Plasma Membrane Expression of T-type Calcium Channel 1 Subunits ...

THE JOURNAL OF BIOLOGICAL CHEMISTRY © 2004 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 279, No. 28, Issue of July 9, pp. 29263–29269, 2004 Printed in U.S.A.

Plasma Membrane Expression of T-type Calcium Channel ␣1 Subunits Is Modulated by High Voltage-activated Auxiliary Subunits* Received for publication, December 9, 2003, and in revised form, April 7, 2004 Published, JBC Papers in Press, April 27, 2004, DOI 10.1074/jbc.M313450200

Stefan J. Dubel‡§, Christophe Altier‡, Se´verine Chaumont‡, Philippe Lory‡, Emmanuel Bourinet‡, and Joe¨l Nargeot‡¶ From the ‡De´partement de Physiologie, Laboratoire de Geńomique Fonctionnelle, CNRS-Unite´ Propre de Recherche 2580, 34396 Montpellier, France

It has been suggested that the auxiliary subunits of high voltage-activated (HVA) calcium channels modulate T-type, low voltage-activated (LVA) calcium channels. Such a regulation has yet to be documented, especially because there has been no biochemical characterization of T-channels. To monitor total protein levels and plasma membrane expression of T-channels in living cells, external epitopes (hemagglutinin, FLAG) were introduced into human recombinant CaV3 channels that were also N-terminally fused to green fluorescent protein. Utilizing Western blot techniques, fluorescence flow cytometry, immunofluorescence, luminometry, and electrophysiology, we describe here that ␤1b and ␣2-␦1 subunits enhance the level of CaV3 proteins as well as their plasma membrane expression in various expression systems. We also report that, in both Xenopus oocytes and mammalian cells, the ␣2-␦1 and ␤1b subunits increase by at least 2-fold the current density of CaV3 channels with no change in the electrophysiological properties. Altogether, these data indicate that HVA auxiliary subunits modulate CaV3 channel surface expression, suggesting that the membrane targeting of HVA and LVA ␣1 subunits is regulated dynamically through the expression of a common set of regulatory subunits.

For a wide majority of ion channel classes with the exception of T-type, low voltage-activated (LVA)1 calcium channels, it has been demonstrated that channel complexes contain auxiliary subunits that participate in the regulation of the biophysical properties and/or the membrane targeting of the pore subunits. Indeed, high voltage-activated (HVA) calcium channel complexes include a core of auxiliary subunits, ␣2/␦, ␤, and ␥ * This work was supported in part by CNRS and grants from the Institut UPSA de la Douleur, the Paul Hamel foundation, the Association Française contre les Myopathies (AFM), and the Association pour la Recherche sur le Cancer (ARC). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. § Supported by a fellowship from the Region Languedoc-Roussillon. ¶ To whom correspondence should be addressed: De´pt. de Physiologie, Laboratoire de Geńomique Fonctionnelle, CNRS-Unite´ Propre de Recherche 2580, 141 rue de la Cardonille, 34396 Montpellier Cedex 01, France. Tel.: 33-4-99-61-99-67; Fax: 33-4-99-61-99-01; E-mail: joel. [email protected]. 1 The abbreviations used are: LVA, low voltage-activated; HVA, high voltage-activated; GFP, green fluorescent protein; PBS, phosphate-buffered saline; HA, hemagglutinin; HEK, human embryonic kidney; CHO, Chinese hamster ovary; Cav3, voltage-dependent calcium channel of the T-type channel family. This paper is available on line at http://www.jbc.org

subunits, that regulate biophysical, pharmacological, and biochemical properties of the pore-forming ␣1 subunit. By contrast, with the HVA calcium channels that function at best as multimeric complexes, the recombinant CaV3 subunits express by themselves as typical T-type, LVA calcium channels in a variety of heterologous expression systems (1–5). To date, no auxiliary subunit, which would associate to T-type channels and modulate their trafficking or surface expression, has been identified. However, a few studies have suggested that ␣2-␦, ␤, or ␥2 subunits might modulate CaV3 channels (6), but this description remains controversial because there are several other studies reporting no effects (7). In recent years, it has been proven useful to monitor protein expression, subcellular localization, protein-protein interactions, and temporal/spatial imaging using fusion with highly specific epitope tags as well as fluorescent proteins (for review see Ref. 8). More specifically, the construction of externally epitope-tagged ion channels has emerged as a powerful means of monitoring surface expression in a variety of cell systems. This technique has been applied to the study of the cystic fibrosis transmembrane regulator (9, 10), Kir2.1 (11), KATP (12), CIC-1 (13), NaV1.5 (14), and most recently, in the study of CaV1.2 trafficking (15). Here, we describe the construction of an equivalent set of tools for the study of CaV3 T-type channel expression. These tagged channels preserve their electrophysiological hallmarks and can be detected and assayed by various immunotechniques. Therefore, by directly measuring plasma membrane expression of CaV3-tagged channels, we demonstrate that both ␣2-␦1 subunit and ␤1 subunit can modulate the cell surface expression of T-type channels in various heterologous expression systems. EXPERIMENTAL PROCEDURES

Recombinant cDNAs Used in Experiments—The following cDNA sequences inserted into expression vectors have been used followed by the GenBankTM accession numbers: ␤1b, NM017346; ␣2-␦1, AF286488; CaV3.1b, AF126965; CaV3.2, NM021098; and CaV3.3, AF211189. The FLAG-NaV1.5 was a kind gift from Dr. Mohamed Chanine (Laval University). It is tagged with a single FLAG epitope in the extracellular loop, SS1-SS2, of domain I (14). The HA-Kir2.1 construct was a kind gift of Dr. Caroline Dart. Construction of CaV3.1-GFP—Using PCR mutagenesis, a unique BssHII/EcoRI site was introduced into the 5⬘ end of CaV3.1b and the removal of the start codon was achieved with the following primers: forward, 5⬘-GCTGCGCGCGAATTCTGACGAGGAGGAGGATGG-3⬘, and reverse, 5⬘-GTCTCCAGCAGCTTGTG-3⬘. This modified BssHII/ SpeI fragment was subcloned back into the original CaV3.1b construct using the BssHII/SpeI sites. Subsequently, the EcoRI/KpnI fragment comprising the entire coding region of CaV3.1b was cloned of into pEGFP-C1 (Clontech). Finally, this CaV3.1b-GFP construct was checked by sequencing. It was expressed in TSA201 cells and found to be electrophysiologically similar to CaV3.1b.

