Fo were all influenced significantly both for the new leaf with virescent color and the chlorotic leaf in the wyv1 mutant, and more severely for the chlorotic leaf (Table 1).

Table 1. Pn and Chlorophyll fluorescence kinetic parameters measured in seedling stage.

Figure 1. Phenotype of wyv1 and wild type (WT) under paddy field conditions.

Material

Pn

Fv / Fm

qP

ΦPS II

ETR

Fo

WT

26.9a

0.80a

0.67a

0.46a

0.79a

65.35a

wyv1 (1)

25.0a

0.78a

0.65b

0.34b

0.56c

47.73b

wyv1 (2)

22.4b

0.60b

0.60c

0.24c

0.38d

13.72c

Note: wyv1 (1) presents the newly developed leaf with virescent color; wyv1 (2) presents the fully elongated leaf with chlorotic color, which are exhibited in Figure 1 as 1 and 2 respectively.

126

Genes & Genomics (2010) 32:123-128

Table 2. Genetic analysis of wyv1 mutant 2

Cross combination

F1

F2 total plants

Wild type

mutant

χ (3 : 1)

Xinong1B / wyv1

normal

1118

847

271

0.34

wyv1 / Xinong1B

normal

978

731

247

0.03

Genetic analysis of the wyv1 mutant The reciprocal crosses F1 between Xinong1B and wyv1 showed normal green leaves throughout development. In the F2 populations, the segregating ratio of normal plant to mutational individuals have no significantly difference with 3 : 1, suggested that the mutant phenotype was controlled by a single recessive nuclear gene (Table 2).

in the F2 population), and then were predicted to be potentially linked with the WYV1 locus. This prediction was proved by genotypes identification of two hundreds and seventy-one F2 recessive individuals. The WYV1 locus was then primarily mapped between SSR markers RM3400 and RM487/RM5626 on chromosome 3 with genetic distances 1.1 cM and 0.7 cM/ 23.8 cM respectively (Fig. 3A). Among the restricted region, ten SSR markers were newly designed by SSRHunter (Li et al., 2005a), five showed the polymorphism (Table 3), and then the WYV1 gene was finally mapped between SSR marker Y7 and Y6 based on 1698 F2 recessive individuals from Xinong1A / wyv1 in this paper. The genetic distances were 0.06 cM and 0.03 cM respectively, and the physical distance was 84 Kb according to indica rice 9311 (Fig. 3).

Molecular mapping of the WYV1 gene

Discussion

Three hundreds and ninety SSR markers scattered on rice chromosomes with proportional spacing were used for primary mapping of WYV1 gene. Among them ninety showed polymorphisms between the wild type and the wyv1 mutant. RM5626, RM487 and RM3400 repeated the differences between two bulked DNA (each bulk contained equal amounts of DNA from ten wild type plants and ten mutational plants

The map-based gene cloning strategy, which has been wildly used in gene functional analysis, was more creditable and feasible. The sequenced genome, such as rice (IRGSP, 2005) fascinates its application. However, available mutants were limited. Chloroplast development and chlorophyll metabolism are more complex than have been anticipated; abundant and burdensome studies are needed to reveal their molecular

Figure 3. Molecular mapping of WYV1 gene on rice chromosome 3. (A) Primary molecular mapping. (B) Fine molecular mapping. (C) BAC clones containing WYV1 gene. (D) Physical distance according to indica rice 9311 (www.gramene.org). The number in the bracket presents quantity of recombinant individuals.

