Polish Journal of Microbiology

POLSKIE TOWARZYSTWO MIKROBIOLOGÓW POLISH SOCIETY OF MICROBIOLOGISTS

Polish Journal of Microbiology formerly

Acta Microbiologica Polonica

2008

Polish Journal of Microbiology formerly Acta Microbiologica Polonica

2008, Vol. 57, No 1

CONTENTS MINIREVIEW New approaches for Helicobacter vaccine development difficulties and progress JAGUSZTYN-KRYNICKA E.K., GODLEWSKA R. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

3

ORIGINAL PAPERS Amplification of a single-locus variable-number direct-repeats with restriction fragment length polymorphism (DR-PCR/RFLP) for genetic typing of Acinetobacter baumannii strains NOWAK-ZALESKA A., KRAWCZYK B., KOT£OWSKI R., MIKUCKA. A., GOSPODAREK E. . . . . . . . . . . . . . . . . . . . . . . .

Regulation of Yersinia enterocolitica mal genes by MalT and Mlc proteins RACZKOWSKA A., BRZÓSTKOWSKA M., BRZOSTEK K. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Proteolytic activity of clinical Candida albicans isolates in relation to genotype and strain source NAWROT. U., SKA£A J., W£ODARCZYK K., FONTEYNE P.A., NOLARD N., NOWICKA J. . . . . . . . . . . . . . . . . . . . . . . . . .

Study on bioactive compounds from Streptomyces sp. ANU 6277 NARAYANA K.J.P., PRABHAKAR P., VIJAYALAKSHMI M., VENKATESWARLU Y., KRISHNA P.S.J. . . . . . . . . . . . . . . . . .

11 19 27 35

Clinical presentation of extraintestinal infections caused by non-typhoid salmonella serotypes among patients at the University Hospital in Cracow during an 7-year period KÊDZIERSKA J., PI¥TKOWSKA-JAKUBAS B., KÊDZIERSKA A., BIESIADA G., BRZYCHCZY A., PARNICKA A., MIÊKINIA B., KUBISZ A., SU£OWICZ W. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Statistical optimization of "-amylase production by Streptomyces erumpens MTCC 7317 cells in calcium alginate beads using response surface methodology KAR S., RAY R.C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

The influence of soluble microbial products on microbial community composition: hypothesis of microbial community succession CHIPASA K.B., MÊDRZYCKA K. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Established and abandoned tea (Camillia sinensis L.) rhizosphere: dominant bacteria and their antagonism SOOD A., SHARMA S., KUMAR V., THAKUR R.L. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

41

49

59 71

SHORT COMMUNICATIONS Polymorphism in the ITS region of ribosomal DNA of Cochliobolus sativus isolates differing in xylanase production BAKRI Y., JAWHAR M., ARABI M.I.E. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Usefulness of strb1 and 16S rDNA-targeted PCR for detection of Streptomyces spp. in environmental samples

77

SAADOUN I., GHARAIBEH R. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

81

INSTRUCTION TO AUTHORS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

85

INSTRUCTION TO AUTHORS AVAILABLE ALSO AT www.microbiology.pl/pjm

Polish Journal of Microbiology 2008, Vol. 57, No 1, 39 ORIGINAL PAPER

New Approaches for Helicobacter Vaccine Development Difficulties and Progress EL¯BIETA K. JAGUSZTYN-KRYNICKA* and RENATA GODLEWSKA

Department of Bacterial Genetics, Institute of Microbiology, Faculty of Biology University of Warsaw, Warsaw, Poland Received 1 August 2007, accepted 10 October 2007 Abstract Despite the enormous progress in understanding the process of bacterial pathogenesis and interactions of pathogens with eucaryotic cells the infectious diseases still remain the main cause of human premature deaths. It is now recognized that Helicobacter pylori infects about half of the worlds population. Based on results of clinical studies the World Health Organization has assigned H. pylori as a class I carcinogen. The review presents new achievements aimed at construction efficient and safe anti-Helicobacter vaccine. We discuss the new global technologies such as immunoproteomics employed for selecting new candidates for vaccine construction as well as new vaccine delivery systems. The review presents also our knowledge concerning H. pylori interaction with immune system which might facilitate modulation of the host immune system by specific adjuvant included into vaccine K e y w o r d s: Helicobacter pylori, adjuvant, delivery system, immunoproteomics, vaccine

Introduction Helicobacter pylori has been an object of intense scientific studies, since its isolation from human stomach biopsies (Marshall and Warren, 1984). In the course of studies, it has been classified as a EpsilonProteobacteria and determined to colonize the gastric mucosa of humans. At present, H. pylori is recognized as a causative agent of chronic inflammation, chronic gastritis and peptic ulceration, and is considered to be a risk factor in the development of mucosa-associated lymphoid tissue lymphoma and adenocarcinoma of the stomach. Over half of the worlds population (87% of Polish population) is infected with H. pylori, with the highest rates in developing countries (Marshall, 2003). Based on results of clinical studies, the World Health Organization has categorized H. pylori as a class I carcinogen. Although H. pylori infections are widespread, the disease develops only in a subset of infected humans. Considerable amount of gathered evidences indicate that the bacterial genotype is an important factor determining the type of induced pathology. Moreover, the nature and severity of the disease depend on both-host characteristics and environmental factors. Epidemiological studies have re-

vealed a correlation between the age of infected individuals and the type of pathology (peptic ulcer or cancer) developed in consequence of infection (Blaser and Atherton, 2004; Hatakeyama and Brzozowski, 2006). The 2005 Nobel Prize in Physiology or Medicine was awarded to B.J. Marshall and J.B. Warren for their studies on the bacterium Helicobacter pylori and its role in gastritis and peptic ulcer diseases. Main H. pylori virulence factors Many virulence factors produced either by all or some H. pylori clinical isolates are involved in the development of disease symptoms. Among them, most extensively studied are various adhesins responsible for bacterial adhesion to gastric mucosal cells, urease which neutralizes the acidic environment of the stomach, CagA which influences the host cell signal-transduction pathways, VacA a vacuolating toxin that also modulates the activity of immune cells and NapA a neutrophil-activating protein. The cagA gene, encoding a highly immunogenic protein of an apparent molecular weight of 120140 kDa, is located within the PAI pathogenicity island

Corresponding author: E.K. Jagusztyn-Krynicka, Department of Bacterial Genetics, Institute of Microbiology, Faculty of Biology, University of Warsaw; Miecznikowa 1, 02-096, Warsaw, Poland; phone (48) 22 5541216; e-mail: [email protected]

4

Jagusztyn-Krynicka E.K. and Godlewska R.

present only in genomes of certain H. pylori strains. The Cag protein, after injection into eukaryotic cells by the type IV transport system apparatus, associates with the plasma membrane and undergoes tyrosine phosphorylation by the host Scr kinase. Phosphorylated CagA interacts with many signal-transduction pathways operating within epithelial cells. These interactions result in alteration of cell morphology as well as proliferation and spreading. CagA is a highly polymorphic protein. Its polymorphism is mainly confined to the C-terminal region and depends on the number of EPIYA phosphorylation motifs as well as the amino acid sequence of the flanking regions (Western vs. East Asian strains). The H. pylori type IV transport system is also involved in stimulating the IL-8 production by epithelial cells through activation of the NF-kB transcription factor, but does not involve the CagA protein. More recent data indicate that the function of effector molecules, which are able to interact with the Nod receptors, is performed by the soluble parts of the bacterial peptidoglycan (Blaser and Atherton, 2004; Bourzac and Guillemin, 2005; Naumann, 2005; Radosz-Komoniewska et al., 2005; Viala et al., 2004). The VacA toxin, classified to the autotransporter protein family, is an oligomeric protein, which undergoes extensive processing. The mature 88 kDa toxin is cleaved proteolytically into two subunits: P55 and P33. Both subunits are necessary for toxin activity. P55 is responsible for recognizing receptors on the surface of eukaryotic cells, whereas P33 is involved in pore formation. VacA is a multifunctional protein, which, apart from inducing cell vacuolization that requires also the activity of many host cell protein, contributes to cell apoptosis in a mitochondrial-dependent manner. Additionally, the protein modulates the functions of immune cells and influences the activity of T lymphocytes, neutrophils, macrophages and mast cells. Depending of the target cells, the activity of VacA can have either an immunosuppressive or immunostimulatory effect (Cover and Blanke, 2005; Fischer et al., 2004). Although only 50% of H. pylori strains are toxigenic, all contain the vacA gene. Yet, the vacA-encoding nucleotide sequences are extremely variable. This variability influences the activity of the toxin and is confined mainly to nucleotide sequences encoding signal peptides and the middle part of the protein. The most frequently isolated strains from patients suffering from severe disease symptoms are characterized by the s1/m1 vacA genotype (Cover and Blanke, 2005). Urease is another important H. pylori virulence factor, which facilitates pathogen colonization of the gastric mucosa. The enzyme catalyzes production of ammonia and sodium dioxide from urea, which, in result, decreases the pH in the stomach. Ammonia also

1

contributes to development of disease symptoms (Radosz-Komoniewska et al., 2005). Many proteins involved in postranlational modification of virulence factors also influence H. pylori pathogenicity. Some extracytoplasmic proteins of Gram-negative pathogens which contain two or more cysteine residues gain their proper structure as a result of an insertion of disulphide bridges. The process is facilitated by a Dsb (disulfide bond) family of the redox proteins. It has been established that members of the Dsb family are essential for correct folding or assembly of a number of pathogenic determinants (£asica and Jagusztyn-Krynicka, 2007). We identified and characterized a new subfamily of disulfide oxidoreductases encoded by a gene denoted dsbI (jhp0542 gene of H. pylori J99, hp0595 of H. pylori 26695 strain and cj0017c of C. jejuni strain NCTC11168). HP0595 and Cj0017c belong to the DsbI protein family, paralogous to the DsbB family (Raczko et.al., 2005). The inactivation of the dsbI gene in H. pylori led to the accumulation of proteins with free thiol groups in the periplasmic space. It was documented that mutation in dsbI almost eliminates the ability of H. pylori to colonize mice intestinal tract, supporting the importance of disulfide bond formation process for infection (Godlewska et.al., 2006). Main issues concerning H. pylori vaccination need to be resolved The mechanism of H. pylori pathogenesis and details regarding the interaction between this bacterium and the human immune system are still far from being understood. Many important issues await clarification. First, a decision should be made concerning protective antigen(s), the route of immunization as well as the antigen delivery system. Recently published experimental data questions the role of antibodies and indicates that T cells might play an important role in protection against H. pylori. In all likelihood, both Th1 and Th2-dependent branches of specific immune responses are involved in the process. It cannot be excluded that stimulation of different immune responses is required for obtaining effective therapeutic or prophylactic vaccines (Aebischer et al., 2005; Chmiela and Michetti, 2006; Prinz et al., 2003). This raises the question concerning the type of adjuvant that should be included into the subunit recombinant vaccine regiment. Differently modified LT and CT toxins or CpG ODN and aluminum salts have been added to the tested vaccine prototypes against H. pylori. Two of them, alum and CpGs, were approved for use in humans. The evaluation of the vaccine efficacy in vivo demands also a reliable animal infection model. Most commonly, preclinical immunological studies

1

New approaches for Helicobacter vaccine

are performed in mice. Although preclinical studies have proven several therapeutic and prophylactic vaccine prototypes to be efficient in a murine infection model, they were ineffective when administrated to humans (Aebischer et al., 2005; Prinz et al., 2003). When the paper by Lagergren (1999) was published, another doubt appeared. The authors have documented that the acid reflux in the esophagus is a risk factor for adenocarcinoma. Thus, the question arose whether there is a relationship between a recently observed, in developed countries, decrease of H. pylori infections resulting from commonly applied antibiotic therapy, and the increase in the number of diagnosed esophagus adenocarcinoma incidences (Lagergren et al., 1999). H. pylori infections are mostly acquired during childhood and persist for years. Yet, the target population for therapeutic and prophylactic immunization against H. pylori should, most likely, be different. In developed countries antibiotic therapy is recommended for individuals who suffer from clinical symptoms. As development of H. pylori-induced pathology and disease symptoms normally lasts for years, the target population for therapeutic vaccines ought to consist of adults mainly. Contrarily, prophylactic vaccines should be preferably administrated to preschool and school-age children, which raises some ethical considerations. Results from experiments conducted on neonatal mice with alum-adjuvanted vaccine suggested that this goal is feasible (Minoura et al., 2003). Classical whole-cell inactivated vaccines Vaccines constitute the most cost-effective tool for prophylaxis of infectious diseases. Vaccination against H. pylori is believed to be more effective for individual patients than antibiotic therapy as well as decrease the number of infections at the population level and, in result, lead to pathogen eradication. Active vaccines can be divided into three main categories: killed vaccines, attenuated vaccines and subunit vaccines. Formalin-killed H. pylori cells were orally administrated to infected and uninfected volunteers together with a mucosal adjuvant a mutated form of the E. coli heat-labile toxin, known to stimulate both Th1 and Th2 immune responses. The vaccine induced production of specific antigen-secreting cells, but did not eradicate the pre-existing infection. Despite several positive results obtained during trials, especially in the case of uninfected volunteers, the enormous genetic diversity of clinical H. pylori isolates is a substantial obstacle in developing a wholekilled cells vaccine. Additionally, the tested vaccine induced among participants many serious side effects,

5

e.g. diarrhea or fever (Kotloff et al., 2001; Losonsky et al., 2003). Another possibility was demonstrated by Smythies et al. (2005) who evaluated the prophylactic potential of the H. pylori ghost. Bacterial ghosts are cell envelopes of Gram-negative bacteria devoid of cytoplasmic content as a result of controlled cell lysis by the MX174 gene product cloned into the bacterial genome. This strategy was shown to give partial protection in an animal model; yet, requires certain improvements and further validation. Subunit Helicobacter vaccines antigen selection Conventional methods used to identify vaccine candidates are based on the analysis of known pathogenic virulence factors in regards to their immunogenicity. Development of genetic engineering methods facilitated the construction of genomic libraries and allowed their screening with specific antibodies taken from patients or immunized animals. A current approach in identifying new, potential, subunit vaccine candidates is reinforced by the recent progress in sequencing of bacterial genomes. Genomes of two H. pylori strains 26695 and J99 have been sequenced recently (Alm et al., 1999; Tomb et al., 1997). Analysis conducted in silico as well as comparison of the genomic content of numerous clinical H. pylori isolates using the microarray technology revealed that their genomes possess 11111281 common genes (Gressmann et al., 2005; Salama et al., 2000). Among them, some will probably be considered as candidates for vaccine development. Common molecular techniques, e.g. microarray technology or proteomics, allow evaluating the diversity of bacterial genomes, analyzing sets of genes expressed in vivo as well as screening of all pathogen antigens and evaluating their application as potential vaccine candidates. It was documented that protective antigens represent only a small fraction of all antigens. In the case of H. pylori, only 10 antigens out of 400 examined revealed protection in preclinical experiments (Ferrero and Labigne, 2001). Abundant, surface-located, conserved and seroreactive antigens might be the most promising candidates in constructing an efficacious vaccine (Bumann et al., 2004; Sabarth et al., 2002). So far, only a few H. pylori antigens, selected by conventional methodologies, were extensively evaluated for their protective potential (CagA, VacA, HspA, NapA, catalase and urease subunit A and B). Although all of these antigens are immunogenic and some were protective in animal models (mice or gerbils), none of them fully protected humans. CagA and VacA, included in many vaccine

6


prototypes, are not conserved and are highly polymorphic. The cagA gene is part of a pathogenicity island which is missing, fully or partially, in some clinical isolates. The vacA gene is present in all genomes but is expressed at different levels. Nonetheless, type I H. pylori strains, expressing both CagA and VacA, are the causative agents of the most dangerous pathologies. So far, the majority of analyzed subunit vaccine candidates contained one or two antigens. However, recent studies indicate that including more antigens might increase vaccine efficacy. Additionally, the latest studies point to an enormous genetic diversity of H. pylori clinical isolates. Thus, comparison of different strains at the protein level seems to be of great importance (Aebischer et al., 2005). Immunoproteomics is a novel strategy combining standard proteomics with immunological screening and is currently the method of choice for identifying new antigens of diagnostic and protective values. It is proposed that highly specific antigens could be used as biomarkers of different pathologies induced by H. pylori infections, whereas novel, highly immunogenic, conserved, abundant and surface-located proteins could facilitate construction of an efficient antiHelicobacter vaccine. Although proteomics are considered useful in evaluating the total protein content in bacterial cells and in studying protein-protein interactions, they display some significant limitations. One of the major problems is the fact that low-abundant and hydrophobic membrane proteins are undetectable by standard methods. More than 1800 H. pylori proteins from the total cell extract have bee resolved by 2-D electrophoresis by Baumann et al. and 384 out of them, being products of 290 genes have been identified (Bumann et al., 2001b). Many studies have been conducted to analyze different H. pylori subproteomes whole sets of surface-located or secreted proteins (Baik et al., 2004; Bumann et al., 2002). Backert et al. has compared subproteomes of soluble and structure-bound proteins of H. pylori 26695 and observed that some proteins known as extracytoplasmic, e.g. NapA or GGT, were detected also in the cytoplasm (Backert et al., 2005). Proteomes of H. pylori growing under different conditions in vitro have been evaluated (Chuang et al., 2005; Slonczewski et al., 2000); yet, our knowledge about sets of proteins produced in vivo is still limited. The Helicobacter sp. immunoproteome has been evaluated in many studies. The majority of analyses was performed with proteins isolated from sequenced strains (mainly the 26695 strain) resolved by 2-D electrophoresis and blotted with sera taken from H. pylori-infected patients, exhibiting different pathologies (Haas et al., 2002; Krah et al., 2003). In the course of numerous studies several antigens were

1

detected; proving the reliability of the proteomics approach. In fact, each study led to the identification of new immunogenic proteins of potential prophylactic value. Some of them, including HP410 (putative neuraminyl-lactose-binding hemagglutinin homologue) or HP0231 (DsbA and DsbC homologue) were protective in the murine infection model (Sabarth et al., 2002). On the other hand, H. pylori membrane proteins described earlier were found to be highly immunogenic, yet were not detected in any immunoproteomic analysis (Lpp or HpaA) (Bumann et al., 2004). Data available on the H. pylori subproteome allowed Bumann et al. to carry out a comparative and comprehensive analysis that resulted in a list of 15 antigens-candidates for vaccine development (Bumann et al., 2004). Recently, Mini et al. (2006) has indicated that identification of antigen(s) of high prophylactic value will still require many immunoproteomic studies, in which, not only sera taken from patients showing different pathologies, but also proteins derived from many H. pylori clinical isolates should be used. Bacterial cells (attenuated pathogenic bacteria and lactic acid bacteria) and viruses as carriers for H. pylori antigens Most pathogenic microorganisms are either restricted to mucosal membranes or need to cross them to achieve their proper infectious niche. For years it was considered that due to the apparent compartmentalization of the mucosal and systemic immune systems, vaccines administrated parenterally are less effective in protection against mucosal pathogens than mucosal immunization. However, more recent data indicates that the protective mechanism can be also stimulated parenterally. The effect seems to be dependent on the antigen delivery system and type of adjuvant used for immunization. Moreover, it should be noticed that although H. pylori colonizes gastric mucosa, vaccine prototypes administrated parenterally were also evaluated. Delivery of vaccine antigens via the mucosal route can be carried out using different strategies. The best examined strategy used both attenuated and commensal microorganisms as bacterial carriers (Kochi et al., 2003). Delivery of vaccine antigens by live bacterial cells has resulted in elucidation of both mucosal and systematic immune responses. Several attenuated Salmonella strains have been exploited as delivery systems for H. pylori antigens, mainly for urease subunits A and B (Angelakopoulos and Hohmann, 2000; Bumann et al., 2001a). The antigens were expressed either as cytoplasmic- or surface-located proteins. Rhiozo et al. showed that exposure of UreA on the