29263

29264

␣2-␦1 and ␤ Subunit Production of T-type Calcium Channels

Construction of CaV3.2-HA and CaV3.2-GFP—A unique SbfI site was introduced into the extracellular SS1-SS2 loop of domain I of the CaV3.2 cDNA by overlapping PCR strategy at position 972 bp to insert a HA epitope. The two oligonucleotide pairs used to introduce the SbfI site were as follows H-SbfI-F1 (5⬘-CTGGCCCTGCGGCGTTGGTG-3⬘) and H-Sbf-R1 (5⬘-GCCTGCAGGTTGCGTGTAGGCCTC-3⬘); and H-SbfI-F2 (5⬘-TACACGCACCTGCAGGCCGAGGG-3⬘) and H-SbfI-R2 (5⬘-TGGGGAAGGTGGCGAGGGGG-3⬘). The PCR products were gel-purified (Qiagen gel purification kit), and equimolar concentrations were used to perform a PCR on the 1.7-kb fragment using H-SbfI-F1 and H-SbfI-R2 primers. This product was subcloned into pcDNA3.1/V5-His Topo TAcloning vector (Invitrogen) following the manufacturer’s protocol. Complementary oligonucleotides encoding the HA epitope flanked with extra amino acids to enlarge the loop (SbfI-HA-F, 5⬘-GGAACCACTATCCATATGACGTTCCGGACTACGCAGTCACGTTCGTCGACCTGCA3⬘, and SbfI-HA-R, 5⬘-GGTCGACGAACGTGACTGCGTAGTCCGGAACGTCATATGGATAGTGTTCCTGCA-3⬘) were annealed to form SbfI adaptors and ligated into the SbfI site. A single clone, the CaV3.2-HA clone, was digested with AscI, and the 1.65-kb fragment was subcloned into CaV3.2-GFP. Each step of this procedure was confirmed by sequencing. The CaV3.2-GFP clone was generated as follows. The CaV3.2 pcDNA3 clone was modified by PCR mutagenesis to introduce an XhoI restriction site in its 5⬘ end (5⬘-CTCGAGCCATGACCGAGGG-3⬘) and a reverse oligonucleotide (5⬘-CAGTTGAGCATGATTACCAGCATG-3⬘). This fragment was subcloned into pcDNA3.1/V5-His Topo TA, sequenced, and further subcloned into the XhoI/NotI sites of pEGFP-C1 (Clontech), generating pEGFPC1G1. Subsequently, a NotI/KpnI fragment (⬃7 kb) excised from the CaV3.2-pcDNA3 construct was subcloned into the NotI/KpnI-cut pEGFPC1G1 construct. The amino acid sequence of the HA-tagged CaV3.2-GFP construct reads EHYPYDVPDYAVTFVD with the boldface letters corresponding to the HA epitope. Construction CaV3.3-HA, CaV3.3– 4⫻ FLAG, and CaV3.3-GFPHA—The CaV3.3 cDNA sequence (originally subcloned into pBK-CMV) contains a unique SbfI site in the SS1-SS2 loop of domain I. The clone was digested with SbfI and dephosphorylated, and subsequently, the same oligonucleotide pair as used for the construction of CaV3.3-HA (see above for the oligonucleotide sequence) was ligated into the SbfI site. To generate FLAG-tagged CaV3.3 clones, complementary oligonucleotides (phosphorylated) encoding the FLAG epitope were annealed to form SbfI adaptors and ligated into the SbfI site using the following primers: I-FlagF, 5⬘-GGACTATAAAGACGATGACGACAAGGCGATCGACCTCCA-3⬘, and FlagR, GGTCGATCGCCTTGTCGTCATCGTCTTTATAGTCCTGCA-3⬘. The boldface letters indicate PvuI sites that were introduced in order to identify clones with the modified sequence. Restriction digests using PvuI and sequencing were performed to confirm the presence of FLAG epitope(s) in CaV3.3 cDNAs (i.e. CaV3.3– 4⫻ FLAG construct). Flow Cytometry of Transfected TSA201 Cells—Cells were harvested by washing once in PBS followed by an incubation in 500 ␮l of 50 mM EDTA-PBS buffer to resuspend the cells. The mixture was analyzed using a Coulter Epics XL flow cytometer. Settings were established to detect the fluorescence of cells above background levels caused by autofluorescence. In general, a minimum of 104 cells was analyzed (**, p ⬎ 0.001; ***, p ⬍ 0.0001, n ⫽ 4). Western Blotting of Tagged CaV3 Channels—TSA201 cells were harvested 48 h after transfection in PBS in the presence of a protease mixture. Cells were lysed and sonicated. An equal quantity of protein was loaded onto an 8% gel and transferred onto nitrocellulose for 1 h at 200 mA. The gel was blocked utilizing 3% milk powder. Primary antibody incubation was performed overnight with a rat anti-HA antibody (1:1000, Jackson Laboratories) for HA constructs or with a mouse anti-FLAG M2 antibody (1:1000, Sigma) for FLAG constructs and was followed by three washes in PBS (15, 5, and 5). A 45-min incubation at room temperature was carried out with either a goat anti-rat-horseradish peroxidase secondary (1:5000, Jackson ImmunoResearch) or a goat anti-mouse-horseradish peroxidase secondary (1:5000, Amersham Biosciences), followed by 3 washes 1X PBS (15min, 5 min, 5 min). Visualization of the bands was carried out using an ECL kit (Amersham Biosciences). Surface Expression Measurements in Xenopus Oocytes—Isolation, injection, two-electrode voltage clamp, and surface expression of CaV3.2-HA-GFP were performed as described previously (15). After electrophysiological recordings, individual non-permeabilized oocytes were processed with the primary and secondary antibodies. Surface expression was measured using enzymatic amplification of HA epitope recognition with a horseradish peroxidase-coupled secondary antibody (goat anti-rat Fab fragments, Jackson ImmunoResearch). CaV3.2-HAGFP surface expression was quantified on individual oocytes with a Victor 2 luminometer (PerkinElmer Life Sciences). A HA-tagged Kir2.1

