Piriformospora indica elicitation of withaferin A ...

Symbiosis DOI 10.1007/s13199-015-0364-9

Piriformospora indica elicitation of withaferin A biosynthesis and biomass accumulation in cell suspension cultures of Withania somnifera S. Ahlawat 1 & P. Saxena 1 & A. Ali 1 & M. Z. Abdin 1

Received: 18 May 2015 / Accepted: 23 November 2015 # Springer Science+Business Media Dordrecht 2015

Abstract Withania somnifera, is an important medicinal plant in India, also known as Ashwagandha, that contains the bioactive compounds- withanolides and withaferin A. The endophytic fungus Piriformospora indica has been shown to be an elicitor stimulating plant growth and metabolism. Different concentrations of cell homogenate, culture filtrate and individual culture discs of P. indica were added to cell suspension and callus cultures of W. somnifera at different time intervals (10, 15, 20, 25 and 5, 10, 15, 20 days respectively) to observe the effect on cell biomass and withaferin A production. Of all the concentrations of P. indica used to study the effect on withaferin A production in cell suspension cultures, the maximum enhancement was achieved with 3 % cell homogenate (2.04 times), followed by 3 % culture filtrate (1.78 times) and culture disc (1.46 times). Quantitative PCR analysis showed an effect of P. indica elicitation on the regulatory genes of MVA, MEP and withanolides biosynthetic pathways, viz. hmgr, fpps, ss, se, cas, dxs and dxr in callus and cell suspension cultures. The highest gene expression of 11.2, 8.7 and 6.9 times was observed with hmgr among all the expressed genes in cell suspension and callus cultures with 3 % cell homogenate, 3 % culture filtrate and disc respectively, in comparison with the controls.

Keywords W. somnifera . Withaferin A . Cell suspension cultures . Piriformospora indica . Ashwagandha

Abbreviations CAS Cycloaretenol synthase DW Dry weight DOXP Deoxy xylulose pathway DXS 1-deoxy-d-xylulose 5-phosphate synthase DXR 1-deoxy-d-xylulose 5-phosphate reductoisomerase FPPS FPP synthase HMGR 3-Hydroxy-3-methylglutaryl coenzyme A reductase HPLC High performance liquid chromatography MS Murashige and Skoog MVA Mevalonate pathway MEP Methyl erythritol pathway RRL Regional Research Laboratory qPCR quantitative polymerase chain reaction SE Squalene epoxidase SS Squalene synthase

1 Introduction Electronic supplementary material The online version of this article (doi:10.1007/s13199-015-0364-9) contains supplementary material, which is available to authorized users. * M. Z. Abdin [email protected] 1

Department of Biotechnology, Faculty of Science, Centre for Transgenic Plant Development, Jamia Hamdard, New Delhi 110062, India

In India, Withania somnifera, also known as Ashwagandha is one of the most extensively used medicinal plants in Ayurvedic and Unani medicines (Roja and Heble 1991). Because of low germination of seeds and excessive exploitation, it has become an endangered plant (Chaturvedi et al. 2007). The estimated production of Ashwagandha roots in India is approximately 1500 tonnes and the annual requirement is about 7000 tonnes necessitating an increase in its cultivation and higher production (Umadevi et al. 2012). Preparation of this plant have

S. Ahlawat et al.

antiinflammatory (Bhattacharya et al. 1997a), anticancer (Devi et al. 1992; Mohan et al. 2004), antistress and immunomodulatory (Ziauddin et al. 1996; Dhuley 1998; Archana and Namasivayam 1999; Rai et al. 2003), adaptogenic (Bhattacharya and Muruganandam 2003), central nervous system (Dhuley 2001; Jain et al. 2001; Chaudhary et al. 2003; Naidu et al. 2003; Ahmad et al. 2005), endocrine (Panda and Kar 1998) and cardiovascular (Mishra et al. 2000; Mohanty et al. 2004) activity. W. somnifera modulates the oxidative stress markers of the human body. The root extract reduces lipid peroxidation (Dhuley 1998) and increased superoxide dismutase (SOD) and catalase activity, thus possessing a free radical scavenging property (Panda and Kar 1997). In the Indian region, there are five morphotypes exhibiting variability in the roots (Atal and Schwarting 1962) as well in their chemistry and molecular composition (Negi et al. 2000, 2006; Dhar et al. 2006; Kumar et al. 2007). Cultivated and wild accessions were reported to differ in morphometric traits and withanolides markers (Kumar et al. 2007) as well as showing intra-specific variation (ITS) region of rDNA (Mir et al. 2010). Dhar et al. (2006) correlated withanolide markers with molecular (AFLP) markers in the different chemotypes of W. somnifera. Withanolides are present in roots and leaves of Withania somnifera and are ergostane type steroids, with atoms C-22 and C-26 bridged by d-lactone functionality and an oxidized C-1 position. These compounds are specific for the Solanaceae family, and in particular for the genus Withania (Bruneton 1999). Withasteroids are sub-divided according to their structural features as (a) compounds unsubstituted at C20, e.g. withaferin A; (b) compounds possessing a hydroxyl group at C-20 (20áF), e.g. withanolide D; (c) compounds in which the side chain is á-oriented at C-17, e.g. withanolide E (Kirson et al. 1971). Withanolides are commercially obtained by solvent extraction of roots and leaves of the plant. Low yield as well as a long maturation period (4–5 years) between seed planting and harvesting are major constrains in industrial production. A large variation in withaferin A content was found in plants growing in their natural habitat. The leaves of naturally occuring plants are reported to contain 0.192 % – 1.312 % withaferin A (Kumar et al. 2007; Mirjalili et al. 2009). Plant cell cultures are an alternative way for obtaining valuable plant metabolites (Verpoorte et al. 2002), although few commercial production systems presently exist. Cell cultures have a higher rate of metabolism than field-grown plants and a shorter biosynthetic cycle (Ramachandra Rao and Ravishankar 2002). Production of withanolide D, withaferin A and withanone have been reported in cell suspension, hairy root and shoot cultures (Roja and Heble 1991; Banerjee et al. 1994; Ray et al. 1996; Vitali et al. 1996; Furmanowa et al. 2001; Ray and Jha 2001; Sangwan et al. 2007; Murthy et al. 2008). Comparatively low yield of withaferin A were found in