1

7


surface of Salmonella cells by employing part of the E. coli adhesin AIDA-1, greatly reduced the level of H. pylori colonization compared to cytoplasmlocated UreA (Rizos et al., 2003). Recently Smythies documented that the genetically engineered polio virus can be employed as a carrier of H. pylori antigens (UreB) (Smythies et al., 2005). Vaccination of mice with a replicon construct resulted in clearance of established H. pylori infection in 73% of animals compared to 31% of mice immunized with the vector alone. A few attempts have been also undertaken to evaluate lactic acid bacteria potential as carriers for H. pylori antigens (Corthesy et al., 2005; Hanniffy et al., 2004). DNA vs. antigen vaccination DNA vaccination offers an attractive novel approach aimed at eradicating H. pylori infections or at least decreasing the number of severe disease cases. Several attempts have been undertaken to estimate the strategy potential of developing a vaccine against H. pylori. Plasmid DNA containing urease-, catalase- or heat-shock protein-encoding genes as well as genes encoding immunogenic proteins that derived from H. pylori genomic library was administered to mice by different routes (intramuscularly, subcutaneously or intranasally) (Dzwonek et al., 2004; Hatzifoti et al., 2006; Xu et al., 2007). In some experiments, decrease in the bacterial load in the stomach and induction of the humoral immune response were noticed. Vaccination also resulted in an up-regulation of the IL-10 level, whereas detection of $-defensin in the stomach indicated that immunization modulates both innate and adaptive immune responses (Hatzifoti et al., 2006). Attempts to employ attenuated Salmonella strains for anti-Helicobacter DNA vaccination have been also undertaken. Salmonella is an enteroinvasive pathogen which can target plasmid DNA, carrying heterologous genes cloned under the control of eukaryotic promoters, to antigen-presenting cells (APC), specifically to dendritic cells (DC) the major target cells processing the antigen. Expression of foreign antigens results in antigen presentation by class I MHC and stimulation of both Th1 and Th2, T lymphocytes (Garmory et al., 2002; Moll, 2004). Salmonella expressing H. pylori hpaA and napA genes cloned into eucaryotic expression vectors showed high immunogenicity when evaluated in murine model (Sun et al., 2006; Xu et al., 2005). Hatzifoti (Hatzifoti et al., 2006) using urease B DNA vaccine pointed out the role of innate immune response in reducing H. pylori colonization of the murine gastric mucosa.

Human trials The safety and immunogenicity of some vaccines have been tested in several clinical trials. Yet, none of the vaccines against H. pylori has progressed beyond phase 1 of clinical trails. Trials have been conducted with a whole-cell killed vaccine and recombinant H. pylori proteins (urease, CagA, VacA, NapA) administrated orally or parenterally (with or without adjuvant). The prophylactic potential of the recombinant Salmonella enterica sv. Typhi/Typhimurium strains, expressing H. pylori antigens, has also been analyzed. Malfertheiner et al., 2002 obtained promising results in evaluating the immunogenicity of a combined vaccine consisting of three antigens (NapA, CagA and VacA). Intramuscular administration of the vaccine to human volunteers, using alum as an adjuvant, was highly immunogenic. Nonetheless, its efficacy still needs to be determined (Aebischer et al., 2005; Kabir, 2007). Recently Graham et al. (2004) developed a human challenge model of H. pylori infection which is regarded as a significant step for vaccine development. The model has served in evaluating the efficacy of the recombinant Salmonella Ty21a strain expressing the H. pylori urease A and B subunits. For the first time, oral administration of a vaccine prototype to human volunteers conferred protection, proving that development of a human H. pylori vaccine is a challenging but feasible goal (Kabir, 2007). Conclusions We are still a long way from developing a therapeutic and/or prophylactic vaccine against H. pylori for humans. Dr B. Marshall at the Keio Medical Price Symposium in 2002 said: It is likely that to be at least ten more years before we can see a useful vaccine for H. pylori. At present, five years later, we are almost sure that he was perfectly right. The development of an efficacious vaccine requires better understanding of the mechanism of protection and induction of postimmunization gastritis observed in the mouse infection model. Recently developed strategies allowing analysis of the transcriptome and proteome of eukaryotic cells are promising technologies in studying these issues, especially the Helicobacter pylori effect on the intracellular signal transduction in epithelial and immune cells. Immunoproteomics should enable screening a larger number of clinical isolates aimed at identifying new, conserved and seroreactive proteins. In the light of the recent studies, one can also expect that an efficacious vaccine for H. pylori should consist of various formulas administrated as a primary immunization and a booster. Such goal could be achieved using both antigens and DNA vaccination.

8


Literature Aebischer T., A. Schmitt, A.K. Walduck and T.F. Meyer. 2005. Helicobacter pylori vaccine development: facing the challenge. Int. J. Med. Microbiol. 295: 343353. Alm R.A., L.S. Ling, D.T. Moir, B.L. King, E.D. Brown, P.C. Doig, D.R. Smith, B. Noonan, B.C. Guild, B.L. de Jonge and others. 1999. Genomic-sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori. Nature 397: 176180. Angelakopoulos H. and E.L. Hohmann. 2000. Pilot study of phoP/phoQ-deleted Salmonella enterica serovar Typhimurium expressing Helicobacter pylori urease in adult volunteers. Infect. Immun. 68: 21352141. Backert S., T. Kwok, M. Schmid, M. Selbach, S. Moese, R.M. Peek, Jr., W. Konig, T.F. Meyer and P.R. Jungblut. 2005. Subproteomes of soluble and structure-bound Helicobacter pylori proteins analyzed by two-dimensional gel electrophoresis and mass spectrometry. Proteomics 5: 13311345. Baik S.C., K.M. Kim, S.M. Song, D.S. Kim, J.S. Jun, S.G. Lee, J.Y. Song, J.U. Park, H.L. Kang, W.K. Lee and others. 2004. Proteomic analysis of the sarcosine-insoluble outer membrane fraction of Helicobacter pylori strain 26695. J. Bacteriol. 186: 949955. Blaser M.J. and J.C. Atherton. 2004. Helicobacter pylori persistence: biology and disease. J. Clin. Invest. 113: 321333. Bourzac K.M. and K. Guillemin. 2005. Helicobacter pylori-host cell interactions mediated by type IV secretion. Cell Microbiol. 7: 911919. Bumann D., S. Aksu, M. Wendland, K. Janek, U. Zimny-Arndt, N. Sabarth, T.F. Meyer and P.R. Jungblut. 2002. Proteome analysis of secreted proteins of the gastric pathogen Helicobacter pylori. Infect. Immun. 70: 33963403. Bumann D., P.R. Jungblut and T.F. Meyer. 2004. Helicobacter pylori vaccine development based on combined subproteome analysis. Proteomics 4: 28432848. Bumann D., W.G. Metzger, E. Mansouri, O. Palme, M. Wendland, R. Hurwitz, G. Haas, T. Aebischer, B.U. von Specht and T.F. Meyer. 2001a. Safety and immunogenicity of live recombinant Salmonella enterica serovar Typhi Ty21a expressing urease A and B from Helicobacter pylori in human volunteers. Vaccine 20: 845852. Bumann D., T.F. Meyer and P.R. Jungblut. 2001b. Proteome analysis of the common human pathogen Helicobacter pylori. Proteomics 1: 473479. Chmiela M. and P. Michetti. 2006. Inflammation, immunity, vaccines for Helicobacter infection. Helicobacter 11 Suppl 1: 2126. Chuang M.H., M.S. Wu, J.T. Lin and S.H. Chiou. 2005. Proteomic analysis of proteins expressed by Helicobacter pylori under oxidative stress. Proteomics 5: 38953901. Corthesy B., S. Boris, P. Isler, C. Grangette and A. Mercenier. 2005. Oral immunization of mice with lactic acid bacteria producing Helicobacter pylori urease B subunit partially protects against challenge with Helicobacter felis. J. Infect. Dis. 192: 14411449. Cover T.L. and S.R. Blanke. 2005. Helicobacter pylori VacA, a paradigm for toxin multifunctionality. Nature Rev. 3: 320332. Dzwonek A., M. Mikula, M. Woszczynski, E. Hennig and J. Ostrowski. 2004. Protective effect of vaccination with DNA of the H. pylori genomic library in experimentally infected mice. Cell. Mol. Biol. Lett. 9: 483495. Ferrero R.L. and A. Labigne. 2001. Helicobacter pylori vaccine development in the post-genomic era: can in silico translate to in vivo. Scand. J. Immunol. 53: 443448. Fischer W., B. Gebert and R. Haas. 2004. Novel activities of the Helicobacter pylori vacuolating cytotoxin: from epithelial cells towards the immune system. Int. J. Med. Microbiol. 293: 539547.

1

Garmory H.S., K.A. Brown and R.W. Titball. 2002. Salmonella vaccines for use in humans: present and future perspectives. FEMS Microbiol. Rev. 26: 339353. Godlewska R., A. Dzwonek, M. Miku³a, J. Ostrowski, M. Paw³owski, J.M. Bujnicki, and E.K. Jagusztyn-Krynicka. 2006. Helicobacter pylori protein oxidation influences the colonization process. Int. J. Med. Microbiol. 296: 3214. Graham D.Y., A.R. Opekun, M.S. Osato, H.M. El-Zimaity, C.K. Lee, Y. Yamaoka, W.A. Qureshi, M. Cadoz and T.P. Monath. 2004. Challenge model for Helicobacter pylori infection in human volunteers. Gut 53: 12351243. Gressmann H., B. Linz, R. Ghai, K.P. Pleissner, R. Schlapbach, Y. Yamaoka, C. Kraft, S. Suerbaum, T.F. Meyer and M. Achtman. 2005. Gain and loss of multiple genes during the evolution of Helicobacter pylori. PLoS Gen. 1: e43. Haas G., G. Karaali, K. Ebermayer, W.G. Metzger, S. Lamer, U. Zimny-Arndt, S. Diescher, U.B. Goebel, K. Vogt, A.B. Roznowski and others. 2002. Immunoproteomics of Helicobacter pylori infection and relation to gastric disease. Proteomics 2: 313324. Hanniffy S., U. Wiedermann, A. Repa, A. Mercenier, C. Daniel, J. Fioramonti, H. Tlaskolova, H. Kozakova, H. Israelsen, S. Madsen and others. 2004. Potential and opportunities for use of recombinant lactic acid bacteria in human health. Adv. Appl. Microbiol. 56: 164. Hatakeyama M. and T. Brzozowski. 2006. Pathogenesis of Helicobacter pylori infection. Helicobacter 11 Suppl 1: 1420. Hatzifoti C., Y. Roussel, A.G. Harris, B.W. Wren, J.W. Morrow and M. Bajaj-Elliott. 2006. Mucosal immunization with a urease B DNA vaccine induces innate and cellular immune responses against Helicobacter pylori. Helicobacter 11: 113122. Kabir S. 2007. The current status of Helicobacter pylori vaccines: a review. Helicobacter 12: 89102. Kochi S.K., K.P. Killeen and U.S. Ryan. 2003. Advances in the development of bacterial vector technology. Exp. Rev. Vaccines 2: 3143. Kotloff K.L., M.B. Sztein, S.S. Wasserman, G.A. Losonsky, S.C. DiLorenzo and R.I. Walker. 2001. Safety and immunogenicity of oral inactivated whole-cell Helicobacter pylori vaccine with adjuvant among volunteers with or without subclinical infection. Infect. Immun. 69: 35813590. Krah A., F. Schmidt, D. Becher, M. Schmid, D. Albrecht, A. Rack, K. Buttner and P.R. Jungblut. 2003. Analysis of automatically generated peptide mass fingerprints of cellular proteins and antigens from Helicobacter pylori 26695 separated by twodimensional electrophoresis. Mol. Cell Proteomics 2: 12711283. Lagergren J., R. Bergstrom, A. Lindgren and O. Nyren. 1999. Symptomatic gastroesophageal reflux as a risk factor for esophageal adenocarcinoma. N. Eng. J. Med. 340: 825831. Losonsky G.A., K.L. Kotloff and R.I. Walker. 2003. B cell responses in gastric antrum and duodenum following oral inactivated Helicobacter pylori whole cell (HWC) vaccine and LT(R192G) in H. pylori seronegative individuals. Vaccine 21: 562565. £asica A.M. and E.K. Jagusztyn-Krynicka. 2007. The role of Dsb proteins of Gram-negative bacteria in the process of pathogenesis. FEMS Microbiol Rev. 31: 62636. Marshall B. 2003. Helicobacter pylori: past, present and future. Keio J. Med. 52: 8085. Marshall B.J. and J.R. Warren. 1984. Unidentified curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet 1: 13111315. Mini R., B. Annibale, E. Lahner, G. Bernardini, N. Figura and A. Santucci. 2006. Western blotting of total lysate of Helicobacter pylori in cases of atrophic body gastritis. Clin. Chem. 52: 220226. Minoura T., S. Kato, S. Otsu, T. Fujioka, K. Iinuma and A. Nishizono. 2003. Childhood Helicobacter pylori infection in a murine model: maternal transmission and eradication by systemic

1


immunization using bacterial antigen-aluminium hydroxide. Clin. Exp. Immunol. 134: 3237. Moll H. 2004. Antigen delivery by dendritic cells. Int. J. Med. Microbiol. 294: 337344. Naumann M. 2005. Pathogenicity island-dependent effects of Helicobacter pylori on intracellular signal transduction in epithelial cells. Int. J. Med. Microbiol. 295: 335341. Malfertheiner P., V. Schultze., G. Del Giudice, B. Rosenkranz, S.H.E Kaufmann, F. Winau, T. Ulrichs, E. Theophil, C.P. Jue, D. Novicki, and others. 2002. Phase 1 safety and immunogenicity of a three-component H. pylori vaccine. Gastroenterology 122 Suppl. 1, A585. Prinz C., N. Hafsi and P. Voland. 2003. Helicobacter pylori virulence factors and the host immune response: implications for therapeutic vaccination. Trends Microbiol. 11: 134138. Raczko A.M., J.M. Bujnicki , M. Pawlowski, R. Godlewska, M. Lewandowska, and E.K. Jagusztyn-Krynicka. 2005. Characterization of new DsbB-like thiol-oxidoreductases of Campylobacter jejuni and Helicobacter pylori and classification of the DsbB family based on phylogenomic, structural and functional criteria. Microbiology 151: 21931. Radosz-Komoniewska H., T. Bek, J. Jozwiak and G. Martirosian. 2005. Pathogenicity of Helicobacter pylori infection. Clin. Microbiol. Infect. 11: 602610. Rizos K., C.T. Lattemann, D. Bumann, T.F. Meyer and T. Aebischer. 2003. Autodisplay: efficacious surface exposure of antigenic UreA fragments from Helicobacter pylori in Salmonella vaccine strains. Infect. Immun. 71: 63206328. Sabarth N., R. Hurwitz, T.F. Meyer and D. Bumann. 2002. Multiparameter selection of Helicobacter pylori antigens identifies two novel antigens with high protective efficacy. Infect. Immun. 70: 64996503.

9

Salama N., K. Guillemin, T.K. McDaniel, G. Sherlock, L. Tompkins and S. Falkow. 2000. A whole-genome microarray reveals genetic diversity among Helicobacter pylori strains. Proc. Natl. Acad. Sci. USA 97: 1466814673. Slonczewski J.L., D.J. McGee, J. Phillips, C. Kirkpatrick and H.L. Mobley. 2000. pH-dependent protein profiles of Helicobacter pylori analyzed by two-dimensional gels. Helicobacter 5: 240247. Smythies L.E., M.J. Novak, K.B. Waites, J.R. Lindsey, C.D. Morrow and P.D. Smith. 2005. Poliovirus replicons encoding the B subunit of Helicobacter pylori urease protect mice against H. pylori infection. Vaccine 23: 901909. Sun B., Z.S. Li, Z.X. Tu, G.M. Xu and Y.Q. Du. 2006. Construction of an oral recombinant DNA vaccine from H. pylori neutrophil activating protein and its immunogenicity. World J. Gastroenterol. 12: 70427046. Tomb J.F., O. White, A.R. Kerlavage, R.A. Clayton, G.G. Sutton, R.D. Fleischmann, K.A. Ketchum, H.P. Klenk, S. Gill, B.A. Dougherty and others. 1997. The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature 388: 539547. Viala J., C. Chaput, I.G. Boneca, A. Cardona, S.E. Girardin, A.P. Moran, R. Athman, S. Memet, M.R. Huerre, A.J. Coyle and others. 2004. Nod1 responds to peptidoglycan delivered by the Helicobacter pylori cag pathogenicity island. Nat. Immunol. 5: 11661174. Xu C., Z.S. Li, Y.Q. Du, Z.X. Tu, Y.F. Gong, J. Jin, H.Y. Wu and G.M. Xu. 2005. Construction of a recombinant attenuated Salmonella typhimurium DNA vaccine carrying Helicobacter pylori hpaA. World J. Gastroenterol. 11: 114117. Xu C., Z.S. Li, Y.Q. Du, Y.F. Gong, H. Yang, B. Sun and J. Jin. 2007. Construction of recombinant attenuated Salmonella typhimurium DNA vaccine expressing H. pylori ureB and IL-2. World J. Gastroenterol. 13: 939944.

