Polish Journal of Microbiology

P O L S K I E T O WA R Z Y S T W O M I K R O B I O L O G Ó W POLISH SOCIETY OF MICROBIOLOGISTS

Polish Journal of Microbiology

I am pleased to inform you that Polish Journal of Microbiology has been selected for coverage in Thomson Scientific products and customers information services. Beginning with No 1, Vol. 57, 2008 information on the contents of the PJM is included in: Science Citation Index Expanded (ISI) and Journal Citation Reports (JCR)/Science Edition. Stanisława Tylewska-Wierzbanowska Editor in Chief

2011

Polish Journal of Microbiology formely Acta Microbiologica Polonica

2011, Vol. 60, No 2

CONTENTS MINIREWIEV

Staphylococcal cassette chromosome mec (SCCmec) classification and typing methods: an overview

Turlej A., Hryniewicz W., Empel J. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 95

ORIGINAL PAPERS

Immobilized cells of recombinant Escherichia coli strain for continuous production of L-aspartic acid

Szymańska G., Sobierajski B., Chmiel A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 105

Reaction conditions for maximal cyclodextrin production by cyclodextrin glucanotransferase from Bacillus megaterium

Zhekova B.Y., Stanchev V.S. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 113

Efficacy of UV treatment in the management of bacterial adhesion on hard surfaces

Kolappan A., Satheesh S. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 119

Comparition of the nucleotide sequences of wheat dwarf virus (WDV) isolates from Hungary and Ukraine

Tobias I., Shevchenko O., Kiss B., Bysov A., Snihur H., Polischuk V., SalÁnki K., Palkovics L. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 125

β-glucanase productivity improvement via cell immobilization of recombinant Escherichia coli cells in different matrices

Beshay U., El-Enshasy H., Ismail I.M.K., Moawad H., Abd-El-Ghany S. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 133

Utilization of UF-permeate for production of β-galactosidase by lactic acid bacteria

Murad H.A., Refaea R.I., Aly E.M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 139

Strains differentiation of Microsporum canis by RAPD analysis using (GACA)4 and (ACA)5 primers

Dobrowolska A., Dębska J., Kozłowska M., Stączek P. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 145

SDS-PAGE heat-shock protein profiles of environmental Aeromonas strains

Osman K.M., Amin Z.M.S., Aly M.A.K., Hassan H., Soliman W.S. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 149

Species-specific sensitivity of coagulase-negative staphylococci to single antibiotics and their combinations

Szymańska G., Szemraj M., Szewczyk E.M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 155

Association between existence of integrons and multi-drug resistance in Acinetobacter isolated from patients in Southern Iran

Japoni S., Japoni A., Farshad S., Ali A.A., Jamalidoust M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 163

Dissemination of class 1, 2 and 3 integrons among different multidrug resistant isolates of Acinetobacter baumannii in Tehran hospitals, Iran

Taherikalani M., Maleki A., SADEghifard N., Mohammadzadeh D., Soroush S., Asadollahi P., Asadollahi K., Emaneini M.SHORT . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 169

COMMUNICATIONS

Host response to the presence of Helicobacter spp. DNA in the liver of patients with chronic liver diseases

Rybicka M., Nakonieczna J., Stalke P., Bielawski K.P. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 175

INSTRUCTIONS TO AUTHORS and full Text articles (in pdf form) AVAILABLE AT: www.microbiology.pl/pjm

Polish Journal of Microbiology 2011, Vol. 60, No 2, 95–103 MINIREVIEW

Staphylococcal Cassette Chromosome mec (SCCmec) Classification and Typing Methods: an Overview Agata Turlej1, Waleria Hryniewicz1 and Joanna Empel2

Department of Epidemiology and Clinical Microbiology, 2 Department of Molecular Microbiology National Medicines Institute, Warsaw, Poland

1 

Received 6 April 2011, accepted 6 May 2011 Abstract Meticillin-resistant Staphylococcus aureus (MRSA) is one of the main causes of hospital-acquired infections, but since late 1990s also the community-acquired. For better understanding of the S. aureus epidemiology there is an urgent need for creation of new typing method for SCCmec element. The molecular typing of MRSA for epidemiological purposes is investigated by pulsed-field gel electrophoresis (PFGE), multilocus sequence typing (MLST), spa typing and the SCCmec type assignment. In last few years not only new type of SCCmec (VI to XI) have been identified, but also additional subtypes (i.e. IVg-j) and different variants of already existed one (i.e. 5C2&5 and 2B2&5) were discovered. The aim of this review is to briefly summarize current knowledge about SCCmec classification and to discuss advantages and disadvantages of selected SCCmec typing methods. K e y w o r d s: Staphylococcus aureus (MRSA), SCCmec classification and typing

Introduction Staphylococcus aureus is one of the leading causes of bacterial infections in developed countries and is responsible for a wide spectrum of diseases, ranging from minor skin infections to fatal necrotizing pneumonia. Since the introduction of penicillin into medical treatment in early 1940s, the resistance for beta-lactams has started to develop. It was a result of the acquisition of a plasmid, coding for penicillinase, a penicillin-hydrolyzing enzyme, which is able to cleave the beta-lactam ring and thus inactivate antibiotic molecule. Penicillin resistant strains soon spread not only in healthcare facilities, but also in the community. To overcome infections caused by beta-lactamase-producing S. aureus, a narrow spectrum semi-synthetic penicillin (meticillin) was introduced. However, soon after that, in 1961, first meticillin-resistant Staphylococcus aureus (MRSA) strain was identified. Initially, MRSA strains were encountered only in the hospitals, but in the late 1990s first virulent community-acquired MRSA (CA-MRSA) clones, characterized by the presence of the toxin Panton-Valentine leukocidin (PVL), appeared rapidly and unexpectedly. They quickly spread worldwide, initially only in the community, but later on also in the healthcare facilities, displacing in some caun-

tries typical HA-MRSA. For this reason, nowadays, distinction between CA-MRSA and mostly multiresistant HA-MRSA become challenging (Chambers and Deleo, 2009; Deurenberg and Stobberingh, 2008). The resistance of S. aureus to meticillin is caused by the presence of the mecA gene, encoding for an additional 78-kDa penicillin binding protein 2a, (PBP2a or PBP2’). Compared to other PBP, PBP2a has a low affinity for all beta-lactam antibiotics. As a result of that, even in the presence of a  beta-lactam antibiotic, the peptidoglycan layer biosynthesis is not disrupted and the bacterium can survive (Berger-Bachi and Rohrer, 2002; Deurenberg and Stobberingh, 2008). The mecA gene is located within a mec operon together with its regulatory genes: mecI and mecR1. (Berger-Bachi and Rohrer, 2002). The mec operon is carried by staphylococcal cassette chromosome mec (SCCmec). The origin of SCCmec is still unknown, but it is proposed that it was acquired by S. aureus from S. sciuri and that the mecA-positive coagulase-negative staphylococci (CoNS), especially S. epidermidis, may be a potential reservoir for the SCCmec element (Mongkolrattanothai et al., 2004; Wu et al., 2001). On the other hand, it is suggested that the main source of SCCmec could be MRSA itself (Aires de Sousa and de Lencastre, 2004). There are also suggestions of possible acquisition of the mecA

*  Corresponding author: Agata Turlej, National Medicine Institute, Chełmska 30/34, 00-725 Warsaw, Poland; phone: (48-22) 841 57 69; fax: (48-22) 8412949; e-mail: [email protected]

96

Turlej A. et al.

region from S. fleurettii, which is a commensal bacterium of animals (Tsubakishita et al., 2010). SCCmec typing, which classifies SCCmec elements on the basis of their structural differences, is applied in epidemiological studies to distinguish MRSA strains or to define an MRSA clone in combination with the genotype of meticillin-susceptible S. aureus (MSSA) strain in which a SCCmec element has integrated. SCCmec element composition SCCmec elements, detected in almost all MRSA strains, belong to particular type of the staphylococcal mobile genetic elements coding for meticillin-resistance and designated as staphylococcal cassette chromosome mec (Katayama et al., 2000). In S. aureus strains, SCCmec elements always integrate sequence specifically at the unique site of the chromosome, attBscc (bacterial chromosomal attachment site). The attBscc is located near the origin of replication, at the 3’ end of orfX, coding for an open reading frame X of unknown function, well conserved among both MRSA and MSSA strains (Hiramatsu et al., 2001; Ito et al., 1999; Ito et al., 2001). The attachment site contains a core 15-bp sequence, called the integration site sequence (ISS), that is necessary for ccr-mediated recombination (IWG-SCC, 2009; Katayama et al., 2000). After integration of SCCmec into the chromosome, ISS is found in direct repeat sequences at left and right SCCmec/chromosomal junctions of the integrated SCCmec element. Different SCCmec elements share similar backbone structure, that consists of (i) mec complex, composed of mecA operon, (ii) ccr gene complex, composed of cassette chromosome recombinase (ccr) gene(s) and (iii) three regions bordering the ccr and mec complexes, designated as joining (J) regions. The composition of almost all SCCmec elements identified so far in S. aureus can be presented as follow: (orfX)J3-mec-J2-ccr-J1 (Chongtrakool et al., 2006; Hiramatsu et al., 2002). The exception constitute SCCmecVII and a newly described SCCmecIX, with the ccr gene complex positioned between J3 and J2 regions and the mec gene complex between J2 and J1 regions (Berglund et al., 2008; Li et al., 2011). It is noteworthy, that different authors, and sometimes even the same, present the structure of the same SCCmec elements in reverse orientations, what creates difficulties or even confusions, especially for these not experienced in the field. The orientation with SCCmec located at the right site of orfX gene seems to be more correct as it is consistent with direction on genomic maps of S. aureus and will be used for needs of this article. Since the structural components mentioned above play a crucial role in classification of SCCmec elements they will be presented below in more details.

2

The ccr gene complex. The ccr gene complex is composed of the ccr gene(s) surrounded by orfs. The ccr genes encode for DNA recombinases of the invertaseresolvase family, enzymes that can catalyze precise excision of the SCCmec as well as its integration, both site- and orientation-specific, into staphylococcal chro­mo­some, being thus responsible for mobilization of the cassette (Katayama et al., 2000). Based on the composition of ccr genes, two distinct ccr gene complexes have been reported to date, one carrying two adjacent ccr genes, ccrA and ccrB, and the second carrying ccrC. The ccrA and ccrB genes identified to date in S. aureus strains have been classified into four and five allotypes respectively, resulting in six ccr gene complex types, designated as type 1 (ccrA1B1), type 2 (ccrA2B2), type 3 (ccrA3B3), type 4 (ccrA4B4), type 7 (ccrA1B6) and type 8 (ccrA1B3). All identified so far ccrC variants have shown high nucleotide similarity and are assigned to only one allotype, ccrC1, constituting type 5 of ccr gene complex (Chongtrakool et al., 2006; IWG-SCC, 2009) (http://www.sccmec.org/). The mec gene complex. Two evolutionary different lineages of mec gene complexes have been described in S. aureus. The first one, which encompasses the vast majority of known and well characterized mec gene complexes, have been observed in MRSA isolates of human origin since the nineties. The prototype of this lineage is the mec gene complex designated as class A, composed of an intact mec operon, the hyper-variable region (HVR) and the insertion sequence IS431 (Ito et al., 2001; Katayama et al., 2001). The mec operon includes mecA gene and located upstream of mecA its regulatory genes: mecR1 and mecI, coding for the signal transducer and the repressor, respectively. Differences between class A mec gene complex and other mec gene complexes of this lineage, described to date, result mainly from insertions of IS elements, IS1272 or IS431, into the region of mecA regulatory genes, causing complete deletion of mecI and, different in size, partial deletions of mecR1. Depending on the structural diversity of mecI-mecR1 region, five major classes of mec gene complexes, of the said lineage, have been defined by IGW-SCC (IWG-SCC, 2009): • Class A, which contains intact mec gene complex: IS431-mecA-mecR1-mecI; • Class B, where mecR1 is truncated by insertion sequence IS1272: IS431-mecA-ΔmecR1-IS1272; • Class C1, where mecR1 is truncated by insertion sequence IS431 having the same direction as the IS431 downstream of mecA: IS431-mecA-ΔmecR1-IS431; • Class C2, where mecR1 is truncated by insertion sequence IS431 having the reverse direction to the IS431 downstream of mecA: IS431-mecAΔmecR1-IS431; and

2

97

SCCmec classification and typing methods Table I Additional resistance genes located on mobile elements within the SCCmec elements Genetic element

SCCmec type/subtype

pUB110

I, II, IVA

Resistance

Gene ble

bleomycin



ant4’

tobramycin

Tn554

II, SCCHg,VIII

ermA

erythromycin





aad9/spc

streptomycin / spectinomycin

SCCHg

–

mer

mercury

pT181

III

tet

tetracycline

ΨTn554

III

cad

cadmium

Tn4001

IV (IVc and 2B&5)

aacA-aphD aminoglycosides

• Class D, where mecR1 is partly deleted but there is no IS element downstream of ΔmecR1: IS431mecA-ΔmecR1. This class has been observed in S. caprae only (Katayama et al., 2001). Recently, data from genome sequencing project of the bovine S. aureus isolate LGA251, have revealed a mec gene complex of the second evolutionary lineage (McCarthy and Lindsay, 2010)) (http://www.sanger. ac.uk/pathogens). This new complex, depicted as: bla Z-mecALGA251-mecR1LGA251-mecILGA251, constitutes the sixth defined major class, assigned as class E (http:// www.sccmec.org/). Besides the major classes of the mec gene complex several variants within the classes have also been distinguished, for example: class A3, where mecI is truncated by insertion sequence IS1182: IS431-mecA-mecR1ΔmecI-IS1182 and class A4, where mecI is disrupted by insertion sequence IS1182: IS431-mecA-mecR1-ΔmecIIS1182-ΔmecI (Shore et al., 2005) or class B2, which has an insertion of the transposone Tn4001 upstream of mecA in ΔmecR1: IS431-mecA-ΔmecR1- Tn4001-IS1272 (Heusser et al., 2007). The joining (J) regions. Apart from the ccr and mecA gene complexes, essential for the SCCmec biolo­ gical functions, the cassette comprises also three joining regions (J1-J3), previously called “junkyard” regions (Hiramatsu et al., 2002). J regions from different SCCmec elements are arranged in the same order. The J1  region is located at right site of the cassette, the J2 region between the ccr and the mec complexes and the J3 region at the left chromosomal junction adjacent to orfX (IWG-SCC, 2009). Although considered as less important in terms of SCCmec functions, these regions are epidemiologically significant since they may serve as targets for plasmids or transposons, carrying additional antibiotic and heavy metal resistance determinants. Acquisition and accumulation of resistance genes by mobile elements like SCCmec enables their dissemination and in consequence leads to emerge of multidrug resistance strains. Examples of antibiotic resistance determinants, that may be carried within

J  regions are summarized in Table  I (Ito et al., 2003; Malachowa and DeLeo, 2010). Sequence analysis of J regions from different SCCmec elements revealed that they are unique to particular types of ccr-mec gene complex combinations and that variations of these regions within the same ccr-mec gene complex combination are specific for SCCmec subtypes (Hisata et al., 2005; Ito et al., 2003; IWG-SCC, 2009; Kwon et al., 2005; Ma et al., 2002; Ma et al., 2006; Milheirico et al., 2007b; Oliveira et al., 2001; Oliveira and de Lencastre, 2002; Shore et al., 2005). The SCCmec element classification The first SCCmec element was identified in Japanese S. aureus strain, N315 in 1999 and shortly after two additional SCCmec from different MRSA strains were determined (Ito et al., 1999; Ito et al., 2001). Based on detailed structural analysis these three SCCmec elements were classified as types I to III (Ito et al., 2001). In time, both new types of SCCmec, such as SCCmecIV (Ma et al., 2002), SCCmecV (Ito et al., 2004), SCCmecVI (Oliveira et al., 2006a), SCCmecVII (Berglund et al., 2008), SCCmecVIII (Zhang et al., 2009), SCCmecIX, SCCmecX (McCarthy and Lindsay, 2010), SCCmecXI (http://www.sccmec.org/) and many new variants of already known SCCmec types have been reported (BoyleVavra et al., 2005; Cha et al., 2005; Chlebowicz et al., 2010; Heusser et al., 2007; Higuchi et al., 2008; Hisata et al., 2005; Kwon et al., 2005; O’Brien et al., 2005; Oliveira and de Lencastre, 2002; Shore et al., 2005; Shukla et al., 2004; Stephens et al., 2007; Takano et al., 2008). With growing number of SCCmec types, subtypes or variants published in the literature it became obvious that without approved international rules of nomenclature system it would be difficult in the nearest future to keep in order suitable naming of new emerged SCCmec elements. To meet the urgent need the International Working Group on Classification of Staphylococcal Cassette Chromosome (SCC) Elements

98

2

Turlej A. et al. Table II Reference strains for SCCmec types, which have been described up to date SCCmec type/subtype I (1B)

Strain NCTC 10442

GenBank accession no AB033763

Origin UK

Isolation date 1961

Description (Ito et al., 2001)

II (2A)

N315 D86934

Japan

1982

(Ito et al., 1999)

III (3A)

85/2082

AB037671

New Zealand

1985

(Ito et al., 2001)

IVa (2B)

CA05

AB063172

USA

1999

(Ma et al., 2002)

IVb (2B)