cell suspension culture (Baldi et al. 2008a; Sabir et al. 2011). Addition of salacin at a concentration of 750 μM to the cultures in production medium enhanced levels of withaferin A to 25 ± 2.9 mg l−1 as compared to 0.47 ± 0.03 mg l−1 in unelicited controls (Ciddi 2006). Nagella and Murthy (2010, 2011) attempted to stimulate withaferin A production in cell suspension culture by using plant growth regulators (PGRs), macro, micro compositions, carbon sources, inoculum mass, media strength and type. The highest production of withanolide A content was recorded in the medium with 2.09 KNO3 (4.36 mg g −1 DW) and the greatest biomass [147.81 g l −1 fresh weight (FW) and 14.02 g l−1 (dry weight (DW)] in the medium containing a 0.59 concentration of NH4NO3. Secondary metabolite synthesis and accumulation in plant cell cultures can be stimulated by elicitors. Elicitors are signalling molecules which can enhance the formation of secondary metabolites in cell cultures by inducing plant defense, hypersensitive responses and/or pathogenesis related proteins (Zhao et al. 2005). Elicitors are of two types, biotic and abiotic. Among biotic elicitors, fungal elicitors have resulted in significant enhancement in the production of some phytochemicals in plant tissue cultures (Marero et al. 1997; Namdeo et al. 2002). Sivanandhan and his group investigated a variety of biotic and abiotic elicitors for the enhancement of major and minor withanolides production in shoots, adventitious roots and hairy root cultures of W. somnifera (Sivanandhan et al. 2012a, b; 2013a, b). On a dry weight basis, the maximum total withanolides detected [withanolide A (7606.75 mg), withanolide B (4826.05 mg), withaferin A (3732.81 mg), withanone (6538.65 mg), 12 deoxy withanstramonolide (3176.63 mg), withanoside IV (2623.21 mg) and withanoside V (2861.18 mg)] were achieved using a combined treatment of chitosan (100 mgl−1) and squalene (6 mM) alongwith 1 mgl−1 picloram, 0.5 mg l−1 KN, 200 mgl−1 L-glutamine and 5 % sucrose in culture at 4 h and 48 h exposure times respectively on 28th day of cell suspension culture of W. somnifera in bioreactor (Sivanandhan et al. 2014). Piriformospora indica is a fungus in a monotypic genus discovered from orchid plants in the Thar desert in Rajasthan, India. It forms a symbiosis with the roots of a wide variety of plants and was isolated from the rhizosphere of the woody shrubs Prosopis juliflora (Swartz) DC. and Zizyphus nummularia (Burm. fil.) Wt. & Arn. that grow in the sandy desert soils of Rajasthan, India (Varma et al. 1999). It has growth-promoting and secondary metabolite-enhancing activities in a range of medicinal and economically important plants (Verma et al. 1998, Varma et al. 1999, 2012; Rai et al. 2001; Malla et al. 2002; Franken 2012; Sharma and Agrawal 2013). To date, there have been no reports on the effect of P. indica on the cell growth and withaferin A production in callus or cell suspension culture of W. somnifera.

P. indica elicitation of cell suspension cultures of W. somnifera

The aim of the present study was to assess the elicitation capacity of the P. indica on callus and cell suspension cultures of W. somnifera and to analyze the phytochemical metabolic transitions accompanying the observed changes in expression.

2 Material and methods 2.1 Plant material The seeds of W. somnifera AGB002 (selected from wild populations in the Rajasthan region), obtained from RRL, Jammu, India, were washed in 1 % T-pol, surface sterilized with 70 % ethanol for 1 min and rinsed three times using sterile water. This was followed by soaking with 0.01 % w/v mercuric chloride for 2 min and washed again with sterile water for 4–5 times. For germination, sterilized seeds were then placed on MS medium (Murashige and Skoog 1962) containing 3 % sucrose and 1 % agar at 25 ± 1 °C under 16/8 h light/ dark regime. After seed germination, the seedlings were grown aseptically in a culture room for a period of 45 days prior to harvesting for explants. 2.2 Callus/cell suspension culture development and maintenance Leaves from 45 days old in vitro seedlings were used as the explant source for initiation of callus. Leaves were cut into small segments and aseptically cultured on MS medium supplemented with 1.5 mgl−1 2,4-dichlorophenoxyacetic acid (2, 4-D) in combination with 0.2 mgl−1kinetin (Kn) for callus induction and proliferation. All the cultures were maintained on the same composition of medium and subcultured every 3 weeks for 6 weeks in complete dark. The cell suspension cultures were initiated by culturing W. somnifera cells in 250-ml Erlenmeyer flasks each containing 50 ml MS (Murashige and Skoog 1962) medium supplemented with 30 g l −1 sucrose and 1.5 mg l−1 2,4-dichlorophenoxyacetic acid (2,4-D) and 0.5 mg l−1 kinetin (Kn) with an inoculum of 5 g l−1 on DW basis. The initial medium pH was adjusted to 5.8 ± 0.2 before autoclaving (15 lb. and 121 °C for 15 min), and the cultures were maintained under continuous agitation at 90 rpm in an orbital shaker and incubated at 25 ± 1 °C in the dark. The cells were subcultured every 25 days. 2.3 Effect of P. indica on withaferin A production The axenic fungal culture of Piriformospora indica was obtained from Dr. Ajit Varma, Amity University, U.P., India. P. indica cultures were maintained on Kaefer agar medium