10


1


Amplification of a Single-locus Variable-number Direct Repeats with Restriction Fragment Length Polymorphism (DR-PCR/RFLP) for Genetic Typing of Acinetobacter baumannii Strains ALICJA NOWAK-ZALESKA*1, BEATA KRAWCZYK 2, ROMAN KOT£OWSKI3, AGNIESZKA MIKUCKA4 and EUGENIA GOSPODAREK4 1 Department

of Biology and Ecology, Academy of Physical Education and Sport in Gdañsk, Gdañsk, Poland of Microbiology, Gdañsk University of Technology, Gdañsk, Poland 3 Department of Food Chemistry, Technology and Biotechnology, Gdañsk University of of Technology, Gdañsk, Poland 4 Department of Microbiology, Nicolaus Copernicus University in Toruñ, Collegium Medicum of L. Rydygier in Bydgoszcz, Bydgoszcz, Poland 2 Department

Received 7 May 2007, revised 21 December 2007, accepted 28 December 2007 Abstract In search of an effective DNA typing technique for Acinetobacter baumannii strains for hospital epidemiology use, the performance and convenience of a new target sequence was evaluated. Using known genomic sequences of Acinetobacter baumannii strains AR 319754 and ATCC 17978, we developed single-locus variable-number direct-repeat analysis using polymerase chain reaction-restriction fragment length polymorphism (DR-PCR/RFLP) method. A total of 90 Acinetobacter baumannii strains isolated from patients of the Clinical Hospital in Bydgoszcz, Poland, were examined. Initially, all strains were typed using macrorestriction analysis of the chromosomal DNA by pulsed-field gel electrophoresis (REA-PFGE). Digestion of the chromosomal DNA with the ApaI endonuclease and separation of the fragments by PFGE revealed 21 unique types. Application of DR-PCR/RFLP resulted in recognition of 12 clusters. The results showed that the DR-PCR/RFLP method is less discriminatory than REA-PFGE, however, the novel genotyping method can be used as an alternative technique for generating DNA profiles in epidemiological studies of intra-species genetic relatedness of Acinetobacter baumannii strains. K e y w o r d s: Acinetobacter baumannii, DR-PCR/RFLP, REA-PFGE, repeated sequences, nosocomial infections

Introduction Acinetobacter spp. are aerobic Gram-negative organisms widely distributed in the soil and water of natural environments (Baumann, 1968) and are also important nosocomial pathogens. Acinetobacter outbreaks involving multidrug-resistant strains have occurred worldwide (Bergogne-Berezin, 2001; BergogneBerezin and Towner, 1996; Dijkshoorn et al., 1993; Spence et al., 2004; Dolzani et al., 1995; Paul et al., 2005; Wright 2005; Zapor and Moran, 2005). In hospitalized patients, Acinetobacter baumannii frequently colonizes the skin and upper respiratory tract and has been isolated from human sputum, blood, urine, and feces (Baltimore et al., 1989; Rosenthal and Tager, 1975; Al-Khoja and Darrell, 1979). They are often resistant to commonly used antibiotics and may form a reservoir of antibiotic resistance genes, particularly in hospital environments.

Understanding the fundamental mechanisms underlying Acinetobacter infections, including the original sources of the infecting organisms, their clonality, and geographical spread, is an important requirement for the development of appropriate infection control measures. In epidemiological studies of A. baumannii infections, many phenotyping and genotyping methods were developed. To date, several methods for the genotyping of A. baumannii isolates have been reported. Genotyping allows investigation of clonal spread and can be used to identify the source of the original infection. Traditional Acinetobacter strain typing methods include serotyping (Traub, 1989), multilocus enzyme electrophoresis (Seltmann et al., 1995), and DNAbased methods, including repetitive extragenic palindromic sequence-based PCR (Bou et al., 2000; Misbah et al., 2004; Huys et al., 2005), amplified ribosomal DNA restriction analysis (ARDRA), pulsed-field gel electrophoresis (PFGE) (Gouby et al., 1992; Seifert

* Corresponding author: A. Nowak-Zaleska, Department of Biology and Ecology, Academy of Physical Education and Sport, Kazimierza Górskiego 1, 80-336 Gdañsk, Poland; phone: (48) 58 5547214; e-mail: [email protected]

12

1

Nowak-Zaleska A. et al.

and Gerner-Smidt, 1995), amplified fragment length polymorphism (AFLP) (Koeleman et al., 1998), ribotyping (Vaneechoutte et al., 1995; Ibrahim et al., 1997), and multilocus sequence typing (MLST) (Ecker et al., 2006). Many laboratories are searching for a method that can provide the appropriate level of discriminatory power and is relatively rapid and cheap, especially for large-scale population studies. In the present study we report the application of single-locus variable-number direct-repeats analysis (DR-PCR/RFLP) for the study of intra-species genetic relatedness of A. baumannii. Results from this genotyping assay and REA-PFGE analysis were compared. Experimental Materials and Methods

Bacterial strains. A total of 90 A. baumannii strains isolated from various clinical specimens of patients from University Hospital of Dr A. Jurasz in Bydgoszcz during 20032006, and reference strain A. baumannii CIP 70.34T (ATCC 19606T) were examined. Species identification and biochemical characterization were performed with the biochemical profile index procedure ID GN (bioMérieux, France). The antimicrobial susceptibility test was performed according to standardized disc diffusion Kirby-Bauer method according to CLSI recommendations. REA-PFGE. Initially, all isolates were tested for epidemiological relationships using REA-PFGE. PFGE was performed with the Bio-Rads Instruction Manual and Application Guide. A. baumannii isolates were grown overnight (18 h at 35°C) on Columbia Agar with 5% sheep blood (bioMérieux, France). Briefly, for the preparation of plugs 200 µl of the bacterial cell suspension was gently mixed with 300 ml of 2% low melting point agarose (BioRad) in a 40°C temperature block, transferred to plug molds and allowed to solidify at 4°C. For cell lysis and protein digestion, the plugs were washed with Wash Buffer (20 mM Tris, pH 8.0, 50 mM EDTA), placed in Proteinase K Reaction Buffer (100 mM EDTA, pH 8.0, 0.2% sodium deoxycholate, 1% sodium lauryl sulfate, 1 mg/ml Proteinase K (A&A Biotechnology, Poland) and incubated for 3 h at 55°C. After that, plugs were washed four times with Wash Buffer for 3060 min at room temperature on a rocker. DNA was digested overnight at 37°C with 20 U of ApaI (MBI Fermentas, Lithuania) for 1/3 plug, and separated on 1.2% agarose gel using the Mapper system (BioRad). Electrophoresis was carried out at 200 V in a buffer containing 0.5× TBE buffer (45 mM Tris, pH 8.0, 45 mM boric acid, 1 mM EDTA) with pulses from 2 to 20 s, for 24 h.

Gels were stained with ethidium bromide and photographed under UV light, with use of the GEL DOC 2000 (BioRad). The interpretation of the banding patterns was carried out visually according to the Tenover guidelines (Tenover et al.,1995). Direct repeat locus identification. The currently known A. baumannii strains AR 319754 (US patent 6562958-A, sequence number 2304) and ATCC 17978 nucleotide sequences were scanned for direct repeats by using the Clone Manager 4 and Tandem Repeats Finder program (http://tandem.bu.edu/trf/trf.html). DR-PCR/RFLP. Genomic material from cultured samples was prepared with the Genomic mini (A&A Biotechnology, Poland) according to the manufacturers protocols. All PCRs were assembled in 25-µl reaction mixtures using Gene Amp System 2400 thermocycler (Perkin Elmer). The PCR mix consisted of 1 U of RUN DNA polymerase (A&A Biotechnology, Poland), reaction buffer (10 mM KCl, 10 mM (NH4)2SO4, 0.1% Triton X-100, 20 mM Tris, pH 8.5), 2 mM MgSO4, 2 mM of each deoxynucleoside triphosphate, 25 pM of each primer (Tan1 and Tan2, Table I) and 50 ng/µl of template DNA. The following PCR conditions were used to generate the amplicons: 94°C for 2 min, followed by 35 cycles of 94°C for 1 min, 68 °C for 1 min, 72°C for 2 min, and 72°C for 10 min for final extension. Amplified products were electrophoresed on 1.5% agarose gels stained in ethidium bromide. Images of the gels were analyzed using a Versa Doc Imaging System version 1000 (BioRad). Table I PCR primers used in this study Tan1 Tan2 Rep2

5AGAAGAGGCTCGTGAAGCTGGTGC 5GCATCGCGTTTTTGATTACGAGAGTTCTGG 5GCCGTGCTGCACATGCCAG

The PCR products were digested with the HaeIII, SsiI (MBI Fermentas, Lithuania) and Hpy99I (BioLabs, New England) endonucleases according to manufacturers recommendations. Digested products together with molecular weight marker (Fermentas M23; MBI Fermentas, Lithuania) were electrophoresed on 12% polyacrylamide gels with TBE buffer. Images of the ethidium bromide stained gels were analyzed using a Versa Doc Imaging System version 1000 (BioRad). Sequencing. Based on the known A. baumannii nucleotide sequence the primers Tan2 and Rep2 (Table I) were designed and synthesized. PCR was performed in the reaction solution consisted of 50 ng/µl of A. baumannii DNA, 20 pM of each primer, 2 mM of each dNTPs, reaction buffer (10 mM KCl, 10 mM (NH4)2SO4, 0.1% Triton X-100, 20 mM Tris, pH 8.5), 2 mM MgSO4 and 2 U of WALK DNA polymerase (A&A Biotechnology). The thermal profile consisted of an initial denaturation step at 94°C for 1 min, fol-

1

13

Genetic typing of A. baumannii by DR-PCR/RFLP

lowed by 35 cycles of a 94°C for 1 min, 66°C for 1 min, and 72°C for 2 min. At the end of amplification mixture was subjected to the final extension at 72°C for 10 min. The amplified products were isolated from an agarose gel bands using Gel-Out Kit (A&A Biotechnology). The purified fragments were ligated into pJET1/blunt vector (Gene JETTM PCR Cloning Kit, MBI Fermentas, Lithuania). DNA inserts of obtained recombinant plasmids were sequenced using automatic 310 Applied Biosystems sequencing system.

A

B

C

D

E

F

Results and Discussion Typing by REA-PFGE. The entire collection of 90 A. baumannii isolates was initially analyzed by REAPFGE (Fig. 1). Clustering yielded 21 different REAPFGE types, designated A to W, among all isolates studied. The incidence of the types identified is shown in Table II. The six most common REA-PFGE types, represented by 8 or more isolates each, altogether comprised 68 A. baumannii isolates (75.5%) when one isolate of a given type per patient was considered. These were types A (14 isolates), B (13 isolates), C (13 isolates), D (10 isolates), E (10 isolates), and F (8 isolates). Five other REA-PFGE types grouped from 2 to 3 isolates each and altogether included 12 isolates (13.3%). Finally, the remaining 10 types were unique among the isolates studied (11.1%).

Fig. 1. PFGE profiles for main genotypes of A. baumannii isolates. Names of genotypes refer to genotypes shown in Table II. Chromosomal DNA was digested with ApaI, and the fragments were fractionated in 1.2% agarose gel.

Table II REA-PEGE typing results of A. baumannii strains REA-PEGE Total number of isolates types A B C D E F G H I J K L M N O P R S T U W Total

14 13 13 10 10 8 3 3 2 2 2 1 1 1 1 1 1 1 1 1 1 90

Year of isolation/Number of isolates 2003

2003

2003

2003

0 0 5 0 0 0 1 3 0 2 0 1 0 0 1 1 0 1 0 0 0 15

0 0 5 4 0 5 2 0 0 0 0 0 1 1 0 0 0 0 0 0 1 19

9 2 3 6 9 3 0 0 2 0 2 0 0 0 0 0 0 0 1 0 0 37

5 11 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 19

14

1


GCCGTGCTGCACATGCCAGTGGTAACGCACATGAATTTACCTCAGAAGAGGCTCGTGAAGCTGGTGCTTTAA GTCATAAAAACGATGATCGTAATGGTCGTGGTCGCAGCCGTTATGATGACGACGAAGATGATGACGGTGGCC GTTCAAGTGGTCGAGGCCGTGGCCGCAGTCGTTATGATGATGACGACGAAGATGATGATCGCGGTCGCTCAG GCGGTCGTGGCCGTGGTCGCAATCGTGATGATGACGACGAAGGTGATGATCGCGGTCGCTCAGGTGGCCGAG GCCGTGGTCGCAGCCGTGATGATGACGATGAAGATGATGATCGCGGTCGTTCAGGTGGCCGAGGTCGTGGTC GCAGCCGCCGTGATGACGACGATGAAGATGATGATCGCGGTCGTTCAGGCGGTCGAGGTCGTGGCCGCAGCC GCCGTGATGACGACGATGAAGATGATGATCGCGGTCGCTCAGGTGGCCGAAGTCGTGGCCGCAGCCGCCGTG ATGACGACGATGAAGATGATGATCGTGGCCGTTCAGGTGGCCGAGGCCGTGGTCGCAGCCGTTATGATGACG ACGATGAAGATGATGACCGTGGCCGTTCAGGCGGTCGAGGCCGTGGCCGCAGCCGTTATGATGACGACGATG AAGATGATGACCGTGGCCGTTCAGGTGGCCGAGGCCGTGGTCGCAGCCGTCGTGACGATGACGACGAAGATG ATGATCGTGGCCGTTCAGGTGGCCGAGGCCGTGGTCGCAGCCGTTATGATGACGACGATGAAGATGATGACC GTGGCCGTTCAGGTGGCCGAGGCCGTGGTCGCAGCCGTCGTGATGATGATGACGAAGATGATGATCGCGGTC GTTCAGGTGGTCGAGGCCGTGGCCGCAGTCGTTATGATGATGACGATGAAGATGATGATCGTGGTCGTTCAG GTGGCCGAGGCCGTGGTCGCAGCCGTCGTGATGACGATGACGACGATGATGACCGCCGTGGCCGTTCAGATG GTCGTGGCCAGAACTCTCGTAATCAAAAACGCGATGC Fig. 2. Nucleotide sequence of A. baumannii DNA fragment containing direct repeat sequences (in grey). Nucleotide sequences of Tan1, Tan 2 and Rep2 are underlined (see Table I).

The A. baumannii clone of REA-PFGE type A has been the most prevalent clone of the species in hospital. It made its first appearance among the isolates studied in 2005 (9 isolates) and also was identified in 2006 (5 isolates). It was constantly observed in various wards of the hospital. The second most prevalent A. baumannii clone was REA-PFGE type B. The earliest isolate of the type B clone in the analysis was identified in 2005 (2 isolates) and was isolated until the end of the study in 2006 (11 isolates). The first isolate of the REA-PFGE type C clone (5 isolates) recovered in the study was detected in 2003 and was dominated type in the hospital during that year. This type was also dominated 1 year later. Isolates of the REA-PFGE type E clone (10 isolates) were first recorded in hospital in 2005 (9 isolates), and was detected in 2006. Twenty-four isolates were found to represent sporadic REA-PFGE types. Typing by DR-PCR/RFLP. The analysis of A. baumannii sequenced genome of AR 319754 and ATCC 17978 strains revealed the presence of direct repeat DNA sequences, located at one position (Fig. 2). This sequence comprises two 19-bp direct repeats with different nucleotides at 8 position and ten 22-bp direct repeats with different nucleotides at 5, 8, 11, 14, 16 and 17 positions and two 25-bp direct repeats with different nucleotides at 8 and 14 positions. Direct repeat sequences are interspersed with 4147 bp polymorphic sequences (Fig. 2). Analysis of this repeat region was included to determine its value for genotyping of A. baumannii strains. Based on this sequence oligonucleotide sequences of two primers for the PCR were designed (Tan1 and Tan2, Table I). A total of 90 clinical A. baumannii strains and reference strain were used in this study. The Tan1 and Tan2 primers enabled amplifications of specific regions from all strains tested giving PCR products with length of approximately 1000 bp.

The computer analysis of the A. baumannii direct repeat DNA sequences was performed to determine the most discriminative restriction enzyme for RFLP analysis based on restriction maps. Due to the data obtained we could choose three restriction enzymes HaeIII, Hpy99I and SsiI as the most discriminating. The RFLP analysis with the HaeIII, Hpy99I and SsiI could distinguish 6, 10 and I

II

III

IV

V

VI

VII

M

Fig. 3. DR-PCR/RFLP patterns of the A. baumannii isolates (representative results) of all types obtained by SsiI restriction enzyme. The lane designated M contains the molecular mass marker (242, 190, 147, 111, 110 and 67 bp). The DNA fragments were electrophoresed in 12% polyacrylamide gel. In the panels the genotype names are given above each lane.

1

15

Genetic typing of A. baumannii by DR-PCR/RFLP Table III DR-PCR/RFLP typing results for clinical and reference A. baumannii strains Restriction pattern HaeIII

Hpy99I

SsiI(AciI)

Total restriction pattern

A B A A A C D A A E A A F

A B C D E F D E D H I D J

A B B B C D E B C F B A G

AAA BBB ACB ADB AEC CFD DGE AEB ADC EHF AIB ADA FJG

6

10

7

12

DR-PCR/RFLP types I II III IV V VI VII VIII IX X XI XII XIII A. baumannii CIP 70.34T (ATCC 19606T)

Number of strains

REA-PFGE types

40 18 3 5 9 2 1 2 3 1 3 3

B(13) + A(10) + D(10) + E(7) F(7) + A(3) + G(3) + other(5) I(2) + J + (1) C(3) + I(1) + H(1) C(8) + L(1) M(1) + K(1) O(1) J(1) + C(1) H(2) + F(1) W(1) C(1) + E(1) + U(1) E(2) + A(1)

90

7 pattern types, respectively, among 90 strains tested. The combination of HaeIII, Hpy99I and SsiI restriction patterns gave 12 composite pattern types, designated I to XII (Table III). Representative results of RFLP analysis with the SsiI are shown in Fig. 3. The largest cluster I of DR-PCR/RFLP patterns consisted of 40 strains and analysis showed that isolates with REA-PFGE types A, B, D and E were most related and belonging to this cluster. Here we show the evaluation of a novel genotyping method based on single-locus variable-number directrepeat analysis using polymerase chain reaction-restriction fragment length polymorphism (DR-PCR/RFLP) for epidemiological studies of A. baumannii clinical strains. DR-PCR/RFLP method was able to identify the most dominant genotypes among clinical strains examined (genotypes I and II, Table III). This study shows much lower discriminatory power of DR-PCR/ RFLP method in comparison to the REA-PFGE. However, the DR-PCR/RFLP method is cheaper, faster, and easier to perform than REA-PFGE.