8/6-3P (JCSC1978) AB063173

USA

1996

(Ma et al., 2002)

IVc (2B)

81/108 (MR108)

AB096217

Japan

NA*

(Ito et al., 2003)

IVd (2B)

JCSC4469

AB097677

Japan

1982

(Ma et al., 2006)

IVg (2B)

M03-68 DQ106887

Korea

2003

(Kwon et al., 2005)

IVh (2B)

HAR22

NA

Finland

2002

(Milheirico et al., 2007b)

IVi (2B)

JCSC6668

AB425823

Sweden

1999

(Berglund et al., 2009)

IVj (2B)

JCSC6670

AB425824

Sweden

1990

(Berglund et al., 2009)

V (5C2)

WIS (JCSC3624)

AB121219

Australia

1999

(Ito et al., 2004)

VI (4B)

HDE 288

AF411935

Portugal

1996

(Oliveira et al., 2006a)

VII (5C1)

JCSC6082

AB373032

Sweden

2002

(Berglund et al., 2008)

VIII (4A)

C10682

FJ670542

Canada

2003

(Zhang et al., 2009)

IX 1(C2)

JCSC6943

NA

Thailand

2006

(Li et al., 2011)

X (7C1)

JCSC6945

NA

Canada

2006

(Li et al., 2011)

XI (8E)

LGA251

Na

NA

NA

http://www.sccmec.org/

*  NA – information not available

(IWG-SCC) was established in 2009. The main objectives of the group was to define consensus rules of a  uniform nomenclature system for SCCmec elements, determine minimum requirements for the description of the new SCCmec elements and establish guidelines for the identification of SCCmec elements for epidemiological studies (IWG-SCC, 2009). In published guidelines IWG-SCC decided to retain the previous nomenclature of SCCmec with additional information about combination of ccr complex type and class of mec complex present in the element. Thus, classification of SCCmec element into the types (SCCmec typing), should be based on the combination of the type of ccr gene complex and the class of the mec gene complex present in the cassette, while variants within SCCmec types (SCCmec subtyping) should be defined by differences in their J regions, as it was proposed earlier by Hiramatsu group (Chongtrakool et al., 2006; IWG-SCC, 2009). Accordingly, SCCmec type I, was described additionally as 1B, what indicates the SCCmec element harboring the type 1 ccr and a class B mec gene complexes. To date, eleven SCCmec types have been defined. The other known SCCmec types are designated type II (2A), type III (3A), type IV (2B), type V (5C2), type VI (4B), type VII (5C1), type VIII (4A), type  IX (1C2), type  X (7C1) and type  XI (8E). They all are summarized in Table II. The improved way of SCCmec classification allowed also to assign the mosaic variants of SCCmec. For

example, SCCmec element from ZH47 strain, harbor­ ing type  2 ccr gene complex and additional ccrC1 in combination with mec class B2 was designated type IV (2B&5), while SCCmec element from TSGH17 and PM1 strains, carrying two different ccrC1 allels, 2 and 8, that was previously reported as SCCmec type  VII or Taiwanese SCCmec type V (SCCmecVT), was designa­ted type V (5C2&5) (Boyle-Vavra et al., 2005; Heusser et al., 2007; Higuchi et al., 2008; IWG-SCC, 2009; Takano et al., 2008). Due to the increasing diversity among SCCmec subtypes, IWG-SCC proposed the preparation of a computerized system, which will be able to characterize and assign certain SCCmec subtype based on the occurrence of specific elements within the J regions. Together with the discovery of new SCCmec types, also a need for new more complex SCCmec typing methods has emerged. Available SCCmec typing methods It had already been observed that the worldwide spread of MRSA is driven by the dissemination of a number of clones with a specific genetic background. Epidemiological studies revealed that for proper clone assignment not only the multilocus sequence typing (MLST) and spa typing is required, but also SCCmec typing is needed (Deurenberg et al., 2007). Since that

2

SCCmec classification and typing methods

time, it has become necessary to find an easy and robust method for SCCmec element identification and typing. The more complex our knowledge about SCCmec elements is, the more challenging invention of the typing method becomes and the more relevant becomes the question, how accurate should we be in assigning SCCmec element type for epidemiological purposes. The SCCmec typing methods has been developed along with the new SCCmec types descriptions and appearance of the novel techniques or approaches for their analysis. Three different schemes of SCCmec typing can be distinguished: methods based on the restriction enzymes digestion, methods based on PCR or multiplex PCR (M-PCR) and methods based on real-time PCR. First SCCmec typing methods. The first methods for detecting polymorphisms in the mecA vicinity were based on hybridizations of the mecA probe and Tn554 probe with ClaI-digested genomic DNA from the analyzed isolates (Leski et al., 1998). This method was very useful for epidemiological studies before the SCCmec element’s structure was described. Nowadays there are some concepts on using restriction enzymes digestion in combination with PCR, like in multienzyme multiplex PCR-amplified fragment length polymorphism (ME-AFLP) or in SCCmec typing method by PCR amplification of the ccrB gene in combination with restriction fragment length polymorphism (RFLP) employing endonucleases HinfI and BsmI (van der Zee et al., 2005; Yang et al., 2006). In the first one, the obtained typing patterns were found to cluster together according to the SCCmec type of the strain, with the discriminatory power comparable to PFGE. However, it is just a pattern based typing, which might be an interesting method for prescreening of a large strain collection, but is by far not sensitive enough to proper assign SCCmec type for epidemiological purposes, since it does not recognize any characteristic features for already described SCCmec elements. The second method is simple and time-effective, but far not elaborate enough, because it focuses only on the ccrB typing. Since the ccrC genes were also described, it is not complex enough to be useful, concerning the current knowledge of SCCmec types. Moreover, for proper SCCmec assignment the mec class description in combination with ccr type is necessary. It seems that the scheme of SCCmec typing based on restriction enzymes digestion is no longer superior. The most common methods used nowadays for SCCmec typing based on PCR are summarized below. PCR based SCCmec typing methods. During the past several years, a number of SCCmec typing methods based on multiplex PCR (M-PCR) have been developed (Boye et al., 2007; Hisata et al., 2005; Kondo et al., 2007; Milheirico et al., 2007a; Oliveira and de Lencastre, 2002; Zhang et al., 2005). Two different approaches were

99

applied in this methods; one was focused on analysis of J regions, whereas the other determine mainly mec class and ccr type. The first M-PCR method was described by Oliveira et al. (Oliveira and de Lencastre, 2002). At that time it was innovative technique that enabled to increase analysis scale and exchange the information about SCCmec types all over the world. It was based on identification of specific genes or motifs located mostly in the J regions of particular cassettes. Potentially, this method should detected SCCmec type I–IV, but in practice detection of SCCmec type III was problematic as in fact the primers were designed not to SCCmec type III but to so-called SCCmercury, which at that time was believed to be the integral part of the element. For more details see Chongtrakool et al. (Chongtrakool et al., 2006). This SCCmec typing strategy also did not discriminate SCCmec type IV and VI. (Oliveira et al., 2006a). In 2007, the same group published an update for Oliveira’s method, which improved the detection of SCCmec type I to IV and includes the structure determination of the SCCmec type  V and VI. However, the SCCmecVI was suggested to be confirmed by ccrB sequencing, which is costly and time-consuming (Milheirico et al., 2007a; Oliveira et al., 2006b) (http:// www.ccrbtyping.net). The most significant advantage of this method is that it is a quick, single-tube M-PCR reaction for all detectable by this method SCCmec types. Unfortunately, the method is still based on markers located within the J regions. This can cause some problems, as for example in our practice we sometimes see the pattern for SCCmec type I similar to type VI, which is confusing. Almost at the same time Zhang et al. has described a complex method for SCCmec I to V typing and SCCmec type IV subtyping in a multiplex PCR reactions (Zhang et al., 2005). This method include three M-PCR reactions and one single target PCR reaction with sets of primers specific to mec, ccr and J1 region. First M-PCR reaction uses a set of primers specific for SCCmec type I to V, with SCCmec subtypes IVa to IVd, the second M-PCR reaction uses primers for assigning mec class A and B and third M-PCR reaction uses primers for type 1–3 ccr described previously by Ito et al. For detection of type 5 ccr the authors propose PCR reaction with single pair of primers (Ito et al., 2001; Zhang et al., 2005). The proposed approach seems to be not useful for large-scale analysis, since four separate reactions should be done. Moreover, it does not allow to detect neither mec class C1 and C2 nor type 4 ccr. On the other hand, this method allows to detect Taiwanese SCCmec type V (5C2&5). This mosaic variant of SCCmec type V gives one extra band of 1599  bp, compared to the reference type  V (5C2). Another SCCmec typing method was developed in 2005 by Hisata et al. who proposed another set of primers (Hisata et al., 2005). The method allowed

100

Turlej A. et al.

to detect SCCmec type I, IIa, IIb, III and IVa to IVd and was based mainly on mec class and ccr type assignment. Unfortunately, it was not possible to perform the analysis in a single M-PCR reaction and the method did not become popular widely. Another recently developed technique was presented by Boye et al. (Boye et al., 2007). It is a quick and easy to interpret method based on single-tube M-PCR reaction, using primers for specific detection of both mec class and ccr type of SCCmec type I to V. It seems to be very useful for first screening of large amount of strains, but for the detection of SCCmec type I to III it is not complex enough. For example, to detect SCCmec type III only ccrC specific pair of primers is used, which confirms just the presence of SCCmercury (Boye et al., 2007). Moreover, this method also misclassifies SCCmec type I with type VI. However, this method can also be used for confirmation of doubtful SCCmec types. The most complex and promising system for SCCmec assignment, especially in the light of the new guidelines for SCCmec elements classification was developed by Kondo et al. (Kondo et al., 2007). This PCR scheme combines six M-PCR reactions: M-PCR 1 for amplification of ccr type (1–4) along with mecA gene; M-PCR 2 for amplification of mec class (A, B and C2); M-PCR 3 for amplification of ORFs from J1 region of SCCmec type I and IV; M-PCR 4 for amplification of ORFs from J1 region of SCCmec type II, III and V; M-PCR 5 and 6 for amplification of gene alleles located in J2 and J3 region of SCCmec elements, respectively. M-PCRs 5 and 6 are used for the identification of integrated copies of transposons (Tn554 or ΨTn554) and plasmids (pUB110 or pT181). The most significant advantage of this method is its flexibility, since it does not detect any particular SCCmec type, but only crucial loci, which in combination gives at the end the SCCmec type. This approach potentially allows detection of SCCmec types I to IX except SCCmecVII and X since primers specific for mec class C1 have not been included to this system yet. Using M-PCRs 3 to 6 it is possible also to identify variety of SCCmec subtypes. However, since this method requires a relatively large number of PCR reactions to determine the structure of SCCmec it is quite complicated and time consuming. That is why it is suggested to perform just M-PCR 1 and 2 to assign type of SCCmec elements and in most cases, it may be enough for epidemiological purposes. Recently new SCCmec type V variants, which are getting epidemiologically important, were also described (Chlebowicz et al., 2010; Higuchi et al., 2008). It turned out that despite the high similarity among ccrC1 genes, its’ specific alleles 1, 2, 8, 9 and 10 typing could be also important for SCCmec type V precise characterization. For detection of mosaic SCCmecV (5C2&5) variant, Higuchi et al. provides a set of primers specific for two types 5 ccr (ccrC1 allel 2 and

2

ccrC1 allel 8), two characteristic ORFs (orf33 and orf35) and the mec class C2 variant, in which nucleotide substitution in IS431 results in truncated transposase in ΨIS431 in mec complex C2 (Higuchi et al., 2008). The last method we would like to mention here concerns detection of recently discovered SCCmec type  VIII (McClure et al., 2010; Zhang et al., 2005). It is based on single-tube M-PCR reaction using a set of primers specific for detection of characteristic features of this particular of SCCmec element, namely type 4 ccr, mec class A, and a unique junction within the J region as well as internal controls. Regarding the growing number of MRSA clones harbouring different SCCmec IV subtypes one of the most important issue become also invention of a robust method for SCCmec type IV subtyping. In our opinion dedicated to solve this problem is method published by Milheirico et al., which is to our knowledge the most complex among available methods and allow to detect SCCmec type IV subtypes from a to h (Milheirico et al., 2007b). We also use subtypig descriebed by Zhang et al., but we find that quite often it is difficult to detect SCCmec type IVc using this method, while we never had such problems when using Milheirico et al. method.The PCR based methods for SCCmec typing are the most common and the easiest to implement in laboratories, since they do not require additional expensive equipment, but on the other hand, they are labor and time-consuming, compared to realtime PCR based analysis. Real-time PCR based SCCmec typing methods. In parallel to PCR based methods for SCCmec typing, the methods based on real-time PCR have also been developed. A multiplex scheme based on a real-time PCR targeting the ccrB regions of SCCmec types I to IV was published in 2004 by Francois et al., but with current knowledge about SCCmec types this method is not elaborate enough (Francois et al., 2004). Recently, however, a new approach using ccr-specific padlock probes and tag microarray analysis for simultaneous probing of core genome diversity and identification of SCCmec was developed. However, the set of padlock probes includes only oligonucleotides targeting diagnostic regions in the mecA, ccrB and ccrC genes without mec class recognition (Kurt et al., 2009). A significant disadvantage of these methods is that they detect only ccr locus and ignore the mec complex, which may result in misclassification and do not allow the detection of novel combinations of the mec and ccr complex in SCCmec elements. On the other hand, in the same year, a very interesting method for SCCmec element typing was published, based on a rapid molecular beacon real-time PCR (MB-PCR) assay (Chen et al., 2009). The design of the system is based on the definition of SCCmec types as a combination of the ccr allotype along with the mec class complex. The assay con-

2

101

SCCmec classification and typing methods

sists of two multiplex panels, the combination of which results in two targets (mec class, ccr) for each SCCmec type. MB-PCR panel I targets mecA, ccrB2, mecI, and the ΔmecR1-IS1272 junction (mec class B) and thus can definitively identify SCCmec types  II and  IV. MB-PCR panel II detects ccrC, ccrB1, ccrB3, ccrB4, and the ΔmecR1-IS431 junction (mec class C2) and is therefore capable of identifying SCCmec types I, III, V, and VI in combination with panel I. This method can also detect the recently described novel SCCmec type VIII (ccrAB4 with mec class A). The authors of this method ascertain that it is possible to easily classify isolates within 3 to 4 h, including DNA isolation, PCR cycling and analysis, which is extremely quick. However, in this analysis it is impossible to detect SCCmec subtypes, since there are no primers designed for J-regions and this method does not detect the mec class C1, which is characteristic for SCCmec type VII and X. The most significant advantage of real-time PCR based methods is the small amount of time and labor required for the analysis. They do not combine many preparatory steps and are easy to interpret. On the other hand, they require special equipment and reagents, which are very expensive. Conclusion A variety of different methods for SCCmec typing are now available. To cope with the increasing diversity of SCCmec elements being reported, methods for their detection should be elaborated and flexible. Conventional PCR assays using commonly up to ten primer pairs in a single-tube assay can give various sensitivities, depending on the template quality and may be easily contaminated. On the other hand, the real-time PCR assay requires expensive reagents and instruments, which can limit its use in many microbiological laboratories. Unfortunately, there is still no method available for SCCmec type VII and X–XI typing. High heterogenicity and variability of SCCmec elements make them complicated as a markers for epidemiological clone assignment. In our opinion, up to date, the best way of assigning the SCCmec type is to prepare the M-PCR 1 and 2 according to Kondo et al. or real-time PCR according to Chen et al., for ccr type and mec class detection. For SCCmec type IV subtyping we recommend method by Milheirico et al. (Milheirico et al., 2007b). This proceeding should be enough in most cases. For more accurate subtyping we suggest using the other M-PCRs described by Kondo et al. and if neces­sary also methods established by Higuchi et al. and McClure et al. Recent work done by IWG-SCC clarified the classification of the major SCCmec elements type, but there is still a lot of ambiguity regarding naming of the

SCCmec variants, which requires further investigations and agreements. This includes answering the question, how accurate should we be in assigning SCCmec element type/variant for epidemiological purposes. Acknowledgements This work was a part of the activities of the CONCORD Collaborative project supported by the European Commission grant HEALTH-F3-2008-222718. WH and JE was also partly supported by finding from the European Community MOSAR network contract LSHP-CT-2007-037941.