(Kaefer 1977) supplemented with 15 g l−1 agar at pH 6.5 and 30 ± 1 °C. The effective co-culture depends on the preculture of the fungus. After the fungus had grown across the agar, 8 mm agar discs (covered with fully grown fungus) were punched out from the actively growing edges of the petri dish culture with a sterilized cork-borer and inoculated with callus culture on the surface of semisolid MS medium supplemented with 30 g l−1 sucrose and 7 g l−1 agar having 1.5 mg l−1 2,4-dichlorophenoxyacetic acid (2,4-D) and 0.5 mg l−1 kinetin (Kn). Inoculations were made on 10th, 15th, 20th and 25th day to the growing callus cultures of W. somnifera. Callus cultures were harvested on 30th day (Supplementary data 1) and analyzed for biomass and withaferin A content. For liquid culture of the fungus, discs were inoculated in 500 ml Erlenmeyer flasks containing 100 ml Kaefer medium without agar at 30 ± 1 °C on a gyratory shaker at 200 rpm for 5 days. After growth, the liquid culture was autoclaved at 15 lb. and 121 °C for 15 min. The autoclaved culture was filtered, and the filtrate was denoted as the culture filtrate. The cell residue (500 mg) was washed three times with sterile water and homogenized in a mortar and pestle with 20 ml sterile water under aseptic conditions. The volume was then made up to 50 ml with sterile water. This preparation was denoted as the cell homogenate. The cell homogenate and culture filtrate of P. indica were added at different concentrations (0.5, 1.0, 2.0, 3.0 and 5.0 % v/v) on 5th, 10th, 15th and 20th day to the growing cell suspension cultures of W. somnifera. Cell suspension cultures were harvested on 22nd day (Supplementary data 2) and analyzed for biomass and withaferin A content. Callus/Cell suspension cultures without any P. indica treatments were termed as control cultures. 2.4 Estimation of withaferin A The plant cell suspension cultures were separated from the media by passing them through a stainless steel sieve (pore size 450 μm), while callus cultures were lifted from the surface of semi solid medium and pooled together. The FW of the filtered cells was determined following washing with distilled water and blotting of excess surface water. Dry weight (DW) was recorded after drying cells at 60 °C until a constant weight was achieved. The extraction and HPLC analysis of withaferin A was carried out following the method of Ganzera et al. (2003). In brief, the cells were centrifuged (5 min at 3000 rpm), and then 100 mg of dried biomass was extracted with 2 ml methanol by sonication. The extracts were combined and diluted with an equal volume of methanol. The samples were then filtered through a 0.45 μm filter and subjected to the HPLC analysis. The withanolide fractions were analyzed using an HPLC system (Water Delta 600, USA) with

S. Ahlawat et al.

mobile phase (mixture of methanol and water, 60:40, v/v) at a flow rate of 1 ml min−1 and detector set at a wavelength of 230 nm. withaferin A mg l1

¼ withaferin A mg g1 as calculated by HPLC*biomass g l1

2.5 Isolation of total RNA and quantitative PCR analysis 2.5.1 Tissue preparation Three treatments [1 (cell suspension cultures with 3 % cell homogenate of P. indica), 2 (cell suspension cultures with 3 % culture filtrate of P. indica) and 3 (callus cultures with P. indica disc)] and C1, C2 (callus and cell suspension cultures respectively, without any treatment) were taken for gene expression studies. 2.5.2 RNA extraction Total RNA was extracted from 100 mg of treated and control callus and cell suspension cultures using RNeasy plant mini kit (Qiagen, USA) according to the manufacturer’s instructions. The RNA was treated with DNase I (Fermentas, St. Leo-Roth, Germany) to digest the genomic DNA. The genomic DNA contamination was checked by performing qualitative PCR using β-actin as housekeeping gene taking RNA as a template. 2.5.3 cDNA synthesis 2 μg isolated RNA was reverse transcribed using Long range reverse transcriptase (Qiagen) primed with 0.5 μg oligo (dT) 18 primer. The RNA was removed from the first strand cDNA by RNase treatment using RNase H (Qiagen) according to the manufacturer’s instructions. Isolated cDNA was used for further experiments. RNA and cDNA were quantified using Nanodrop 2000c spectrophotometer. Again endpoint PCR was done using primers for housekeeping gene (β-actin) to check the cDNA quality in terms of amplification. 2.5.4 Quantitative PCR (qPCR) Gene-specific primers were designed using Primer Quest software of Integrated DNA Technologies (http://www.idtdna. com/Primerquest/Home/Index) using default criterion of the software with amplified products ranging from 75 to 200 bp and Tm around 60 °C. Primer sequences used in the qRT-PCR analyses are presented in Table 1. The primers were further validated for unique amplicon using Primer-BLAST (http://

www.ncbi.nlm.nih.gov/tools/primer-blast/). Real time PCR was performed to check the quantitative expression of seven genes (hmgr, fpps, cas, ss, se, dxs and dxr) of withanolides biosynthetic pathway using gene specific primers (Table 1) and β-actin as the reference gene on a LC 480 qPCR equipment (Roche, India). Dye based chemistry was used for the study. cDNA was used as template (50 ng μl−1) in 20 μl reactions taking 10 μl Light cycler SYBR®Green I Master Mix (Roche) and 10 pmol of each primer (Sigma). The qPCR cycling was performed at 95 °C (10 min) for 1 cycle, 40 cycles at 95 °C (15 s), and annealing/extension at 60 °C (1 min). A melt curve analysis was done to check the primer dimer and other contamination at 95 °C (15 s), 60 °C (20 s) and 95 °C (15 s) for 40 cycles. Samples were run in triplicate using a no template control (NTC) in each of the assays. LC 480 SW1.5 analysis software was used for the cycle threshold (Cp) values. Relative expression analysis was done using ΔΔCT method. 2.5.5 Statistical analysis All experiments were conducted with three replicates. Statistical analysis was performed using one-way analysis of variance (ANOVA) followed by Duncan’s multiple range (DMRT) test. The values are mean ± SE for three samples in each group. P values equal to 0.05 were considered as significant.

3 Results and discussion 3.1 Effect of P. indica on biomass and withaferin A production P. indica discs were inoculated with the callus cultures on 10th, 15th, 20th and 25th day to the growing callus cultures of W. somnifera (Table 2) and harvested on 30th day. Irrespective of day of inoculation of P. indica discs, no significant effect on biomass was observed. A 1.46 times increase in withaferin A production (3.8 ± 0.16 mg l−1) was achieved in comparison to the control cultures (2.6 ± 0.11 mg l−1), when P. indica disc was inoculated on 15th day of cultivation. No effect of P. indica disc was observed on 25th day of inoculation (2.7 ± 0.14 mg l−1), while 1.11 and 1.19 times increase in withaferin A content (2.9 ± 0.13 and 3.1 ± 0.15 mg l−1) was achieved in comparison to the control cultures on 10th and 20th day of inoculation. Cell suspension cultures were inoculated with cell homogenate or culture filtrate on 5th, 10th, 15th and 20th day and harvested on 22nd day. The effect of addition of cell homogenate and culture filtrate on biomass and withaferin A production is summarized in Tables 3 and 4, respectively. The addition of cell homogenate of P. indica resulted in growth promoting effect on cell suspension cultures with 2 treatments.

P. indica elicitation of cell suspension cultures of W. somnifera Table 1

Oligonucleotide sequences of primer sets for pathway genes from W. somnifera

S. No.

Primer name

Primer sequence (5′-3′)

Primer size (bp)

Amplicon size (bp)

Accesion no.

1.