FIG. 1. Coexpression of ␣2-␦1 and ␤1b subunits can augment the current density of CaV3.1 and CaV3.2 channels. A stable CHO cell line expressing CaV3.1 was transfected transiently with (n ⫽ 8) and without (n ⫽ 11) the ␣2-␦1 and ␤1b subunits. A, typical current traces in response to a 100-ms-long depolarization from ⫺110 to ⫺30 mV. B, current-voltage relationship for CaV3.1 ⫾ (␣2-␦1 ⫹ ␤1b). Xenopus oocytes were injected with CaV3.2 with and without subunits (C and D). C, typical current traces in response to a 100-ms-long depolarization from ⫺100 to ⫺30mV. Note that ␣2-␦1 and ␤1b do not alter current waveforms. D, current-voltage (I/V) relations for CaV3.2 ⫾ ␣2-␦1 ⫹ ␤1b (n ⫽ 14). Note that, for both CaV3.1 and CaV3.2, the coexpression of subunits does not induce any shift of the I/V curves (B, D). potassium channel and the wild-type CaV3.2 calcium channel were used as positive and negative controls, respectively (data not shown). Surface and Total Expression Measurements of CaV Subunits in HEK293 Cells—Cells were transfected using LipofectAMINE 2000 with a constant amount of DNA (2 ␮g) in 35-mm dishes. Each transfection then was split into 4 wells of a 12-well plate. Two days after transfection, the cells were fixed for 5 min in 4% paraformaldehyde followed by 2 ⫻ 5-min washes with PBS. Two wells were permeabilized with 0.1% Triton X-100 for 5 min and incubated for 30 min in blocking solution (PBS ⫹ 1% serum). The expression of CaV1.2-HA and CaV3.2-HA channels was measured using a mouse anti-HA directly coupled to horseradish peroxidase (1/2000, monoclonal antibody clone 12CA5, Roche Applied Science). For the 4⫻ FLAG-CaV3.3- and FLAG-tagged NaV1.5 channels, a mouse anti-FLAG directly coupled to horseradish peroxidase (1/1000; Sigma) was used. Incubation of the primary antibody was carried out at room temperature for 1 h. After extensive washes (4 ⫻ 5 min in PBS ⫹ 1% fetal calf Serum, 5 ⫻ 5 min in PBS alone), SuperSignal enzyme-linked immunosorbent assay femto maximum sensitivity substrate (Pierce) was added, and the luminescence was measured with a Victor 2 luminometer. Patch Clamp Experiments in Transfected HEK293 and CHO-Cav3.1 Cell Lines—HEK293 cells as well as a CHO cell line stably expressing the CaV3.1b isoform (CHO-CaV3.1) were cultivated in Dulbecco’s modified Eagle’s medium, Glutamax, and 10% fetal calf serum. The clonal CHO-CaV3.1 cell line was established with the CaV3.1b isoform (GenBankTM accession number AF126965) using standard protocols. The transfection of the ␣2-␦1 and/or ␤1b subunits was performed using JetPEI (QBiogen) following standard protocols. Cells were cotransfected with a CD8 expression plasmid (1/10 ratio) to allow optimized identification of the transfected cells using CD8 Dynabeads (Dynal) applied prior to electrophysiological recordings. Whole cell calcium currents were recorded at room temperature 2–3 days after transfection using an Axopatch 200B amplifier (Axon Instruments, CA). Extracellular solution contained (in mM): 2 CaCl2, 135 TEACl, and 10 HEPES (pH to 7.4 with TEAOH). Borosilicate glass pipettes that had a typical resistance of 1–2 megohms were filled with an internal solution containing (in mM): 110 CsCl, 10 EGTA, 10 HEPES, 3 Mg-ATP, and 0.6 GTP (pH to 7.2 with CsOH). RESULTS

␤1b and ␣2-␦1 Subunits Enhance CaV3 Current Density—We have studied the effect of transient transfection of ␤1b and ␣2-␦1 subunits in a CHO line stably transfected with the human CaV3.1 subunit to overcome any difficulty from the electro-