Literature Aires de Sousa M. and H. de Lencastre. 2004. Bridges from hospitals to the laboratory: genetic portraits of methicillin-resistant Staphylococcus aureus clones. FEMS Immunol. Med. Microbiol. 40: 101–111. Berger-Bachi B. and S. Rohrer. 2002. Factors influencing methicillin resistance in staphylococci. Arch. Microbiol. 178: 165–171. Berglund C., T. Ito, M. Ikeda, X.X. Ma, B. Soderquist and K. Hiramatsu. 2008. Novel type of staphylococcal cassette chromosome mec in a methicillin-resistant Staphylococcus aureus strain isolated in Sweden. Antimicrob. Agents. Chemother. 52: 3512–3516. Berglund C., T. Ito, X.X. Ma, M. Ikeda, S. Watanabe, B. Soderquist and K. Hiramatsu. 2009. Genetic diversity of methicillin-resistant Staphylococcus aureus carrying type IV SCCmec in Orebro County and the western region of Sweden. J. Antimicrob. Chemother. 63: 32–41. Boye K., M.D. Bartels, I.S. Andersen, J.A. Moller and H. Westh. 2007. A new multiplex PCR for easy screening of methicillin-resistant Staphylococcus aureus SCCmec types I–V. Clin. Microbiol. Infect. 13: 725–727. Boyle-Vavra S., B. Ereshefsky, C.C. Wang and R.S. Daum. 2005. Successful multiresistant community-associated methicillin-resistant Staphylococcus aureus lineage from Taipei, Taiwan, that carries either the novel staphylococcal chromosome cassette mec (SCCmec) type VT or SCCmec type IV. J. Clin. Microbiol. 43: 4719–4730. Cha H.Y., D.C. Moon, C.H. Choi et al. 2005. Prevalence of the ST239 clone of methicillin-resistant Staphylococcus aureus and differences in antimicrobial susceptibilities of ST239 and ST5 clones identified in a Korean hospital. J. Clin. Microbiol. 43: 3610–3614. Chambers H.F. and F.R. Deleo. 2009. Waves of resistance: Staphylococcus aureus in the antibiotic era. Nat. Rev. Microbiol. 7: 629–641. Chen L., J.R. Mediavilla, D.C. Oliveira, B.M. Willey, H. de Lencastre and B.N. Kreiswirth. 2009. Multiplex real-time PCR for rapid staphylococcal cassette chromosome mec typing. J. Clin. Microbiol. 47: 3692–3706. Chlebowicz M.A., K. Nganou, S. Kozytska, J.P. Arends, S. Engelmann, H. Grundmann, K. Ohlsen, J.M. van Dijl and G. Buist. 2010. Recombination between ccrC genes in a type V (5C2&5) staphylococcal cassette chromosome mec (SCCmec) of Staphylococcus aureus ST398 leads to conversion from methicillin resistance to methicillin susceptibility in vivo. Antimicrob. Agents. Chemother. 54: 783–791. Chongtrakool P., T. Ito, X.X. Ma et al. 2006. Staphylococcal cassette chromosome mec (SCCmec) typing of methicillin-resistant Staphylococcus aureus strains isolated in 11 Asian countries: a proposal for a new nomenclature for SCCmec elements. Antimicrob. Agents. Chemother. 50: 1001–1012. Deurenberg R.H., C. Vink, S. Kalenic, A.W. Friedrich, C.A. Bruggeman and E.E. Stobberingh. 2007. The molecular evolution of

102

Turlej A. et al.

methicillin-resistant Staphylococcus aureus. Clin. Microbiol. Infect. 13: 222–235. Deurenberg R.H. and E.E. Stobberingh. 2008. The evolution of Staphylococcus aureus. Infect. Genet. Evol. 8: 747–763. Francois P., G. Renzi, D. Pittet, M. Bento, D. Lew, S. Harbarth, P. Vaudaux and J. Schrenzel. 2004. A novel multiplex real-time PCR assay for rapid typing of major staphylococcal cassette chromosome mec elements. J. Clin. Microbiol. 42: 3309–3312. Heusser R., M. Ender, B. Berger-Bachi and N. McCallum. 2007. Mosaic staphylococcal cassette chromosome mec containing two recombinase loci and a new mec complex, B2. Antimicrob. Agents. Chemother. 51: 390–393. Higuchi W., T. Takano, L.J. Teng. and T. Yamamoto. 2008. Structure and specific detection of staphylococcal cassette chromosome mec type VII. Biochem. Biophys. Res. Commun. 377: 752–756. Hiramatsu K., L. Cui, M. Kuroda and T. Ito. 2001. The emergence and evolution of methicillin-resistant Staphylococcus aureus. Trends. in microbiology 9: 486–493. Hiramatsu K., Y. Katayama, H. Yuzawa and T. Ito. 2002. Molecular genetics of methicillin-resistant Staphylococcus aureus. Int. J. Med. Microbiol. 292: 67–74. Hisata K., K. Kuwahara-Arai, M. Yamanoto et al. 2005. Dissemination of methicillin-resistant staphylococci among healthy Japanese children. J. Clin. Microbiol. 43: 3364–3372. Ito T., Y. Katayama and K. Hiramatsu. 1999. Cloning and nucleotide sequence determination of the entire mec DNA of pre-methi­ cillin-resistant Staphylococcus aureus N315. Antimicrob. Agents. Chemother. 43: 1449–1458. Ito T., Y. Katayama, K. Asada, N. Mori, K. Tsutsumimoto, C. Tiensasitorn and K. Hiramatsu. 2001. Structural comparison of three types of staphylococcal cassette chromosome mec integrated in the chromosome in methicillin-resistant Staphylococcus aureus. Antimicrob. Agents. Chemother. 45: 1323–1336. Ito T., K. Okuma, X.X. Ma, H. Yuzawa and K. Hiramatsu. 2003. Insights on antibiotic resistance of Staphylococcus aureus from its whole genome: genomic island SCC. Drug. Resist. Updat. 6: 41–52. Ito T., X.X. Ma, F. Takeuchi, K. Okuma, H. Yuzawa and K. Hiramatsu. 2004. Novel type V staphylococcal cassette chromosome mec driven by a novel cassette chromosome recombinase, ccrC. Antimicrob. Agents. Chemother. 48: 2637–2651. IWG-SCC. 2009. Classification of staphylococcal cassette chromosome mec (SCCmec): guidelines for reporting novel SCCmec elements. Antimicrob. Agents. Chemother. 53: 4961–4967. Katayama Y., T. Ito and K. Hiramatsu. 2000. A new class of genetic element, staphylococcus cassette chromosome mec, encodes methicillin resistance in Staphylococcus aureus. Antimicrob. Agents. Chemother. 44: 1549–1555. Katayama Y., T. Ito and K. Hiramatsu. 2001. Genetic organization of the chromosome region surrounding mecA in clinical staphylococcal strains: role of IS431-mediated mecI deletion in expression of resistance in mecA-carrying, low-level methicillin-resistant Staphylococcus haemolyticus. Antimicrob. Agents. Chemother. 45: 1955–1963. Kondo Y., T. Ito, X.X. Ma, S. Watanabe, B.N. Kreiswirth, J. Etienne and K. Hiramatsu. 2007. Combination of multiplex PCRs for staphylococcal cassette chromosome mec type assignment: rapid identification system for mec, ccr, and major differences in junkyard regions. Antimicrob. Agents. Chemother. 51: 264–274. Kurt K., A. Alderborn, M. Nilsson, B. Strommenger, W. Witte and U. Nubel. 2009. Multiplexed genotyping of methicillin-resistant Staphylococcus aureus isolates by use of padlock probes and tag microarrays. J. Clin. Microbiol. 47: 577–585. Kwon N.H., K.T. Park, J.S. Moon et al. 2005. Staphylococcal cassette chromosome mec (SCCmec) characterization and molecular

2

analysis for methicillin-resistant Staphylococcus aureus and novel SCCmec subtype IVg isolated from bovine milk in Korea. J. Antimicrob. Chemother. 56: 624–632. Leski T., D. Oliveira, K. Trzcinski, I.S. Sanches, M. Aires de Sousa, W. Hryniewicz and H. de Lencastre. 1998. Clonal distribution of methicillin-resistant Staphylococcus aureus in Poland. J. Clin. Microbiol. 36: 3532–3539. Li S., R.L. Skov, X. Han et al. 2011. Novel types of staphylococcal cassette chromosome mec elements identified in CC398 methicillin resistant Staphylococcus aureus strains. Antimicrob. Agents. Chemother. Ma X.X., T. Ito, C. Tiensasitorn, M. Jamklang, P. Chongtrakool, S. Boyle-Vavra, R.S. Daum and K. Hiramatsu. 2002. Novel type of staphylococcal cassette chromosome mec identified in community-acquired methicillin-resistant Staphylococcus aureus strains. Antimicrob. Agents. Chemother. 46: 1147–1152. Ma X.X., T. Ito, P. Chongtrakool and K. Hiramatsu. 2006. Predom­inance of clones carrying Panton-Valentine leukocidin genes among methicillin-resistant Staphylococcus aureus strains isolated in Japanese hospitals from 1979 to 1985. J. Clin. Microbiol. 44: 4515–4527. Malachowa N. and F.R. DeLeo. 2010. Mobile genetic elements of Staphylococcus aureus. Cell. Mol. Life Sci. 67: 3057–3071. McCarthy A.J. and J.A. Lindsay. 2010. Genetic variation in Staphylococcus aureus surface and immune evasion genes is lineage associated: implications for vaccine design and host-pathogen inter­ actions. BMC Microbiol. 10: 173. McClure J.A., J.M. Conly, S. Elsayed and K. Zhang. 2010. Multiplex PCR assay to facilitate identification of the recently described staphylococcal cassette chromosome mec type VIII. Molecular and cellular probes 24: 229–232. Milheirico C., D.C. Oliveira and H. de Lencastre. 2007a. Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus. Antimicrob. Agents. Chemother. 51: 3374–3377. Milheirico C., D.C. Oliveira and H. de Lencastre. 2007b. Multiplex PCR strategy for subtyping the staphylococcal cassette chromosome mec type IV in methicillin-resistant Staphylococcus aureus: ‘SCCmec IV multiplex’. J. Antimicrob. Chemother. 60: 42–48. Mongkolrattanothai K., S. Boyle, T.V. Murphy and R.S. Daum. 2004. Novel non-mecA-containing staphylococcal chromosomal cassette composite island containing pbp4 and tagF genes in a commensal staphylococcal species: a possible reservoir for antibiotic resistance islands in Staphylococcus aureus. Antimicrob. Agents. Chemother. 48: 1823–1836. O’Brien F.G., G.W. Coombs, J.C. Pearson, K.J. Christiansen and W.B. Grubb. 2005. Type V staphylococcal cassette chromosome mec in community staphylococci from Australia. Antimicrob. Agents. Chemother. 49: 5129–5132. Oliveira D.C., A. Tomasz and H. de Lencastre. 2001. The evolution of pandemic clones of methicillin-resistant Staphylococcus aureus: identification of two ancestral genetic backgrounds and the associated mec elements. Microb. Drug. Resist. 7: 349–361. Oliveira D.C. and H. de Lencastre. 2002. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrob. Agents. Chemother. 46: 2155–2161. Oliveira D.C., C. Milheirico and H. de Lencastre. 2006a. Redefining a structural variant of staphylococcal cassette chromosome mec, SCCmec type VI. Antimicrob. Agents. Chemother. 50: 3457–3459. Oliveira D.C., C. Milheirico, S. Vinga and H. de Lencastre. 2006b. Assessment of allelic variation in the ccrAB locus in methicillinresistant Staphylococcus aureus clones. J. Antimicrob. Chemother. 58: 23–30.

2

SCCmec classification and typing methods

Shore A., A.S. Rossney, C.T. Keane, M.C. Enright and D.C. Coleman. 2005. Seven novel variants of the staphylococcal chromosomal cassette mec in methicillin-resistant Staphylococcus aureus isolates from Ireland. Antimicrob. Agents. Chemother. 49: 2070–2083. Shukla S.K., S.V. Ramaswamy, J. Conradt, M.E. Stemper, R. Reich, K.D. Reed and E.A. Graviss. 2004. Novel polymorphisms in mec genes and a new mec complex type in methicillin-resistant Staphylococcus aureus isolates obtained in rural Wisconsin. Antimicrob. Agents. Chemother. 48: 3080–3085. Stephens A.J., F. Huygens and P.M. Giffard. 2007. Systematic derivation of marker sets for staphylococcal cassette chromosome mec typing. Antimicrob. Agents. Chemother. 51: 2954–2964. Takano T., W. Higuchi, T. Otsuka et al. 2008. Novel characteristics of community-acquired methicillin-resistant Staphylococcus aureus strains belonging to multilocus sequence type 59 in Taiwan. Antimicrob. Agents. Chemother. 52: 837–845. Tsubakishita S., K. Kuwahara-Arai, T. Sasaki and K. Hiramatsu. 2010. Origin and molecular evolution of the determinant of methicillin resistance in staphylococci. Antimicrob. Agents. Chemother. 54: 4352–4359. van der Zee A., M. Heck, M. Sterks, A. Harpal, E. Spalburg, L.  Kazobagora and W. Wannet. 2005. Recognition of SCCmec

103

types according to typing pattern determined by multienzyme multiplex PCR-amplified fragment length polymorphism analysis of methicillin-resistant Staphylococcus aureus. J. Clin. Microbiol. 43: 6042–6047. Wu S.W., H. de Lencastre and A. Tomasz. 2001. Recruitment of the mecA gene homologue of staphylococcus sciuri into a resistance determinant and expression of the resistant phenotype in Staphylococcus aureus. J Bacteriol 183, 2417–2424. Yang J.A., D.W. Park, J.W. Sohn and M.J. Kim. 2006. Novel PCRrestriction fragment length polymorphism analysis for rapid typing of staphylococcal cassette chromosome mec elements. J. Clin. Microbiol. 44, 236–238. Zhang K., J.A. McClure, S. Elsayed, T Louie and J.M. Conly. 2005. Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. J. Clin. Microbiol. 43: 5026–5033. Zhang K., J.A. McClure, S. Elsayed and J.M. Conly. 2009. Novel staphylococcal cassette chromosome mec type, tentatively designated type VIII, harboring class A mec and type 4 ccr gene complexes in a Canadian epidemic strain of methicillin-resistant Staphylococcus aureus. Antimicrob. Agents. Chemother. 53: 531–540.

Polish Journal of Microbiology 2011, Vol. 60, No 2, 105–112 ORGINAL PAPER

Immobilized Cells of Recombinant Escherichia coli Strain for Continuous Production of L-aspartic Acid GRAŻYNA SZYMAŃSKA*, BOGUSŁAW SOBIERAJSKI and ALEKSANDER CHMIEL

Department of Biosynthesis of Drugs, Chair of Biology and Pharmaceutical Biotechnology, Medical University of Łódź, Poland Received 6 September 2010, revised 15 February 2011, accepted 20 February 2011 Abstract For L-aspartic acid biosynthesis, high production cells of Escherichia coli mutant B-715 and P1 were immobilized in chitosan gel using a technique developed in our laboratory. The immobilization process reduced initial activity of the intact cells, however, the biocatalyst produced was very stabile for long-term use in multi-repeated batch or continuous processes. Temperature influence on the conversion of ammonium fumarate to L-aspartic acid was investigated. In long-term experiments, over 603 hours, the temperature 40°C was found to be the best for both biocatalyst stability and high conversion rate. The optimum substrate concentration was 1.0 M. Continuous production of L-aspartic acid was investigated in three types of column bioreactors characterized by different volumes as well as different high to biocatalyst bed volume rations (Hz/Vz). The highest conversion rate, 99.8%, and the productivity 6 g/g/h (mass of L-aspartic acid per dry mass of cells in biocatalyst per time unit) was achieved in the bioreactor with the highest value Hz/Vz = 3.1, and liquid hour space velocity value of 5.2, defined as the volume of feeding substrate passed per volume of catalyst in bioreactor per one hour. K e y w o r d s: E. coli, immobilized cells, L-aspartic acid

Introduction When extracted from cells, intracellular enzymes can be used in solution for only one batch process if they are not immobilized. This shortcoming can be eliminated by enzyme immobilization; however, such preparations are frequently not sufficiently stable and their productivity is usually unsatisfactory for industrial purposes. These disadvantages can be overcome by immobilization of whole cells, enabling both cheaper and less laborious biotechnology to be developed. In their first technological description (Chibata et al., 1974) examined various methods for the immobilization of E. coli cells with high aspartase activity. As a  result, L-aspartic acid production on an industrial scale using Escherichia coli cells immobilized in polyacrylamide was developed in 1973 (Chibata et al., 1974). Subsequently, various other polymers for this process have been proposed and applied (Chibata et al., 1985, Fusee et al.,1981); however, it is obvious that continuous improvement of both the biological agents and process technology is necessary. We have previously described our investigations on strain improvement (Gadomska et al., 2007; Papierz et al., 2007) and in this paper, we present our own immobilization method of whole E. coli cells in chitosan for L-aspartic acid biosynthesis in continuous process in column bioreactors.

For industrial production of L-aspartic acid, column bioreactors, single or in combination of two or more columns, are proposed (Lee and Hong, 1988; Tosa et al., 1973; Kawabata et al., 1990; Sato et al., 1975). Continuous L-aspartic acid biosynthesis is carried out using immobilized cells of bacteria with high aspartase activity by passing an ammonium fumarate solution through the biocatalyst bed. Bioreactor productivity is closely related to aspartase activity, ammonium fumarate solution concentration and substrate flow rate. L-aspartic acid biosynthesis is profitable if the conversion rate of ammonium fumarate to the product is over 90% (Mukouyama et al., 2000; Mukouyama and Komatsuzaki, 2001). In this paper, the continuous process of L-aspartic acid production in column bioreactors was optimized using immobilized cells of recombinant strain Escherichia coli P1. Experimental Materials and Methods

Bacteria. For preliminary elaboration of cell immobilization procedure E. coli mutant B-715 (Papierz et al., 2007) was applied. For continuous process investigations in bioreactors a recombinant strain of E. coli P1

*  Corresponding author: G. Szymańska, Department of Biosynthesis of Drugs, Chair of Biology and Pharmaceutical Biotechnology, Medical University of Łódź; ul. Muszyńskiego 1, 90-151 Łódź, Poland; e-mail: [email protected]

106

2

Szymańska G. et al.