SE-F SE-R FPPS-F FPPS-R SS-F SS-R DXR-F DXR-R DXS-F DXS-R HMGR-F HMGR-R CAS-F CAS-R

TGGCTTAGGCCCTCGTCCAT CTGCCTAACTATTTCTGCCT TCGGAACTATCTGTTATTG CTCGGAGCTGTATGGGAGT AGACATGCAGAAGCAGAT TCACGAAGCTCAACAGGA CCCGTTTGTCCTTCCACTTG AAGTCCCTGAAAGCCCCTCA GCAGTTTCAGTTCCAGCA TTGGCGGTCTCTGTGTGT GTCGTTCCCCTTCCCCTAAA ATGAGGGAGAGAATAGCGGC GTCACTCTGAGGTTGCTTGG TTTCAGGAGGGAGTGGATTG

20

182

GU574803.1

19

176

HM855234.1

18

134

GU181386.1

20

161

JQ710679.1

18

118

JQ710678.1

20

169

HQ293119.1

20

192

HM037907.1

2. 3. 4. 5. 6. 7.

Cell suspension culture growth was significantly increased by 1.11 times (15.2 ± 0.56 g l−1) in comparison to control cultures (13.6 ± 0.49 g l−1), when cell homogenate of P. indica was added at a concentration of 3.0 % (v/v) on 15th day of cultivation. A non-significant enhancement of 1.10 times (14.1 ± 0.69 g l−1) was obtained in comparison to control cultures (12.8 ± 0.59 g l−1) on addition of culture filtrate at a concentration of 3.0 % (v/v) on 10th day of cultivation. Addition of cell homogenate of P. indica at 3.0 % (v/v) for an exposure time of 7 days resulted in significant withaferin A production (4.9 ± 0.23 mg l−1), while 4.1 ± 0.12 mg l−1 withaferin A was achieved by addition of culture filtrate under same conditions. On 15th day of addition of 3.0 % (v/v) P. indica, cell homogenate (2.04 times; Table 3) and culture filtrate (1.78 times; Table 4) showed greater elicitation potential for withaferin A in comparison to their control cultures, respectively. Enhancement of lignan was also found to be strongly dependent on the concentration of culture filtrate and the time of its addition. Incidentally, in hairy root cultures of Linum album an exposure time of 48 h and concentration of 3.0 % (v/v) were found to be optimum for significant

enhancement of lignan production irrespective of the biotic elicitor preparation added (Kumar et al. 2012). The biomass as well as withaferin A content was increased by elicitors derived from P. indica in the present study with in vitro W. somnifera cultures. A comparison of the effect of cell homogenate and culture filtrate on growth and withaferin A content of callus and cell suspension cultures of W. somnifera showed a similar pattern except for the degree of enhancement of growth and withaferin A content. Thus, it can be inferred that some component(s) of the cell homogenate was responsible and was probably intracellular (Kumar et al. 2012). The results from the elicitor dose that was smaller than the optimum suggests that the elicitor binding sites in cells are not fully occupied for the activation of biosynthesis of secondary metabolites. Excessive doses may cause a deleterious effect on the biosynthetic capacity of the cells. The optimal time of addition of an elicitor depends on the right combination of the growth phase during which it is added and the exposure time. This is because the growth phase influences the response to the elicitors well as the pattern of phytochemicals

Table 2 Final biomass (g l−1 DW ± SE) and withaferin A production (mg l−1 DW ± SE) of in vitro callus cultures of W. somnifera co-cultured with P. indica added on an nutrient agar disc at different days during a

30 day growth cycle. The values shown are for the callus obtained after 30 days in culture

Day of addition of P. indica

Control 10 15 20 25

Final callus Biomass at day 30 (DW g l−1 ± SE)

14.3 ± 0.44a 13.7 ± 0.64c 14.6 ± 0.58ab 14.4 ± 0.62ab 13.1 ± 0.65c

Withaferin A concentration (mg l−1) (mg g−1 DW)

(mg l−1)

0.18 ± 0.008 a 0.21 ± 0.01b 0.26 ± 0.01c 0.21 ± 0.01b 0.21 ± 0.009b

2.6 ± 0.11a 2.9 ± 0.13b 3.8 ± 0.16c 3.1 ± 0.15cd 2.7 ± 0.14ab

Data represent mean ± SE of three replicates. Values represent the mean ± standard error of three experiments. Mean values with common letters are not significantly different according to Duncan’s multiple range test at 5 % level

S. Ahlawat et al. Table 3 Final biomass (g l−1 DW ± SE) and withaferin A production (mg l−1 DW ± SE) of in vitro cell suspension cultures of W. somnifera after addition of cell homogenate of P. indica at different days during a Day of addition of CH of P. indica

22 day growth cycle. The values shown are for the cell suspension culture obtained after 22 days

Final Biomass of cell suspension cultures at day 22 (DW g l−1 ± SE)

Withaferin A concentration (mg g−1 DW)

(mg l−1)

Control Day of addition –5th

13.6 ± 0.49c

0.18 ± 0.009a

2.4 ± 0.12ab

0.5(% v/v) 1.0 “ 2.0 “ 3.0 “ 5.0 “ Day of addition – 10th

12.1 ± 0.54ab 14.2 ± 0.58c 11.9 ± 0.62a 13.7 ± 0.66c 12.8 ± 0.56b

0.18 ± 0.008a 0.17 ± 0.008a 0.22 ± 0.01b 0.19 ± 0.009ab 0.17 ± 0.008 a

2.2 ± 0.11a 2.4 ± 0.12b 2.6 ± 0.13c 2.6 ± 0.11c 2.2 ± 0.09a

12.6 ± 0.58ab 11.9 ± 0.61a 11.4 ± 0.59a 12.3 ± 0.62a 12.4 ± 0.46a

0.19 ± 0.009a 0.18 ± 0.008ab 0.20 ± 0.09b 0.19 ± 0.009ab 0.17 ± 0.008a

2.4 ± 0.11b 2.1 ± 0.09a 2.3 ± 0.12b 2.4 ± 0.11b 2.1 ± 0.08a

13.6 ± 0.55bc 11.9 ± 0.58a 14.3 ± 0.61cd 15.2 ± 0.56d 12.8 ± 0.42ab

0.19 ± 0.009a 0.26 ± 0.01b 0.23 ± 0.01b 0.32 ± 0.02c 0.17 ± 0.007a

2.6 ± 0.12ab 3.1 ± 0.15bc 3.3 ± 0.16c 4.9 ± 0.23d 2.2 ± 0.1a

13.4 ± 0.55b 13.9 ± 0.58b 11.3 ± 0.39a 12.1 ± 0.58a 13.9 ± 0.43b

0.18 ± 0.008a 0. 19 ± 0.01a 0.19 ± 0.009a 0.21 ± 0.01a 0.17 ± 0.008a

2.4 ± 0.11ab 2.6 ± 0.12b 2.1 ± 0.11a 2.5 ± 0.12b 2.4 ± 0.12ab

0.5(% v/v) 1.0 “ 2.0 “ 3.0 “ 5.0 “ Day of addition – 15th 0.5(% v/v) 1.0 “ 2.0 “ 3.0 “ 5.0 “ Day of addition – 20th 0.5(% v/v) 1.0 “ 2.0 “ 3.0 “ 5.0 “