29265

FIG. 2. Schematic representation of tagged CaV3 channels and their functional expression. Description of the constructions can be found under “Experimental Procedures.” A, CaV3.1 construct with an N-terminal GFP fusion. CaV3.2 constructs harbor a HA epitope in the extracellular S5-H5 loop of domain I with/ without N-terminal GFP fusion. The CaV3.3 constructs have 4⫻ FLAG inserted into the extracellular S1-S2 loop of domain I and, similarly, a HA sequence in the same site with N-terminal GFP fusion. B, example of functional expression of CaV3.1-GFP, CaV3.2-HA-GFP, and CaV3.3HA-GFP. Currents were evoked using a 100-ms-long (CaV3.1-GFP, CaV3.2-HA-GFP) or 200-ms-long depolarization pulse (CaV3.3-HA-GFP) from ⫺100 to ⫺30 mV using 2 mM Ca2⫹ as a charge carrier. Current kinetics of tagged channels are similar to wild type untagged channels. C, TSA201 cells transfected with GFP-tagged channels visualized in live cells under fluorescence microscopy at ⫻10 magnification. D, Western blots of recombinant channels expressed in TSA201 using HA- or FLAGspecific antibodies recognize a single high molecular weight band indicating the correct synthesis of cDNAs.

physiological analysis of transiently expressed T-type channels in mammalian cells. The cell line has a mean T-current density of 11.7 pA/pF, which showed a 2-fold increase in its current density, when transfected with both the rat ␤1b and ␣2-␦1 subunits (Fig. 1A). No change in the current-voltage (I/V) curve parameters, steady-state activation, or inactivation properties could be detected (Fig. 1B), indicating that unlike for HVA channels, there was no modulation of electrophysiological properties of CaV3.1 channels caused by ␤ and ␣2-␦ subunits. Functional expression of CaV3.2 channels was measured in Xenopus oocytes. Using barium as charge carrier, the current was typical of LVA channels with strong voltage-dependent activation and fast inactivation kinetics (inactivation ␶ of 10.5 ⫾ 1.2 ms, n ⫽ 10 at the peak of the IV curve). When CaV3.2 cDNA was injected along with ␤1b and ␣2-␦1 cDNAs, the Tcurrent amplitude was 3-fold larger (Fig. 1C) without any modification in activation or inactivation kinetics as seen in typical current traces (Fig. 1C). As for the CaV3.1 current in CHO cells (Fig. 1B), the increase in the CaV3.2 current was not accompanied by a change of the activation threshold as seen on the I/V curve (Fig. 1D) or a change of the voltage dependence of the activation (half-activation potentials (V0.5) for CaV3.2 alone (⫺35.7 ⫾ 0.4 mV, n ⫽ 12) and for CaV3.2 ⫹ ␣2-␦1/␤1b (⫺36.5 ⫾ 0.4 mV, n ⫽ 14)). Construction of Epitope- and GFP-tagged CaV3 Subunits— Recently, the antibodies generated against both CaV3.1 and CaV3.3 were used to monitor total protein expression either on

Western blots and immunostaining (16). However, the availability of antibodies that would recognize epitope at the extracellular side of a T-type calcium channel, allowing us to monitor surface expression, does not exist. In a first series of experiments, a FLAG epitope was inserted into the extracellular S1-S2 loop of domain I of CaV3.3. To optimize recognition by the antibody, extra flanking residues were introduced. The site was chosen both because of a unique and convenient SbfI restriction site and the absence of surrounding putative glycosylation sites. A series of FLAG-tagged CaV3.3 constructs were made, which contained 1, 2, or 4 FLAG epitopes. Only the 4⫻ FLAG was detected on Western blots, and this construct could be used in chemiluminescent assays. To improve a further detection of tagged CaV3 channels, we inserted a HA epitope at this same Sbf1 site. The HA epitope detection has been used successfully to analyze potassium channel expression (12). In addition, a series of T-type calcium channels (CaV3.1, CaV3.2, CaV3.2-HA, and CaV3.3) N-terminally tagged with GFP were constructed to allow the monitoring of CaV channels using fluorescence techniques (see Fig. 2A for schematic representation of CaV3 constructs). All of these various constructs were assayed functionally in patch clamp studies and proven to function adequately as T-type channels (see Fig. 2B for typical current traces obtained with these recombinant clones), indicating that the insertion of these additional sequence did not alter channel properties.

29266


FIG. 4. Expression of CaV3.2-HA-GFP channels in Xenopus oocytes. A, typical current traces with and without the coexpression of the ␤1b and ␣2-␦1 subunits. Oocytes were held at ⫺100 mV, and depolarization stepped from ⫺70 mV with subsequent 10-mV increments. B, quantification of expression levels of the HA-tagged proteins at the surface of non-permeabilized cells. Single oocyte chemiluminescence was detected with a luminometer. Intensity of photon emission is expressed as relative light units (RLU). As with the wild type cDNA constructs, the tagged CaV3.2-HA-GFP channels showed an increase in current amplitude. There was a parallel increase in current density and surface expression for the tagged CaV3.2-HA-GFP channels in the Xenopus oocytes

FIG. 3. Fluorescence measurements in TSA201 cells transiently transfected with ␣2-␦1 and ␤1b subunits and GFP-tagged CaV3 channels. A, example of CaV3.1-GFP-transfected cells that shows an increase in intensity and the number of detected cells when coexpressed with ␤1b and ␣2-␦1 (right panel). B, histogram of mean fluorescence of GFP-tagged CaV3 channels showing significant increases in mean fluorescence when ␤1b and ␣2-␦1 subunits were coexpressed. A minimum of 104 cells was counted in each instance (**, p ⬎ 0.001, ***, p ⬍ 0.0001, n ⫽ 4). Quantification of this experiment was carried out using a flow cytometer (see “Experimental Procedures”) C, Western blot experiments of CaV3.2-HA-GFP and CaV3.3-HA-GFP that reveal an increase in total protein expression in the presence of ␤1b and ␣2-␦1 subunits.