(Gadomska et al., 2007) with high aspartase activity was used. The bacterial suspension in LB-medium was mixed with 50% glycerol (1:1), frozen and stored at –70°C as stocks for further use. Media (as described earlier, Gadomska et al., 2007). (1) FF medium for biomass cultivation: Yeast Extract (Difco) 20 g/l, ammonium fumarate 5.0 g/l, KH2PO4 11.4 g/l, MgSO4 × 7 H2O 0.5 g/l, pH 7.2. (2) Medium for cell activation (activation medium): ammonium fumarate 50.0 g/l, MgSO4 × 7 H2O 0.25 g/l, 1% Triton 0.5 ml/l, pH 8.5. (3) Medium for L-aspartic acid production (productive medium): ammonium fumarate 150.0 g/l, MgSO4 × 7 H2O 0.25 g/l, pH 8.5. Chemicals (at analytical grade), if not indicated otherwise, were purchased from POCh S.A. Cell multiplication and activation. Bacteria were cultured in shaking flasks as described earlier (Gadomska et al., 2007), then the cells were centrifuged at 4000 rpm for 20 min and introduced into the activation medium (1 g of wet mass/20 ml). The cell suspension was activated by shaking for 24 hours in shaking flasks at 37°C. Activated cells were centrifuged at 4000 rpm for 20 min and washed twice with distilled water (1 g wet mass/20 ml water). Immobilization of E. coli cells with chitosan. Activated cells of E. coli were suspended in weight proportion 1:1 in a solution of chitosan consisting of 5.0 g of chitosan (Marine Institute, Gdynia) dissolved in 100 ml of 2% acetic acid (Chemical Company of Lublin) and stored for approximately 20 hours at ambient temperature. The mixture was instilled into crosslinking reagent via syringe. Sodium hexametaphosphate (NaPO3)12–13Na2O (Fluka), sodium ortophosphate (POCh) and penta-sodium triphosphate Na5P3O10 (Fluka) were used in different concentrations as crosslinking reagents. The immobilisation process was optimized in this study. After 15–45 min of hardening, the gel pellets obtained were washed with distilled water and placed into the activation medium. L-aspartic acid biosynthesis Process with cell suspension. Activated cells were mixed with the production medium (1 g wet mass/20 ml) in a 100 ml flask and shaken at a temperature of 37°C. After 15, 30, 60 and 120 min of incubation, samples of 0.1 ml were withdrawn for analysis. Process with immobilized cells in shake flask. Immobilized cells (2 g biocatalysts containing 1g of wet biomass) were washed with distilled water and introduced into the shaken 100 ml flasks with 20 ml production media. The biosynthesis process was conducted as described above. Continuous production of L-aspartic acid in bioreactors by immobilized cells. Water jacket column bioreactors with different working volumes, i.e.: 2 ml,

20 ml and 40 ml were used. The substrate solution was passed through the column using a peristaltic pump. Both the medium and biocatalyst bed were kept at the same selected temperature. Aspartic acid analysis. To estimate the amount of L-aspartic acid, HPLC was applied using a column 250–4 LichrospherTM 100RP-18 (Merck) and Waters fluorescence detector, type 474. The details of the analytical procedure were described in a previous study (Papierz et al., 2007). Results Immobilization procedure optimization. In preliminary trials of immobilization of E. coli cells using mutant B-715 the bacterial cells were immobilized as chitosan pellets of 1.5–2.0 mm diameter using three cross-linking reagents: sodium hexametaphosphate, sodium ortophosphate or penta-sodium triphosphate. In the optimum immobilization procedure, 5% chitosan sol containing E. coli cells was reacted with 4% hexametaphosphate solution for a duration of approximately 30 min. The effect of the kind of phosphate ions used, their concentration and the time of pellet cross-linking on the activity and mechanical stability of the biocatalysts was investigated, and for further study, the recombinant cells of E. coli P1 were immobilized with 5% chitosan sol cross-linking 4% sodium hexameta­ phosphate solution for 15–45 min as this is the best means of cell immobilization. During the recombinant E. coli P1 cell immobilization process, some difficulties with obtaining a homogeneous suspension of the cells in chitosan sol were observed. The biomass of the recombinant was sticky and stringy and the obtained pellets were irregular, with varying diameters. An irregular shape of the immobilized biocatalysts (Fig. 1) was unfavourable for packing them into a bioreactor. Those difficulties can influence the quality of the study and the reliability of the results obtained. With the aim of eliminating those difficulties, we examined the effect of components within the medium used for bacterial multiplication, and added a surface-active substance (surfactant) for the immobilization of recombinant cells. Two variants of the FF medium (for multiplication) were applied: a)  with the previously) determined amount of Yeast Extract (rich medium – FF20), b)  with half the previously determined amount of Yeast Extract (poor medium – FF10). The activation of biomass was carried out for 24 hours at 37°C in two activation media: a) without Tween 80, b) with added Tween 80. The application of the poor medium for the multi­ plication of recombinant E. coli P1, followed by the addition of surfactant for cell activation, caused easier

2

L-aspartic acid production by E. coli immobilized cells

107

Fig. 1. E. coli P1 cells immobilized in chitosan gel: a) in rich medium without surfactant, b) in poor medium with surfactant.

immobilization and more effective L-aspartic acid biosynthesis (Fig. 2). Activity of immobilized biocatalyst. Bacteria were cultivated and activated as described in Materials and Methods. The active biomass was divided into two parts. One part was used directly for the L-aspartic acid biosynthesis process in cell suspension; the second part was immobilized as described above. 1 g of intact cells or 2 g of immobilized cells were introduced into 20 ml of the productive medium in 100 ml flasks and shaken at a temperature of 37°C. After 15 min of incubation, the samples were taken for analysis in order to estimate an initial (i.e. maximum) process rate for both preparations. The immobilized cells were almost 60% less active than the intact cells. Effect of temperature. It is common knowledge that the rate of any biochemical process depends on its temperature; the rate increasing steadily as the temperature increases, up to the level at which enzymes are inactivated. Immobilization of the cells or enzymes can affect the thermal stability of biocatalysts. Exothermic

reactions, such as L-aspartic acid biosynthesis, complicate temperature optimization in long-term, largescale bioreactor processes. There are different optimum temperature values for highest reaction rate in a batch short-term process and in a long-term continuous process. Biosynthesis in shaking flasks at the growth-optimum temperature 37°C and much higher temperatures: 48, 50, 52, 54 and 56°C was studied. In a short (up to 2 hours) test, biocatalyst activity increased together with an increase in temperature, obtaining a maximum at 54 and 56°C (Fig. 3). In the next experiment the activity of newly-immobilized cells at 56°C for a 72-hour bioreactor run was investigated with a substrate flow rate of 44 ml/h. In this process the conversion of ammonium fumarate to L-aspartic acid decreases during the first day by nearly one-third (Fig. 4). On the basis of this result

Fig. 2. Effect of multiplication and activation of bacteria on L-aspartic acid biosynthesis by immobilized cells E. coli P1.

Fig. 3. Effect of temperature on biosynthesis of L-aspartic acid by immobilized cells E. coli P1.

108

2

Szymańska G. et al.

Fig. 4. Decrease of conversion of ammonium fumarate to L-aspartic acid by immobilized cells E. coli P1 during 3 days test in 56°C.

Fig. 5. Effect of ammonium fumarate concentration on continuous production of L-aspartic acid in a column bioreactor with immobilized cells E. coli P1.

a new process was conducted at temperatures of 37°C and 40°C. During a 603-hour operation of the bioreactor, biocatalyst activities at both temperatures were at similar levels (about 55% conversion). For further experiments, temperatures in the range 37–40°C was applied. The effect of ammonium fumarate concentration. The aim of evolving technology is to obtain the highest possible concentration of a given product. In one-step enzymatic reaction, such as L-aspartic acid biosynthesis, it is possible to obtain this result by increasing substrate concentration. The effect of production medium ammonium fumarate concentration on L-aspartic acid biosynthesis was investigated in three bioreactors running in parallel. Every bioreactor was supplied (100 ml/h) with different concentration of ammonium fumarate, i.e.: 1.0 mol/l (150 g/l), 1.2 mol/l (180 g/l) and 1.5 mol/l (225 g/l) in substrate solution. The initial rate of ammonium fumarate to L-aspartic acid conversion in every bioreactor was over 50%. However, over the next 40 days, a decrease in conversion yield, dependent on substrate concentration, was observed. In the days that followed, productivity was stable in every bioreactor; however, the best results were achieved with a substrate concentration of 1mol/l (Fig. 5). After the continuous process had run for 603 hours in the bioreactors, the biocatalyst preparations were removed, and their activities in shaking flasks in fresh ammonium fumarate solution of 1 mol/l were investi-

gated as a short-term experiment for residual activity of biocatalysts estimation. An experiment with newlyimmobilized cells was conducted as the control. The highest activity was observed for biocatalyst previously working in substrate solution of 1 mol/l (Fig. 5). The use of higher concentrations of ammonium fumarate during a long-term continuous process resulted in biocatalyst inactivation. Continuous production of L-aspartic acid. Appropriate quantities of immobilized cells of E. coli P1 were placed into the three column bioreactors: A, B and C, as described in Table I. The conversion of ammonium fumarate to L-aspartic acid in continuous process at a substrate solution flow rate of below 100 ml/h in these reactors is shown in figure 6. In the first experiment carried out in bioreactor A, a fresh biocatalyst was used after cell immobilization. In bioreactor A with 43 ml of biocatalyst (3.8 g dry mass of E. coli P1 cells) production medium was passed through at flow rates rz from 5 to 858 ml/h at 37°C (Table II, Fig. 6). The highest conversion rate, over 95%, was obtained at a substrate flow rate of rz = 53–136 ml/h. Increasing the substrate flow rate to over 136 ml/h, a permanent decrease in substrate to product conversion ratio was observed. At a maximum flow rate of 858 ml/h, the conversion ratio decreased below 50%. It is possible to assume that the freshly prepared biocatalyst used in this experiment, despite earlier activa-

Table I Characteristics of bioreactors A, B and C Volume Dry mass Height Bioreactor of a biocatalyst of cells in of biocatalyst Hz/Vz ratio bed (Vz) [ml] biocatalyst [g] bed (Hz) [cm] A 43.0

3.80 15.0 0.35

B 10.0

0.83

3.5 0.35

C

0.15

4.0

1.3

3.10

2

109

L-aspartic acid production by E. coli immobilized cells

Fig. 6. Effect of substrate flow rate on conversion of ammonium fumarate to L-aspartic acid in bioreactors A, B and C.

tion, did not achieve its maximum activity. It could be that further cell activation occurred in the biocatalyst bed through the initial period of the biosynthesis process in the bioreactor. In the next experiment, freshly prepared pellets of biocatalyst were placed into production medium for 3 days before they were used for continuous process in bioreactor B. This biocatalyst preparation stage may well have caused further reduction of the diffusion barrier for substrate and product through the external envelopes of the cells. As the result, the maximum conversion ratio of nearly 100% was achieved in bioreactor B during the initial period of the process for a flow rate rz = 2.8–10.0 ml/h. The productivity of the biocatalyst in this experiment was 0.4–1.6 g/g/h (Table III). Table II Effect of substrate medium flow rate through bioreactor A during L-aspartic acid biosynthesis Liquid hour L-aspartic Flow Productivity* Conversion acid space velocity rate [g/g/h] [%] [g/l] LHSV [ml/h] 5

0.1

102.0

0.1

76.7

21

0.5

113.3

0.6

85.9

44

1.0

118.0

1.5

89.4

53

1.2

124.0

1.7

95.7

82

1.9

129.3

2.8

97.2

136

3.1

126.7

4.5

95.1

162

3.8

119.3

5.0

89.8

An important parameter introduced in this work, according to Mukouyama and Komatsuzaki (2001), was the ratio of the bioreactor height to the bioreactor volume (Hz/Vz). In both experiments for different biocatalyst volumes in bioreactor A and B, the same ratio Hz/Vz = 0.35 was maintained. In the next experiment bioreactor C was used with a biocatalyst bed height of 4 cm and working volume of 1.3 ml; Hz/Vz = 3.1. The maximum conversion ratio of over 99% for the low flow rate of 6.8 ml/h, was achieved. The productivity of the biocatalyst in this experiment was 6 g/g/h. The increased substrate solution flow rate through bioreactor C resul­ ted in the same decrease of conversion rate as in bio­ reactors A and B, however with a lower ratio (Table IV). Discussion For L-aspartic acid biosynthesis, the high production cells of Escherichia coli were immobilized in chitosan gel using a technique developed in our laboratory. In the process of cell immobilization it is crucial to obtain a homogenous suspension of bacterial cells. In the case of the immobilization of recombinant E. coli P1, the addition of the surfactant Tween 80 to the medium for biomass cultivation was necessary. This Table III Effect of substrate medium flow rate through bioreactor B during L-aspartic acid biosynthesis Liquid hour L-aspartic Flow Productivity* Conversion acid space velocity rate [g/g/h] [%] [g/l] LHSV [ml/h] 2.8

0.3

132.6

0.4

99.7

10.0

1.0

132.3

1.6

99.5

24.8

2.5

113.8

3.4

85.6

40.2

4.0

109.5

5.3

82.3

115.5

11.6

76.9

10.6

57.8

123.0

12.3

75.1

11.1

56.5

*  productivity as grams of L-aspartic acid calculated as 1 g dry weight   of biomass per 1 hour [g/g/h]

Table IV Effect of substrate medium flow rate through bioreactor C during L-aspartic acid biosynthesis

192

4.5

119.3

6.0

89.8

Liquid hour L-aspartic Flow Productivity* Conversion acid space velocity rate [g/g/h] [%] [g/l] LHSV [ml/h]

258

6.0

116.7

8.1

87.9

6.8

312

7.3

110.7

9.1

83.1

12.8

9.8

117.3

10.0

88.2

360

8.4

108.7

10.3

81.6

19.2

14.8

107.5

14.0

80.8

675

15.7

71.0

12.6

53.3

30.4

23.4

93.1

18.7

70.0

858

20.0

62.7

14.1

47.1

45.6

35.1

74.1

22.7

55.7

*  productivity as grams of L-aspartic acid calculated as 1 g dry weight   of biomass per 1 hour [g/g/h]

5.2

132.8

6.0

99.8

*  productivity as grams of L-aspartic acid calculated as 1 g dry weight   of biomass per 1 hour [g/g/h]

110

Szymańska G. et al.

surfactant facilitated the immobilization of the recombinant cells; as mentioned above, their biomass was sticky and difficult to homogenize without it. Among three reagents, sodium orthophosphate, penta-sodium triphosphate and sodium hexametaphosphate, the final one was selected as the best cross-linking agent. Chibata et al. (1974) and Sato et al. (1975) have suggested the use of polyacrylamide gel; however, it is mechanically unstable and, following polymerization, some toxic monomer (acrylamide) usually remains inside the gel. Sato et al. (1979) and Umemura et al. (1984) have immobilized the cells and enzymes for L-aspartic acid production in κ-carrageenan gel. The main disadvantage of this method is the high temperature, 45–55°C, which is required for κ-carrageenan sol preparation. Very popular for biocatalyst preparation for various biochemical reactions is an alginate gel, which is cheap and extremely easy to prepare. We tested the alginate gel containing active E. coli cells for conversion of ammonium fumarate to L-aspartic acid (Chmiel et al., data not published). However, alginate beds proved very unstable in the process conditions. It is commonly known that any immobilization technique causes reduction in the initial activity of intact free cells or enzymes. In the case of our immobilized biocatalyst, the activity reduction was about 60%, however the main aim of cell or enzyme immobilization is in stabilizing the biocatalyst for long-term use in multi-repeated batch or continuous processes. It is necessary to optimize the basic reaction parameters for the newly immobilized biocatalyst. The control of temperature during L-aspartic acid biosynthesis is extremely important because a considerable amount of heat is produced during the process. Conducting the process at a higher temperature may reduce the necessary cooling of the biocatalyst bed, thereby reducing the cost of production. In our work, the increase of temerature from 37 to 56°C causes a significant increase in the rate of L-aspartic acid biosynthesis in shortterm experiments. However, after 24, 49 and 72 hours, the cell activity has decreased to 75%, 72% and 69% respectively. The thermal instability of the immobilized L-aspartic acid producing E. coli cells was described earlier (Chibata et al., 1974; Tosa et al., 1974). The aspartase instability in E. coli cells has been described in patents (Mukouyama et al., 2000; Mukouyama et al., 2001). The thermal stability of biocatalysts was tested at 37 and 40°C in long-term experiments over 603 hours. The activity of the biocatalyst was roughly equal at both temperatures and after 25 days, had decreased by only about 3–5%. In comparison with published data (Chibata et al., 1974; Tosa et al., 1974) immobilized recombinant E. coli P1 cells show a higher thermal stability, and their maximum activity was attained at a temperature approximately 4°C higher in our studies.