Genes & Genomics (2010) 32:123-128

127

Table 3. New SSR markers displaying polymorphisms between Xinong1A and wyv1. Marker RM15330 RM411 Y3 Y6 Y7

Forward primer CAGCTTGTGCCATCATCTCAA ACACCAACTCTTGCCTGCAT CCTAGCCCAATGCATATAAAC GCATAAACAATGTTCACGTTGT TACATGATGGCGTTGGTCCT

mechanisms. As an excellent material in such studies, leaf color mutants have been paid more and more attentions recently (Jung et al., 2003; Zhang et al., 2006; Wu et al., 2007), especially for color-revertible mutants due to more suitable for answering the defects of chloroplast development (Lo´pez-Juez, 2007). The virescent2 (v2) was temperature-sensitive and developed chlorotic leaves at the restrictive temperature. The V2 mutation causes inhibition of chloroplast differentiation; in particular, it disrupts the chloroplast translation machinery during early leaf development (Sugimoto et al., 2004). Recently, the V2 gene has been cloned and encodes a novel type of guanylate kinase targeted to plastids and mitochondria (Sugimoto et al., 2007). The virescent2 (v3) was also temperature-sensitive and the related gene encodes the large subunit of ribonucleotide reductase (RNR). A threshold activity of RNR is required for chloroplast biogenesis in developing leaves. The mutation of V3 leads to insufficient activity of RNR, plastid DNA synthesis is preferentially arrested to allow nuclear genome replication and then the plant showed chlorotic (Yoo et al., 2009). The wyv1 was partially color-revertible when cultivated in paddy field conditions, from white-yellow to yellow-green and then virescent. A process of decrease and increase in the chlorophyll contents appeared from May 22 to June 21 (Fig. 2), and now continuous lower temperature happened to appear in Chongqing city. Thus we presumed that the wyv1 maybe also temperature-sensitive and which has been proved by growth in the plant incubator in our lab (data not shown). The maximum photochemical efficiency is the key index in the assessment of photosystem II (PS II) activity, which shows the primary conversion efficiency of light energy on PS II (Li et al., 2005b). In wyv1 mutant, the significantly decreased Pn seems to be mainly restrited to the PSII activity, because Fv/Fm and Pn were not influenced in the virescent leaf, but influenced in the chlorotic leaf; at the same time, the values of qP, ΦPSⅡ, ETR and Fo also decreased significantly in the mutant than that in the wild type (Table. 1). WYV1 gene was finally mapped between SSR marker Y7 and Y6 on chromosome 3 with genetic distances 0.06 cM and 0.03 cM respectively, and the physical distance was only 84 Kb according to indica rice 9311. On this chromosome, many genes related with leaf colors have been reported, such as V1,

Reverse primer CTTCAGCCCACCCAGAAATG TGAAGCAAAAACATGGCTAGG GCGAACAAGTAATATGGCCT CCTTCCATAGGTATCCGTATGT GAGATGTGATGGCAGGCTCAT

V2, V5, V7, Al10, ST3, Z3, Z9 (http://www.gramene.org/), Chl1 and Chl9 (Zhang et al., 2006), Chl11 (Huang et al., 2007), and Ygl3 (Du et al., 2009). But these mutants have clearly different phenotype with the wyv1. At the same time, there were six genes annotated in this region according to www.gramene.org, none of which was characterized. All of these indicated that WYV1 was a novel gene and this research must accelerate its function analysis, especially for chlorophyll metabolism and chloroplast development in rice. Leaf-colors have been widely used to simply and effectively identify seed purity (Wu et al., 2003). Some marked varieties have been bred in China, and showed excellent advantage in production. For example, Baifeng A was a green-revertible albino CMS line (Shen et al., 2005); NHR4 was a restorer line with yellow-green leaf throughout development; Baifeng A was crossed with NHR4, and the hybrid rice cultivar ‘Fenghuayou No. 2’ with normal leaf color was bred (Bao et al., 2006). If ‘Fenghuayou No. 2’ is polluted by Baifeng A and NHR4, the off-types are easily eliminated due to its distinct phenotype. Many hybrid varieties have been obtained by crossing with Jinhui10 in China, such as “Xinongyou No. 1” (Jin23A/Jinhui10). The wyv1 came from Jinhui10, which must further promote its application in production. Acknowledgements

This study was supported by the National Natural Sciences Foundation of P. R. China (30800598), the Special Capital of Southwest University basic scientific research (XDJK 2009B019), the Excellent Youth Foundation Project of Chongqing (CSTC, 2008BA1033), and the New Century Project for Excellent Innovative Human of Education Ministry in P. R. China