Sequencing data. For four A. baumannii strains belonging to the most prevalent DR-PCR/RFLP type I, the PCR products with Tan2 and Rep2 primers (Table I) were obtained, cloned into pJET1/blunt Vector and sequenced. The obtained DNA sequences were used to identify and compare theirs direct repeats sequences (Fig. 4). Multiple sequence alignment was generated by using the program ClustalX. The results were prepared using the editor program Gendoc (copyright Karl Nicholas). Exactly the same sequences were obtained for four tested strains of type I. The nucleotide sequence for one of them was deposited in the GenBank database under accession number DQ 785810. A 63-bp deletion with one direct repeat was revealed in comparison to A. baumannii sequenced genome of AR 319754. There is also a small heterogeneity between tested strains of type I and A. baumannii sequenced genome of AR 319754 in rest of the sequence (96.1% homogeneity). For further analysis PCR product of clone type II was cloned into pJET1/blunt vector and sequenced

Table IV Simulated and real restriction patterns obtained from restriction maps for HaeIII, Hpy99I and SsiI enzymes Sequences DQ785810 2378 2360 2359 EU009127 AR319754

DR-PCR/ RFLP (group)

HaeIII

Hpy99I

SsiI

I

99, 78, 60, 57, 54, 51, 48, 42, 24, 18, 12, 6

299, 247, 133, 73, 68, 66, 41, 12

170, 124, 102, 78, 66, 56, 38, 34, 33, 32, 28, 18, 16, 12

II

99, 78, 60, 57, 54, 51, 48, 42, 24, 18, 10, 6 99, 78, 66, 60, 57, 54, 51, 48, 42, 30, 18, 12, 6

320, 198, 132, 71, 68, 66, 41, 40

126, 102, 96, 94, 81, 66, 38, 34, 31, 18 236, 124, 110, 102, 63, 56, 51, 38, 34, 32, 28, 16, 12, 6

132, 126, 83, 66, 64, 63, 55, 17, 14

16

1


DQ785810 2378 2360 2359 EU009127 AR319754

: : : : : :

* 20 * 40 * 60 * 80 * 100 GCCGTGCTGCACATGCCAGTGGTAACGCACATGAATTTACCTCAGAAGAGGCTCGTGAAGCTGGTGCTTTAAGTCATAAAAACGATGATCGTAATGGTCG GCCGTGCTGCACATGCCAGTGGTAACGCACATGAATTTACCTCAGAAGAGGCTCGTGAAGCTGGTGCTTTAAGTCATAAAAACGATGATCGTAATGGTCG GCCGTGCTGCACATGCCAGTGGTAACGCACATGAATTTACCTCAGAAGAGGCTCGTGAAGCTGGTGCTTTAAGTCATAAAAACGATGATCGTAATGGTCG GCCGTGCTGCACATGCCAGTGGTAACGCACATGAATTTACCTCAGAAGAGGCTCGTGAAGCTGGTGCTTTAAGTCATAAAAACGATGATCGTAATGGTCG GCCGTGCTGCACATGCCAGTGGTAACGCACATGAATTTACCTCAGAAGAGGCTCCTGAAGCTGGTGCTTTAAGTCATAAAAACGATGATCGTAATGGTCG GCCGTGCTGCACATGCCAGTGGTAACGCACATGAATTTACCTCAGAAGAGGCTCGTGAAGCTGGTGCTTTAAGTCATAAAAACGATGATCGTAATGGTCG

: : : : : :

100 100 100 100 100 100

DQ785810 2378 2360 2359 EU009127 AR319754

: : : : : :

* 120 * 140 * 160 * 180 * 200 TGGTCGCAGCCGTTATGATGACGACGAAGATGATGACCGAGGCCGTTCAAGTGGTCGAGGCCGTGGCCGCAGTCGTTATGATGATGACGACGAAGATGAT TGGTCGCAGCCGTTATGATGACGACGAAGATGATGACCGAGGCCGTTCAAGTGGTCGAGGCCGTGGCCGCAGTCGTTATGATGATGACGACGAAGATGAT TGGTCGCAGCCGTTATGATGACGACGAAGATGATGACCGAGGCCGTTCAAGTGGTCGAGGCCGTGGCCGCAGTCGTTATGATGATGACGACGAAGATGAT TGGTCGCAGCCGTTATGATGACGACGAAGATGATGACCGAGGCCGTTCAAGTGGTCGAGGCCGTGGCCGCAGTCGTTATGATGATGACGACGAAGATGAT TGGTCGCAGCCGTTATGATGACGACGAAGATGATGACCGCGGCCGTTCAAGTGGTCGAGGCCGGTGCCGCAGTCGTTATGATGATGACGACGAAGATGAT TGGTCGCAGCCGTTATGATGACGACGAAGATGATGACGGTGGCCGTTCAAGTGGTCGAGGCCGTGGCCGCAGTCGTTATGATGATGACGACGAAGATGAT

: : : : : :

200 200 200 200 200 200

DQ785810 2378 2360 2359 EU009127 AR319754

: : : : : :

* 220 * 240 * 260 * 280 * 300 GATCGCGGTCGCTCAGGCGGTCG---------------------------------------------------------------TGGCCGTGGTCGCG GATCGCGGTCGCTCAGGCGGTCG---------------------------------------------------------------TGGCCGTGGTCGCG GATCGCGGTCGCTCAGGCGGTCG---------------------------------------------------------------TGGCCGTGGTCGCG GATCGCGGTCGCTCAGGCGGTCG---------------------------------------------------------------TGGCCGTGGTCGCG GTCGTGATGATGACGATGAAGCG-----------------------------------------------------------------GATGATCGCGCG GATCGCGGTCGCTCAGGCGGTCGTGGCCGTGGTCGCAATCGTGATGATGACGACGAAGGTGATGATCGCGGTCGCTCAGGTGGCCGAGGCCGTGGTCGCA

: : : :

237 237 237 237

:

300

DQ785810 2378 2360 2359 EU009127 AR319754

: : : : : :

* 320 * 340 * 360 * 380 * 400 GTCGTGATGATGACGACGAAGATGATGATCGCGGTCGCTCAGGTGGCCGAGGTCGTGGTCGCAGCCGCCGTGATGACGACGATGAAGATGATGATCGCGG GTCGTGATGATGACGACGAAGATGATGATCGCGGTCGCTCAGGTGGCCGAGGTCGTGGTCGCAGCCGCCGTGATGACGACGATGAAGATGATGATCGCGG GTCGTGATGATGACGACGAAGATGATGATCGCGGTCGCTCAGGTGGCCGAGGTCGTGGTCGCAGCCGCCGTGATGACGACGATGAAGATGATGATCGCGG GTCGTGATGATGACGACGAAGATGATGATCGCGGTCGCTCAGGTGGCCGAGGTCGTGGTCGCAGCCGCCGTGATGACGACGATGAAGATGATGATCGCGG GCTCAGATGATGACGACGAAGATGATGATGGCGGTCGATCAGACGACCGAGGTGATGGTCGTAGCCGCGGTGATGACGACGATGAAGATGATGATCGTCG GCCGTGATGATGACGATGAAGATGATGATCGCGGTCGTTCAGGTGGCCGAGGTCGTGGTCGCAGCCGCCGTGATGACGACGATGAAGATGATGATCGCGG

: : : :

337 337 337 337

:

400

DQ785810 2378 2360 2359 EU009127 AR319754

: : : : : :

* 420 * 440 * 460 * 480 * 500 TCGTTCAGGCGGTCGAGGTCGTGGCCGCAGCCGTCGTGATGACGACGATGAAGATGATGATCGTGGCCGTTCAGGTGGCCGAGGTCGTGGTCGCAGCCGT TCGTTCAGGCGGTCGAGGTCGTGGCCGCAGCCGTCGTGATGACGACGATGAAGATGATGATCGTGGCCGTTCAGGTGGCCGAGGTCGTGGTCGCAGCCGT TCGTTCAGGCGGTCGAGGTCGTGGCCGCAGCCGTCGTGATGACGACGATGAAGATGATGATCGTGGCCGTTCAGGTGGCCGAGGTCGTGGTCGCAGCCGT TCGTTCAGGCGGTCGAGGTCGTGGCCGCAGCCGTCGTGATGACGACGATGAAGATGATGATCGTGGCCGTTCAGGTGGCCGAGGTCGTGGTCGCAGCCGT TCGATCAGGTGGCCGAGGTCGTGGTCGCAGCCGCCGTGATGATGACGATGAAGATGATGATCGCGGTCGCTCAGGTGGCCGAGGTCGTGGTCGCAGCCGT TCGTTCAGGCGGTCGAGGTCGTGGCCGCAGCCGCCGTGATGACGACGATGAAGATGATGATCGCGGTCGCTCAGGTGGCCGAAGTCGTGGCCGCAGCCGC

: : : :

437 437 437 437

:

500

DQ785810 2378 2360 2359 EU009127 AR319754

: : : : : :

* 520 * 540 * 560 * 580 * 600 TATGATGACGACGATGAAGATGATGATCGTGGCCGTTCAGGTGGCCGAGGCCGTGGTCGCAGCCGTCGTGATGACGACGATGAAGATGATGATCGCGGTC TATGATGACGACGATGAAGATGATGATCGTGGCCGTTCAGGTGGCCGAGGCCGTGGTCGCAGCCGTCGTGATGACGACGATGAAGATGATGATCGCGGTC TATGATGACGACGATGAAGATGATGATCGTGGCCGTTCAGGTGGCCGAGGCCGTGGTCGCAGCCGTCGTGATGACGACGATGAAGATGATGATCGCGGTC TATGATGACGACGATGAAGATGATGATCGTGGCCGTTCAGGTGGCCGAGGCCGTGGTCGCAGCCGTCGTGATGACGACGATGAAGATGATGATCGCGGTC TATGATGACGACGATGAAGATGATGATCGTGGCCGTTCAGGTGGCCGAGGCCGTGGTCGCAGCCGTCGTGATGACGACGATGAAGATGATGATCGCGGTC CGTGATGACGACGATGAAGATGATGATCGTGGCCGTTCAGGTGGCCGAGGCCGTGGTCGCAGCCGTTATGATGACGACGATGAAGATGATGACCGTGGCC

: : : :

537 537 537 537

:

600

DQ785810 2378 2360 2359 EU009127 AR319754

: : : : : :

* 620 * 640 * 660 * 680 * 700 GCTCAGGTGGCCGAGGTCGTGGTCGCAGCCGTTATGATGACGACGATGAAGATGATGACCGTGGCCGTTCAGGCGGTCGAGGTCGTGGCCGCAGCCGTCG GCTCAGGTGGCCGAGGTCGTGGTCGCAGCCGTTATGATGACGACGATGAAGATGATGACCGTGGCCGTTCAGGCGGTCGAGGTCGTGGCCGCAGCCGTCG GCTCAGGTGGCCGAGGTCGTGGTCGCAGCCGTTATGATGACGACGATGAAGATGATGACCGTGGCCGTTCAGGCGGTCGAGGTCGTGGCCGCAGCCGTCG GCTCAGGTGGCCGAGGTCGTGGTCGCAGCCGTTATGATGACGACGATGAAGATGATGACCGTGGCCGTTCAGGCGGTCGAGGTCGTGGCCGCAGCCGTCG GCTCAGGTGGCCGAGGTCGTGGTCGCAGCCGTTATGATGACGACGATGAAGATGATGACCGTGGCCGTACAGGCGGTCGAGGTCGTGGCCGCAGCCGTCG GTTCAGGCGGTCGAGGCCGTGGCCGCAGCCGTTATGATGACGACGATGAAGATGATGACCGTGGCCGTTCAGGTGGCCGAGGCCGTGGTCGCAGCCGTCG

: : : :

637 637 637 637

:

700

DQ785810 2378 2360 2359 EU009127 AR319754

: : : : : :

* 720 * 740 * 760 * 780 * 800 TGACGATGATGACGAAGATGATGATCGTGGTCGTTCAGGTGGCCGAGGCCGTGGCCGCAGTCGTTATGATGACGACGATGAAGATGATGAACGTGGCCGT TGACGATGATGACGAAGATGATGATCGTGGTCGTTCAGGTGGCCGAGGCCGTGGCCGCAGTCGTTATGATGACGACGATGAAGATGATGAACGTGGCCGT TGACGATGATGACGAAGATGATGATCGTGGTCGTTCAGGTGGCCGAGGCCGTGGCCGCAGTCGTTATGATGACGACGATGAAGATGATGAACGTGGCCGT TGACGATGATGACGAAGATGATGATCGTGGTCGTTCAGGTGGCCGAGGCCGTGGCCGCAGTCGTTATGATGACGACGATGAAGATGATGAACGTGGCCGT TGACGATGATGAGGAAGATGATGATCGTGGTCGTATAGGTGGCCGAGGCCGTGCGCGCAGTCGTTATGAGGACGACGATGAACATGATGATCGTGGCCGT TGACGATGACGACGAAGATGATGATCGTGGCCGTTCAGGTGGCCGAGGCCGTGGTCGCAGCCGTTATGATGACGACGATGAAGATGATGACCGTGGCCGT

: : : :

737 737 737 737

:

800

DQ785810 2378 2360 2359 EU009127 AR319754

: : : : : :

* 820 * 840 * 860 * 880 * 900 TCAGGTGGCCGAGGTCGTGGCCGCAGCCGTCGTGATGATGACGATGAAGATGATGATCGCGGTCGTTCAGGTGGTCGAGGCCGTGGCCGCAGTCGTTATG TCAGGTGGCCGAGGTCGTGGCCGCAGCCGTCGTGATGATGACGATGAAGATGATGATCGCGGTCGTTCAGGTGGTCGAGGCCGTGGCCGCAGTCGTTATG TCAGGTGGCCGAGGTCGTGGCCGCAGCCGTCGTGATGATGACGATGAAGATGATGATCGCGGTCGTTCAGGTGGTCGAGGCCGTGGCCGCAGTCGTTATG TCAGGTGGCCGAGGTCGTGGCCGCAGCCGTCGTGATGATGACGATGAAGATGATGATCGCGGTCGTTCAGGTGGTCGAGGCCGTGGCCGCAGTCGTTATG TCAGGTGGCCGAGGTCGTGGCCGCAGCCGTCGTGATGATGACGATGATGATGATGATCGCGGTCGTTCAGGTGGTCGAGGCCGTGGCCGCAGTCGTTATG TCAGGTGGCCGAGGCCGTGGTCGCAGCCGTCGTGATGATGATGACGAAGATGATGATCGCGGTCGTTCAGGTGGTCGAGGCCGTGGCCGCAGTCGTTATG

: : : :

837 837 837 837

:

900

DQ785810 2378 2360 2359 EU009127 AR319754

: : : : : :

* 920 * 940 * 960 * 980 * 1000 ATGATGACGATGAAGATGATGATCGTGGTCGTTCAGGTGGCCGAGGCCGTGGTCGCAGCCGTCGTGATGACGATGACGACGATGATGACCGCCGTGGCCG ATGATGACGATGAAGATGATGATCGTGGTCGTTCAGGTGGCCGAGGCCGTGGTCGCAGCCGTCGTGATGACGATGACGACGATGATGACCGCCGTGGCCG ATGATGACGATGAAGATGATGATCGTGGTCGTTCAGGTGGCCGAGGCCGTGGTCGCAGCCGTCGTGATGACGATGACGACGATGATGACCGCCGTGGCCG ATGATGACGATGAAGATGATGATCGTGGTCGTTCAGGTGGCCGAGGCCGTGGTCGCAGCCGTCGTGATGACGATGACGACGATGATGACCGCCGTGGCCG ATGATGACGAAGAAGATGATGATCGTGGTCGTTCAGGTGGCCGAGGCCGTGGTCGCAGTCGTCGTGATGACGATGACGACGATGATGACCGCCGTGGCCG ATGATGACGATGAAGATGATGATCGTGGTCGTTCAGGTGGCCGAGGCCGTGGTCGCAGCCGTCGTGATGACGATGACGACGATGATGACCGCCGTGGCCG

: : : :

937 937 937 937

: : : : : :

* 1020 * 1040 TTCAGATGGTCGTGGTCAGAACTCTCGTAATCAAAAACGCGATGC TTCAGATGGTCGTGGTCAGAACTCTCGTAATCAAAAACGCGATGC TTCAGATGGTCGTGGTCAGAACTCTCGTAATCAAAAACGCGATGC TTCAGATGGTCGTGGTCAGAACTCTCGTAATCAAAAACGCGATGC TTCAGACGGTCGTGGTCAGAACTCTCGTAATCAAAAACGCGATGC TTCAGATGGTCGTGGCCAGAACTCTCGTAATCAAAAACGCGATGC

DQ785810 2378 2360 2359 EU009127 AR319754

: 982 : 982 : 982 : 982 : 979 : 1045

: 1000

Fig. 4. Alignment of the nucleotide sequences for four A. baumannii strains belonging to the most prevalent DR-PCR/RFLP type I (DQ 785810, 2378, 2360, 2359), one strain of type II (EU 009127) and reference AR 319754 strain.

1

Genetic typing of A. baumannii by DR-PCR/RFLP

(Fig. 4). The obtained nucleotide sequence was deposited in the GenBank database under accession number EU 009127. A 65-bp deletion with one direct repeat was revealed in comparison to A. baumannii sequenced genome of AR 319754. The results shown in that analysis indicate also heterogeneity between type I, II and A. baumannii AR 319754 sequences (93.7% homogeneity between type I and II, and 91.1% between type II and A. baumannii AR 319754). The computer analysis of the obtained nucleotide sequences revealed that the restriction patterns determined from the sequencing data for three restriction enzymes (HaeIII, Hpy99I and SsiI) were with accordance to restriction patterns obtained using DR-PCR/ RFLP method (Table IV). The present study clearly revealed that the RFLP profiles obtained with restriction enzymes used might be useful for differentiation of A. baumannii strains. The use of additional enzymes might allow a higher degree of discrimination between isolates and may be regarded as an auxiliary method in relation to REA-PFGE for epidemiological studies. Acknowledgements Financial support was obtained from Polish State Committee for Scientific Research (grant no KBN 2P05D 101 28) We thank Dr A. Burkiewicz from A&A Biotechnology (Poland) for assistance and advice.

Literature Al-Khoja M.S. and J.H. Darrell. 1979. The skin as the source of Acinetobacter and Moraxella species occurring in blood cultures. J. Clin. Pathol. 32: 497499. Baltimore R.S., R.L. Duncan, E.D. Shapiro and S.C. Edberg. 1989. Epidemiology of pharyngeal colonization of infants with aerobic gram-negative rod bacteria. J. Clin. Microbiol. 27: 9195. Baumann P. 1968. Isolation of Acinetobacter from soil and water. J. Bacteriol. 96: 3942. Bergogne-Berezin E. 2001. The increasing role of Acinetobacter species as nosocomial pathogens. Curr. Infect. Dis. Rep. 3: 440444. Bergogne-Berezin E. and K.J. Towner. 1996. Acinetobacter spp. as nosocomial pathogens: microbiological, clinical, and epidemiological features. Clin. Microbiol. Rev. 9:148165. Bou G., G. Cervero, M.A. Dominguez, C. Quereda and J. Martinez-Beltran. 2000. PCR-based DNA fingerprinting (REP-PCR, AP-PCR) and pulsed-field gel electrophoresis characterization of a nosocomial outbreak caused by imipenem- and meropenem-resistant Acinetobacter baumannii. Clin. Microbiol. Infect. 6: 635643. Dijkshoorn L., H.M. Aucken, P. Gerner-Smidt, M.E. Kaufmann, J. Ursing and T.L. Pitt. 1993. Correlation of typing methods for Acinetobacter isolates from hospital outbreaks. J. Clin. Microbiol. 31: 702705. Dolzani L., E. Tonin, C. Lagatolla, L. Prandin and C. MontiBragadin. 1995. Identification of Acinetobacter isolates in the A. calcoaceticus-A. baumannii complex by restriction analysis of the 16S-23S rRNA intergenic-spacer sequences. J. Clin. Microbiol. 33: 11081113.