2

Substrate concentration is another important process parameter influencing both the reaction rate and product concentration. In our study, the optimum ammonium fumarate concentration was 1.0 M what was agreement with other publications. Increases of substrate concentration to 1.2 and 1.5 M decreased the efficiency of the continuous process and caused additional biocatalyst inactivation of about 8–13% and 13–28% respectively. In accordance with literature (Mukouyama and Komatsuzaki, 2000; Mukouyama and Komatsuzaki, 2001) the process of L-aspartic acid biosynthesis is profitable for a conversion rate over 90%, which was obtained in our experiment at a flow rate of rz98% identity), whereas the isolates of the barley strain are more variable (>94% identity). As the demarcation criterion for mastrevirus species has been set to 75% nucleotide sequence identity by the International Committee for Taxonomy of Viruses (Fauquet et al., 2008), both strains are currently considered to belong to the same species. Schubert et al. (2007) recently proposed two new mastrevirus species Barley dwarf virus

(BDV) and Oat dwarf virus (ODV) based on DNA sequence differences. ODV was accepted as a new tentative mastrevirus species sharing 70% genome-wide nucleotide sequence identity with the wheat and barley strains of WDV (Fauquet et al., 2008). The aim of the present study was the molecular characterisation of WDV isolates from Hungary and Ukraine and their comparison with the available sequences of WDV. Experimental Materials and Methods

Virus isolates. Symptoms of viral infection were found during spring observations carried out in wheat crops in Martonvasar (Middle Hungary), Pula (Southern Hungary) and Mironivka (Middle Ukraine). Plants displaying yellowing of leaves or dwarfing were placed in an insect-proof greenhouse and were tested for WDV by ELISA using a WDV kit (Bio-Rad). The collected WDV-infected plants were replanted into clay pots and placed in an insect-proof isolation net. For virus transmission, thirty individuals of virus-free Psammotettix alienus Dahlb. were placed underneath each net. One week later the leafhoppers were transferred to young seedlings of wheat being in two leaves stage. Six weeks later the plants were tested again for WDV by ELISA. Three isolates, WDV-HU-2Marton (collected in 2008 from Martonvasar), WDV-HU-Pula

Table I Primers used for sequencing Name WDV-Barley forw

1 

Genome position1 468–488

(B)

Sequence (5’-3’) ATCCCGGGTCCTCCGACTAC

WDV-Barley rev

478–458

(B)

GACCCGGGATCGTAAGGGGC

WDV-Barley 540

555–531

(B)

TAAGCCAAACAAACAACTCCTACGG

WDV-P1

611–631 (B) GACCGAGGAAATTGGTTACGG

WDV-5’

1045–1067 (B)

CCACTGACATCTTTACGATGCC

WDV-Barley 1200

1200–1225 (B)

AACTACGTAGTGGGGAAGAATATCG

WDV-Barley 1900

1895–1917 (B)

CATAGGTCGTGAAATTCAACTAG

WDV-Barley 2110

2094–2122 (B)

TTCGAGGCTTACGGAGTAGAGATGTTCAT

WDV-Wheat P1

475–494

(W)

GACCGAGGAAATTGGTTACGG

WDV-Wheat 483

506–485

(W)

GCTTATACACAGCCCCCTTCC

WDV-Wheat 5’

809–831

(W)

CCACTGACATCTTTACGATGCC

WDV-Wheat 1076

1069–1087 (W)

TAAGAAAGGAGCACTGTATC

WDV-Wheat 1410

1428–1406 (W)

GCGAGTCATTCATCAACTACTCG

WDV-Wheat 1850

1850–1482 (W)

CCACTCCTGCGGATCAAGC

WDV-Wheat forw

2305–2326 (W)

ACGAAGCTTGTTCTGCACGAGA

WDV-Wheat rev

2316–2295 (W)

AACAAGCTTCGTGCTTCCATC

WDV-Wheat 2521

2521–2542 (W)

CAGAAGTCCGGCAGGTCCTTA

With reference to WDV-Heves (FM999833) – B and WDV-2 Marton (FN806785) – W.

2

WDV isolates from Hungary and Ukraine

Table II Abbreviation, accession number and origin of Wheat dwarf virus isolates used in this study Abbreviation

Accession number

Country of collection

WDV-HU-B

AM040732 Hungary

WDV-HU-F

AM040733 Hungary

WDV-HU-H07 FM210034 Hungary WDV-HU-Heves FM999833 Hungary WDV-HU-Dunakiliti FM999832

Hungary

WDV-HU-Martonbar AM747816

Hungary

WDV-HU-2Marton

FN806785 Hungary

WDV-HU-Pula

FN806786 Hungary

WDV-Uk-g

FN806783 Ukraine

WDV-Uk-Miron

FN806784 Ukraine

WDV-Uk-Odessa

FN806787 Ukraine

WDV-BU-Bg17 AM989927 Bulgaria WDV-Swe-Enk1 AJ311031 Sweden WDV-Swe-Enk2 AM491490 Sweden WDV-Swe-SE X02869 Sweden WDV-Chi-hbsjz061 EF536870

China

WDV-Chi-ynkm062 EF536881

China

WDV-Chi-sxyl052 EF536878 China WDV-Chi-gsgg050 EF5368591 China WDV-Chi-sxyl051 EF536877 China WDV-Ge-SxA22 AM296022 Germany WDV-Ge-SxA23 AM296023 Germany WDV-Ge-SxA24 AM296024 Germany WDV-Ge-SxA25 AM296025 Germany WDV-Ge-SCBB21 AM296021 Germany WDV-Ge-BaW1 AM411651 Germany WDV-Ge-BaW2 AM411652 Germany WDV-Ge-McP20 AM296020 Germany WDV-Ge-Sx18

AM296018 Germany

WDV-Cz-6217

FJ546189

Czech Republic

WDV-Cz-6239

FJ546190

Czech Republic

WDV-Cz-W

FJ546188

Czech Republic

WDV-Cz-1841

FJ546191

Czech Republic

WDV-Cz-19

AM296019

Czech Republic

WDV-Cz-11105

FJ546180

Czech Republic

WDV-Cz-8100

FJ546179

Czech Republic

WDV-Cz-11229

FJ546181

Czech Republic

WDV-Cz-6482

FJ546178

Czech Republic

WDV-Cz-B

FJ546193

Czech Republic

WDV-Tr-bar

AJ783960 Turkey

WDV isolates sequenced in this study are indicated in bold type.

(collected in 2007 from Pula) and WDV-Uk-Miron (collected in 2009 from Mironivka and maintained in our greenhouse by subsequent transmission) were selected for further studies. Ten wheat samples from

127

the Odessa region (South Ukraine) and one from Glevakha (Central North Ukraine) were initially tested by PCR with WDV specific primers. Two samples (WDV-Uk-Odessa and WDV-Uk-g collected from Odessa and Glevakha, respectively) were selected for molecular characterization. Isolation of virus DNA, cloning and sequence analysis of the WDV isolates. DNA extraction was done according to Shepherd et al. (2008) with a slight modification (fresh leaf material was used instead of dry leaves). The samples were then stored at –20°C or used directly as a template for rolling circle amplification (RCA) of the WDV genome (Haible et al., 2006). One microliter of the final Extract-n-Amp DNA solution was mixed with 4 μl of Templi PhiTM sample buffer (TempliPhiTM, Amersham Biosciences), heated for 2 min at 94°C, and then brought to room temperature. Five μl of reaction buffer and 0.2 μl of enzyme mix were added to the cooled mixture and the Templi PhiTM extension reaction was run at 30°C for 18–20 h. WDV genome concatemers (multiple copies of unit-length virus genomes covalently linked end-to-end) generated during Phi29 DNA polymerase amplification were digested with HindIII (wheat strain) or SmaI (barley strain) to release unit-length genomes. After digestion genomic DNA was separated in 1% agarose gel and extracted with a DNA purification kit (Fermentas DNA Extraction Kit). The WDV genome was inserted into a HindIII or SmaI digested pBSK+ plasmid (Strata­ gene). The recombinant plasmids were transformed into Escherichia coli DH5α (Sambrook et al., 1989). Clones containing inserts with the expected size of 2.7 kb were sequenced with the DyeDeoxyTerminator Kit (Applied Biosystems) using reverse, universal (–20) and internal primers (Table I). Sequence analysis was performed using University of Wisconsin Genetics Computer Groups (GCG) sequence analysis software package version 9.1. In order to determine the phylogenetic relationships between different WDV isolates complete genomes were analysed (Table II). Sequence alignment, tree formation, and bootstrap analysis were done with the help of the software Clustal X 1.83. Results and Discussion This work has been focused on the screening of Hungarian and Ukrainian cereal ecosystems for the presence of Wheat dwarf virus and its unique vector, P. alienus. The outcomes of the 2-year monitoring clearly demonstrated significant spread of the virus in Ukraine and confirmed the positive tendency in its spread compared to previous years of observations. In addition, for the first time a virus vector has been

128

2

Tóbiás I. et al. Table III Sequence identity of complete genomes of the WDV isolates characterized in our laboratory WDV Pula

B

F

2Marton

H07

Heves

Dunakiliti

Bg17

Mironivka

.g

Odessa

99.5 99.5 99.2 85.3 85.5 85.3 85.4 98.7 99.5 85.5

B 99.6 99.4 85.1 85.3 85.1 85.2 98.7 99.6 85.3 F 99.3 85.2 85.4 85.2 85.3 98.7 99.4 85.3 2Marton 85.3 85.2 85 85.1 98.4 99.3 85.2 H07 99.3 99 96.3 84.9 84.9 96.5 Heves 99.4 96.6 85.1 85.1 96.8 Dunakiliti 96.6 84.9 84.9 96.9 Bg17 85.1 85 99.3 Mironivka 98.7 85.2 .g 85.1 Abbrevations and accession numbers: WDV-HU-B: AM040732, WDV-HU-F: AM040733, WDV-HU-H07: FM210034, WDV-HU-Heves: FM999833, WDV-HU-Dunakiliti: FM999832, WDV-BU-Bg17: AM989927, WDV-Uk-g: FN806783, WDV-Uk-Miron: FN806784, WDV-HU-2Marton: FN806785, WDV-HU-Pula: FN806786 and WDV-Uk-Odessa: FN806787

shown to be common to Ukrainian fields since it has been detected in virtually every region of the country where the virus was identified. Depending on the place of origin, the degree of WDV infection of collected wheat plants was 20–70% as confirmed by ELISA tests and PCR. In laboratory, the virus was transmitted by P. alienus in insect-proof isolation net and maintained on oat or wheat plants. Nucleic acids were isolated from plants infected with WDV-HU-2Marton, WDV-HU-Pula, WDV-Uk-g and WDV-Uk-Odessa, WDV-Uk-g and WDV-Uk-Miron and used for subsequent molecular and phylogenetic characterization. The Extraction-n-Amp DNA extraction method was very rapid and simple in order to isolate intact viral DNA. WDV genome amplification via the RCA method generates large DNA concameters, from which unit-length genome were subsequently cleaved with HindIII or SmaI enzymes. The size of the full length genome obtained for WDV-HU-2Marton and WDV-HU-Pula constituted 2750 nucleotides, while the genomes of WDV-Uk-g and WDV-Uk-Miron were 2749-nucleotide-long, and the WDV-Uk-Odessa genome was exactly 2734 nucleotides in length. The very special property of this latter isolate is hat it has originated from the winter wheat variety Selyanka. To our knowledge, this is the first report of the barley strain of WDV isolated from naturally infected wheat plants. The genomes of these characterized isolates contained all four expressed mastrevirus ORFs (MP, CP, Rep, RepA), and the intergenic regions LIR and SIR. The nucleotide sequences were deposited in GenBank as WDV-Uk-g: FN806783, WDV-Uk-Miron: FN806784, WDV-HU-2Marton: FN806785, WDV-HUPula: FN806786 and WDV-Uk-Odessa: FN806787, and

were further compared to previously characterized WDV isolates (Tobias et al., 2006, 2009, 2010) (Table III). The analysis of the full genome sequences revealed high levels of identity among wheat strains and higher level of diversity among barley strains. The sequences’ identities between isolates of the wheat strain of different geographical origins were very similar (> 98.7% identity). For the movement protein (MP) and coat protein (CP), we observed high sequence identity (>98.8%) at the predicted amino acid level, in some cases MPs (Hungarian and Swedish isolates) and CPs (Hungarian isolates originating from different parts of the country) were identical. For the short (SIR) and large intergenic region (LIR), we observed a higher variability (97% and 96.6% identity, respectively) (data not shown). Regarding the diversity of the WDV isolates of the barley strain, we observed a relatively high variability (96.3–99.4%). Interestingly, however, the MP and CP also revealed a high level of amino acid sequence identity among barley strain isolates originating from different geographical regions (98.5–100%). Similar to wheat strain isolates, barley strain isolates showed greater variability also in the LIR and SIR. Molecular characterization of Ukrainian and Hungarian WDV isolates was followed by phylogenetic analysis in order to compare their relationships with previously characterized wheat and barley isolates available from the GenBank database (Fig. 1). The phylogenetic analysis of WDV isolates showed that they were clearly distinguishable, both barley and wheat strains formed two clades. Isolates from Hungary, Germany, Czech Republic, Ukraine and Sweden clustered in clade  1. Interestingly, both Ukrainian isolates WDVUk-g and WDV-Uk-Miron showed closer relationship to WDV-HU-Pula and WDV-Swe-Enk2 isolates, respectively, than to each other. This is surprising as

2

WDV isolates from Hungary and Ukraine

129

Fig. 1. Phylogenetic tree constructed by the UPGMA method for complete genome sequences of Wheat dwarf virus isolates. (Bootstrap values are indicated) The isolate ODV-Ge-SxA25 was used as the outgroup with a ca. 70% genome-wide nucleotide sequence identity with barley and wheat strain isolates of WDV.

130

2

Tóbiás I. et al.

according to the available literature data phylogenetic relationships of WDV isolates normally show high degree of dependence on the geographical origin of the virus (Köklü et al., 2007). However, both WDV-Uk-g and WDV-Uk-Miron isolates came from the same geographical region of the Ukraine (Kiev region, central north of the Ukraine) and the sites of sampling were situated just approximately 100 km apart from each other. Apparently, other issues (such as vector occurrence and behaviour, plant cultivars cultivated at a given territory, agricultural techniques and, primarily, the initial virus source in the country) should be considered as well when evaluating spread and evolutionary divergence of WDV. Clade 2 could be divided into two subgroups, one with wheat isolates from China and the other containing only the WDV-Swe-SE isolate from Sweden. As for the isolates of barley strain of WDV, clade 3 could be divided into two subgroups, one with a divergent pool of isolates from Hungary, Germany and Czech Republic. The other subgroup comprised Ukrainian and Bulgarian isolates of WDV-BU-Bg17 and WDVUk-Odessa. In Clade 4, WDV-TR-bar isolate formed one subgroup and WDV-Cz-11105 and WDV-Cz-8100 formed the other one. These observations are in a good agreement with previous results (Schubert et al., 2007, and Kundu et al., 2009). In conclusion, the results presented in this work have shown that Hungarian and Ukrainian isolates of WDV were divided into two distinct groups of wheat and barley strains. WDV-Uk-Odessa is the first barley strain isolate originating from wheat infected under natural conditions. At this point it should be mentioned that we have managed to identify the barley strain of WDV in a single wheat plant only once during the intensive two-year strain-specific PCR-based screening of WDV isolates in naturally grown cereal crops in Hungary and Ukraine. Hence the proven fact of WDV barley strain transmission to wheat plants by P. alienus is obviously an uncommon and rare event. Seemingly it may happen under natural conditions but only occasionally and possibly when virus concentrations in host plants are high enough to allow host range extension by overcoming typical limitations on virusplant relationships. In our opinion, the issue of WDV transmission by its vector needs further characterization especially by employing molecular approaches to identify virus genes and/or gene products (and preferably their vector counterparts) responsible for the transmission of the virus and its efficiency. Acknowledgements This research was supported by a Hungarian Scientific Research Found (OTKA 61644 and 68589). TI, KB, PL, SO, SH and BA were supported by TéT (UA-14/8).