Biochemical Analysis of CaV3-tagged Proteins as Expressed in TSA201 Cells—The expression of CaV3-GFP-tagged clones in HEK293 could be detected easily by fluorescence microscopy (Fig. 2C). The CaV3.3 4⫻ FLAG construct exhibited electrophysiological properties similar to those of wild type CaV3.3, although the currents on average were of smaller amplitudes (data not shown). The FLAG-tagged CaV3.3 proteins containing either a single or double FLAG epitope failed to be detected on Western blots. The presence of four FLAG sequences was necessary for Western blot detection (Fig. 2D). By contrast, both CaV3.2-HA and CaV3.3-HA-GFP, which contained a single HA epitope, could be detected using Western blot (Fig. 2D). ␤1b and ␣2-␦1 Subunits Enhance the Level of Expression GFP-tagged CaV3 Channels—CaV3.1, CaV3.2, CaV3.2-HA, and CaV3.3-HA tagged with GFP were expressed in TSA201 cells. When both ␤1b and ␣2-␦1 were coexpressed together with any of the GFP-tagged CaV3 channels, an increase in the number and intensity of cells expressing the GFP was observable using fluorescent microscopy (Fig. 3A). To further study the expression of the GFP-tagged CaV3 subunits, fluorescent cell cytometry was used as a quantitative, high throughput detection method. When the CaV3 channels were coexpressed with both of the subunits, a significant increase in the mean average GFP fluorescence of 180 (CaV3.1-GFP), 320 (CaV3.2-HA-GFP), and 80% (CaV3.3-HA-GFP) was measured (Fig. 3B). These results were confirmed using Western blot analysis, which shows a

significant increase in protein levels when both subunits are coexpressed (Fig. 3C). These data indicate that HVA auxiliary subunits augment CaV3 subunit expression at the protein level. ␤1b and ␣2-␦1 Subunits Promote CaV3.2 Surface Expression in Xenopus Oocytes—To combine T-current and cell surface expression measurements, the CaV3.2-HA-GFP construct was expressed in Xenopus oocytes. The plasma membrane expression of CaV3.2-HA-GFP was measured directly using an immunoassay developed in the laboratory for the CaV1.2 channels (16). The T-currents generated by the CaV3.2-HA-GFP construct were augmented significantly following ␤1b and ␣2-␦1 coexpression (Fig. 4A). The surface expression of CaV3.2-HAGFP was increased by ⬃2-fold upon coexpression with ␣2-␦1 and ␤1b, consistent with the increase in current density (Fig. 4B). This set of experiments, based on the combined use of electrophysiological and surface protein measurements, demonstrates that the ␣2-␦1 and ␤1b subunits increased the concomitant expression of CaV3.2 at the plasma membrane and T-current density in Xenopus oocytes. ␤1b and ␣2-␦1 Subunits Enhance the Level of Expression of Tagged CaV3 Channels in HEK293 Cells—Using mammalian cells, flow cytometry experiments of GFP-tagged CaV3 channels (Fig. 3) did not allow any quantification of surface expression. To extend the observations reported above, the cell surface measurement assay then was developed for mammalian cells. This chemiluminescence technique allows us to quantitatively examine both surface and total expression of epitope-tagged CaV channels in a rather large population of cells (⬎250,000 cells). HEK293 cells were transfected with various combinations of ␤1b and ␣2-␦1 subunits. 48 h later, the cells were fixed and the surface expression of CaV3.2-HA- and CaV1.2-HA-tagged channels as well as CaV3.3– 4⫻ FLAG- and NaV1.5-FLAG-tagged channels was determined (Fig. 5). We found that the ␤1b and ␣2-␦1 subunits, individually and together, were able to enhance significantly the surface expression of the CaV3.2 and CaV3.3 subunits. CaV3.2-HA expression was augmented when ␤1b and ␣2-␦1 were coexpressed individually, with an increase of 148 ⫾ 2% and 151 ⫾ 19% (total) and 237 ⫾ 35% and 201 ⫾ 12% (surface) for ␤1b and ␣2-␦1, respectively. When both subunits were expressed together, a 437 ⫾ 65% increase in Cav3.2-HA surface expression was measured, whereas only a 181 ⫾ 18% increase was found in total expression. For Cav3.3– 4⫻ FLAG, when ␤1b and ␣2-␦1 were


29267

FIG. 5. Increase in total and surface expression of CaV3.2-HA and CaV3.3-FLAG-tagged channels with ␣2-␦1 and ␤1b subunits. The histograms show the normalized relative surface expression of HA-tagged CaV1.2, CaV3.2, and FLAG-tagged CaV3.3 calcium channels and the FLAG-tagged NaV1.5 sodium channel with and without the ␣2-␦1 and ␤1b subunits. Expression has been normalized to that of the CaV/NaV subunits alone in each group of the data. Note that, for each group, the background chemiluminescent level (BKG) obtained for cells transfected with the empty vector has been reported. The numbers of experiments are indicated in brackets, and the statistical significance is indicated with asterisk (*, p ⬍ 0.05; **, p ⬍ 0.005; ***, p ⬍ 0.0005).

coexpressed the membrane expression was increased by 143 ⫾ 1% and 171 ⫾ 15%, respectively, whereas the total expression was increased by 192 ⫾ 13% and 153 ⫾ 9%, respectively. The expression of both auxiliary subunits with Cav3.3– 4⫻ FLAG led to a further 231 ⫾ 7% (surface) and 264 ⫾ 11% (total) increase in expression as compared with each of the subunits expressed separately (p ⬍ 0.05); however, the relative amount of membrane expression was not modified significantly. For CaV1.2 HA-tagged channels, a 268 ⫾ 11% increase in surface expression was measured when both subunits were coexpressed with a 430 ⫾ 11% increase in total expression. Finally, we have performed similar experiments with NaV1.5, a sodium channel that shares a similar overall homology with CaV channel subunits (17). Using a NaV1.5 channel tagged with an external FLAG epitope, no change in surface expression was observed with the ␤1b and ␣2-␦1 subunits (Fig. 5), indicating that the reported effects of ␤1b and ␣2-␦1 subunits on CaV3 channels expression are specific for voltagegated calcium channels. DISCUSSION