References Arnon DI (1949) Copper enzymes in isolated chloroplasts. Polyphenoloxidase in Beta vulgaris. Plant Physiol. 24: 1-15. Ayumi T and Ryouichi T (2006) Chlorophyll metabolism. Curr. Opin. Plant Biol. 9: 248−255. Bao ZF, Liu XH, Shu XL, Shu QY, Xia YW and Wu DX (2006) High yielding hybrid rice cultivar ‘FENGHUAYOU No. 2’ breed from marker-labeled male sterile line. J. Nuclear Agricult. Sci. 20: 401−402. Beale SI (2005) Green genes gleaned. Trends Plant Sci. 10: 309−312. Bevins MA, Madhavan S and Markwell J (1993) Two Sweetclover (Melilotus alba Desr.) Mutants Temperature Sensitive for

128 Chlorophyll Expression. Plant Physiol. 103: 1123−1231. Chen T, Zhang YD, Zhao L, Zhu Z, Lin J, Zhang SB and Wang CL (2007) Physiological character and gene mapping in a new green-revertible albino mutant in rice. J. Genet. Genomics 34: 331−338. Chen T, Zhang YD, Zhao L, Zhu Z, Lin J, Zhang SB and Wang CL (2009) Fine mapping and candidate gene analysis of a green-revertible albino gene gra(t) in rice. J. Genet. Genomics 36: 117−123. Du P, Ling YH, Sang XC, Zhao FM, Xie R, Yang ZL and He GH (2009) Gene Mapping Related to Yellow Green Leaf in a Mutant Line in Rice. Genes Genomics 31: 165−171. Eckhardt U, Grimm B and Ho¨rtensteiner S (2004) Recent advances in chlorophyll biosynthesis and breakdown in higher plants. Plant Mol. Biol. 56: 1−14. He B, Liu LL, Zhang WW and Wan JM (2006) Plant Leaf Color Mutants. Plant Physiol. Comm. 42: 1−9. Hoeberichts FA, Vaeck E, Kiddle G, Coppens E, van de Cotte B, Adamantidis A, Ormenese S, Foyer CH, Zabeau M, Inzé D, et al. (2008) A Temperature-sensitive mutation in the Arabidopsis thaliana phosphomannomutase gene disrupts protein glycosylation and triggers cell death. J. Biol. Chem. 283: 5708−5718. Hörtensteiner S (2009) Stay-green regulates chlorophyll and chlorophyll-binding protein degradation during senescence. Trends Plant Sci. 14: 155−162. Huang XQ, Wang PR, Zhao HX and Deng XJ (2007) Genetic Analysis and Molecular Mapping of a Novel Chlorophyll Deficit Mutant Gene in Rice. Chinese J. Rice Sci. 21: 355−359. International Rice Genome Sequencing Project (IRGSP) (2005) The map-based sequence of the rice genome. Nature 346: 793−800. Jung KH, Hur JH, Ryu CH, Choi YJ, Chung YY, Miyao A, Hirochika H and An GH (2003) Characterization of a rice chlorophyll-deficient mutant using the T-DNA gene-trap system. Plant Cell Physiol. 44: 463−472. Kurata N, Miyoshi K, Nonomura KI, Yamazaki Y and Ito Y (2005) Rice mutants and genes related to organ development, morphogenesis and physiological traits. Plant Cell Physiol. 46: 48−62. Lander ES, Green P and Abrahamson J (1987) MAPMARKER: aninteractive computer for constructing primary genetics linkage maps of experimental and natural populations. Genetics 1: 174−182. Li Q and Wan JM (2005a) SSRHunter: development of a local searching software for SSR sites. Yi Chuan 27: 808−810. Li ZB, Wei YN, Zhang RH and Zhang XJ (2005b) Primary studies on chlorophyll fluorescence characteristics of cotton leaves at different leaf position. Cotton Sci. 17: 189−190. Liu WZ, Fu YP, Hu GC, Si HM, Zhu L, Wu C and Sun ZX (2007) Identification and fine mapping of a thermo-sensitive chlorophyll deficient mutant in rice (Oryza sativa L.). Planta 226: 785−795. Liu ZL, Yuan S, Liu WJ, Du JB, Tian WJ, Luo MH and Lin HH (2008) Mutation mechanism of chlorophyll-less barley mutant NYB. Photosynthetica 46: 73−78. Lo´pez-Juez E (2007) Plastid biogenesis, between light and shadows. J. Exp. Bot. 58: 11−26.