Literature Achon M.A., L. Serrano, L. Ratti and C. Rubies-Autonell. 2006. First detection of Wheat dwarf virus in barley in Spain associated with an outbreak of barley yellow dwarf. Plant Dis. 90: 970. Bendahmane M., H-J. Schalk and B. Gronenborn. 1995. Identification and characterization of wheat dwarf virus from France using a rapid method for geminivirus DNA preparation. Phytopathology 85: 1449–1455. Bisztray Gy., R. Gáborjányi and J. Vacke. 1989. Isolation and characterisation of wheat dwarf virus found for the first time in Hungary. J. Plant. Dis. Protect. 96: 449–454. Commandeur U. and W. Huth. 1999. Differentiation of strains of wheat dwarf virus in infected wheat and barley plants by means of polymerase chain reaction. J. Plant. Dis. Protect. 106: 550–552. Fauquet C.M., R.W. Briddon, J.K. Brown, E. Moriones, J. Stanley, M. Zerbini and X. Zhou. 2008. Geminivirus strain demarcation and nomenclature. Arch. Virol. 153: 783–821. Gutierrez C. 1999. Geminivirus DNA replication. Cell. Mol. Life Sci. 56: 313–329. Haible D., S. Kober and H. Jeske. 2006. Rolling circle amplification revolutionizes diagnosis and genomics of geminiviruses. J. Virol. Meth. 135: 9–16. Heyraud F., V. Matzeit, M. Kammann, S. Schaefer, J. Schell and B. Gronenborn. 1993. Identification of the initiation sequence for viral-strand DNA synthesis of wheat dwarf virus. EMBO J. 12: 4445–4452. Huth W. 2000. Viruses of Gramineae in Germany – a short overview. J. Plant. Dis. Protect. 107: 406–414. Jezewska J. 2001. First report of Wheat dwarf virus occurring in Poland. Phytopath Polonica 21: 93–100. Jilaveanu A. and J. Vacke. 1995. Isolation and identification of wheat dwarf virus (WDV) in Romania. Probleme de Protectia Plantelor 23: 51–62. Kammann M., H.J. Schalk, V. Matzeit, S. Schaefer, J. Schell and B.  Gronenborn. 1991. DNA replication of wheat dwarf virus, a gemini­virus, requires two cis-acting signals. Virology 184: 786–790. Kapooria R.G. and J. Ndunguru. 2004. Occurrence of viruses in irrigated wheat in Zambia. EPPO/OEPP Bulletin 34: 413–419. Köklü G., J.N.E. Ramsell and A. Kvarnheden. 2007. The complete genome sequence for a Turkish isolate of Wheat dwarf virus (WDV) from barley confirms the presence of two distinct WDV strains. Virus Genes 34: 359–366. Kundu J.K., S. Gadiou and G. Cervená. 2009. Discrimination and genetic diversity of Wheat dwarf virus in Czech Republic. Virus Genes 38: 468–474. Kvarnheden A., M. Lindblad, K. Lindsten and J.P.T. Valkonen. 2002. Genetic diversity of Wheat dwarf virus. Arch. Virol. 147: 205–216. Lemmetty A. and E. Huusela-Veistola. 2005. First report of Wheat dwarf virus in winter wheat in Finland. Plant Dis. 89: 912. Lindsten K. and B. Lindsten. 1993. Occurrence and transmission of Wheat dwarf virus (WDV) in France. In: Proceedings of Third International Conference on Pest in Agriculture 7–9 December 1993, Montpellier, France, pp. 41–48. Lindsten K. and J. Vacke. 1991. A possible barley adapted strain of Wheat dwarf virus (WDV). Acta Phytopath. Entomol. Hung. 26: 175–180. Lindsten K, J. Vacke and B. Gerhardson. 1970. A preliminary report on three cereal virus diseases new to Sweden spread by Macrosteles and Psammotettix leafhoppers. Nat. Swedish Inst. Plant. Protec. Cent. 14: 285–297. Mechner S., B. Manurung, M. Grüntzig, A. Habekuss, W. Witsack and E. Fuchs. 2003. Investigations into the ecology of the Wheat dwarf virus (WDV) in Saxony-Anhalt, Germany. J. Plant Dis. Protect. 110: 313–323.

2

WDV isolates from Hungary and Ukraine

Mesterházy Á., R. Gáborjányi, M. Papp and P. Fónad. 2002. Multiple virus infection of wheat in South Hungary. Cer. Res. Com. 30: 329–334. Najar A., K.M. Makkouk, H. Boudhir, S.G. Kumari, R. Zarouk, R.  Bessai and F.B. Othman. 2000. Viral diseases of cultivated legume and cereal crops in Tunisia. Phyt. Medit. 39: 423–432. Razvyazkina G.M. 1975. Virus Diseases of Cereals – Novosibirsk, 1975 – 292 p. (in Russian) Sambrook J., E.F. Fritsch and T. Maniatis. 1989. Molecular Cloning. A Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Schubert J., A. Habekuss, K. Kazmaier and H. Jeske. 2007. Surveying cereal-infecting geminiviruses in Germany – Diagnostics and direct sequencing using rolling circle amplification. Virus Research 127: 61–70. Shepherd D., PD Martin, P. Lefeuvre, A. Monjane, B. Owor, E.P. Rybicki and A. Varsani. 2008. A protocol for the rapid isolation of full geminivirus genomes from dried plant tissue. J. Virol. Meth. 149: 97–102. Snihur H., V. Polischuk and U. Kastirr. 2007. Dissemination of viruses of cereal crops in agrocoenosises of Ukraine. // 10 th International Plant Virus Epidemiology Symposium. 15–20 October 2007, ICRISAT, Hyderabad, India. P. 107.

131

Stephanov J. and A. Dimov. 1981. Bolestta vdjudjavanje po spenittsata Bolgaria. Rasteniev Nauki 18: 124–128 (in Bulgarian with English summary). Szunics L., E. Pocsai, G. Vida, O. Veisz, L. Láng and Z. Bedő. 2003. Kalászos gabonák vírusok okozta betegségei 2002-ben. Növénytermelés 52: 33–39 (in Hungarian with English summary). Tóbiás I., B. Kiss and L. Palkovics. 2006. The nucleotide sequence of two Hungarian isolates of Wheat dwarf virus. Acta Phytopath. et Entomol. Hung. 41: 47–52. Tóbiás I., B. Kiss, É. Pájtli, G. Tholt and K. Salánki. 2008. Molecular characterization and transmission experiments with barley strain of Wheat dwarf virus. Növényvédelem 44(11), 545–552. (in Hungarian with English summary) Tóbiás I., B. Kiss, N. Bakardjieva and L. Palkovics. 2009. The nucleotide sequence of barley strain of Wheat dwarf virus isolated in Bulgaria. Cer. Res. Com. 37: 237–242. Tóbiás I., B. Kiss, K. Salánki and L. Palkovics. 2010. The nucleotide sequence of barley strain of Wheat dwarf virus isolated in Hungary. Cereal Research Communication 38: 67–74. Vacke J. 1961. Wheat dwarf virus. Biol. Plant. 3: 228–233. Xie J., X.Wang, Y. Liu, Y. Peng and G. Zyhou. 2007. First report of the occurrence of Wheat dwarf virus in wheat in China. Plant Dis. 91: 111.

Polish Journal of Microbiology 2011, Vol. 60, No 2, 133–138 ORGINAL PAPER

β-glucanase Productivity Improvement via Cell Immobilization of Recombinant Escherichia coli Cells in Different Matrices Usama Beshay1, *, Hesham El-Enshasy1, I.M.K. Ismail2, Hassan Moawad3 and Sawsan Abd-El-Ghany1 1

 Bioprocess Development Department, Genetic Engineering and Biotechnology Research Institute (GEBRI) Mubarak City for Scientific Research and Technology Applications, New Bourg El-Arab City Universities and Research District, 21934 Alexandria, Egypt 2  Botany Department, Faculty of Science, Cairo University, Cairo, Egypt 3  Agricultural Microbiology Department, National Research Centre, Dokki, Cairo, Egypt Received 10 September 2010, revised 3 March 2011, accepted 10 March 2011 Abstract

The studies have been performed to analyze the production of β-glucanase by a recombinant strain of Escherichia coli immobilized in different matrices. Porous sintered glass SIRAN®, Ceramic supporting matrices and Broken Pumice stone as well as SIRAN Raschig-rings were examined for the immobilization of whole bacterial cells. The β-glucanase activity of bacteria immobilized in CeramTec PST 5 (4–5 mm) was very low. CeramTec PST 5 (1.5–2.5 mm) was found to be the best carrier compared to all other matrices regarding glucanase production (630 U/ml) and compared to enzyme activity produced by free cells (500 U/ml). Different doses of matrices were applied (2, 5, 7, 10 g/lask) in the form of “matrix weight”. Using 2 g/flask of CeramTec PST 5 (1.5–2.5 mm) yielded enzyme activity of 630 U/ml). CeramTec gives highest operational stability of β-glucanase by repeated batch fermentation to 5 cycles, and activity reached 660 U/ml. Scanning electron microscopy observations showed a high number of vegetative cells that continued growth inside the matrices, indicating that β-glucanase activity improvement was due to the immobilization of the cells. K e y w o r d s: β-glucanase, organic and/or inorganic matrices, cell immobilization, scanning electron microscope

Introduction β-1,3-glucanase, synthesized by many bacteria, hydro­lyzes glucan polymers containing β-1,3-linkages (Kourkoutas et al., 2004). This enzyme plays a key role in both the pulp drainability and beatability changes. The use of pure endoglucanase was responsible for most of the success in deinking (Gusek et al., 1991). Enzymes displaying β-glucanase activity have been found to have a variety of uses. For example they are used as a biological control of soil-borne plant pathogens and as a food supplementation (Weuster-Botz, 1993). β-1,3-glucanase is an important enzyme in the field of industrial and agricultural processing. The resistance of this enzyme to denaturation by high temperature and pH extremes makes it particularly important. Cell immobilization can be defined as the confinement or localization of viable microbial cells to a certain defined region (Hamdy et al., 1990). This is achieved by significantly increasing the effective size or density of the cells by their aggregation or by attachment of the

cells to some support surface. Thus, flocculated cells in the form of large aggregates are considered to be immobilized. The advantages of inorganic supports compared to organic supports were studied by several groups (Kourkoutas et al., 2004). These include their abundance and low price, higher mechanical strength, high thermal stability, higher resistance to organic solvents and microbial attack, easy handling and easy regenerability (Gusek et al., 1991; Weuster-Botz, 1993). Many inorganic supports were studied for immobili­ zation such as polygorskite, montmorilanite, hydromica, porous porcelain, pumice stone and glass beads (Colagrande et al., 1994; Beshay, 1998). The aim of the present work wasto optimize the production of β-glucanases using a high bacterial cell density cultivation strategy. Cell immobilization is applied to improve the productivity of the recombinant strain. Different inorganic supports such as porous sintered glass SIRAN® SIKUG 041, Ceramic supporting matrices and Broken Pumice stone as well as SIRAN Raschigrings were tested.

*  Corresponding author: U. Beshay, Mubarak City for Scientific Research and Technology Applications, Bioprocess Development Depart­ment, New Bourg El-Arab City, Universities and Research District; 21934 Alexandria, Egypt; phone: +2 03 4593 422; fax: +2 03 4593 407; e-mail: [email protected]; u.beshay@mucsat,sci.eg

134

Beshay U. et al.

Experimental Material and Methods

Microorganism. The E. coli strain BL21(DE3) pET-bglhisactophilin-Sec used in this work was kindly provided by prof. dr Erwin Flaschel, the head of the Fermentation Engineering Department, Bielefeld University, Germany. This strain contained a plasmid coexpressing protein of a chimeric Bacillus amyloliquefaciens β-glucanase C-terminally linked with hisactophilin from Dictyostelium discoideum as metal chelating affinity tag and kill protein from the plasmid CoIE1 as a permeabilizing agent for the outer membrane of Escherichia coli. The fusion protein was expressed under control of the genuine promoter of β-glucanase from Bacillus amyloliquefaciens, whereas the kill protein was under the control of stationary phase promoter of the fic gene (Miksch et al., 1997; Flaschel et al., 1998). Media for vegetative cell growth and fermentation. The optimized medium Terrific broth glycerol TBG (Beshay et al., 2003) used in this work contained the following gm per liter: 12.0 peptone, 24.0 yeast extract, 5.0 NaCl, 7.0 lactose. These components were dissolved in 800 ml distilled water and pH was adjusted at 7.0. The medium was distributed into flasks containing 40 ml medium each and then autoclaved at 121°C for 20 minutes. Kanamycin was added after cooling (50 µl/50ml). The second part of the medium, i.e. “salts”, consisted of g per liter: 2.30 potassium dihydrogen phosphate, 12.50 di-potassium hydrogen phosphate. Salts were dissolved separately in 200 ml distilled water and distributed into 20 test tubes each containing 10 ml, then autoclaved. Sterilized salts were added to the basal medium before inoculation. Porous supports for immobilization of E. coli. Three inorganic porous supports, porous sintered glass SIRAN, broken pumice stone, and the ceramic catalyst carrier CeramTec F1/porous PST 5 were used to immobilize the cells. The first supporting matrix used to immobilize E. coli was SIRAN® in the form of porous sintered glass beads (Schott Engineering GmbH, Mainz, Germany). Two different shapes of porous sintered glass SIRAN® beads and Raschig-rings SIRAS 09 were used in this study. The characteristics of porous sintered glass SIRAN are gathered in Table I. Table I Characteristics of porous sintered glass (SIRAN®) Characteristic dimensions (mm)

Pore volume (%)

SIKUG 041

0.4–1

SIRAS 09

8.8 × 9

Carrier type

Pore diameter (µm)

Surface area m2/g

55–60

109 cells/ml), and heated for 1 h at 100°C. After being heated, 20 µl of the boiled cell suspensions (thermostable O antigen of the strains) was mixed with 20 µl of each specific rabbit antiserum (O:1 to O:30) in ceramic rings on agglutination glass sides. The mixtures were rotated for 2 min, and the degree of agglutination (0 to 2+) was recorded. Two negative controls were used, boiled cell suspensions mixed with phosphate-buffered saline and boiled cell suspensions mixed with rabbit serum obtained from nonimmunized animals. Molecular identification. All strains were re-identified on the basis of the restriction fragment length polymorphism patterns (RFLP) obtained from the 16S rDNA (Ausubel et al., 1994). Aeromonas strains ATCC 7966, ATCC 43979, and ATCC 15468, and Escherichia coli (ATCC 25922) and Staphylococcus aureus (ATCC 25923), were included as quality controls. Bacterial DNA extraction for PCR. Approximately 100 µl of a TSA culture grown for 16 h at 28°C was used for DNA extraction using the InstaGene matrix (Bio-Rad Laboratories AG, Glattbrugg, Switzerland) in accordance with the manufacturer’s instructions. Subsequently, 5 µl of the DNA solution was used as a template for PCR amplification. The sequence, specificities, the primer combination and the size and length of the amplified products are summarized in Table I. The general reaction conditions in a Gene Cycler were 94°C for 1 min, 60°C for 1 min and 72°C for 3 min. This was repeated for 35 cycles. The program also included a preincubation at 94°C for 2 min before the first cycle and an incubation at 72°C for 3 min followed by cooling at 4oC after the last cycle. Stress induction. Environmental strains of A. hydrophila, A. caviae and A. veronii biovar sobria each was separately grown in 250 ml of Luria-Bertani (LB) broth containing 0.3 M NaCl. The HSP bands were visible if the strains were grown in a broth medium but not after cultivation on an agar medium. Heat shock stress

Table I Oligonucleotide primer sequences and size of the PCR-targeted products of selected species of Aeromonas

Specificity

Forward and Reverse sequence

Primer sequence (5’–3’)

Length (bp)

Location

20

IGS

Aeromonas species

Aero-F



Aero-R GGTTCTTTTCGCCTTTCCCT 20 23S

GGAAACTTCTTGGCGAAAAC

A. hydrophila

A-hydro-F CCAAACGAGAGAAGCCCTT



A-hydro-R CCATTCCACTAACTTCCAAGAA

19

iGS 23S

A. caviae

Acav-F CGCGCCGTTGCAAACATG



Acav-R GCGATACCTAGCTTATGCTAA 21 23S

A. veronii biovar sobria Aver-F

TGGTAGCTAATAACTGCCAG

Aver-R GGCTTCTCTCGTTTGGCGT

Size of amplified product (bp)

18 IGS 20

16S

19 IGS

550 700 320 1170

2

Heat shock proteins of environmental Aeromonas strains

conditions were imposed according to the following procedures: 1) each strain was cultured at a temperature of 42°C and 50°C, 2) at each temperature, samples were taken at intervals after heat shock, and crude cell extracts were prepared. Culture samples were taken after 3 h, 6 h, 24 h, 48 h and 72 h. Analysis of Aeromonas spp. culture supernatant proteins by SDS-PAGE. Following the procedure of Love and Hirsh (1994), bacterial cells were centrifuged (15,600× g, 5 min, room temperature). Bacteria were lysed in gel sample buffer consisting of 9.5 M urea, 2% Nonidet P-40, 2% ampholytes (Bio-Lyte 5/7 [Bio-Rad Laboratories, Richmond, Calif.] and 2-D Pharmalyte [Pharmacia LKB, Uppsala, Sweden]), and 5% 2-mercaptoethanol. An equal volume of glass beads (212- to 300-[Lm diameter; Sigma Chemical Co., St. Louis, Mo.) was then added to each tube. After the tubes were vortexed for 3 min, they were centrifuged (15,600×g, 5 min, room temperature). The proteins in the supernatants were separated by electrophoresis through a 3% stacking gel and a 10% separating gel. Polyacrylamide gel electrophoresis, Coomassie blue staining analysis of proteins was carried out by standard protocols. Computer-aided analysis of the gels. Images of the gels were captured using a Sharp JX-330 flat-bed scanner, and image analysis of the protein profiles was performed using Amersham Pharmacia Biotech Image Master 2-D Elite software. The relative amount of each protein spot was calculated and expressed by the software as the percentage of the spot volume and represented the intensity of each individual spot compared to the intensity of the whole gel. The genetic similarity coefficient between two genotypes was estimated according to Dice. The similarity-derived dissimilarity matrix was used in the cluster analysis by using the unweighted pair-group method with arithmetic averages (UPGMA). Results Effect of the incubation temperature on for 24 and 48 h on the SDS-PAGE protein pattern. The Aeromonas species that were subjected to heat stress in the present investigation were A. hydrophila, A. caviae and A. veronii biovar sobria. The SDS-PAGE electrophoresis HSP patterns for cells subjected to temperature downshifts from 42 to 25°C and upshifts to 50°C were examined after 24 and 48 h. The protein profile for isolates of Aeromonas species was established out by running eight per cent SDSPAGE with an objective to find variation in the protein banding pattern of all the isolates. It was found that there was variation in the protein banding pattern. Most proteins were similarly expressed at the three temperatures. Aeromonas intraspecies generation of heat-shock proteins (HSP). The SDS-PAGE protein profiles of the

151

A. hydrophila, A. caviae and A. veronii biovar sobria grown in LB- broth revealed that, Aeromonas phenospecies produced protein patterns containing several discrete bands in the most important area, with molecular masses in the range of 103.9–83.5 kDa (Table II). Differences between strains were evident in this range of molecular weights in the number of bands that were expressed under different temperatures (25°C, 42°C and 50°C) when incubated for 24 and 48 h. The SDS-PAGE protein pattern revealed that the 3 Aeromonas species bands ranged from 12–18 bands (Table II). The A. veronii biovar sobria serovar which was isolated had a strong band of molecular mass in the range of 103.1–101.0 kDa (Table II) which lacked from all the other serovars. The band with molecular masses of >9 kDa and 3000 bp. PCR assay to detect complete gene makeup of class 1 integron was carried out in 20 µl volume with the same concentration mixture mentioned above. The only modification was increased to 3U amount of Smart Taq polymerase (Fermentas, Lithuania). PCR amplification program was as follows: 5 minutes of initial denaturation at 94°C , 1 min of denaturation at 94°C , 1 min of annealing at 55°C, and 30 seconds of extension at 72°C for a total of 35 cycles. Five seconds were added to the extension time at each cycle. Statistical analysis. Correlation between antibiotic resistance patterns and presence of different classes of integron was determined by Chi-square and Fisher’s Exact test by SPSS version 15 software. The significant level was defined as P3000

1

500, 800, 900, 1200, 2500

1

500, 800, 1000, 1200, 2500

2

620, 900, 1300, 1700, >3000

1

500, 600, 800, 900,1200, 2500

2

500, 600, 800, 1000, 2300, 2500

1

500, 600, 800, 1200, 1500, 2500

2

500, 600, 800, 1200, 2500, 3000

2

500, 800, 1000, 1200, 1500, 2500

1

500, 600, 800, 900, 1200, 1500, 2500

4

500, 600, 800, 1000, 1200, 1500, 2500

4

500, 600, 800,1200, 1500, 2400, 2500

1

Fig. 1. Detection of integrons by amplification of integrase.