production (Eilert 1987; Kumar et al. 2012). No increment in the growth of the cell suspension culture was observed upon addition of culture filtrate for a shorter period, i.e. 2 days or very long period, i.e. 17 days. The correct exposure time of an elicitor is an important factor for maximizing its elicitation potential (Rijhwani and Shanks 1998; Ketchum et al. 1999). The effect of dose of fungal elicitors on secondary metabolites biosynthesis was also observed for ajmalicine accumulation in Catharanthus roseus suspension cultures on exposure to different concentrations of fungal extracts of Trichoderma viride, Aspergillus niger and Fusarium moniliforme. A high dosage of elicitors has been reported to induce hypersensitive response leading to cell death in this plant (Namdeo et al. 2002). In the present study, the enhancement of withaferin A was found to be strongly dependent on the concentration of cell homogenate and the time of its addition. In cell suspension cultures of Linum album (Baldi et al. 2008b), an increment in

podophyllotoxin and 6-methoxypodophyllotoxin production by about four and eight fold, respectively, along with a 20 % increase in biomass by P. indica as compared to the control cultures was recorded. There is increasing evidence that plant defense pathways are co-regulated by symbiotic associations. Although an association was not established in the present study, it can be hypothesized that the plant growth promoting effect of P. indica, could be due to the activation of defense pathway in the plant cell cultures by the products of the fungal cells. The activation of plant defense pathways lead to the secretion of hydrolytic enzymes, which are believed to have a role in defense (Pozo et al. 2002; Kumar et al. 2012). Alternatively, the response may reflect altered levels of plant growth hormones that are known to act as long-distance signals (Murphy et al. 2000; Baldi et al. 2010).

P. indica elicitation of cell suspension cultures of W. somnifera Table 4 Final biomass (g l−1 DW ± SE) and withaferin A production (mg l−1 DW ± SE) of in vitro cell suspension cultures of W. somnifera after addition of culture filtrate of P. indica at different days during a 22 days growth cycle. The values shown are for cell suspension culture obtained after 22 days

Day of addition of CF of P. indica

Final Biomass of cell suspension cultures at day 22 (DW g l−1 ± SE)

Withaferin A concentration (mg l−1) mg g−1 (DW)

mg l−1

12.8 ± 0.59cd

0.18 ± 0.008a

2.3 ± 0.12ab

12.4 ± 0.47bc 11.3 ± 0.57a 13.3 ± 0.59d 11.9 ± 0.53ab

0.18 ± 0.009a 0.17 ± 0.007a 0.18 ± 0.008a 0.17 ± 0.009a

2.2 ± 0.11bcd 1.9 ± 0.09a 2.4 ± 0.11d 2.0 ± 0.1ab

5.0 “ Day of addition – 10th

12.1 ± 0.54abc

0.17 ± 0.007a

2.1 ± 0.1abc

0.5(% v/v) 1.0 “ 2.0 “ 3.0 “ 5.0 “ Day of addition – 15th 0.5(% v/v) 1.0 “ 2.0 “ 3.0 “ 5.0 “ Day of addition – 20th 0.5(% v/v) 1.0 “ 2.0 “ 3.0 “

11.7 ± 0.44a 12.6 ± 0.51ab 13.2 ± 0.62bc 14.1 ± 0.69c 12.8 ± 0.56b

0.17 ± 0.008a 0.18 ± 0.009a 0.18 ± 0.008a 0.19 ± 0.009a 0.18 ± 0.009a

2.0 ± 0.09a 2.3 ± 0.11ab 2.4 ± 0.11bc 2.7 ± 0.13c 2.3 ± 0.11ab

11.5 ± 0.49a 12.7 ± 0.53b 12.9 ± 0.56b 13.1 ± 0.63b 12.8 ± 0.42b

0.14 ± 0.007b 0.16 ± 0.008ab 0.18 ± 0.009a 0.31 ± 0.01b 0.17 ± 0.008a

1.6 ± 0.08a 2.0 ± 0.1ab 2.3 ± 0.11b 4.1 ± 0.12c 2.2 ± 0.09ab

12.3 ± 0.38a 12.5 ± 0.44ab 13.4 ± 0.51ab 13.4 ± 0.39b

0.13 ± 0.006ab 0.15 ± 0.007bc 0.16 ± 0.007bc 0.17 ± 0.008c

1.6 ± 0.07a 1.9 ± 0.09b 2.1 ± 0.10bc 2.3 ± 0.11c

14.6 ± 0.49c

0.11 ± 0.006a

1.6 ± 0.08a

Control Day of addition – 5th 0.5(% v/v) 1.0 “ 2.0 “ 3.0 “

5.0 “


3.2 Relative expression of MVA, MEP and withanolides biosynthetic genes influenced by P. indica Quantitative PCR was done to observe the effect of P. indica treatments on expression of MVA, MEP and withanolides biosynthetic genes. The expression profiles of 7 genes encoded enzymes (HMGR, CAS, FPPS, SS, SE, DXS and DXR) of MVA, MEP and withanolides biosyntheses and one reference transcript by qPCR were studied using primer pairs listed in Table 1. The expression of these genes is summarized in Figs. 1 and 2. Transcripts of all the genes studied could be detected in all treatments in various amounts using qPCR. In Fig. 1, expression levels in all the treatments were compared separately taking the cDNA from control callus and cell suspension culture (without any treatment) as the reference sample. The results show that all treatments [1 (cell suspension cultures with addition of 3 % cell homogenate of P. indica on 15th day for 7 days), 2 (cell suspension cultures

with addition of 3 % culture filtrate of P. indica on 15th day for 7 days) and 3 (callus cultures with P. indica disc on 15th day for 15 days)] led to increased expression of almost all the studied genes and also increased production of withaferin A. The results show that highest gene expression of 11.2, 8.7 and 6.9 times were observed with hmgr among all the expressed genes in cell suspension and callus cultures with 3 % cell homogenate, 3 % culture filtrate and disc respectively, in comparison to their respective controls. The relative expression of the ss gene was increased by 3.5 and 6.3 times with treatment 1 (3 % cell homogenate of P. indica) and treatment 2 (3 % culture filtrate of P. indica), respectively, while only a 1.9 times increase was observed by treatment 3 (P. indica disc). The expression of dxs was 2.3 and 2.1 times greater in treatment 2 and treatment 3, respectively, as compared to control. All the analyzed genes except dxs and fpps were up-regulated by treatment 1, whereas all the observed genes were upregulated by the treatment 2 and treatment 3. Random up/