The main finding of the this study is that the HVA auxiliary subunits ␣2-␦1 and ␤1b modulate the amount of CaV3 channel protein at the plasma membrane. We also report that the increase in plasma membrane expression is accompanied by an increase in the T-type current density. Interestingly, we have observed no alteration in current properties with any of the LVA channels when coexpressed with ␤1b and ␣2-␦1 subunits regardless of the expression system. Overall, this study also

validates the use of epitope-tagged CaV3 channels to probe T-channel modulation. The effect of any regulatory subunits on T-type channels has yet to be determined. A few studies have reported some changes in both current density and electrophysiological properties when HVA ␣2-␦ auxiliary subunits were expressed with T-type channel CaV3 subunits (6, 18 –20), whereas other studies have failed to ascribe any effect (21) (for review see Ref. 5). We report here that the ␣2-␦1 subunit is able to increase total and surface expression of both CaV3.2 and CaV3.3 channels in HEK293 cells. Therefore, we have confirmed previous data suggesting a ␣2-␦ subunit modulation of T-type channels by demonstrating that the ␣2-␦1 subunit is able to up-regulate the surface expression of CaV3 channels as well as significantly increase T-type current density. Indeed, other studies have suggested that a functional association of ␣2-␦1 subunit with a T-type could occur based on the use of the anti-epileptic drug Gabapentin, which has been shown to bind onto the ␣2-␦1 subunit and to modulate T-currents (22, 23). Overall, these data indicate that ␣2-␦ subunits could be considered as a regulatory subunit of T-type calcium channels and that the ␣2-␦ subunits may interact with CaV3 channels. In this study, we also have demonstrated that ␤1b has a significant effect on augmenting the surface expression and total expression of both CaV3.2 and CaV3.3 channels. We also have found that the CaV3.3 total protein expression is affected by all of the ␤ subunit family members, indicating that ␤

29268


subunits share their ability to modulate T-type channels.2 To date, whether or not the ␤ subunits regulate the CaV3 channels is controversial. A few studies have suggested that ␤ subunits do not regulate the T-type current density, i.e. the T-type channel expression. Antisense depletion of ␤ subunits failed to decrease T-type channel expression in NG108-15 cells (24) as well as in nodose ganglion neurons (25). Similarly, the overexpression of the ␤1b subunit did not affect either the T-type current density or the kinetic properties of native T-currents in NG108-15 cells (19). In good agreement with these data, we have failed to identify any significant electrophysiological alteration of recombinant CaV3 channels when the ␤1b subunit was expressed and we have failed to identify a clear change in T-current density in regular transient cotransfection experiments in mammalian cells. Indeed, the use of tagged CaV3 channels was instrumental to describe an ⬃2-fold increase in cell surface expression and in T-current density caused by the ␤1b subunit. The ␤ subunit roles in modulation of biophysical properties of HVA channels have been well studied (for review see Ref. 26). It also has been demonstrated that the ␤ subunits tightly bind onto a retention motif located within the intracellular I-II loop of HVA pore channel subunits (CaV) and facilitate HVA channel trafficking and cell surface expression (27). It is tempting to suggest that the CaV3 channels also may possess ␤ subunit interaction site(s). A consensus sequence (QQE(D/E)LGY . . . WI . . . E) present in the I-II intracellular loop of every HVA CaV subunit is the primary interaction site of the ␤ subunits (28, 29). It has been suggested that the CaV3.1 protein may be sufficiently homologous to provide a similar binding site (GSCYEELLKYLVYILRKA) (for review, see Ref. 6). However, a sequence comparison of this region for all of the CaV3 channels identified to date revealed a conserved consensus sequence that reads EPCYE . . . Y . . . R . . . RR. In addition, we were unable to identify any interaction between either the fulllength rat ␤1b subunit or the ␤ subunit interacting domain site and the I-II loop of the CaV3.3 channel using the two-yeast hybrid assay (data not shown). Furthermore, by attaching the I-II loop of CaV3.1 channels to a reporter CD8 construct, Cornet et al. (30) demonstrate that this sequence does not possess a retention motif as found on HVA channels. These various observations would argue that the I-II loop of the CaV3 channels does not interact with the ␤ subunits. If there are other regions of CaV3 channels that are able to interact with ␤ subunits to promote the regulation, they are likely to very weak since ␤1b failed to be immunoprecipitated with the CaV3– 4⫻ FLAGtagged channel, whereas this was not the case with the CaV1.2HA-tagged channel.2 An alternative explanation would be that the CaV3 channels expressed in the various cell systems used in this study may be guided or stabilized by the ␤ subunits as well as the other HVA auxiliary subunits on their way to the membrane without the need for a tight association. Indeed, it has been suggested recently that ␤ subunit modulation of HVA current density may also rely on a labile interaction that can be mimicked with purified ␤ subunits applied in patch clamp experiments (31, 32). Further electrophysiological studies using purified ␤ subunits applied intracellularly on recombinant CaV3 channels might be useful to determine whether a similar modulation occurs for T-type calcium channels. In summary, we have demonstrated that the ␤1b and ␣2-␦1 subunits are able to induce both a global increase in protein level and an enhanced surface expression of CaV3 channels, which is correlated to an increase in current density both in Xenopus oocytes and mammalian cells. An augmentation of