Genes & Genomics (2010) 32:123-128 Michelmore RW, Paran I and Kesseli RV (1991) Identification of markers linked to disease-resistance genes by bulked segregant analysis: a rapid method to detect markers in specific genomic regions by using segregating populations. Proc. Natl. Acad. Sci. USA 88: 9828−9832. Murray MG and Thompson WF (1980) Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8: 4321−4325. Pasini L, Bruschini S, Bertoli A, Mazza R, Fracheboud Y and Marocco A (2005) Photosynthetic performance of cold-sensitive mutants of maize at low temperature. Physiol. Plant 124: 362− 370. Sang XC, Yang ZL, Zhong BQ, Lin YF, Hou L, Pei Y, Li GY and He GH (2006) Assessment of purity of rice CMS lines using cpDNA marker. Euphytica 152: 177−183. Shen SQ, Shu QY, Wu DX, Chen SF and Xia YW (2005) Breeding of New Rice CMS Line Baifeng A with a Green2revertible Albino Leaf Color Marker. Hybrid Rice 20: 10−11. Sugimoto H, Kusumi K, Noguchi K, Yano M, Yoshimura A and Iba K (2007) The rice nuclear gene, VIRESCENT 2, is essential for chloroplast development and encodes a novel type of guanylate kinase targeted to plastids and mitochondria. Plant J. 52: 512− 527. Sugimoto H, Kusumi K, Tozawa Y, Yazaki J Kishimoto N, Kikuchi S and Iba K (2004) The virescent-2 mutation inhibits translation of plastid transcripts for the plastid genetic system at an early stage of chloroplast differentiation. Plant Cell Physiol. 45: 985− 996. Wellburn AR (1994) The spectral determination of chlorophyll a and b, as well as total carotenoids, using various solvents with spectrophotometers of different resolution. J. Plant Physiol. 144: 307− 313. Wu DX, Shen SQ, Cui HR, Xia YW and Shu QY (2003) A novel thermo/photoperiod-sensitive genic male-sterile(T/PGMS) rice mutant with green-revertible albino leaf color marker induced by gamma irradiation. Field Crops Res. 81: 141−147. Wu ZM, Zhang X, He B, Diao LP, Sheng SL, Wang JL, Guo XP, Su N, Wang LF, Jiang L, et al. (2007) A Chlorophyll-Deficient Rice Mutant with Impaired Chlorophyllide Esterification in Chlorophyll Biosynthesis. Plant Physiol. 145: 29−40. Yoo SC, Cho SH, Sugimoto H, Li JJ, Kusumi K, Koh HJ, Iba K and Paek N C (2009) Rice Virescent3 and Stripe1 Encoding the Large and Small Subunits of Ribonucleotide Reductase Are Required for Chloroplast Biogenesis during Early Leaf Development. Plant Physiol. 150: 388−401. Yue B, Cai XW, Vick B and Hu JG (2009) Genetic characterization and molecular mapping of a chlorophyll deficiency gene in sunflower (Helianthus annuus). J. Plant Physiol. 166: 44−651. Zhang HT, Li JJ, Yoo JH, Yoo SC, Cho SH, Koh HJ, Seo HS and Paek NC (2006) Rice Chlorina-1 and Chlorina-9 encode ChlD and ChlI subunits of Mg-chelatase, a key enzyme for chlorophyll synthesis and chloroplast development. Plant Mol. Biol. 62: 325− 337.