S. Ahlawat et al.

cross-talk to a varying level (Chaurasiya et al. 2012). The increased expression of these genes may, lead to a greater expression of enzymes related to withanolides biosynthesis ultimately leading to more carbon supply into withanolides biosynthesis in the callus and cell suspension cultures. Finally, the real-time PCR results suggest that the withanolides biosynthesis pathway is favored in comparison with other competing pathways as indicated by the significant accumulation of enzyme transcripts in the in P. indica treated samples.

4 Conclusions

Fig. 1 Transcript abundance of the hmgr, ss, se, cas, fpps, dxs and dxr genes assayed by RT-PCR in comparison to control in cell suspension and callus cultures of W. somnifera treated by P. indica. 1 (cell suspension cultures with addition of 3 % cell homogenate of P. indica on 15th day for 7 days), 2 (cell suspension cultures with addition of 3 % culture filtrate of P. indica on 15th day for 7 days) and 3 (callus cultures with P. indica disc on 15th day for 15 days). Values are the means of three independent experiments ±SE. Letters indicate statistical differences at P = 0.05

down regulation of all the genes except hmgr was observed during real time PCR. Only hmgr gene expression pattern corresponds to withaferin A elicitation by P. indica treatments. W. somnifera has two independent biosynthetic pathways (MVA and DOXP) leading to the formation of IPP for withanolides production. HMGR is a rate-limiting enzyme of the mevalonate pathway (Schaller et al. 1995; MaujiRam et al. 2010) that supplies carbon precursors for withanolides biosynthesis. Both the MVA and DOXP (non-mevalonate/deoxy xylulose or MEP) pathways participate in the biosynthesis of the withanolides and plastidic activity and regulate this

Fig. 2 Withaferin A content (mg l−1) of cultured cells of W. somnifera used for Rt-PCR. C1, C2 and C3, cell suspension cultures and callus cultures without any P. indica treatment; Treatments [1 (cell suspension cultures with 3 % cell homogenate of P. indica on 15th day for 7 days), 2 (cell suspension cultures with 3 % culture filtrate of P. indica on 15th day for 7 days) and 3 (callus cultures with P. indica disc on 15th day for 15 days)]. Values are the means of three independent experiments ±SE

Cell suspension cultures of W. somnifera offer the potential for continuous production of withaferin A. The use of P. indica for the elicitation of cell suspension cultures of this medicinal plant could open the way for profitable in vitro secondary metabolite production. This is the first report an endophytic fungus enhancing the production of withaferin A in cultures of W. somnifera. Homogenised cultures of P. indica were found to be an effective elicitor for withaferin A production. The amount and timing of the elicitor treatment was critical for enhancement, The expression of genes coding for withanolides biosynthetic pathway enzymes were enhanced by the application of homogenised cell homogenate, culture filtrate and intact fungal cultures. Acknowledgments Seema Ahlawat is thankful to Department of Science and Technology, Government of India, for providing WoS-A Fellowship.

References Ahmad M, Saleem S, Ahmad AS, Ansari MA, Yousuf S, Hoda MN, et al. (2005) Neuroprotective effects of Withania somnifera on 6hydroxydopamine induced Parkinsonism in rats. Hum Exp Toxicol 24:137–147 Archana R, Namasivayam A (1999) Antistressor effect of Withania somnifera. J Ethnopharmacol 64:91–93 Atal CK, Schwarting AE (1962) Intraspecific variability in Withania somnifera. I. A preliminary survey. Llyodia 25:78–87 Baldi A, Singh D, Dixit VK (2008a) Dual elicitation for improved production of withaferin a by cell suspension cultures of Withania somnifera. Appl Biochem Biotechnol 151:556–564 Baldi A, Jain A, Gupta N, Srivastava AK, Bisaria VS (2008b) Co-culture of mycorrhiza-like fungi (Piriformospora indica and Sebacina vermifera) with plant cells of Linum album for enhanced production of podophyllotoxins: a first report. Biotechnol Lett 30:1671–1167 Baldi A, Farkya S, Jain A, Gupta N, Mehra R, Bisaria VS, et al. (2010) Enhanced production of podophyllotoxins by co-culture of transformed linum album cells with plant growth-promoting fungi. Pure Appl Chem 82(1):227–241 Banerjee S, Naqvi AA, Mandal S, Ahuja PS (1994) Transformation of Withania somnifera (L.) Dunal by Agrobacterium rhizogenes: infectivity and phytochemical studies. Phytother Res 8:452–455