17

Ecker J.A., C. Massire, T.A. Hall, R. Ranken, T.T. Pannella, I.C. Agasino, L.B. Blyn, S.A. Hofstadler, T.P. Endy, P.T. Scott and others. 2006. Identification of Acinetobacter species and genotyping of Acinetobacter baumannii by multilocus PCR and mass spectrometry. J. Clin. Microbiol. 44: 29212932. Gouby A., M.J. Carles-Nurit, N. Bouziges, G. Bourg, R. Mesnard and P.J. Bouvet. 1992. Use of pulsed-field gel electrophoresis for investigation of hospital outbreaks of Acinetobacter baumannii. J. Clin. Microbiol. 30: 15881591. Huys G., M. Cnockaert, A. Nemec, L. Dijkshoorn, S. Brisse, M. Vaneechoutte and J. Swings. 2005. Repetitive-DNA-element PCR fingerprinting and antibiotic resistance of pan-European multi-resistant Acinetobacter baumannii clone III strains. J. Med. Microbiol. 54: 851856. Ibrahim A., P. Gerner-Smidt and W. Liesack. 1997. Phylogenetic relationship of the twenty-one DNA groups of the genus Acinetobacter as revealed by 16S ribosomal DNA sequence analysis. Int. J. Syst. Bacteriol. 47: 837841. Koeleman J.G.M., J. Stoof, D.J. Biesmans, P.H.M. Savelkoul and C.M.J.E. Vandenbroucke-Grauls. 1998. Comparison of amplified ribosomal DNA restriction analysis, random amplified polymorphic DNA analysis, and amplified fragment length polymorphism fingerprinting for identification of Acinetobacter genomic species and typing of Acinetobacter baumannii. J. Clin. Microbiol. 36: 25222529. Misbah S., S. AbuBakar, H. Hassan, Hanifah Y.A. and M.Y. Yusof. 2004. Antibiotic susceptibility and REP-PCR fingerprint of Acinetobacter spp. isolated from a hospital ten years apart. J. Hosp. Infect. 58: 25461. Paul, M., M. Weinberger, Y. Siegman-Igra, T. Lazarovitch, I. Ostfeld, I. Boldur, Z. Samra, H. Shula, Y. Carmeli, B. Rubinovitch and others. 2005. Acinetobacter baumannii: emergence and spread in Israeli hospitals 19972002. J. Hosp. Infect. 60: 256260. Rosenthal S. and I.B. Tager. 1975. Prevalence of gram-negative rods in the normal pharyngeal flora. Ann. Intern. Med. 83: 355357. Seifert H. and P. Gerner-Smidt. 1995. Comparision of ribotyping and pulsed-field gel electrophoresis for molecular typing of Acinetobacter isolates. J. Clin. Microbiol. 33: 14021407. Seltmann G., W. Beer, H. Claus and H. Seifert. 1995. Comparative classification of Acinetobacter baumannii strains using seven different typing methods. Zentbl. Bakteriol. 282: 372383. Spence R.P., T.J. van der Reijden, L. Dijkshoorn and K.J. Towner. 2004. Comparison of Acinetobacter baumannii isolates from United Kingdom hospitals with predominant Northern European genotypes by amplified-fragment length polymorphism analysis. J. Clin. Microbiol. 42: 832834. Tenover F.C., R.D. Arbeit, R.V. Goering, P.A. Mickelsen, B.E. Murray, D.H. Persing and B. Swaminathan. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. 33: 22332239. Traub W.H. 1989. Acinetobacter baumannii serotyping for delineation of outbreaks of nosocomial cross-infection. J. Clin. Microbiol. 27: 27132716. Vaneechoutte M., L. Dijkshoorn, I. Tjernberg, A. Elaichouni, P. de Vos, G. Claeys and G. Verschraegen. 1995. Identification of Acinetobacter genomic species by amplified ribosomal DNA restriction analysis. J. Clin. Microbiol. 33: 1115. Wright M.O. 2005. Multi-resistant gram-negative organisms in Maryland: a statewide survey of resistant Acinetobacter baumannii. Am. J. Infect. Control. 33: 419421. Zapor M.J. and Moran K.A. 2005. Infectious diseases during wartime. Curr. Opin. Infect. Dis. 18: 395359.

18


1


Regulation of Yersinia enterocolitica mal genes by MalT and Mlc proteins ADRIANNA RACZKOWSKA*, MARTA BRZÓSTKOWSKA and KATARZYNA BRZOSTEK

Department of Applied Microbiology, Institute of Microbiology, Faculty of Biology University of Warsaw, 02-089 Warszawa, Poland Received 25 October 2007, revised 29 September 2007, accepted 5 December 2007 Abstract To show the role of MalT protein in the regulation of mal genes, encoding proteins involved in transport and metabolism of maltose/ maltodextrins in Yersinia enterocolitica, we constructed a malT mutant which was characterized by a strong reduction in maltose transport and a loss of MBP protein. We also studied the influence of MalT activity on the production of Yop proteins in Y. enterocolitica and found that the level of these virulence factors is not changed in the malT mutant. Subsequently, transcriptional fusion malT::lacZYA was applied to study the activity of malT promoter. Monitoring of $-galactosidase activity suggests the influence of catabolic repression on malT transcription, since the activity of malT promoter was decreased twofold in the presence of glucose. Furthermore, Mlc protein was identified in Y. enterocolitica as a factor regulating the transcription of malT. We observed a two-fold increase in the level of malT transcription in the mlc mutant background. Moreover, overproduction of Mlc protein strongly inhibited the activity of malT promoter. Thus, the data presented in this study suggest that the level of mal gene expression in Y. enterocolitica may be regulated by two proteins: MalT, the activator of mal transcription and Mlc, the repressor of malT expression. K e y w o r d s: Yersinia enterocolitica, MalT protein, maltose regulon

Introduction The maltose regulon in Escherichia coli is composed of several genes encoding proteins which are involved in the effective use of maltose and maltodextrins as carbon and energy sources. Proteins required for active transport of these sugars are encoded by genes of two divergent operons, malEFG and malKlamBmalM (Boos and Schuman, 1998). In the first operon, the malE gene encodes the periplasmic maltose-binding protein (MBP), whereas the malF and malG genes encode the inner membrane components of the maltose transport system. In the second operon, the malK gene codes for an ATPase energizing maltose transport, which is attached to the inner surface of the cytoplasmic membrane via the EAA loop of MalF and MalG. The lamB gene codes for the lambda receptor (maltoporin) which facilitates the permeation of maltose/maltodextrins through the outer membrane. The last gene of this operon, malM, encodes an envelope protein with an unknown function. Metabolism of maltose/maltodextrins involves three enzymes: amylomaltase, maltodextrin phosphorylase and amylase,

which are encoded by the malQ, malP and malS genes, respectively (Schneider et al., 1992). Expression of the maltose regulon in E. coli is positively controlled by a specific transcriptional activator, MalT protein (Richet and Raibaud, 1987). MalT belongs to a class of bacterial transcriptional activators of MalT or LAL family. MalT binds and activates its target promoters only in the presence of ATP and a specific internal inducer i.e. maltotriose. Maltose added to the growth medium of E. coli functions as an external inducer (Ehrmann and Boos,1987; Raibaud and Richet, 1987). The regulation of MalT activity involves at least three negative effector proteins: MalK, the ATPase of the maltose/maltodextrins ABC (ATP-binding cassette) transporter (Schreiber et al., 2000; Joly et al., 2004), MalY, a protein homologous to $C-S lyases (Schlegel et al., 2002), and Aes, which is homologous to acylesterases (Joly et al., 2002). Furthermore, malT expression is regulated by the cAMP/CAP complex and is, therefore, under catabolite repression control (Chapon, 1982). The malT gene transcription is also dependent on the activity of Mlc global regulator.

* Corresponding author: A. Raczkowska, Department of Applied Microbiology, Institute of Microbiology, University of Warsaw, Miecznikowa 1, 02-089 Warsaw, Poland; e-mail: [email protected]

20

1

Raczkowska A. et al.

Mlc (makes large colonies) is a repressor that regulates the expression of several genes involved in sugar metabolism (Bohm and Boos, 2004; Plumbridge, 1998; Kim et al., 1999). The activity of Mlc protein is modulated through the interaction with the major glucose transporter, EIICBGlc, in response to external glucose (Tanaka et al., 2000). In the absence of glucose, PTS protein is phosphorylated by PEP (phosphoenolpyruvate). The phospho-form of EIICBGlc does not interact with Mlc which could bind to DNA and repress target genes encoding the components necessary for glucose transport. On the other hand, the transport of glucose results in the dephosphorylation of EIICBGlc and the derepression of Mlc-dependent genes (Seitz et al., 2003). The maltose system and homologs of mal genes have been also identified and described in other Gramnegative bacteria (Boos and Schuman, 1998). In the case of Klebsiella pneumoniae additional pulA gene, encoding pullulanase, appears to be a part of the maltose regulon (Konishi et al., 1979). Very little is known about the maltose system in Yersinia enterocolitica, a human enteropathogen. These bacteria secrete several essential virulence factors called Yop proteins using Type III secretion system encoded by the pYV plasmid. Six of these Yop proteins are effectors, which after translocation into the cytoplasm of host cells interfere with the signaling pathways involved in the regulation of the actin cytoskeleton, phagocytosis, apoptosis and the inflammatory response (Navarro et al., 2005). The remaining substrates of Type III secretion system regulate synthesis, secretion and facilitate transport of Yop effector proteins (Cornelis et al., 1998). We have previously identified two components involved in the maltose/maltodextrins transport in Y. enterocolitica, namely maltoporin (OmpM), analogous to LamB of E. coli (Brzostek et al., 1993), and periplasmic maltose-binding protein MalE (MBP, maltose binding protein) (Brzostek and Raczkowska, 2001). Moreover, we have found a correlation between the functioning of the maltose system and the level of Y. enterocolitica Yop proteins secreted into the growth medium. Maltose mutants generated by transposon mutagenesis were both impaired in the maltose transport and Yops production (Brzostek et al., 1993). Inactivation of some mal genes by transposon insertion has been reported to affect the production and secretion of main virulence factors in Vibrio cholerae. In addition, the intact maltose transport system seems to be crucial for the translocation of these virulence factors across the outer membrane (Lang et al., 1994). In this study, we focused on the role of MalT in the regulation of maltose transport in Y. enterocolitica. We also searched for a correlation between the functioning of MalT and the production of Yop proteins.

The effect of catabolic repression and the influence of the Mlc global repressor on the transcription of malT in Y. enterocolitica were investigated. Experimental Materials and Methods

Bacterial strains and plasmids. The strains and plasmids used in this study are listed in Table I. Growth media and culture conditions. E. coli strains were grown aerobically in LB medium at 37°C, whereas Y. enterocolitica strains were incubated at 25°C in LB medium and minimal medium A (MMA) (Miller, 1972) supplemented with casamino acids (0.5%), glycerol (0.2%) and glucose (0.2%). In other experiments glycerol (0.2%) and maltose (0.2%) were used as the carbon source. For the induction of Yop proteins, the LB-MOX medium was applied (LB supplemented with 20 mM MgCl2 and 20 mM sodium oxalate). When necessary, antibiotics were used at following concentrations: nalidixic acid, 30 µg/ml; chloramphenicol, 12.5 µg/ml; kanamycin, 50 µg/ml. Isolation of Y. enterocolitica insertional malT mutant. For the construction of MalT-deficient derivative, a 695 bp fragment of the malT gene from Y. enterocolitica Ye9 (serotype O9) was amplified with Taq polymerase using primers TfX1 (5-TCGTCTAGACG CCTGACCGGTGAAGATAACG-3 [underlining indicates an additional XbaI site]) and TrS2 (5-TCCCC CGGGCTCGGTTTGCTGCATCATCGGC-3 [underlining indicates an additional SmaI site]). The obtained fragment was ligated into the commercial pDrive cloning vector (Qiagen) to generate plasmid pDT4. Subsequently, the XbaI/SmaI fragment of malT was subcloned into the SmaI/XbaI-digested suicide conjugative plasmid pEP185.2 (CmR) (Kinder et al., 1993). The resulting plasmid, pET8, was conjugated into Y. enterocolitica Ye9N (NalR) and transconjugants, malT mutants, carrying this construct inserted into their chromosome, were selected on LB medium with chloramphenicol (12.5 µg/ml). Transconjugants were tested on McConkey agar supplemented with maltose (1%). Construction of malT::lacZYA fusion. For the construction of malT::lacZYA chromosomal transcriptional fusion, XbaI/SmaI fragment of the malT gene from the pDT4 plasmid was cloned into SmaI/XbaIdigested suicide conjugative plasmid, pFUSE (CmR) with oriR6K, mobRP4 and the promoterless lacZYA genes (Bäumler et al., 1996). The resulting plasmid, pFT2 (Fig. 1), was conjugated into Y. enterocolitica Ye9N (NalR) and transconjugants carrying this construct inserted into their chromosome were selected. The function of the malT promoter driving lacZYA expression in selected transconjugants was initially

1

21

Regulation of Y. enterocolitica mal genes Table I Strains and plasmids used in this study

Strain or plasmid Y. enterocolitica O9 strains Ye9N pYV+, NalR

Relevant characteristic(s)

MB3 Ye18 Ye20 AR2 E. coli strains DH5" S17-1 8pir Plasmids pDrive pDT4 pEP185.2 pET8 pFUSE pFT2 pD5Mlc pBBR1 MCS-2 pBBRM7 pRK2013 pDM3 pEP12

pYV+, NalR, malT::pET8 pYV+, NalR, malT::lacZYA (CmR) pYV+, NalR, malT::lacZYA (CmR), pBBRM7 (Km R) pYV+, NalR, mlc::pEPM1, malT::lacZYA (Cmr)

Cloning vector, AmpR, Km R pDrive with 695 bp fragment of malT gene Suicide vector, CmR pEP185.2 with XbaI/SmaI fragment of malT gene from pDT4, CmR Suicide vector, derivative of pPEP185.2 with the promoterless lacZYA genes, CmR pFUSE with SmaI/XbaI fragment of malT from pDT4 to give malT::lacZYA, CmR 1283 bp fragment of entire mlc gene with rbs Cloning vector, KmR pBBR1 MCS-2 with SmaI/XbaI fragment of mlc with rbs from pD5Mlc, KmR Helper plasmid, KmR pDrive with 633 bp fragment of mlc, KmR Suicide, conjugative vector, Km R

pEPM1

pEP12 with EcoRV/XhoI fragment of mlc from pDM3, KmR

Reference or source Department of Applied Microbiology, Warsaw University This study This study This study This study

recA1 endA1 gyrA96 thi-1 hsdR17(rk mk+) supE44)lacU169 F (M80dlacZM15) (Sambrook et al., 1989) recA thi pro hsdR M+ (RP42 Tc::Mu-Km::Tn7), 8 pir (Simon et al., 1983)

confirmed on LB agar plate supplemented with X-gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside, 20 µg/ml) and incubated at 25°C. Cloning of the mlc sequence in pBBR1 MCS-2 vector. The 1283 bp PCR product containing entire mlc coding sequence with rbs was amplified with primers YmlcS1 (5-TCCCCCGGGCTCGGTGACAGAGAA GGAGC-3 [underlining indicates an additional SmaI site]) and YmlcX2 (5-TGCTCTAGACCTATCCTTG CAGGAGAGTTTCACC-3[underlining indicates an additional XbaI site]). The resulting product was ligated into the pDrive cloning vector (pD5Mlc), then subcloned into a medium copy, mobilizable pBBR1 MCS-2 cloning vector (KmR) (Kovach et al., 1995) digested with SmaI and XbaI to create pBBRM7 construct. Then, using the E. coli DH5" strain containing the helper plasmid pRK2013 (Figurski and Helinski, 1979), which provides tra and mob genes, the pBBRM7 plasmid was mobilized into Y. enterocolitica strains by triparental mating. Strains with active malT::lacZYA transcriptional fusion were selected on LB medium with Nal, Cm and Km. Isolation of Y. enterocolitica mlc mutant. For construction of an Mlc-deficient derivative, a 633 bp fragment of the mlc gene was PCR amplified with Taq polymerase using primers MlcE1 (5-TCCGATATCT GACGGCTATCGCCATTACCATGCA-3[underlining indicates an additional EcoRV site]) and MlcX2 (5-TGCCTCGAGTGGCGAATACAAGATCCAATG

Qiagen This study (Kinder et al., 1993) This study (Bäumler et al., 1996) This study This study (Kovach et al., 1995) This study (Figurski and Helinski, 1979) This study Department of Applied Microbiology, Warsaw University This study

GCGA-3[underlining indicates an additional XhoI site]). The obtained product was ligated with the pDrive cloning vector (pDM3), then subcloned into a suicide, conjugative vector, pEP12 (KmR), digested with EcoRV and XhoI. The resulting plasmid, pEPM1, was integrated into the chromosome of Ye18 strain by a single recombination event between the 633 bp mlc sequence in pEPM1 and the corresponding region of mlc on the chromosome. Transconjugants were selected on LB plates supplemented with the appropriate antibiotics (Nal, Cm, Km). $-galactosidase assay. The $-galactosidase activity was assayed at 28°C as described by Miller (1972), using chloroform and 0.1% SDS to disrupt the cells. The enzyme activities, expressed in Miller units, represent the average from assays performed in duplicate in three independent experiments. The variations observed between independent experiments did not exceed 20%. Isolation of periplasmic proteins. Bacterial periplasmic proteins were prepared according to the method described previously (Brzostek and Raczkowska, 2001). Cultures were grown overnight at 25°C in MMA supplemented with casamino acids (0.5%) and glycerol (0.2%). For induction, maltose (0.2%) was added to the growth medium. Induction and isolation of Yop proteins. Overnight cultures of Y. enterocolitica strains were subcultured in LB-MOX medium at 25°C and incubated to

22


1

Fig. 1. Construction of the suicide conjugative plasmid carrying a fragment of malT to create a chromosomal transcriptional fusion.