2

S. J. Dubel, unpublished data.

CaV1.2 plasma membrane expression was observed with the coexpression of the auxiliary subunits as expected based on previous reports of increased current density (33, 34), immunostaining (35), and membrane expression using external epitope tags (15). There is no modification in the relative level (surface/total expression) of CaV1.2-HA expression at the cell surface when both of the auxiliary subunits are expressed. This is also evident with CaV3.3-tagged channels, whereas for the Cav3.2 channels, the auxiliary subunits significantly increase the relative surface expression of the channels. It is not known whether this is attributed to an increase in the rate of trafficking to the cell surface or stabilization of the protein at the plasma membrane, but it should be noted that the surface expression level of CaV3.2 channels (13%) is lower compared with either CaV3.3 (30%) or CaV1.2 channels (20%) without auxiliary subunits, thus suggesting that CaV3.2 channels may be more sensitive to the effects of the auxiliary subunits. Utilizing HA-tagged CaV3.2 and FLAG-tagged CaV3.3 channels, we were able to demonstrate that exogenously expressed ␤1b and ␣2-␦1 subunits are able to increase both total and surface expression in mammalian cells not only together but also individually. These subunits are likely to act synergistically to enhance the effects observed with each separate subunit. The mechanism of this additional augmentation has yet to be documented. One possible explanation would be that these auxiliary subunits modulate the expression/stabilization of each other, which would result ultimately in a significant increase in the CaV3 subunit expression/stabilization. Although the synthesis, assembly, and trafficking of CaV3 channels is undoubtedly a complex process governed by a wide range of regulatory proteins, the fact that HVA auxiliary subunits act on all of the three members of the T-type channel family suggests either a common site of interaction or a general mechanism by which these CaV3 channels are modulated. The observed increase in the surface expression of calcium channels by the coexpression of ␤1b and ␣2-␦1 subunits also may involve channel recycling or degradation of voltage-dependent calcium channels at the cell surface. Although calcium channel endocytosis still is documented poorly, it has been shown recently that endophilin, a key regulator of clathrin-mediated synaptic vesicle endocytosis, is able to interact with CaV1.2, CaV2.1, and CaV2.2 calcium channels (36). Such a mechanism could account for the ␤1b and ␣2-␦1 subunit stabilization of CaV3 channels at the cell surface. The construction of T-type CaV3 subunits with exogenous epitopes in the extracellular domains should be useful in evaluating a wide range of protein trafficking, processing, and modulation of these channels and will open up new avenues in exploring the T-type channel physiological and pathophysiological functions. For example, whether the ␥ subunits modulate T-type channel function and trafficking can be now addressed. Indeed, it has been reported recently that the ␥2 subunit modulates the biophysical properties of CaV3.3 channels (37) and that LVA current density is enhanced in the thalamic neurons of the “stargazer” mice, which is deficient in the ␥2/stargazin protein (38). The use of externally tagged CaV3 channels combined with a virus delivery strategy should make it possible to analyze cell surface expression of T-channels in a wide variety of cell types, including cardiac myocytes and neurons (39). Furthermore, with the recent identification of mutations within the human gene CACNA1H (that codes for CaV3.2 channels) in patients with childhood absence epilepsy (40), these new tools should be useful to analyze whether cellular trafficking or membrane expression is impaired for mutant CaV3 channels. Acknowledgments—We thank Drs. Terry P. Snutch, Arnaud Monteil, and Edward Perez Reyes for providing wild-type calcium channel sub-

␣2-␦1 and ␤ Subunit Production of T-type Calcium Channels unit cDNAs. We also thank Nathalie Bonneaud for a human embryonic two-yeast cDNA library and expertise in carrying out the two-yeast hybrid experiments and Christian Barre`re and Elodie Kupfer for skillful developement of the CHO-␣1G cell line and for maintenance of the cell lines as well as Anne Pages for oocyte injection and recordings. REFERENCES 1. Perez-Reyes, E., Cribbs, L. L., Daud, A., Lacerda, A. E., Barclay, J., Williamson, M. P., Fox, M., Rees, M., and Lee, J. H. (1998) Nature 391, 896 –900 2. Monteil, A., Chemin, J., Bourinet, E., Mennessier, G., Lory, P., and Nargeot, J. (2000) J. Biol. Chem. 275, 6090 – 6100 3. McRory, J. E., Santi, C. M., Hamming, K. S., Mezeyova, J., Sutton, K. G., Baillie, D. L., Stea, A., and Snutch, T. P. (2001) J. Biol. Chem. 276, 3999 – 4011 4. Klugbauer, N., Lacinova, L., Marais, E., Hobom, M., and Hofmann, F. (1999) J. Neurosci. 19, 684 – 691 5. Perez-Reyes, E. (2003) Physiol. Rev. 83, 117–161 6. Dolphin, A. C., Wyatt, C. N., Richards, J., Beattie, R. E., Craig, P., Lee, J. H., Cribbs, L. L., Volsen, S. G., and Perez-Reyes, E. (1999) J. Physiol. (Lond.) 519, 35– 45 7. Kang, M. G., and Campbell, K. P. (2003) J. Biol. Chem. 278, 21315–21318 8. Zhang, J., Campbell, R. E., Ting, A. Y., and Tsien, R. Y. (2002) Nat. Rev. Mol. Cell. Biol. 3, 906 –918 9. Howard, M., Jilling, T., DuVall, M., and Frizzell, R. A. (1996) Kidney Int. 49, 1642–1648 10. Howard, M., DuVall, M. D., Devor, D. C., Dong, J. Y., Henze, K., and Frizzell, R. A. (1995) Am. J. Physiol. 269, C1565–C1576 11. Ma, D., Zerangue, N., Lin, Y. F., Collins, A., Yu, M., Jan, Y. N., and Jan, L. Y. (2001) Science 291, 316 –319 12. Zerangue, N., Schwappach, B., Jan, Y. N., and Jan, L. Y. (1999) Neuron 22, 537–548 13. Kuchenbecker, M., Schu, B., Kurz, L., and Rudel, R. (2001) Pflugers Arch. 443, 280 –288 14. Baroudi, G., Pouliot, V., Denjoy, I., Guicheney, P., Shrier, A., and Chahine, M. (2001) Circ. Res. 88, E78 –E83 15. Altier, C., Dubel, S. J., Barrere, C., Jarvis, S. E., Stotz, S. C., Spaetgens, R. L., Scott, J. D., Cornet, V., De Waard, M., Zamponi, G. W., Nargeot, J., and Bourinet, E. (2002) J. Biol. Chem. 277, 33598 –33603 16. Yunker, A. M., Sharp, A. H., Sundarraj, S., Ranganathan, V., Copeland, T. D., and McEnery, M. W. (2003) Neuroscience 117, 321–335 17. Perez-Reyes, E. (1998) J. Bioenerg. Biomembr. 30, 313–318 18. Gao, B., Sekido, Y., Maximov, A., Saad, M., Forgacs, E., Latif, F., Wei, M. H., Lerman, M., Lee, J. H., Perez-Reyes, E., Bezprozvanny, I., and Minna, J. D.