500, 600, 800, 900, 1200, 1500, 1700, 2500, >3000

1

500, 600, 750, 800, 900, 1200, 1300, 1500, 2500, >3000

1

Lane 8, 100 bp DNA ladder (MBI Fermentas, Hanover, MD); lanes 1, 3, 5, integrase 1 amplicons (160 bp); lane 2, both integrase 1(160 bp) and integrase 2 amplicons (288 bp). Lane 4, 6 and 7 were integron negative.

>3000 bp and the strains containing bands with 500, 600, 800 and 1200 bp were more frequent (Table IV). The association between drug resistance to norfloxacin, ceftazidime, gentamicin, ciprofloxacin, cefepime, amikacin and the presence of integrons was statistically signifi­cant, while no association was observed between colistin, imipenem, meropenem, cefoperazon/sulbactom, tobramycin, ampicillin/sulbactam and integron (Table V).

Discussion Acinetobacter infections are complicated in hospitalized patients due to the acquisition of multi-drug resistance. Most samples in the present study were isolated from the blood (39.8%). Similar data were obtained previously in the same region (Feizabadi et al., 2008). Dissemination of Acinetobacter through blood may

Table V Association between the existence of integron and antibiotic resistance in 88 Acinetobacter isolates Association with integron3 Colistin

3

% Resistance int-negative2 (no)

% Resistance int-positive1 (no)

Antibiotic

0 (0)

2.3 (2)

2.3 (2)

0.126

Imipenem

13.6 (12)

9.1 (8)

22.7 (20)

0.501

Meropenem

15.9 (14)

11.4 (10)

27.3 (24)

0.571

Cefoperazone/sulbactam

21.6 (19)

11.4 (10)

33 (29)

0.110

Tobramycin

14.8 (13)

21.6 (19)

36.4 (32)

0.069

Ampicillin/sulbactam

1

% Resistance of total (total no)

25 (22)

13.6 (12)

38.6 (34)

0.092

Ciprofloxacin

48.9 (43)

25 (22)

73.6 (65)

P< 0.05

Amikacin

47.7 (42)

27.3 (24)

75 (66)

Norfloxacin

48.9 (43)

27.3 (24)

76.2 (67)

P< 0.05

Gentamicin

51.1 (45)

28.4 (25)

79.5 (70)

P< 0.05

Cefepime

51.1 (45)

29.5 (26)

80.6 (71)

P< 0.05

Ceftazidime

52.3 (46)

29.5 (26)

81.8 (72)

P< 0.05

0.001

– int-positive: integron positive in multiplex PCR assay; 2 – int-negative: integron negative in multiplex PCR assay. – Significant values are in bold.

2

167

Multidrug resistant Acinetobacter and integrons

indicate the role of the bloodstream in spreading the infection (Gisneous and Rodriguez-Bano, 2002). Consistent with previous studies, A. baumannii is the predominant species in clinical isolates (Seifert et al., 1993; Towner, 2009). The three most effective antibiotics against Acine­ tobacter were found to be colistin, imipenem and meropenem. Despite being the most effective antibio­ tic against Acinetobacter in vitro, colistin use is limited only to life threatening conditions due to its serious side effects (Reed et al., 2001; Lewis and Lewis, 2004). Nevertheless, observation of high resistance rate of Acinetobacter to the majority of the tested antibiotics has limited the use of alternative effective antibiotics. More likely, resistance genes are acquired via genetic elements such as integrons, plasmids and transposons (Perez et al., 2007). In this regard, the role of integron is remarkable due to possessing a strong capturing system (Gonzalez et al., 1998; Seward, 1999; Turton et al., 2005). Continuous capturing of antibiotic resistance genes in Acinetobacter will extend quickly, so with more uncontrolled administration of antibiotics in hospitals and clinics, the possibility of acquiring resistance will be increased. To overcome progressive antibiotic resistance, rational and timely administration of effective antibiotics should be implemented. The present study on the existence of integron revealed that 53.4% of the isolates contained integron classes 1 or 2. These results are in agreement with published reports that Acinetobacter harbors high prevalence of integron class 1, lower class 2 and no class 3 (Koeleman et al., 2000; Ploy et al., 2000; Galleco and Towner, 2001; Gaur et al., 2006; Xu et al., 2008). The lack of integron class 3 may indicate its null role in antibiotic resistance. As mentioned above, the prevalence of class 1 integron, as compared to class 2 may imply that class 1 integron is more important in capturing resistant determinants. Alternatively, both systems acquire the same resistance genes but class 1 integrons may express these genes more efficiently. To determine this possibility, sequencing and cloning of resistance genes of the isolates containing class 1 or 2 integrons might be helpful. Comparison of antibiotic resistance patterns and their association with class 1 and 2 integrons confirms that both classes of integrons exhibit similar resistance patterns to the tested antibio­ tics (Table III). However, class 1 integron is more likely involved in emerging resistance to antibiotics. Data in the present study show a statistical association between the presence of integrons and resistance to 6 antibiotics. Because we did not detect any association between resistance to other antibiotics and the presence of integrons, this can implicate the role of other resistance determinants (Gaur et al., 2006; Chen et al., 2010). In conclusion, Acinetobacter expressed high resistance to most of the prescribed antibiotics. To reduce

the resistance rate, comprehensive control measures along with determination of periodical antibiotic sensitivity pattern may alleviate the situation to an acceptable level. Colistin, imipenem and meropenem are the most effective agents against Acinetobacter. However, the clinical application of colistin is limited due to its inappropriate side effects. Acknowledgements Deep thanks are due to prof. A. Alborzi for his invaluable help with provision of the laboratory facilities in Prof. Alborzi Clinical Microbiology Research Center. We are thankful to Hassan Khajehei, PhD for critical reading of the manuscript.

Literature Arakawa Y., M. Murakami, K. Suzuki, H. Ito, R. Wacharotayankun, S. Ohsuka, N. Kato and M. Ohta, M. 1995. A novel integron-like element carrying the metallo-b-lactamase gene blaIMP. Antimicrob. Agents. Chemother. 39: 1612–1615. Bergogne-Berezin E. and K.J. Towner. 1996. Acinetobacter spp. as nosocomial pathogens: Microbiological, clinical & epidemiological features. Clin. Microbiol. 8: 148–165. Chen T.L., W.C. Chang, S.C. Kuo, Y.T. Lee, C.P. Chen, L.K. Siu, W.L. Cho and C.P. Fung. 2010. Contribution of a plasmid borne blaOXA-58 with its hybrid promoter provided by IS1006 and ISAba3-like to {beta}-lactam resistance in Acinetobacter genomic species 13TU. Antimicrob. Agents. Chemother. 54: 3107–3112. Feizabadi M.M., B. fatollahzadeh, M. Taherikalani, M. Rasoolinejad, N. Sadeghiferd, M. Aligholi, S. Soroush and S. MohammadiYegane. 2008. Antimicrobial susceptibility patterns and distribution of bla OXA genes among Acinetobacter spp. isolated from patients at Tehran hospitals. Jpn. J. Infect. Dis. 61: 274–278. Galleco L. and K.J Towner. 2001. Carriage of class 1 integrons and antibiotic resistance in clinical isolates of Acinetobacter baumannii from Northern Spain. J. Med. Microbiol. 50: 71–77. Gaur A., P. Prakash, S. Anupurba and T.M. Mahapatra. 2006. Possible role of integrase gene polymerase chain reaction as an epidemiological marker: study of multi-drug resistant Acinetobacter baumannii isolated from nosocomial infections. Int. J. Antimicrobial. Agents. 29: 446–450. Gisneous J.M. and J. Rodriguez-Bano. 2002. Nosocomial bacteremia due to Acinetobacter baumannii: epidemiology, clinical features and treatment. Clin. Microbiol. Infects. 8: 687–693. Gonzalez G., K. Sossa, H. Bello, M. Dominguez, S. Mella and R. Zemelman. 1998. Presence of integrons in isolates of different biotypes of Acinetobacter baumannii from Chilean hospitals. FEMs. Microbiol. lett. 161: 125–128. Koeleman J.G., J. Stoof, M.W. Van Der bijl, C. M.VandenbrouckeGrauls and P.H. Savelkoul. 2000. Identification of epidemic strains of Acinetobacter baumannii by integrase gene PCR. J. Clin. Microbiol. 39: 8–13. Lévesque C., L. Piché, C. Larose and P.H. Roy. 1995. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob. Agents. Chemother. 39: 185–91. Lewis J.R. and S.A. Lewis. 2004. Colistin interactions with mammalian urothelium. Am. J. physiol. Cell. physiol. 286: C913– C922. Neild B.S., A.J. Holmes, M.R. Gillings, G.D. Recchia, , B.C. Mabbutt, K.M. Nevalainen and H.W. Stokes. 2001. Recovery of new integron classes from environmental DNA. FEMS. Microbiol. Lett. 195: 59–65. Nordmann P. 2004. Acinetobacter baumannii, the nosocomial pathogen par excellence. Pathol. Biol. 52: 301–303.

168

Japoni S. et al.

Perez F., A.M. Hujer, K.M. Hujer, B.K. Decker, P.N. Rather and R.A. Bonomo. 2007. Global challenge of multidrug-resistant Acinetobacter baumannii. Antimicrob. Agents. Chemother. 51: 3471–3484. Ploy M.C., F. Denis, P. Courvalin and T. Lambert. 2000. Molecular characterization of integrons in Acinetobacter baumannii: description of a hybrid class 2 integron. Antimicrob. Agents. Chemother. 44: 2684–2688. Radström P., O. Sköld, G. Swedberg, J. Flensburg, P.H. Roy and L. Sundström. 1994. Transposon Tn5090 of plasmid R751, which carries an integron, is related to Tn7, Mu, and the retroelements. J. Bacteriol. 176: 3257–3268. Reed M.D., R.C. Stern, M.A. O’Riordan and J.L. Blumer. 2001. The pharmacokinetics of colistin in patients with cystic fibrosis. J. Clin. Pharmacol. 41: 645–54. Rowe-Magnus D. A. and D. Mazel. 1999. Resistance gene capture. Curr. Opin. Microbiol. 2: 481–486.

2

Seifert H., R. Baginsky, A. Schulze and G. Polverer. 1993. The distribution of Acinetobacter species in clinical culture materials. Zentralbl. Bakteriol. 279: 544–552. Seward R.J. 1999. Detection of integrons in worldwide nosocomial isolates of Acinetobacter spp. Clin. Microbiol. Infect. 5: 308–318. Towner K.J. 2009. Acinetobacter: an old friend, but a new enemy. J. Hosp. Infect. 73: 355–63. Turton J.F., M.E. Kaufmann, J. Glover, J.M. Coelho, M. Warner, R. Pike and T.L. Pitt. 2005. Detection and typing of integrons in epidemic strains of Acinetobacter baumannii found in the United Kingdom. J. Clin. Microbiol. 43: 3074–3082. Villegas M.V. and A.I. Hartstein. 2003. Acinetobacter outbreaks, 1977–2000. Infect. Control. Hosp. Epidemiol. 24: 284–95. Xu X., F. Kong, X. Cheng, B. Yan X. Du, J. Gai, H.Ai, L. Shi and J. Iredell. 2008. Integron gene Cassettes in Acinetobacter spp. Strains from south China”. Int. J. Antimicrobial. Agents. 32: 441–445.

Polish Journal of Microbiology 2011, Vol. 60, No 2, 169–174 ORGINAL PAPER

Dissemination of Class 1, 2 and 3 Integrons among Different Multidrug Resistant Isolates of Acinetobacter baumannii in Tehran Hospitals, Iran MOROVAT TAHERIKALANI1,2*, ABBAS MALEKI2, NOURKHODA SADEGHIFARD1,2, DELBAR MOHAMMADZADEH3, SETAREH SOROUSH2, PARISA ASADOLLAHI2, KHAIROLLAH ASADOLLAHI4 and MOHAMMAD EMANEINI5

Department of Medical Microbiology, School of Medicine, Ilam University of Medical Sciences, Ilam, Iran 2  Clinical Biology Research Center, Ilam University of Medical Sciences, Ilam, Iran 3  Department of Microbiology, Science and Research Branch, Islamic Azad University of Tehran, Iran 4  Department of Epidemiology, School of Medicine, Ilam University of Medical Sciences, Ilam, Iran 5  Department of Microbiology, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran

1 

Received 3 January 2011, revised 10 April 2011, accepted 12 April 2011 Abstract A total of 100 non-duplicate Acinetobacter baumannii isolates were collected from different hospitals in Tehran and were confirmed as A. baumannii by conventional biochemical and API testing. Antimicrobial susceptibility of these isolates was checked by a disk diffusion method in accordance with CLSI guidelines. The isolates were then detected as carrying class 1 and 2 integron gene cassettes by PCR evaluation and then genotyped by REP-PCR. More than 50% (n = 50) of the isolates were multidrug resistant. The results showed that more than 80% of all multidrug resistant A. baumannii strains carry a class 1 integron. Distribution of IntI 1 and IntI2 among A. baumannii isolates was 58% and 14%, respectively. Analysis of a conserved segment of class 1 integron showed a range from 100 bp to 2.5 kb. REP-PCR fingerprinting showed more than 20 genotypes among A. baumannii strains. There was no relationship between REP genotypes and the distribution of different classes of integrons. This is a comprehensive study on the distribution of different classes of integrons among A. baumannii in Iran. Considering the exact role of integrons in coding drug resistance in bacteria, the findings of this study could help us find antimicrobial resistant mechanisms among A. baumannii isolates in Iran. K e y w o r d s: A. baumannii, hospital isolates in Iran, integron classes

Introduction Acinetobacter baumannii is an important opportunistic pathogen responsible for a variety of nosocomial infections, including ventilator-associated pneumonia, bacteremia, surgical-site infections, secondary meningitis, and urinary tract infections (von Dolinger et al., 2005; Fontana et al., 2008; Peleg et al., 2008). Most A. baumannii infections are caused by the outbreak strains, which can spread widely and rapidly between patients. Since these strains also exhibit multiple-antibiotic resistance, it has been suggested that epidemic potential among isolates of A. baumannii may be linked to the presence of integrons. Integrons are DNA elements capable of capturing genes by a site-specific recombination mechanism that often carry gene cassettes, containing antibiotic resistance genes (Turton, et al., 2005). Various studies have reported the existence of antibiotic resistance genes located on integrons among Acinetobacter spp. (Gallego

and Towner 2001; Navia et al., 2002; Nemec et al., 2004; Zarrilli et al., 2004). Several classes of integrons have been described, with class I integrons being the most common and widely distributed among Gram-negative bacteria. Integrons have been found in isolates of Acinetobacter spp. from different locations of the world and it has been suggested that multi-resistant isolates of Acinetobacter spp. may act as a reservoir of integron-associated antibiotic resistance gene, which could then spread to other pathogens in the hospital environment (Gallego and Towner 2001). Few studies have hitherto focused on the distribution of antibiotic resistance genes among Acinetobacter spp. in Iran (Feizabadi et al., 2008; Taherikalani et al., 2008; Taherikalani et al., 2009; Akbari et al., 2010); however, there is limited information on the detection of different classes of integrons in Iran. This study aimed to determine the distribution of class 1, 2 and 3 integrons among A. baumannii isolates, collected from different clinical specimens in selected

*  Corresponding author: M. Taherikalani, Department of Microbiology, School of Medicine, and Clinical Microbiology Research Center, Ilam University of Medical Sciences, Banganjab, Ilam, IR of Iran, Postal Zip: 69391-77143; phone: +98-841-223-5747; fax. +98-841-2227136; e-mail: [email protected]

170

2

Taherikalani M. et al.

hospitals, in Tehran and to evaluate any correlations between antibiotic resistance and the carriage of different classes of integrons among A. baumannii isolates. Experimental Materials and Methods

Bacterial isolates. A total of 100 non-duplicate isolates of Acinetobacter spp. were collected from different clinical specimens during 2007–2009. These isolates were confirmed as A. baumannii by conventional biochemical testing and 20NE API galleries (BioMerieux, Inc) used in the previous studies (Feizabadi et al., 2008; Taherikalani et al., 2009; Akbari et al., 2010). These studies were carried out in the laboratory of microbio­ logy in Ilam University, Iran. Fifty six percent (n = 56) of the isolates were recovered from wound and trachea. The strains isolated were then stored at –80°С in nutrient broth containing 50% glycerol v/v for further investigation. Antimicrobial susceptibility testing. Antimicrobial susceptibility testing was performed by disk agar diffusion, according to CLSI guidelines. The applied antimicrobials were as follows: ampicillin-sulbactam (10/10 µg), piperacillin (100 µg), cefotaxime (30 µg), ceftazidime (30 µg), cefteriaxone (30 µg), cefepime (30 µg), imipenem (10 µg), ciprofloxacin (5 µg), amikacin (30 µg), gentamicin (10 µg) and tetracycline (10 µg). Inoculums of the A. baumannii isolates (106 CFU) were swabbed on several Muller-Hinton agar plates, and different disks, impregnated each with different antibiotics, were then placed on these plates. Incubation at 37°C for 24 h was then carried out after which the inhibition zones were read. Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 29213 and Pseudomonas aeruginosa ATCC 27853 were used as control strains. PCR amplification of integron-associated genes for different integron classes. DNA extraction was carried out using commercial standard kit (Bioner, Republic of Korea) and 4 μl of the suspension were used as the template DNA for PCR.