OD600 0.3. Induction of Yops was carried out at 37°C for 3 h. Secreted proteins were precipitated at 4°C overnight with 5% TCA and centrifuged at 10 000× g for 20 min at 4°C. The pellet of Yop proteins was washed with 70% cold acetone and suspended in the electrophoresis sample buffer. SDS-PAGE. Electrophoresis of periplasmic proteins and secreted Yop proteins isolated from Y. en-

terocolitica strains was done on 10% SDS-polyacrylamide gels according to Sambrook et al. (1989). Transport of maltose. Bacteria were grown in minimal medium A (MMA) supplemented with casamino acids (0.5%), glycerol (0.2%) (uninduced cells) or glycerol (0.2%) and maltose (0.2%) (induced cells). Cells from the exponential phase of growth were washed and resuspended in phosphate-buffered saline

1

Regulation of Y. enterocolitica mal genes

to the value of OD578 = 0.1. At time zero, [14C] maltose (specific activity 540 mCi/mmol, 20 GBq/mmol; final concentration 3×102 µM) was added. Samples were withdrawn after 20, 40, 60, 120, 180 s and filtered through membrane filters. The radioactivity of the dried filters was determined. Sequencing of the mlc gene from Y. enterocolitica O9. The fragment of DNA containing entire mlc coding sequence with rbs subcloned in pD5Mlc vector was sequenced using standard primers for SP6 promoter and T7 promoter on an ABI PRISM® 377 DNA Sequencer (GMI, Inc) (DNA Sequencing and Oligonucleotide Synthesis Laboratory, IBB PAN, Warsaw). Alignment procedures were carried out using EMBL software. Results and Discussion The MalT protein in E. coli is a transcriptional activator essential for mal gene expression. In this study, we investigated the role of the MalT protein in the functioning of the maltose system in Y. enterocolitica. Thus, we constructed Y. enterocolitica malT insertional mutants, one of which (named MB3) was chosen for further analysis. The lack of functional MalT resulted in the loss of the ability to ferment maltose, so malT mutants formed white colonies on MacConkey plates supplemented with maltose, in contrast to the wild type strain (red colonies). Construction of malT mutants was confirmed by PCR and Southern analysis (data not shown). In order to demonstrate that MalT regulates mal genes expression in Y. enterocolitica, the production

23

of a periplasmic MBP protein (MalE), a component of the maltose transport system, was examined in Ye9N (wild type) and MB3 (malT strain), growing in MMA in the presence or absence of maltose as an external inducer. Electrophoretic analysis (SDS-PAGE) of periplasmic proteins of Ye9N strain indicated the presence of MBP at a position corresponding to the apparent molecular mass of about 40 kDa in the sample obtained from cells grown under conditions inducing the maltose system. In uninduced cells, MBP was not present. The lack of MalT protein in MB3 strain resulted probably in the inhibition of malE expression, because we could not detect any band corresponding to the MBP protein in both inducible and uninducible growth conditions (data not shown). These findings are in agreement with our previous studies, which showed that in Y. enterocolitica the synthesis of both MBP and LamB proteins as well as the transport of maltose into the cells are induced by maltose, necessary for MalT activation. We also demonstrated that rabbit antibodies raised against the MBP of E. coli cross-react with the analogous protein from Ye9 and that the MBP of Y. enterocolitica restores the maltose transport activities in the E. coli malE mutant (Brzostek and Raczkowska, 2001). For additional characterization of Y. enterocolitica malT mutant, the rate of maltose transport was determined (Fig. 2). The uptake of maltose into Ye9N cells increased about twenty-eight-fold in strain growing in the presence of maltose, compared with the medium supplemented with glycerol alone. The mutant lacking MalT protein (MB3 strain) was drastically impaired in transport, irrespective of the growth medium (maltose induction). These results show that the

Fig. 2. Transport of [14C] maltose in Y. enterocolitica strains. Bacteria were grown in MMA supplemented with glycerol (0.2%) or glycerol (0.2%) and maltose (0.2%) as a inducer. Ye9N strain, induced (n) and uninduced cells (o); MB3 strain, induced (●) and uninduced cells (¡). Data shown are means of duplicate experiments.

24

1


Fig. 3. SDS-PAGE of Yop proteins isolated from Y. enterocolitica strains. Yop proteins were induced 3 h at 37°C in LB medium (MOX version) and precipitated with 5% TCA from the supernatant of a culture. Lane 1 Protein Molecular Weight Marker (MBI Fermentas); lane 2 Ye9N (25°C); lane 3 Ye9N (37°C); lane 4 MB3 (25°C); lane 5 MB3 (37°C). The position of same Yop proteins is indicated.

activity of MalT in Y. enterocolitica depends on the presence of the external inducer i.e. maltose and that this protein regulates the expression of mal genes playing a similar role as in E. coli. In addition, we analyzed the malT mutant of Y. enterocolitica paying special attention to the virulence phenotype i.e. Yops production. Such studies were prompted by the results of our earlier observations indicating that transposon mutants impaired in the maltose transport activity demonstrate a reduced level of Yop proteins (Brzostek et al., 1995). To verify the hypothesis that the maltose regulon affects Yops production/secretion, the profile of Yop proteins was analyzed by SDS-PAGE. Ye9 strain synthesized and secreted the set of Yop proteins at 37°C in the absence of calcium ions in the growth medium (Fig. 3, lane 3), but not at 25°C (Fig. 3, lane 2). The loss of MalT did not affect Yop production, the protein profile of the malT mutant was identical to the profile of the wild type strain (Fig. 3, lane 4 and 5). An additional but significant aim of our study was to investigate factors controlling malT expression in Y. enterocolitica. It is known that the malT transcription in E. coli is regulated by the cAMP/CAP complex and is subject to catabolite repression (Chapon,

1982). In order to monitor the role of the presence of glucose in the medium in Y. enterocolitica malT expression, we applied Ye18 strain, carrying chromosomal transcriptional fusion of malT::lacZYA. To create this fusion the suicide conjugative plasmid pFT2 was constructed (Fig. 1). The malT::lacZYA fusion located on the chromosome was confirmed by PCR with a pair of primers: MalT1 (5-TGTCTAGACAAT CGCCAGGACGTCTTC-3), designed for the nucleotide sequence of the chromosomal part of malT, and LacZ2 (5-AGTCTCAATCTGCACTACAA-3) for lacZ sequence present on the pFUSE plasmid. The activity of the malT promoter was examined in strains growing in MMA medium supplemented with glycerol or glycerol and glucose. We observed that the level of transcription of the malT::lacZYA fusion was reduced above two-fold in the presence of glucose in the growth medium compared with the glycerol alone (Table II). These results suggest that malT transcription in Y. enterocolitica is sensitive to catabolite repression. Considering that Mlc, known as a global repressor of several genes encoding proteins required for sugar utilization in E. coli, may influence malT transcription in Y. enterocolitica, we studied Mlc activity in Yersinia cells. Firstly, mlc gene was identified and the sequence analysis indicated that this gene encodes a protein of 406 amino acid residues (Fig. 4). The comparison of the amino acid sequence of Mlc of Y. enterocolitica with Mlc from E. coli K12 revealed a high level of similarity (82%). Amino acid sequence alignment of the Mlc Y. enterocolitica O9 (Ye9) with Y. enterocolitica serotype O8 (Ye8) and Y. pestis (Yp) revealed 99% and 93% similarity, respectively. To analyze Mlc properties we measured the effect of mlc mutation on malT transcription. Y. enterocolitica mlc mutant was constructed in a strain carrying a transcriptional fusion malT::lacZYA. The level of malT transcription in the mlc mutant derivative (AR2 strain) was approximately two-fold-higher than in Ye18 strain (Mlc+), indicating that Mlc negatively regulates malT expression at the transcriptional level (Table II). In addition, the malT expression in AR2 strain decreased when glucose was added into the growth medium. Table II Expression of malT::lacZYA transcriptional fusion in Y. enterocolitica strains Strains Ye18 (Mlc+) Ye20 (Ye18/pBBRM7) AR2 (Mlc) a

malT::lacZYA expressiona Glycerol Glucose 650 ± 15 280 ± 12 100 ± 6 85 ± 8 1100 ± 96 580 ± 10

Cells were grown in MMA medium supplemented with 0.2% glycerol or 0.2% glycerol and 0.2% glucose. Culture samples were taken at the OD600 of 0.6, and $-galactosidase activities in Miller units were determined. Each value is the average of three independent experiments ± SD.

1

Regulation of Y. enterocolitica mal genes

25

Fig. 4. Amino acid sequence alignment of the Y. enterocolitica Ye9 Mlc with Y. enterocolitica serotype O8 (Ye8), Y. pestis (Yp), and E. coli (Ec) homologues. Changes in amino acids are indicated by grey background. The amino acid sequence of Y. enterocolitica O8 was obtained from the Sanger Institute (http://www.sanger.ac.uk), Y. pestis and E. coli from NCBI (http://www.ncbi.nlm.nih.gov/).

Confirmation of the effect of a lack of functional Mlc protein should have emerged from the complementation experiments. To carry out genetic complementation, the pBBRM7 plasmid expressing Mlc was constructed. Unfortunately, the complementation of the mlc mutation in the strain AR2 was not achieved with plasmid pBBRM7. We were able to introduce pBBRM7 only to Ye18 (Mlc, malT::lacZYA) yielding Ye20 strain. When Mlc was expressed from pBBRM7 an inhibitory effect of this protein was observed. The

level of malT transcription was six-fold decreased in Ye20 compared with Ye18 strain (Table II). These results suggest that Mlc may control mal gene expression by regulating the amount of MalT protein. Taken together, our data suggest that the level of malT transcription may be a result of the functioning of two opposing factors, the cAMP-CRP complex (activator) and the Mlc protein (repressor). These results are in agreement with the data obtained for E. coli and may reflect a common feature of genes belonging

26


to the Mlc regulon which possess at least one cAMP/ CRP binding site as well as the Mlc binding site and thus are under dual control (Decker et al., 1998, Plumbridge, 1999). Basing on current knowledge it is probable that Mlc protein, protecting a region extending from +1 to the +23 with respect to the transcriptional start of malT gene, directly interfers with RNA polymerase binding. Moreover, it has been proved that binding of the cAMP/CRP complex at position 70.5 upstream of the transcriptional start has no effect on Mlc binding (Decker et al., 1998). To summarize, the presented work sheds light on the mechanisms responsible for the control of maltose regulon in Y. enterocolitica via regulation of malT expression. Our results indicate the influence of catabolic repression and the inhibitory effect of Mlc protein on the level of malT transcription. Moreover, our findings point out that MalT does not regulate the production of Yop proteins. Acknowledgements This study was supported by the Polish Ministry of Science through the Faculty of Biology, Warsaw University intramural grant, BW-501-68-1680-46.

Literature Bäumler A.R., M. Tsolis, A.W.M. Van Der Velden, I.S. Stojiljkovic and F. Anic Heffron. 1996. Identification of a new iron regulated locus of Salmonella typhi. Gene 183: 207213. Bohm A. and W. Boos. 2004. Gene regulation in prokaryotes by subcellular relocalization of transcription factors. Curr. Microbiol. 7: 151156. Boos W. and H. Schuman. 1998. Maltose/maltodextrin system of Escherichia coli: transport, metabolism, and regulation. Microbiol. Mol. Biol. Rev. 62: 204229. Brzostek K. and A. Raczkowska. 2001. The level of Yop proteins secreted by Yersinia enterocolitica is changed in maltose mutants. FEMS Microbiol. Lett. 204: 95100. Brzostek K., H. Heleszko and J. Hrebenda. 1993. Maltoporins and maltose-binding proteins of Yersinia enterocolitica. J. Gen. Microbiol. 139: 195201. Brzostek K., H. Heleszko and J. Hrebenda. 1995. Production of Escherichia coli LamB protein in Yersinia enterocolitica. FEMS Microbiol. Lett. 127: 1721. Chapon C. 1982. Role of the catabolite activator protein in the maltose regulon of Escherichia coli. J. Bacteriol. 150: 722729. Cornelis G.R., A. Boland, A.P. Boyd, C. Geuijen, M. Iriarte, C. Neyt, M.P. Sory and I. Stainier. 1998. The virulence plasmid of Yersinia, an antihost genome. Microbiol. Mol. Biol. Rev. 62: 13151352. Decker K., J. Plumbridge and W. Boss. 1998. Negative transcriptional regulation of a positive regulator: the expression of malT, encoding the transcriptional activator of the maltose regulon of Escherichia coli, is negatively controlled by Mlc. Mol. Micobiol. 27: 281390. Ehrmann M. and W. Boos. 1987. Identification of endogenous inducers of the mal system in Escherichia coli. J. Bacteriol. 169: 35393545. Figurski D.H. and D.R. Helinski. 1979. Replication of an origincontaining derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad. Sci. USA 76: 16481652.

1

Joly N., A. Böhm, W. Boos and E. Richet. 2004. MalK, the ATPbinding cassette component of the Escherichia coli maltodextrin transporter, inhibits the transcriptional activator MalT by antagonizing inducer binding. J. Biol. Chem. 279: 3312333130. Joly N., O. Danot, A. Schlegel, W. Boos and E. Richet. 2002. The Aes protein directly controls the activity of MalT, the central transcriptional activator of the Escherichia coli maltose regulon. J. Biol. Chem. 277: 1660616613. Kim S.Y., T.W. Nam, D. Shin, BM. Koo. and Y.J. Seok. 1999. Purification of Mlc and analysis of its effect on the pts expression in Escherichia coli. J. Biol. Chem. 274: 2539825402. Kinder S.A., J.L. Badger, G.O. Bryant, J.C. Pepe and V.G. Miller. 1993. Cloning of the YenI restriction endonuclease and methylase from Yersinia enterocolitica serotype O8 and construction of a transformable R M+ mutant. Gene 136: 271275. Konishi Y., A. Amemura, S. Tanabe and T. Harada. 1979. Immunological study of pullulanase from Klebsiella strains and the occurrence of this enzyme in the Enterobacteriaceae. Int. J. Syst. Bacteriol. 29: 1318. Kovach M.E., P.H. Elzer, D.S. Hill, G.T. Robertson, M.A. Farris, R.M. Roop II and K.M. Peterson. 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166: 175176. Lang H., G. Jonson, J. Holmgren and E.T. Palva. 1994. The maltose regulon of Vibrio cholerae affects production and secretion of virulence factors. Infect. Immun. 62: 47814788. Miller J.H. 1972. Experiments in Molecular Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Navarro L., N.M. Alto and J.E. Dixon. 2005. Functions of the Yersinia effector proteins in inhibiting host immune responses. Curr. Opin. Microbiol. 8: 2127. Plumbridge J. 1998. Control of the expression of the manXYZ operon in Escherichia coli: Mlc is a negative regulator of the mannose PTS. Mol. Microbiol. 27: 369379. Plumbridge J. 1999. Expression of the phosphotransferase system both mediates and is mediated by Mlc regulation in Escherichia coli. Mol. Microbiol. 33: 260273. Raibaud O. and E. Richet. 1987. Maltotriose is the inducer of the maltose regulon. J. Bacteriol. 169: 30593061. Richet E. and O. Raibaud. 1987. Purification and properties of the MalT protein, the transcription activator of the Escherichia coli maltose regulon. J. Biol. Chem. 262: 1264712653. Sambrook J., E.F. Fritsch and T. Maniatis. 1989. Molecular Cloning: a Laboratory Manual, 2 nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Schlegel A., O. Danot, E. Richet, T. Ferenci and W. Boos. 2002. The N terminus of the Escherichia coli transcription activator MalT is the domain of interaction with MalY. J. Bacteriol. 184: 30693077. Schneider E., S. Freundlieb, S. Tapio and W. Boos.1992. Molecular characterization of the MalT-dependent periplasmic "-amylase of Escherichia coli encoded by malS. J. Biol. Chem. 267: 51485154. Schreiber V., C. Steegborn, T. Clausen, W. Boos and E. Richet. 2000. A new mechanism for the control of a prokaryotic transcriptional regulator: antagonistic binding of positive and negative effectors. Mol. Microbiol. 35: 765776. Seitz S., S.J. Lee, C. Pennetier, W. Boos and J. Plumbridge. 2003. Analysis of the interaction between the global regulator Mlc and EIIBGlc of the glucose-specific phosphotransferase system in Escherichia coli. J. Biol. Chem. 278: 1074410751. Simon R., U. Priefer and A. Puhler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria. Biotechnology 1: 784791. Tanaka Y., H. Kimata and H. Aiba. 2000. A novel regulatory role of glucose transporter of Escherichia coli: membrane sequestration of a global repressor Mlc. EMBO J. 19: 53445352.


Proteolytic Activity of Clinical Candida albicans Isolates in Relation to Genotype and Strain Source URSZULA NAWROT1*, JACEK SKA£A2, KATARZYNA W£ODARCZYK1, PIERRE-ALAIN FONTEYNE3, 4, NICOLE NOLARD3 and JADWIGA NOWICKA5, 6 1 Department

of Microbiology, Wroc³aw Medical University, Poland of Genetics, Institute of Microbiology, University of Wroc³aw, Poland 3 Scientific Institute of Public Health, Brussels, Belgium 4 Centre of Applied Molecular Technologies Université Catholique de Louvain 5 Department of Haematology; 6 Department of Clinical Chemistry, Wroc³aw Medical University, Wroc³aw, Poland 2 Department

Received 2 July 2007, revised 15 November 2007, accepted 12 December 2007 Abstract Proteolytic activity is regarded as one of the most important virulence factors of Candida albicans. Several authors recently demonstrated that some karyotypes and genotypes harbouring a group I self-splicing intron (CaLSU) located in the gene encoding the large rRNA subunit showed a high level of proteinase production. The aim of this study was to investigate the correlation between the level of proteinase production and the presence of the CaLSU intron in C. albicans isolates originating from the blood and respiratory tracts (sputum/pharyngeal swabs) of patients with and without oropharyngeal candidosis. The results revealed statistically significant differences in genotype distribution and the level of proteinase production between the C. albicans isolates obtained from blood and from the respiratory tract. Genotype A, without the intron, was prevalent in all groups of strains and its prevalence was higher among isolates from blood (75%) and from patients with candidosis (80%) compared with strains from colonisation (as opposed to infection) (57.8%). Isolates from blood produced significantly less proteinase than isolates from the respiratory tract (p < 0.02), and this difference should be attributed to lower proteinase production of genotypes B and C from blood compared with genotypes B and C from the respiratory tract (p < 0.01). The higher proteinase production of genotype B than of genotype A was found among respiratory tract isolates only. The presented data indicate that the association between proteinase production and the CaLSU intron depends on the strains population. Further study is needed on well-defined groups of clinical isolates to elucidate whether the observed diversity in proteinase production plays a role in the selection of strains inducing bloodstream infections. K e y w o r d s: Candida albicans; acid proteinase; group I self-splicing intron; rDNA-genotyping

Introduction Candida albicans is an opportunistic microorganism widespread in the human population. It colonises the gastrointestinal tract of up to 70% of healthy adults and is the most frequent cause of superficial (mucosa- or skin-associated) as well as deep-seated, life-threatening mycoses. Proteolytic activity is regarded as one of the most important virulence factors of this pathogen (Schaller et al., 2005; Naglik et al., 2003). C. albicans produces at least ten iso-enzymes of aspartic proteinases (Sap1-10), of which Sap1-8 are extracellulary secreted (Hube et al., 1991; Monod et al., 1994; Monod et al., 1998). A contribution of the Saps to host tissue-invasion and the activation of inflammatory response has been postulated. The broad spectrum of Saps substrate specificity includes impor-

tant host proteins, e.g. collagen, laminin, fibronectin, immunoglobulins, sIgA, and lactoferrin. Saps also digest some cell-surface antigens, enhance adhesion, participate in cell membrane damage, and induce inflammatory response via activation of interleukin-1$ (Schaller et al., 2005; Naglik et al., 2003, Naglik et al., 2004). The expression of sap genes depends on environmental factors, e.g. pH, temperature, and presence of protein, as well as morphological transition (hypha, yeast) and switch phenotypes (opaque/white phenotype) (Hube et al., 1994). Clinical C. albicans isolates differ in the level of proteinase produced in vitro and may also show different patterns of sap expression. Elevated proteinase production has been correlated with strain invasiveness in vivo; for example, strains isolated from candidosis of the oral cavity secreted higher proteinase levels than strains isolated