P. indica elicitation of cell suspension cultures of W. somnifera Bhattacharya SK, Muruganandam AV (2003) Adaptogenic activity of Withania somnifera an experimentalstudy using a rat model of chronic stress. Pharmacol Biochem Behav 75:547–555 Bhattacharya SK, Satyan KS, Chakrabarti A (1997a) Effect of trasina, an ayurvedic herbal formulation, on pancreatic islet superoxide dismutase activity in hyperglycaemic rats. Indian J Exp Biol 35:297–299 Bruneton J (1999) Pharmacognosy, Phytochemistry, Medicinal plants. 2nd edn. Lavoisier, Paris. 464 Chaturvedi HC, Jain M, Kidwai NR (2007) Cloning of medicinal plants through tissue culture. J Exp Biol 45:937–948 Chaudhary G, Sharma U, Jagannathan NR, Gupta YK (2003) Evaluation of Withania somnifera in a middle cerebral artery occlusion model of stroke in rats. Clin Exp Pharmacol Physiol 30:399–404 Chaurasiya ND, Sangwan NS, Sabir F, Misra LN, Sangwan RS (2012) Withanolide biosynthesis recruits both mevalonate and DOXP pathways of isoprenogenesis in Ashwagandha Withania somnifera L. (Dunal). Plant Cell Rep. doi:10.1007/s00299-012-1302-4 Ciddi V (2006) Withaferin A from cell cultures of Withania somnifera. Indian J Pharm Sci 68:490–492 Devi PU, Sharada AC, Solomon FE, Kamath MS (1992) In vivo growth inhibitory effect of Withania somnifera (Ashwagandha) on a transplantable mouse tumor Sarcoma 180. Indian J Exp Biol 30:169–172 Dhar RS, Verma V, Suri KA, Sangwan RS, Satti NK, Qazi GN, et al. (2006) Phytochemical and genetic analysis in selected chemotypes of Withania somnifera. Phytochem 67:2269–2276 Dhuley JN (1998) Effect of ashwagandha on lipid peroxidation in stressinduced animals. J Ethnopharmacol 60:173–178 Dhuley JN (2001) Nootropic-like effect of ashwagandha (Withania somnifera L) in mice. Phytother Res 15:524–528 Eilert U (1987) Elicitation: methodology and aspects of application. In: Constabel F, Vasil I (eds) Cell culture and somatic cell genetics of plants. Academic Press, San Diego, pp. 153–196 Franken P (2012) The plant strengthening root endophyte Piriformospora indica: potential application and the biology behind. Appl Microbiol Biotechnol 96:1455–1464 Furmanowa M, Gajdzis-Kuls D, Ruszkowska J, Czarnocki Z, Obidoska G, Upadhyay SN, et al. (2001) In vitro propagation of Withania somnifera and isolation of withanolides with immunosuppressive activity. Planta Med 67:146–149 Ganzera M, Choudhary MI, Khan IA (2003) Quantitative HPLC analysis of withanolides in Withania somnifera. Fitoterapia 74:68–76 Jain S, Shukla SD, Sharma K, et al. (2001) Neuroprotective effects of Withania somnifera Dunn in hippocampal sub-regions of female albino rat. Phytother Res 15:544–548 Kaefer E (1977) Meiotic and mitotic recombination in Aspergillus and its chromosomal aberrations. Adv Genet 19:33–131 Ketchum REB, Gibson DM, Croteau RB, Shuler ML (1999) The kinetics of taxoid accumulation in cell suspension culture of taxus following elicitation with methyl jasmonate. Biotechnol Bioeng 62:97–105 Kirson I, Glotter E, Lavie D, Abraham A (1971) Constituents of Withania somnifera Dun part XII the withanolides of an Indian chemotype. J Chem Soc C:Org 2032–2044 Kumar A, Kaul MK, Bhan MK, Khanna P, Suri KA (2007) Morphological and chemical variation in 25 collections of the Indian medicinal plant, Withania somnifera (L.) Dunal (Solanaceae). Genet Resour Crop Evol 54:655–660 Kumar V, Rajauria G, Sahai V, Bisaria VS (2012) Culture filtrate of root endophytic fungus Piriformospora indica promotes the growth and lignan production of Linum album hairy root cultures. Process Biochem 47:901–907 Malla R, Singh A, Zeyaullah MD, Yadav V, Verma A, Varma A, Rai M (2002) Piriformospora indica and plant growth promoting rhizobacteria: an appraisal. In: Rao GP, Manoharchari C, Bhat DJ, Rajak RC, Lakhanpal TN (eds) Frontiers of fungal diversity in India. International Book Distributing Co, Lucknow, pp. 401–419

Marero LM, Jin JH, Shin JH, Lee HJ, Chung IS, Lee HJ (1997) Effect of fungal elicitation on indirubin production from a suspension culture of Polygonum tinctorium. Enzym Microb Technol 21:97–101 MaujiRam KMA, Jha P, Khan S, Kiran U, Abdin MZ, et al. (2010) HMGCoA reductase limits artemisinin biosynthesis and accumulation in Artemisia annua L. plants. Acta Physiol Plant 32:859–866 Mir BA, Koul S, Kumar A, Kaul MK, Soodan AS, Raina SN (2010) Intraspecific variation in the internal transcribed spacer (ITS) regions of rDNA in Withania somnifera (L.) Dunal. Indian J Biotechnol 9:325–328 Mirjalili MH, Fakhr-Tabatabaei SM, Alizadeh H, Ghassempour A, Mirzajani F (2009) Genetic and withaferin A analysis of Iranian natural populations of withania somnifera and W. coagulans by RAPD and HPTLC. Nat Prod Commun 4:337–346 Mishra LC, Singh BB, Dagenais S (2000) Scientific basis for the therapeutic use of Withania somnifera (ashwagandha) a review. Altern Med Rev 5:334–346 Mohan R, Hammers HJ, Bargagna-Mohan P, Zhan XH, Herbstritt CJ, Ruiz A, et al. (2004) Withaferin a is a potent inhibitor of angiogenesis. Angiogenesis 7:115–122 Mohanty I, Arya DS, Dinda A, Talwar KK, Joshi S, Gupta SK (2004) Mechanisms of cardioprotective effect of Withania somnifera in experimentally induced myocardial infarction. Basic Clin Pharmacol Toxicol 94:184–190 Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Plant Physiol 15:473–497 Murphy JG, Rafferty SM, Cassells AC (2000) Stimulation of wild strawberry (Fragaria vesca) arbuscular mycorrhizas by addition of shellfish waste to the growth substrate: interaction between mycorrhization, substrate amendment and susceptibility to red core (Phytophthora fragariae). Appl Soil Ecol 15:153–158 Murthy HN, Dijkstra C, Anthony P, White DA, Davey MR, Paek KY, et al. (2008) Establishment of Withania somnifera hairy root cultures for the production of withanolide a. J Int Plant Biol 50:975–981 Nagella P, Murthy HN (2010) Establishment of cell suspension cultures of Withania somnifera for the production of withanolide a. Bioresour Technol 101:6735–6739 Nagella P, Murthy HN (2011) Effects of macroelements and nitrogen source on biomass accumulation and withanolide-a production from cell suspension cultures of Withania somnifera (L.) Dunal. Plant Cell Tissue Organ Cult 104:119–124 Naidu PS, Singh A, Kulkarni SK (2003) Effect of Withania somnifera root extract on haloperidol-induced orofacial dyskinesia possible mechanisms of action. J Med Food 6:107–114 Namdeo A, Patil S, Fulzele DP (2002) Influence of fungal elicitors on production of ajmalicine by cell cultures of Catharanthus roseus. Biotechnol Prog 18:159–162 Negi MS, Singh A, Lakshmikumaran M (2000) Genetic variation and relationship among and within Withania species as revealed by AFLP markers. Genome 43:975–980 Negi MS, Sabharwal V, Wilson N, Lakshmikumaran MS (2006) Comparative analysis of the efficiency of SAMPL and AFLP in assessing genetic relationships among Withania somnifera genotypes. Curr Sci 91:464–471 Panda S, Kar A (1997) Evidence for free radical scavenging activity of Ashwagandha root powder in mice. Indian J Physiol Pharmacol 41: 424–426 Panda S, Kar A (1998) Changes in thyroid hormone concentrations after administration of ashwagandha root extract to adult male mice. J Pharm Pharmacol 50:1065–1068 Pozo M, Cordier C, Dumas-Gautod E, Gianinazzi SJ, Barea JM, AzconAguilar C (2002) Localized versus systemic effect of arbuscular mycorrhizal fungi on defence responses to Phytophthora infection in tomato plants. J Exp Bot 53:525–534 Rai M, Acharya D, Singh A, Varma A (2001) Positive growth responses of the medicinal plants Spilanthes calva and Withania somnifera to