29269

(2000) J. Biol. Chem. 275, 12237–12242 19. Wyatt, C. N., Page, K. M., Berrow, N. S., Brice, N. L., and Dolphin, A. C. (1998) J. Physiol. (Lond.) 510, 347–360 20. Hobom, M., Dai, S., Marais, E., Lacinova, L., Hofmann, F., and Klugbauer, N. (2000) Eur. J. Neurosci. 12, 1217–1226 21. Lacinova, L., Klugbauer, N., and Hofmann, F. (1999) J. Physiol. (Lond.) 516, 639 – 645 22. Gee, N. S., Brown, J. P., Dissanayake, V. U., Offord, J., Thurlow, R., and Woodruff, G. N. (1996) J. Biol. Chem. 271, 5768 –5776 23. Agueev, V., Bernatchez, G., Perez-Reyes, E., and Parent, L. (2000) Biophys. J. 78, 457A (Abstr. 2692) 24. Leuranguer, V., Bourinet, E., Lory, P., and Nargeot, J. (1998) Neuropharmacology 37, 701–708 25. Lambert, R. C., Maulet, Y., Mouton, J., Beattie, R., Volsen, S., De Waard, M., and Feltz, A. (1997) J. Neurosci. 17, 6621– 6628 26. Jones, S. W. (1998) J. Bioenerg. Biomembr. 30, 299 –312 27. Bichet, D., Cornet, V., Geib, S., Carlier, E., Volsen, S., Hoshi, T., Mori, Y., and De Waard, M. (2000) Neuron 25, 177–190 28. De Waard, M., Pragnell, M., and Campbell, K. P. (1994) Neuron 13, 495–503 29. Pragnell, M., De Waard, M., Mori, Y., Tanabe, T., Snutch, T. P., and Campbell, K. P. (1994) Nature 368, 67–70 30. Cornet, V., Bichet, D., Sandoz, G., Marty, I., Brocard, J., Bourinet, E., Mori, Y., Villaz, M., and De Waard, M. (2002) Eur. J. Neurosci. 16, 883– 895 31. Garcia, R., Carrillo, E., Rebolledo, S., Garcia, M. C., and Sanchez, J. A. (2002) J. Physiol. (Lond.) 545, 407– 419 32. Yamaguchi, H., Hara, M., Strobeck, M., Fukasawa, K., Schwartz, A., and Varadi, G. (1998) J. Biol. Chem. 273, 19348 –19356 33. Tomlinson, W. J., Stea, A., Bourinet, E., Charnet, P., Nargeot, J., and Snutch, T. P. (1993) Neuropharmacology 32, 1117–1126 34. Welling, A., Bosse, E., Cavalie, A., Bottlender, R., Ludwig, A., Nastainczyk, W., Flockerzi, V., and Hofmann, F. (1993) J. Physiol. (Lond.) 471, 749 –765 35. Gao, T., Chien, A. J., and Hosey, M. M. (1999) J. Biol. Chem. 274, 2137–2144 36. Chen, Y., Deng, L., Maeno-Hikichi, Y., Lai, M., Chang, S., Chen, G., and Zhang, J. (2003) Cell 115, 37– 48 37. Green, P. J., Warre, R., Hayes, P. D., McNaughton, N. C., Medhurst, A. D., Pangalos, M., Duckworth, D. M., and Randall, A. D. (2001) J. Physiol. (Lond.) 533, 467– 478 38. Zhang, Y., Mori, M., Burgess, D. L., and Noebels, J. L. (2002) J. Neurosci. 22, 6362– 6371 39. Wei, S. K., Colecraft, H. M., DeMaria, C. D., Peterson, B. Z., Zhang, R., Kohout, T. A., Rogers, T. B., and Yue, D. T. (2000) Circ. Res. 86, 175–184 40. Chen, Y., Lu, J., Pan, H., Zhang, Y., Wu, H., Xu, K., Liu, X., Jiang, Y., Bao, X., Yao, Z., Ding, K., Lo, W. H., Qiang, B., Chan, P., Shen, Y., and Wu, X. (2003) Ann. Neurol. 54, 239 –243