* Corresponding author: U. Nawrot, Department of Microbiology, Medical University of Wroc³aw, Cha³ubinskiego 4, 50-368 Wroc³aw, Poland; e-mail: [email protected]

28

Nawrot U. et al.

from the oral cavities of healthy individuals (Kuriyama et al., 2003; De Bernardis et al., 1992). It was demonstrated that the level of proteinase production may be connected with some genotypes of C. albicans. Taylor et al. (2005) and Tavanti et al. (2004) found that strains with distinct karyotypes differ in the level and pattern of Sap secretion. A very interesting finding is the association between a high level of proteinase production and a genotype harbouring a group I selfsplicing intron (CaLSU) located in the gene encoding the large rRNA subunit (Sugita et al., 2002, Nawrot et al., 2004). C. albicans strains can be differentiated according to the presence of the CaLSU intron into three main genotypes, namely genotype A, without the intron, genotype B, harbouring the intron, and the heterozygous genotype C, possessing LSU rRNA genes with and without the intron in a single genome (Mercure et al., 1993; McCullough et al., 1999a; McCullough et al., 1999b). The intron is a target for base analogues (5-fluorocytosine), pentamidine, and also the anti-tumour glycopeptide bleomycin, which interfered with the self-splicing process (Mercure et al., 1993; Zhang et al., 2002; Jayaguru and Raghunathan, 2006). It is supposed that a high susceptibility to the factors mentioned above may be one of the reasons for the elimination of genotype B and its lower frequency among clinical isolates. The CaLSU has been intensively studied by molecular biologist investigating the self-splicing phenomenon (e.g. Mercure et al., 1997; Zhang and Leibowitz, 2001; Xiao et al., 2005) and has also been used in many evolutionary and epidemiological studies as a valuable molecular marker (Lott et al., 1999; Pujol et al., 2002; Blignaut et al., 2002). Recently, several authors reported the distribution of intronbased genotypes in different groups of clinical isolates of C. albicans (Tamura et al., 2001, Millar et al., 2002; Karahan, 2004; Karahan and Akar, 2005; Qi et al., 2005; Millar et al., 2005; Girish Kumar et al., 2006), and some of them postulated association of genotype A with strain invasiveness. In this study we tested the correlation between the level of proteinase production and the presence of the CaLSU intron in two groups of C. albicans isolates, one originating from blood and the second from the respiratory tracts of patients with haematological malignancies. Experimental Materials and Methods

Strains. The study was performed on 206 strains, of which 112 were C. albicans blood isolates obtained during the 2002 Belgian Candidemia Survey and pre-

1

served in the BCCM-IHEM Collection and 94 were clinical isolates obtained from the respiratory tracts (54 from throat swabs and 40 from sputum) of patients hospitalised in the Department of Haematology of Wroc³aw Medical University in the years 20002002. Thirty of the respiratory isolates were obtained from patients with clinical signs of pharyngeal mycoses and 64 originated from non-symptomatic patients regarded as colonised. The isolates were identified using the ID32C tests (bioMerieux) and stored at 70°C. DNA extraction. For DNA extraction, yeast cells were cultivated in YPG medium (2% yeast extract, 2% peptone, and 2% glucose) at 30°C for 18 hours. Cellular DNA was extracted according to Rose et al. (1990) with some modification. Briefly, cells were collected by centrifugation (1 min, 14 000 rpm) and resuspended in 200 µl of solution containing 0.5% zymolase in 50 mM Tris-HCl buffer (pH 7.5), 25 mM EDTA, and 1% mercaptoethanol. After 40 minutes of incubation at 37°C, 200 µl of lysis solution with 1% SDS and 0.2 M NaOH, 240 µl of 3 M sodium acetate was added. The mixture was briefly vortexed and centrifuged for 15 min (14 000 rpm, 4°C). The supernatant was transferred to a new microcentrifuge tube. The DNA was precipitated by adding an equal volume of isopropanol and collected by centrifugation (14 000 rpm, 4°C, 15 min). The DNA precipitate was washed with 70% ethanol, dried, suspended in 100 µl of water with RNase (300 µg/ml), and stored in 20°C. Detection of CaLSU by PCR. The PCR assay was performed with the primer pair CA-INT-L (5-ATA AGG GAA GTC GGC AAA ATA GAT CCG TAA-3) and CA-INT-R (5CCT TGG CTG TGG TTT CGC TAG ATA GTA GAT-3), described previously by McCullough et al. (1999b). The reactions were performed with a DNA ENGINE PTC-200 thermal cycler (JM Research, USA). DNA samples were denatured at 94°C for 3 min before 30 cycles of 94°C for 1 min, 65°C for 1 min, and 72°C for 4 min with a final extension at 72°C for 4 min following the last cycle. The expected PCR products were single bands of size 450 bp and 840 bp for genotypes A and B, respectively, and two bands for genotype C (450 bp and 840 bp). Electrophoresis in 2% agarose gel visualised in UV light after ethidium bromide staining was used (Fig. 1). Detection of proteolytic activity. For the proteolytic activity assay the Candida isolates were cultured on Staibs medium with 5% casein at 28°C for 7 days. The supernatants were removed by centrifugation (3000 rpm, 30 min), adjusted to pH 6.5 (using 0.1 M NaOH), sterilised by filtration, and stored frozen at 20°C. Five hundred µl of 0.2 M sodium citrateHCl buffer (pH 3.3) and 700 µl of 0.5% haemoglobin (used as a substrate) were added to 200 µl of the supernatant (for each strain in triplicate). After 1 hour of incubation at 37°C the reaction was stopped by adding

1

29

Proteolytic activity of clinical C. albicans isolates M

2

3

4

5

6

7

8

Fig. 1. Gel-electrophoresis of PCR products of seven C. albicans strains with the primer pair CA-INT-L and CA-INT-R. M marker pUC MIX8; lanes 2, 3 and 4 strains of genotype C (an additional band is indicated), lanes 5, 7, and 8 genotype A, lane 6 genotype B.

5% TCA. At the same time, control tests were carried out with buffer, TCA (added at the beginning of incubation), haemoglobin, and appropriate supernatant. After incubation, the samples were centrifuged at 4000 rpm for 30 min and the protein concentration was measured spectrophotometrically at 280 nm (Remold et al., 1968). One arbitrary unit of enzyme activity was defined as a 0.1 extinction increase at 280 nm and was calculated for 1 litre of medium. The proteolytic activities of the culture supernatants from five selected strains were additionally tested after exposure to different concentrations of pepstatin A (Sigma), an inhibitor of aspartic proteinases. The buffer and the culture supernatants were mixed with pepstatine A at final concentrations of 0.0250.8 µM and incubated for 15 min at 37°C. After incubation, the substrate (haemoglobin) was added and the proteolytic activity was determinate as described above. Statistica for Windows (StatSoft, Inc., 1997) was used for statistical evaluations. Students t-test was used and differences were considered significant when the value of p was less than or equal to 0.05. Results The expected PCR products were obtained for genotypes A and B (single bands of size 450 bp and 840 bp, respectively), but for genotype C an addi-

tional band of 690 bp was observed (Fig. 1). To test the stability of the unexpected product, PCR with the DNA of the strains with genotype C was performed at annealing temperatures of 52.6°C, 59.6°C, and 68.6°C (Fig. 2). The changes in the annealing temperature did not result in increased intensity of the observed band. One of the genotype C isolates was found to display a band of 430435 bp instead of the typical 450 bp. The results of CaLSU-based genotyping are presented in Table I. In the investigated group of strains, genotype A, without the intron, dominated (145/206 strains, 70.4%), whereas the CaLSU was fully present (genotype B) in 41 (19.9%) strains and partially present (genotype C) in 20 (9.7%). Among the blood isolates, 84 were classified as type A (75%), 20 as type B (17.9%), and 8 as type C (7.1%). Of the respiratory tract (RT) isolates, genotype A was identified in 61 strains (64.89%), genotype B in 21 (22.3%), and genotype C in 12 (12.76%). When we analysed the strains isolated from infection and from colonisation separately, elevated percentages of genotype A (80%) and lower levels of genotypes B (10%) and C (10%) were observed among the strains obtained from infection. Statistically significant differences in genotype distribution were found between the isolates from blood and the isolates colonising the RT (p = 0.035). The proteolytic activities of all the RT isolates and of 59 blood isolates (20 strains with genotype B, 8 with genotype C, and 31 randomly selected strains with genotype A) were tested. The proteolytic activities of the strains isolated from the blood ranged from 10 to 802 U/l (medium: 315.9 U/l) and were significantly lower than 52.6°C 1

2

59.6°C 3

M

1

2

68.6°C 3

1

2

3

Fig. 2. The elecrophoregram of PCR with C. albicans strains of genotype C (13) performed at different annealing temperatures. The intensity of the 690-bp band does not increase. Strain number 2 showed a slight difference in the weight of the smaller band (approximately 450435 bp). M DNA molecular-weight marker.

30

1

Nawrot U. et al. Table I The results of CaLSU-based genotyping of C. albicans strains isolated from blood and from the respiratory tract Number/(%) of strains

Source Blood Respiratory tract (RT) RT-colonisation RT-infection Total

Genotype A 84 (75) 61 (64.89) 37 (57.81) 24 (80) 145 (70.4)

those obtained from the respiratory tract (p < 0.02) (Fig. 3). Comparison of strains of genotypes A, B, and C did not reveal statistically significant differences when we analysed isolates from blood and the total group (the sum of blood and respiratory tract isolates). Nevertheless, when analysing RT isolates we found statistically significant higher activity of genotype B (p 0.2), but the differences between the activities of genotypes A and B and between A and C among the isolates from infection were significant (Fig. 4). Statistically significant differences were also 900

Genotype C 20 (17.9) 21 (22.3) 18 (28.13) 3 (10) 41 (19.9)

Total 112 (100) 94 (100) 64 (100) 30 (100) 206 (100)

found between the activities of RT-colonising strains and strains from blood (p < 0.01), between genotype B from RT (colonising as well as infecting strains) and genotype B from blood (p = 0.011 and p = 0.048, respectively), and between genotype C from RT (colonising as well as infecting strains) and genotype C from blood (p = 0.0024 and p = 0.019, respectively). Discussion The results presented in this study reveal statistically significant differences in the distribution of genotypes and in the level of proteinase production among C. albicans isolates from blood and from the respiratory tract. An association between the presence of the CaLSU intron and high proteinase secretion has been confirmed. Genotype A was prevalent among all the tested groups of C. albicans strains, and the percentage of strains with genotype A was higher in blood isolates

p < 0.05

800

p < 0.02

700 Proteolytic activity U/l

Genotype B 8 (7.1) 12 (12.76) 9 (14.06) 3 (10) 20 (9.7)

p < 0.01 p < 0.01

600 500 400 300 200

Medium +/ SD

100

Medium +/ SE

0

A/t

B/t

C/t

I

II

A/I

A/II

B/I

B/II

C/I

C/II

Medium

Fig. 3. Proteolytic activity of C. albicans strains isolated from blood (I) and from the respiratory tract (II). A/t; B/t; C/t activity of the total numbers of strains with genotypes A, B, and C, respectively I strains isolated from blood, II strains isolated from the respiratory tract. A/I, B/I, C/I strains isolated from blood with genotypes A, B, and C, respectively. A/II, B/II, C/II strains isolated from the respiratory tract with genotypes A, B, and C, respectively.

1

31

Proteolytic activity of clinical C. albicans isolates 900 p < 0.02

800

Proteolytic activity U/l

700 600 500 400 300 Medium +/ SD

200

Medium +/ SE

100 0

RT-inf

RT-col

A-inf

A-bol

B-inf

B-col

C-inf

C-col

Medium

Fig. 4. Proteolytic activity of strains isolated from infection and form colonisation of the respiratory tract. RT-inf strains isolated from infection of the respiratory tract; RT-col strains isolated from colonisation of the respiratory tract; A-inf, B-inf, C-inf strains isolated from infection with genotypes A, B, and C, respectively; A-col, B-col, C-col strains isolated from colonisation with genotypes A, B, and C, respectively.

(75%) and in strains infecting the RT (80%) compared with strains colonising the RT (57.8%). Similarly, Karahan et al. (2004) showed a prevalence of genotype A in strains isolated from blood and concluded that this intron-less genotype may be more invasive and more prone to induce blood-stream infection than genotypes carrying the intron. To our knowledge, all reports on blood isolates showed at least a 50% participation of genotype A, although the prevalence of this genotype was also reported in different, noninvasive groups of C. albicans isolates. For example, Qi et al. (2005) found genotype A in up to 90% of isolates from the oral cavities of healthy carriers, Karahan et al. (2004) found it in 44.6% of non-invasive clinical isolates, and in our previous study (Nawrot et al., 2004) we found 4353% of genotype A among strains colonising the gastrointestinal tract in diabetic children. Taking all these reports into account, we suppose that in some populations there may be a selective pressure which favours genotype A colonisation and infection of the human body, especially invasion of the bloodstream. Very good candidates for such selective factors are anti-microbial and anti-tumour drugs, such as pentamidine and bleomicine, which showed antifungal activity almost exclusively to intron-harbouring strains. The published data also demonstrate differences in the distribution of intron-possessing genotypes. McCullough et al. (1999a), analysing the global genotype diversity of C. albicans, showed an increasing prevalence of group C after 1990 (17%) compared with isolates collected before 1990 (5.5%). Currently, studies performed on local strain collections reported dif-

ferent participation of genotype C (e.g. 5.8% by Qi et al., 2005; 34.5% by Karahan et al., 2004). In our study we found genotype C in 7% of the invasive isolates and in 12.8% of the non-invasive, which strongly demonstrates that the divergence in the distribution of genotype C also depends on the infected body-site. According to the definition by McCullough et al. (1999b), genotype C strains are heterozygous, and PCR with primers flanking the fragment of rDNA including CaLSU yields two bands (450 bp without the intron and 840 bp with the intron). Recently, Qi et al. (2005) reported an additional, third PCR product. However, in our experiments we also observed the band described by these authors as a PCR product. Moreover, such a band of different intensity is also visible in most studies by other authors (e.g. McCullough et al., 1999b; Tamura et al., 2001; Karahan et al., 2004; Millar et al., 2001). To test whether the observed band is really a PCR product, we performed several PCRs at different annealing temperatures (Fig. 2), assuming that the amount of the product should be enhanced. Unfortunately, we did not observe increased intensity of this band, which rather suggests its artificial origin. What is interesting is that among the genotype C isolates tested in this study we found one with an atypical band of approximately 430 bp instead of 450 bp. Recently, Karahan et al., 2005, described eight subtypes of genotype A distinguished on the basis of sequence diversity and RFLP analysis. Because of an 18-bp insertion, four of these subtypes differed in the length of the PCR product. Our observations suggest that genotype C strains also show diversity in the discussed fragment of LSU rDNA.

32

Nawrot U. et al.

Apart from genotype distribution, the investigated populations of C. albicans isolates showed significant differences in the level of produced proteinase. The isolates were cultured under the same conditions and underwent the same environmental pressure, so the levels of produced enzymes should be attributed to the microorganisms properties. The blood isolates produced less enzyme than isolates from the RT and, moreover, strains with genotypes B and C from blood produced lower proteinase than genotypes B and C from the RT. According to Hube (Hube et al., 1994), Sap2 is the main iso-enzyme produced on protein-containing media in 3037°C. Recent data (Kuryama et al., 2003) showed that particular strains cultured under such conditions often differ in the pattern and level of isoenzymes produced and that these differences are connected with karyotype. Previously we found a significantly higher level of proteinase production in genotype B isolates (Nawrot et al., 2004). In the current study, this correlation was observed only among the RT isolates, especially those from infection. These data indicate that the association between proteinase production and the CaLSU intron depends on the strains population. The CaLSU is regarded as a quite stable molecular marker, and its high frequency has been observed in some C. albicans clades (Lott et al., 1999; Pujol et al., 2002). Therefore, the association between the presence of the intron and proteinase production most probably reflects an association between karyotype and the regulatory mechanisms involved in the expression of sap genes. It is not clear if the observed differences in proteinase production may play a role in selecting strains inducing bloodstream infections. Further study is needed on well-defined groups of clinical isolates employing advanced molecular technology to learn about the epidemiological mechanisms and to characterise the properties of invasive C. albicans isolates. Literature Blignaut E., C. Pujol, S. Lockhart, S. Joly and D.R. Soll. 2002. Ca3 fingerprinting of Candida albicans isolates from human immunodeficiency virus-positive and healthy individuals reveals a new clade in South Africa. J. Clin. Microbiol. 40: 826836. De Bernardis F., M. Boccanera, L. Rainaldi, C.E. Guerra, I. Quinti and A. Cassone. 1992. The secretion of aspartyl proteinase, a virulence enzyme, by isolates of Candida albicans from the oral cavity of HIV-infected subjects. Eur. J. Epidemiol. 8: 362367. Girish Kumar C.P., A. M. Hanafy, M. Katsu, Y. Mikami, and T. Menon. 2006. Molecular analysis and susceptibility profiling of Candida albicans isolates from immunocompromised patients in South India. Mycopathologia 161: 153159. Hube B., M. Monod, D.A. Schofield, A.J. Brown, and N.A. Gow. 1994. Expression of seven members of the gene family encoding secretory aspartyl proteinases in Candida albicans. Mol. Microbiol. 14: 8799.