S. Ahlawat et al. inoculation by Piriformospora indica in a field trial. Mycorrhiza 11: 123–128 Rai D, Bhatia G, Sen T, Palit G (2003) Anti-stress effects of Ginkgo biloba and Panax ginseng a comparative study. J Pharmacol Sci 93:458–464 Ramachandra Rao S, Ravishankar GA (2002) Plant cell cultures:chemical factories of secondary metabolites. Biotechnol Adv 20:10–153 Ray S, Jha S (2001) Production of withaferin a in shoot cultures of Withania somnifera Dunal. Planta Med 67:432–437 Ray S, Ghosh B, Se S (1996) Withanolide production by root cultures of Withania somnifera transformed with Agrobacterium rhizogens. Planta Med 62:571–573 Rijhwani S, Shanks JV (1998) Effect of elicitor dosage and exposure time on biosynthesis of indole alkaloids by Catharanthus roseus hairy root cultures. Biotechnol Prog 14:442–449 Roja G, Heble MR (1991) Tissue cultures of Withania somnifera: morphogenesis and withanolide synthesis. Phytother Res 5:185–187 Sabir F, Sangwan RS, Singh J, Misra LN, Pathak N, Sangwan NS (2011) Biotransformation of withanolides by cell suspension cultures of Withania somnifera (Dunal). Plant Biotech Rep 5:127–134 Sangwan RS, Chaurasiya NS, Lal P, Misra L, Uniyal GC, Tuli R, Sangwan NS (2007) Withanolide a biogeneration in in vitro shoot cultures of ashwagandha (Withania somnifera Dunal), a main medicinal plant in Ayurveda. Chem Pharm Bull 55:1371–1375 Schaller H, Grausem B, Benveniste P, Chye ML, Tan CT, et al. (1995) Expression of the Hevea brasiliensis (H.B.K.) müll. Arg. 3hydroxy-3-methylglutaryl coenzyme a reductase 1 in tobacco results in sterol overproduction. Plant Physiol 109:761–770 Sharma G, Agrawal V (2013) Marked enhancement in the artemisinin content and biomass productivity in Artemisia annua L. shoots cocultivated with Piriformospora indica. World J Microbiol Biotechnol 29:1133–1138 Sivanandhan G, Arun M, Mayavan S, Rajesh M, Mariashibu TS, et al. (2012a) Chitosan enhances withanolides production in adventitious root cultures of Withania somnifera (L.) Dunal. Ind Crop Prod 37: 124–129 Sivanandhan G, Arun M, Mayavan S, Rajesh M, Jeyaraj M, et al. (2012b) Optimization of elicitation conditions with methyl jasmonate and salicylic acid to improve the productivity of withanolides in the

adventitious root culture of Withania somnifera (L.) Dunal. Appl Biochem Biotechnol 168:681–696 Sivanandhan G, Kapil Dev G, Jeyaraj M, Rajesh M, Muthuselvam M, et al. (2013a) A promising approach on biomass accumulation and withanolides production in cell suspension culture of Withania somnifera (L.) Dunal. Protoplasma 250:885–898 Sivanandhan G, Kapil Dev G, Jeyaraj M, Rajesh M, Manickavasagam M, et al. (2013b) Increased production of withanolide a, withanone and withaferin a in hairy root cultures of Withania somnifera (L.) Dunal elicited with methyl jasmonate and salicylic acid. Plant Cell Tissue Organ Cult 114:121–129 Sivanandhan G, Selvaraj N, Ganapathi A, Manickavasagam M (2014) Enhanced biosynthesis of withanolides by elicitation and precursor feeding in cell suspension culture of Withania somnifera (L.) Dunal in shake-flask culture and bioreactor. PLoS One 9:104005 Umadevi M, Rajeswari R, Sharmila Rahale C, Selvavenkadesh S, Pushpa R, Bhowmik D (2012) et al Traditional and medicinal uses of Withania somnifera. The Pharma Innovation 1:102–110 Varma A, Sudha S, Franken P (1999) Piriformospora indica- a cultivable plant growth promoting root endophyte with similarities to arbuscular mycorrhizal fungi. Appl Environ Microbiol 65:2741– 2744 Varma A, Bakshi M, Lou B, Hartmann A, Oelmueller R (2012) Piriformospora indica: a novel plant growth promoting mycorrhizal fungus. Agric Res 1:117–131 Verma S, Varma A, Rexer KH, Kost G, Sarbhoy A, Bisen P, Butehorn B, Franken P (1998) Piriformospora indica, gen. nov. sp. nov., a new root-colonizing fungus. Mycologia 95:896–903 Verpoorte R, Contin A, Memelink J (2002) Biotechnology for the production of plant secondary metabolites. Phytochem Rev 1: 13–25 Vitali G, Conte L, Nicoletti M (1996) Withanolide composition and in vitro culture of Italian Withania somnifera. Planta Med 62:287–288 Zhao J, Davis LC, Verpoorte R (2005) Elicitor signal transduction leading to production of plant secondary metabolites. Biotechnol Adv 23: 283–333 Ziauddin M, Phansalkar N, Patki P, Diwanay S, Patwardhan B (1996) Studies on the immunomodulatory effects of Ashwagandha. J Ethnopharmacol 50:69–76