1

Hube B, C.J. Turver, F.C. Odds, H. Eiffert , G.J. Boulnois, H. Kochel, and R. Ruchel. 1991. Sequence of the Candida albicans gene encoding the secretory aspartate proteinase. J. Med. Vet. Mycol. 29: 129132. Jayaguru P. and M. Raghunathan. 2006. Group I intron renders differential susceptibility of Candida albicans to Bleomycin. Mol. Biol. Rep. 34: 1117. Karahan Z.C. and N. Akar. 2005. Subtypes of genotype A Candida albicans isolates determined by restriction endonuclease and sequence analyses. Microbiol. Res. 160: 361366. Karahan Z.C., H. Guriz, H. Agirbasli, N. Balaban, J.S. Gocmen, D. Aysev and N. Akar. 2004. Genotype distribution of Candida albicans isolates by 25S intron analysis with regard to invasiveness. Mycoses 47: 4659. Kuriyama T., D.W. Williams and M.A. Lewis. 2003. In vitro secreted aspartyl proteinase activity of Candida albicans isolated from oral diseases and healthy oral cavities. Oral Microbiol. Immunol. 18: 405407. Lott T.J., B.P. Holloway, D.A. Logan, R. Fundyga and J. Arnold. 1999. Towards understanding the evolution of the human commensal yeast Candida albicans. Microbiology 145: 11371143. McCullough M.J., K.V. Clemons and D.A. Stevens. 1999a. Molecular epidemiology of the global and temporal diversity of Candida albicans. Clin. Infect. Dis. 29: 12201225. McCullough M.J., K.V. Clemons and D.A. Stevens. 1999b. Molecular and phenotypic characterisation of genotypic Candida albicans subgroups and comparison with Candida dubliniensis and Candida stellatoidea. J. Clin. Microbiol. 37: 417421. Mercure S., L. Cousineau, S. Montplaisir, P. Belhumeur and G. Lemay. 1997. Expression of a reporter gene interrupted by the Candida albicans group I intron is inhibited by base analogs. Nucleic Acids Res. 25: 431437. Mercure S., S. Montplaisir and G. Lemay. 1993. Correlation between the presence of a self-splicing intron in the 25S rDNA of C. albicans and strains susceptibility to 5-fluorocytosine. Nucleic Acids Res. 21: 60206027. Millar B.C., J.E. Moore, J. Xu, M.J. Walker, S. Hedderwick and R. McMullan. 2002. Genotypic subgrouping of clinical isolates of Candida albicans and Candida dubliniensis by 25S intron analysis. Lett. Appl. Microbiol. 35: 102106. Millar B.C., J. Xu, R. McMullan, M.J. Walker, S. Hedderwick and J.E. Moore. 2005. Frequency and distribution of group I intron genotypes of Candida albicans colonising critically ill patients. Br. J. Biomed. Sci. 62: 2427. Monod M, B. Hube, D. Hess and D. Sanglard. 1998. Differential regulation of SAP8 and SAP9, which encode two new members of the secreted aspartic proteinase family in Candida albicans. Microbiology 144: 27312737. Monod M., G. Togni, B. Hube and D. Sanglard. 1994. Multiplicity of genes encoding secreted aspartic proteinases in Candida species. Mol. Microbiol. 13: 357368. Naglik J., A. Albrecht, O. Bader and B. Hube. 2004. Candida albicans proteinases and host/pathogen interactions. Cell. Microbiol. 6: 915926. Naglik J.R., S.J. Challacombe and B Hube. 2003. Candida albicans secreted aspartyl proteinases in virulence and pathogenesis. Microbiol. Mol. Biol. Rev. 67: 400428. Nawrot U., J. Skala, A. Noczynska, N. Potocka, K. Koczocik and E. Baran. 2004. Distribution of Ca.LSU intron and acid protease production by Candida albicans strains isolated from gastrointestinal tract of diabetes children. Pol. J. Microbiol. 53: 189191. Pujol C., M. Pfaller and D.R. Soll. 2002. Ca3 fingerprinting of Candida albicans bloodstream isolates from the United States,

1

Proteolytic activity of clinical C. albicans isolates

Canada, South America, and Europe reveals a European clade. J. Clin. Microbiol. 40: 27292740. Qi Q.G., T. Hu and X.D. Zhou. 2005. Frequency, species and molecular characterization of oral Candida in hosts of different age in China. J. Oral. Pathol. Med. 34: 352356. Remold H., H. Fasold and F. Staib. 1968. Purification and characterisation of proteolytic enzyme from Candida albicans. Biochim. Biophys. Acta 167: 399406. Rose M.D., Winston, F. and Hietr, P. 1990. Methods in Yeast Genetics. A Laboratory Course Manual. Cold Spring Harbor Laboratory Press. Schaller M., C. Borelli, H.C. Korting and B. Hube. 2005. Hydrolytic enzymes as virulence factors of Candida albicans. Mycoses 48: 365377. Sugita T., S. Kurosaka, M. Yajitate, H. Sato and A. Nishikawa. 2002. Extracellular proteinase and phospholipase activity of three genotypic strains of a human pathogenic yeast, Candida albicans. Microbiol. Immunol. 46: 881883. Tamura M., K. Watanabe, Y. Mikami, K. Yazawa and K. Nishimura. 2001. Molecular characterization of new clinical isolates of C. albicans and C. dubliniensis in Japan: analysis

33

reveals a new genotype of C. albicans with group I intron. J. Clin. Microbiol. 39: 43094315. Tavanti A., G. Pardini, D. Campa, P. Davini, A. Lupetti and S. Senesi. 2004. Differential expression of secretory aspartyl proteinase genes (SAP110) in oral Candida albicans isolates with distinct karyotypes. J. Clin. Microbiol. 42: 47264734. Taylor B.N., H. Hannemann, M. Sehnal, A. Biesemeier, A. Schweizer, M. Rollinghoff and K. Schroppel. 2005. Induction of SAP7 correlates with virulence in an intravenous infection model of candidiasis but not in a vaginal infection model in mice. Infect. Immun. 73: 70617063. Xiao M., T. Li, X. Yuan, Y. Shang, F. Wang, S. Chen and Y. Zhang. 2005. A peripheral element assembles the compact core structure essential for group I intron self-splicing. Nucleic Acids Res. 33: 46024611. Zhang Y. and M.J. Leibowitz. 2001. Folding of the group I intron ribozyme from the 26S rRNA gene of Candida albicans. Nucleic Acids Res. 29: 26442653. Zhang Y., Z. Li, D.S. Pilch and M.J. Leibowitz. 2002. Pentamidine inhibits catalytic activity of group I intron Ca.LSU by altering RNA folding. Nucleic Acids Res. 30: 29612971.

34

Nawrot U. et al.

1


Study on Bioactive Compounds from Streptomyces sp. ANU 6277 KOLLA J.P. NARAYANA1, PEDDIKOTLA PRABHAKAR2, MUVVA VIJAYALAKSHMI1*, YENAMANDRA VENKATESWARLU2 and PALAKODETY S.J. KRISHNA3 1 Department

of Microbiology, Acharya Nagarjuna University, Guntur - 522 510, A.P. Chemistry Division-I, Indian Institute of Chemical Technology 3 Biotechnology Unit, Institute of Public Enterprise, Hyderabad - 500 007, A.P., India 2 Organic

Received 14 October 2007, revised 16 December 2007, accepted 3 January 2008 Abstract An attempt was made to study the bioactive compounds from a terrestrial Streptomyces sp. ANU 6277 isolated from laterite soil. Four active fractions were recovered from the solvent extracts obtained from the culture broth of five day-old strain. Three bioactive compounds were purified and identified as 3-phenylpropionic acid, anthracene-9,10-quinone and 8-hydroxyquinoline. The components of the partially purified fourth active fraction were analyzed by gas chromatography-mass spectrometry and identified as benzyl alcohol, phenylethyl alcohol and 2H-1, 4-benzoxazin-3 (4H)-one. Four active fractions were screened for antimicrobial activity against Gram-positive and Gram-negative bacteria, and fungi including phytopathogenic, toxigenic and dermatophytic genera. Among these metabolites, 8-hydroxyquinoline exhibited strong antibacterial and antifungal activity as compared to 3-phenylpropionic acid and anthracene-9,10-quinone. K e y w o r d s: Streptomyces sp. ANU 6277, antimicrobial activity, bioactive compounds

Introduction Actinomycetes are Gram-positive bacteria that are wide spread in nature and play a pivotal role in the production of bioactive metabolites (Sanglier et al., 1993). Among actinomycetes, the members of the genus Streptomyces are considered economically important because they alone constituted 50% of soil actinomycete population and 75% of total bioactive molecules are produced by this genus (Prabavathy et al., 2006). They continue to be prolific sources of secondary metabolites with biological activities that ultimately find application as antimicrobial, anticancer agents or other pharmaceutically useful compounds (Bibb, 2005). Majority of streptomycetes and other actinomycetes members produce a diverse array of antibiotics including aminoglycosides, glycopeptides, $-lactams, macrolides, nucleosides, peptides, polyenes and tetracyclines (Berdy, 2005). As a result of the increasing prevalence of antibiotic-resistant pathogens and the pharmacological limitations of antibiotics, there is an exigency for new antimicrobial substances (Sahin and Unger, 2003). Taxonomy of the strain ANU 6277 and production and biological properties of 3-phenylpro-

pionc acid were reported earlier (Narayana et al., 2007). In the present study, an attempt was made to explore the other bioactive compounds of the strain and their antimicrobial spectrum. Experimental Materials and Methods

Cultivation of the strain. A prevalent actinomycete strain, Streptomyces sp. ANU 6277 was isolated from laterite soil sample collected at Acharya Nagarjuna University (ANU) campus by dilution plate technique (Narayana et al., 2007). The strain was maintained on yeast extract-malt extract-dextrose (YMD) agar medium (Williams and Cross, 1971). Actively growing pure culture of the strain was used to inoculate 100 ml of YMD broth in 250 Erlenmeyer flasks. After 48 h incubation at 30°C, YMD culture broth (10%) was used as seed culture to inoculate 500 ml fermentation broth (4% dextrose, 0.9% proteose peptone, 0.1% yeast extract, 0.6 % CaCO3, 0.1% K2HPO4, 0.1% MgSO4 × 7H2O, pH 7.2) in 2-litre Erlenmeyer flasks and incubated at 30°C for 5 days.

* Corresponding author: M. Vijayalakshmi, Department of Microbiology, Acharya Nagarjuna University, Guntur-522 510, A.P., India; e-mail: [email protected]

36

1

Narayana K.J.P. et al.

Extraction, purification and identification of bioactive compounds from the strain. After 5 days incubation of the culture, the fermentation was stopped and pH of the medium was adjusted to 3.5 with 1N HCl. Cells were removed from fermentation broth by filtration and the culture filtrate was extracted with ethyl acetate. The crude solvent extract was subjected to Silica gel chromatography (22× 5 cm, Silica gel 60, Merck) and eluted with gradient solvent system consisting of ethylacetate + hexane. Elutions collected during column chromatography were concentrated and tested for their antimicrobial activity against a Grampositive (Bacillus subtilis MTCC 441) and Gramnegative bacteria (Pseudomonas aeruginosa MTCC 424), and yeast (Candida albicans MTCC 183) to screen bioactive fractions. Further purification of bioactive fractions was carried out in HPLC preparative column (10 mm* 250 mm, 5 µ using hexane:2-propanol, 8:2). Structural elucidation of pure bioactive compounds from the strain was carried out by EI-MS, 1H NMR and 13C NMR spectral studies. The partially purified fourth active fraction was analysed by gas chromatography-mass spectrometry (GC-MS). An Agilent GC-MS system equipped with a fused silica capillary column (CW-amine 60 m× 0.25 mm I.D., Film thickness 0.5 µm) was used to analyze the compounds in this active fraction. The data was processed with GC/MSD ChemStation (Agilent Technologies 6890-N series GC with 5990 series II MSD). Column condition was programmed as column oven temperature 150°C (4 min) 4°C/min, temperature of inject port 250°C and detector port 280°C (Roy et al., 2006). The peaks of components in gas chromatography were subjected to mass-spectral analysis. The spectra were analyzed from the available library data, NIST MS Search (version 2.0) (included with NIST 02 mass spectral library, Agilent p/n G1033A). Biological activity. Minimum inhibitory concentrations (MIC) of bioactive compounds obtained from the strain against different microorganisms including bacteria and fungi were determined by conventional agar dilution method (Cappuccino and Sherman, 1999) using nutrient agar for bacteria and Sabourouds agar medium for fungi and yeast. Different concentrations of compounds (0 to 1000 µg/ml) were prepared in Dimethyl sulphoxide (DMSO) and assayed against test organisms. The organisms used in this assay are Bacillus cereus MTCC 430, B. subtilis MTCC 441, Escherichia coli MTCC 40, Klebsiella pneumoniae MTCC 109, Proteus vulgaris MTCC 742, Pseudomonas aeruginosa MTCC 424, P. fluorescens MTCC 103, Staphylococcus aureus MTCC 96, Aspergillus flavus, A. niger, Candida albicans MTCC 183, Fusarium oxysporum, F. udum MTCC 2204, Epidermophyton floccosum MTCC 613, Microsporum canis MTCC 2820 and Penicillium citrinum.

The antimicrobial activity was observed after 2448 h incubation at 30°C for bacteria and 4872 h incubation at 28°C for fungi and yeast. The experiment was performed in triplicates and negative controls were maintained as DMSO without compound. Positive controls were tested with tetracycline for antibacterial activity, carbendazim for phytopathogenic and toxigenic fungi and griseofulvin for dermatophytes. Lowest concentration of compounds that showed antimicrobial activity in terms of growth inhibition zone against test organisms was recorded as MIC value (Hwang et al., 2001). Results and Discussion The scheme for the extraction of bioactive compounds from the strain is presented in Figure 1. An amount of 2.54 g crude solvent extract was obtained from 40 liter of fermentation broth after defatted with cyclohexane. Four active fractions were screened, concentrated and designated as AF1, AF2, AF3 and AF4. TLC analysis of the compounds revealed that AF2 and AF3 exhibited pure single distinct band. AF1 with little impurity and AF4 had mixture of three compounds. Purity of AF1 was obtained after preparative HPLC step and determined as 3-phenylpropionic acid by 1H NMR, 13C NMR and EI-MS spectral studies (Narayana et al., 2007). The structure of AF2 and AF3 was elucidated by 1H NMR, 13C NMR and EI-MS studies. 1H NMR (300 MHZ, CdCl3) of AF2 showed protons at 7.8 (4H, dd, aromatic-H), 8.3 (4H, dd, aromatic-H) and 13C NMR (300 MHZ, CdCl3) exhibited peaks at 126 (4-aromatic carbons), 135 (4-aromatic carbons) and 185 (keto carbon). 1H NMR (300 MHZ, CdCl3) of AF3 depicted protons at 7.1 (1H, d, aromatic-H), 7.3 (1H, d, aromatic-H), 7.5 (2H, d, aromatic-H), 8.2 (1H, d, aromatic-H), 8.3 (1H, S, O-H) and 8.8 (1H, d, aromaticH). 13C NMR (300 MHZ, CdCl3) of AF3 exhibited peaks at 110, 117, 121, 127, 128, 135, 138, 147 and 152 (9-aromatic carbons). Molecular weights of AF2 and AF3 were determined by EI-MS analysis. AF2 gave molecular ions in positive mode at m/z are 50, 63, 76, 126, 152, 180, 208 suggested a molecular weight of 208 g/mol. AF3 gave molecular ions in positive mode at m/z are 129, 93, 77, 145 indicated a molecular weight of 145 g/mol. Based on the above data, AF2 and AF3 were characterized as anthracene9,10-quinone and 8-hydroxyquinoline respectively. The compounds in fourth active fraction (AF4) were analysed by GC-MS (Fig. 2). Three peaks were observed with retention time of 7.74 min (C1), 8.70 min (C2) and 8.85 min (C3) respectively. MS analysis of these peaks suggested M+ at m/z 108, 122 and 149 g/mol of molecular weights respectively. By

1

37

Bioactive compounds from Streptomyces sp.

Fermentation broth (40 lit) (5-day old)

Extracted with ethyl acetane Defatted with cyclohexane

Silica gel chromatography (Eluted with ethyl acetane: hexane)

Fig. 1. Extraction of bioactive compounds from the strain ANU 6277.

using available library data, C1, C2 and C3 in AF4 were determined as benzyl alcohol, phenylethyl alcohol and 2H-1, 4-benzoxazin-3 (4H)-one respectively. Claeson and Sunesson (2005) analyzed many volatile compounds including benzyl alcohol and phenylethyl alcohol from S. albidoflavus grown on tryptone-glucose medium by GC-MS. A bioactive compound, dibutyl phthalate has been reported in culture broth of S. albidoflavus by GC-MS (Roy et al., 2006). No reports were found on 2H-1, 4-benzoxazin-3 (4H)one from microorganisms especially actinomycetes. Three bioactive compounds (AF1, AF2 and AF3) and a partially purified active fraction (AF4) of the strain were tested against different microorganisms including bacteria and fungi. Data on their antibacterial activity are presented in Table I. The compound, AF3 (8-hydroxyquinoline) exhibited strong antibacterial activity against all the test bacteria including Gram-positive and Gram-negative ones as compared to AF1, AF2 and AF4. AF3 also exhibited good anti-

microbial activity over tetracycline (positive control). Among the bacteria tested, P. aeruginosa was highly sensitive to the metabolites of the strain. MIC values of AF1 (10100 µg/ml), AF2 (75500 µg/ml), AF3 Table I MIC (µg/ml) of bioactive compounds (AF1-AF4) from the tested strain against different bacteria Bacteria Bacillus cereus B. subtilis Escherichia coli Klebsiella pneumoniae Proteus vulgaris Pseudomonas aeruginosa P. fluorescens Serratia marcescens Staphylococcus aureus

AF1* AF2 75 50 50 100 50 10 10 25 100

250 100 100 500 250 75 100 100 500

AF3 25 10 10 50 25 25 50 10 25

* Narayana et al., 2007; ** Tet-tetracycline (µg/ml)

AF4 Tet** 500 250 250 500 250 100 100 250 500

75 50 25 50 25 50 50 25 50

38

1

Narayana K.J.P. et al.

Abundance 35 000

30 000

C1 7.74

C2 8.70 C3 8.85

25 000

20 000

15 000

10 000

5000 Time min

4.00

5.00

6.00

7.00

8.0 0

9.00

10.00

Fig. 2. GC-Spectra of an active fraction, AF4 collected from culture broth of the strain. Components C1, C2 and C3 with retention time 7.74 min, 8.70 min and 8.85 min are determined as benzyl alcohol, phenylethyl alcohol and 2H-1,4-benzoxazin-3 (4H)-one respectively by mass spectral analysis.

(550 µg/ml) and AF4 (1001000 µg/ml) were observed against the test bacteria. Among different phytopathogenic and toxigenic fungi, F. udum was highly susceptible to the metabolites of strain followed by A. flavus, P. citrinum and A. niger. But F. oxysporum exhibited resistance to AF4 and sensitivity to AF1, AF2 and AF3. Among the four active fractions of the strain, AF3 proved to possess strong antifungal activity against phytopathogenic and toxigenic fungi (Table II). MIC values of these metabolites against the molds ranged from 210 µg/ml (AF3), 1050 µg/ml (AF1), 1001000 µg/ml (AF2) and 2501000 µg/ml (AF4), whereas positive control carbendazim showed MIC values ranging from 15 µg/ml. Dermatophytes such as C. albicans, E. floccosum and M. canis were found sensitive to all the active fractions of the strain (Table III). AF3 exhibTable II MIC (µg/ml) of bioactive compounds (AF1-AF4) from the tested strain against phytopathogenic and toxigenic molds Phytopathogenic and toxigenic molds Aspergillus flavus A. niger Fusarium oxysporum F. udum Penicillium citrinum

AF1*

AF2

AF3

AF4

CZM**

25 50 50 10 25

250 500 1000 100 500

5 5 10 2 5

500 1000 > 1000 250 500

2 5 5