PCR annealing temperature, primer sequences and the amplicon sizes are listed in Table I (Srinivasan, Rajamohan et al., 2009). The PCR conditions were as follows: initial denaturation at 95°C for 5 min; 30 cycles with denaturation at 95°C for 30s, annealing at 50°C, 51°C, 52°C and 53°C for 30s for integrons class 1, 2 and 3 and conserved sequence of integron class 1 respectively, and extension at 72°C for 45s followed by final extension at 72°C for 7 min. PCR products were separated by electrophoresis on a 1% agarose gel and were detected by comparison against a 100 bp DNA ladder as a size marker under the visualization of UV light on Geldoc apparatus. REP-PCR Finger-printing. DNA extraction was carried out by DNA extraction kit (Bioner, Republic of Korea) and 4 μl of the extract was used as the template DNA. The primer pair REP1, 5’-IIIGCGCCGICATCAGGC-3’ and REP2, 5’-ACGTCTTATCAGGCCTAC-3’ were used to amplify putative REP-like elements in the genomic bacterial chromosomes (Bou et al., 2000). Amplification reaction was performed in a final volume of 25 μl. Each reaction mixture contained 2.5 μl of 10X PCR buffer, 1.25 U Taq DNA polymerase (Fermentas, UK), and 0.8 μl of mixed dNTPs (Fermentas, UK), 1.5 μl of 25 Mm MgCl2, 1 μl of 10 pmol primers and 50 ng of bacterial DNA. Amplification reaction was carried out by thermal cycler (Ependorff, Germany) with an initial denaturation at 94°C for 10min, followed by 30 cycle of denaturation at 94°C for 1 min, annealing at 45°C for 1 min, and extension at 72°C for 1 min, followed by final extension at 72°C for 16 min. Aliquots of each sample were subjected to electrophoresis in 1.2% agarose gels. Amplified products were detected by Geldoc apparatus after staining with ethidium bromide (50 mg/L) and the created photographs were then analysed visually and with the TotalLab TL120 software. Results The most effective antimicrobial agents against A. baumannii isolates were as follows: gentamicin 55% (n=55), imipenem 47% (n=47), ampicillin-sulbactam, ami­

Table I Primers used in PCR amplification of integron classes 1 to 3 Target gene

Forward

Reverse

Annealing Size of Temperature amplicon (°С) (bp)

intI 1

5’-ACATGTGATGGCGACGCACGA-3’

50

300

intI 2

5’-CACGGATATGCGACAAAAAGGT-3’ 5’-GTAGCAAACGAGTGACGAAATG-3’

51

962

intI 3

5’-GCCTCCGGCAGCGACTTTCAG-3’

52

1041

53

Variable

5’-ATTTCTGTCCTGGCTGGCGA-3’ 5’-ACGGATCTGCCAAACCTGACT-3’

Conserved Segment of IntI 1 (5’-CS) 5’-GGCATCCAAGCAGCAAG-3’ (3’-CS) 5’-AAAGCAGACTTGACCTGA-3’

2

171

Classes of integrons among hospital isolates of A. baumanniiin Iran

Fig. 1. Variable amplicon size of conserved segments of integron class 1.

Fig. 3. PCR of class 2 integron among clinical A. baumannii isolates.

Lane 1 (negative control: DDW); Lanes 3 and 8 (clinical positive sample); Lanes 2 and 4–7 and 9–11 and 13–21 (clinical negative samples).

Lanes 1–2, 8, 9 13–14 (clinical positive isolates), Lane 11 (100 bp DNA size marker); Lanes 3–7, 9, 12, 15–20 (clinical negative isolates).

Fig. 2. PCR of class 1 integron among clinical A. baumannii isolates.

Fig. 4. REP PCR. Pattern of genomic DNA from 19 clinical A. baumannii isolates.

Lanes 1–2, 4–5, 7–8, 10 (clinical positive isolates), Lane 11 (100 bp DNA size marker), Lanes 12–20 (clinical positive isolates).

Lanes 1–10, 12–20 (clinical isolates of A. baumannii), Lane 11 (DNA Ladder 100 bp to 3000 bp).

kacin 38% (n = 38) and tetracycline 31% (n = 31). Most isolates showed high resistance to piperacillin (100%) and cephalosporin drugs (more than 95%). The REP- fingerprinting of some A. baumannii isolates are shown in Fig. 1. All the isolates not previously compared with REP or other typing methods were revealed to have 20 REP patterns. No reliable REP pattern was observed among 15 isolates.

PCR detecting integrase gene showed that 58% (n=58) of all the isolates had intI 1; however, intI 2 was only identified in 14% (n = 14) of the isolates and intI 3 was not revealed in any of the clinical isolates. The coexistence rate of intI 1/intI 2 was 9% (n = 9). The relationship between antibiotic resistance and the existence of different integrons is shown in Table II. More than 50% of penicillin and cephalosporin resistant isolates har-

Table II Distribution of intI 1 and intI 2 among A. baumannii isolates resistant to different antibiotic agents Antibiotic agent Piperacillin

Number of resistant isolates t 100

Class 1 integron n (%) 58 (58)

Class 1&2 integrons n (%)

Class 2 integron n (%)t

14 (14)

9 (9)

Ampicillin- sulbactam

62

24 (37.5)   3 (4.83)

1 (1.61)

Ciprofloxacin

85

51 (60)

14 (16.4)

9 (10.58)

Amikacin

62

27 (43.54)

10 (16.12)

7 (11.29)

Imipenem

53

24 (45.28)   7 (13.20)

4 (7.54)

Cefotaxime

97

57 (58.76)

13 (13.4)

9 (9.27)

Cefepime

99

58 (58.58)

14 (14.14)

9 (9.09)

Ceftazidime

97

57 (58.76)

13 (13.4)

9 (9.27)

Ceftriaxone

97

56 (57.73)

14 (14.43)

9 (9.27)

Tetracycline

31

16 (51.6)   7 (22.58)

5 (16.12)

Gentamicin

45

18 (40)   8 (17.7)

4 (8.88)

172

Taherikalani M. et al.

2

Fig. 5. UPGMA dendogram illustrating the relationships between sample origins, hospitals, wards and the existence of class 1 and 2 integron genes among the genotypes of A. baumannii isolates.

bored different integrons. Ceftriaxone and cefotaxime resistant isolates were the most common intI 1 harboring isolates (58.76%), followed by ceftriaxone and cefepime with 58.73% and 58.58%, respectively. However, tetracycline resistant isolates were the most common intI 2 harboring isolates (22.58%), followed by gentamicin and amikacin with 17.7% and 16.12%, respectively (Figs 3, 4). Amplification of the integron gene cassettes of the integrase positive isolates gave PCR products of various sizes ranging from 100 bp to 2.5 kb (Fig. 4). Distribution of the integron gene cassettes among integrase positive isolates was accounted for 10% (n = 10). Various amplicons of integron gene cassettes were not seen among all integrase positive isolates. The correlations between REP-genotype, different hospitals, wards, sample origins and the existence of integrons are shown in dendogram (Fig. 5). Discussion Acinetobacter baumannii is typically resistant to various antimicrobial agents such as penicillins, cephalosporines, macrolides, aminoglycosides, tetracyclines and fluoroquinolones (Wang et al., 2007). Because of the multidrug resistance and tendency to spread in hospital population, A. baumannii has a special clinical significance, requiring epidemiologic monitoring as a measure for control of nosocomial infection. On the basis of the sequence of integrase gene, integrons are divided into at least six classes, with class 1 integron being the most common among the clinical isolates of Gram-negative bacteria, including acineto-

bacters (Koeleman et al., 2001; Turton et al., 2005). It seems that class 2 integrons were rarely detected in Acinetobacter spp., but class 3 integrons were not detected in those bacteria at all (Ploy et al., 2000; Koeleman et al., 2001; Turton et al., 2005). PCR detecting integrase gene used has advantages over the integron cassette PCR in screening for integrons, in that it is designed to give a small product which is easily amplified. Integron cassette PCR can give a negative result even when the integrons are present, if the cassette array is difficult to amplify or if there are no cassettes present. The PCR detecting integrase gene was simple, reliable, and easy to perform (Turton et al., 2005). In the current study a high prevalence of intI 1 and intI 2 was found among multidrug resistant A. baumannii strains, isolated from different specimens. The results related to class1 integron were in concordance with other studies (Gonzalez et al., 1998; Seward 1999). Although some studies clarified the presence of intI 2 among A. baumannii strains, only 14% of the isolates in this study seemed to harbor this class of integrons. These findings are relatively significant since most studies report that class 2 integrons are not found or are found in low rates among A. baumannii strains (Ploy et al., 2000; Turton et al., 2005). Class 3 integron was not found among A. baumannii strains, which was in accordance with other reports (Ploy et al., 2000). Although amplicons with variable sizes were found in integron gene cassette, in agreement with other studies, these variable amplicon could not be detected among all integrase positive strains (Turton et al., 2005).

2

Classes of integrons among hospital isolates of A. baumanniiin Iran

Antibiotic resistance is an important factor in the spread of nosocomial infection. It is generally considered that the existence of integrons confers the advantage of antibiotic resistance upon the strains. Among the multiresistant strains described in this study, there were still some strains which did not contain integrons (of classes 1 and 2 at least); however, most of them were susceptible to gentamicin, imipenem, and ampicillin-sulbactam. Integrons containing the same organization of cassettes were found in various REP genotypes, suggesting horizontal transfer of integrons, also reported in other studies (Sallen et al., 1995; Seward 1999). In addition, the promoter sequences were mostly conserved, even in isolates from different countries with distinct selective pressure, suggesting that acquisition of resistance is likely due to transfer of entire integrons via plasmids and/or transposons rather than of individual cassettes (Ploy et al., 2000). In concordance with other studies, it was proven that the isolates of the same genotype possess different integrons and in the same way, the unrelated isolates with different genotypes could contain the same integrons. Similar 2.5-kb integrons, with integron cassettes, found by PCR in the present study, have been widely found in isolates of European clones I and II from many countries (Nemec et al., 2004; Turton et al. 2005). The 2.5-kb integron has also been found in a number of outbreak strains of A. baumannii of different genotypes in Italy, Russia and Ireland (Gombac et al., 2002; Zarrilli et al., 2004; Turton et al., 2005). In conclusion, integrons could be a feature of epidemic strains or clones of A. baumannii currently found in Iran. Information on both the genotype and integron type is useful in epidemiological studies. The association of integrons with epidemic behaviors merits further studies. Acknowledgment This work was supported by Ilam University of Medical Scien­ces. We acknowledge the microbiology lab workers of Ilam University of Medical Sciences who cooperated in this work.

Literature Akbari M., M. Niakan, M. Teherikalani, M.M. Feizabadi, N.A. Azadi, S. Soroush, M. Emaneini, A. Abdolkarimi, A. Maleki and A. Hematian. 2010. Rapid identification of Iranian Acinetobacter baumannii strains by single PCR assay using bla OXA-51-like carbenemase and evaluation of the antimicrobial resistance profiles of the isolates. Acta Microbiol. Immunol. Hung. 57: 87–94. Bou, G., G. Cervero, M.A. Dominguez, C. Quereda and J. Martinezeltran. 2006. PCR-based DNA fingerprinting (REP-PCR, AP-PCR) and pulsed-field gel electrophoresis characterization of a  nosocomial outbreak caused by imipenem- and meropenem-resistant Acinetobacter baumannii. Clin. Microbiol. Infect. 6: 635–643

173

Clinical and Laboratory Standard Institute. 2006. Performance Standards for Antimicrobial Disk Susceptibility tests; 9th for informational Supplement, M2-A9.Clinical and Laboratory Standards Institute, Wayne, Pa. von Dolinger de Brito D., E.J. Oliveira, V.O. Abdallah, A.L. da Costa Darini and P.P. Filho. 2005. An outbreak of Acinetobacter baumannii septicemia in a neonatal intensive care unit of a university hospital in Brazil. Braz. J. Infect. Dis. 9: 301–309. Fontana C, M. Favaro, S. Minelli, M.C. Bossa, G.P. Testore, F. Leonardis, S. Natoli and C. Favalli. 2008. Acinetobacter baumannii in intensive care unit: a novel system to study clonal relationship among the isolates. BMC Infect. Dis. 8: 79. Feizabadi M.M., B. Fathollahzadeh, M. Taherikalani, M. Rasoolinejad, N. Sadeghifard, M. Aligholi, S. Soroush and S. Mohammadiegane. 2008. Antimicrobial susceptibility patterns and distribution of blaOXA genes among Acinetobacter spp. Isolated from patients at Tehran hospitals. Jpn. J. Infect. Dis. 61: 274–278. Gallego L. and K.J. Towner. 2001. Carriage of class 1 integrons and antibiotic resistance in clinical isolates of Acinetobacter baumannii from northern Spain. J. Med. Microbiol. 50: 71–77. Gonzalez G., K. Sossa, H. Bello, M. Dominguez, S. Mella and R. Zemelman. 1998. Presence of integrons in isolates of different biotypes of Acinetobacter baumannii from Chilean hospitals. FEMS. Microbiol. Lett. 161: 125–128. Gombac F., M.L. Riccio, G.M. Rossolini, C. Lagatolla, E. Tonin, C. Monti-Bragadin, A. Lavenia and L. Dolzani. 2002. Molecular characterization of integrons in epidemiologically unrelated clinical isolates of Acinetobacter baumannii from Italian hospitals reveals a limited diversity of gene cassette arrays. Antimicrob. Agents. Chemother. 46: 3665–3668. Koeleman J.G, M.W. van der Bijl, J. Stoof, C.M. VandenbrouckeGrauls and P.H. Savelkoul. 2001. Antibiotic resistance is a major risk factor for epidemic behavior of Acinetobacter baumannii. Infect. Control. Hosp. Epidemiol. 22: 284–288. Navia M.M., J. Ruiz and J. Vila. 2002. Characterization of an integron carrying a new class D beta-lactamase (OXA-37) in Acinetobacter baumannii. Microb. Drug. Resist. 8: 261–265. Nemec A., L. Dolzani, S. Brisse, P. van den Broek and L. Dijkshoorn. 2004. Diversity of aminoglycoside-resistance genes and their association with class 1 integrons among strains of panEuropean Acinetobacter baumannii clones. J. Med. Microbiol. 53: 1233–1240. Peleg A.Y, H. Seifert and D.L. Paterson. 2008. Acinetobacter baumannii: emergence of a successful pathogen. Clin. Microbiol. Rev. 21: 538–582. Ploy M.C, F. Denis, P. Courvalin and T. Lambert. 2000. Molecular characterization of integrons in Acinetobacter baumannii: description of a hybrid class 2 integron. Antimicrob. Agents. Chemother. 44: 2684–2688. Sallen B., A. Rajoharison, S. Desvarenne ans C. Mabilat. 1995. Molecular epidemiology of integron-associated antibiotic resistance genes in clinical isolates of enterobacteriaceae. Microb. Drug. Resist. 1: 195–202. Seward R.J. 1999. Detection of integrons in worldwide nosocomial isolates of Acinetobacter spp. Clin. Microbiol. Infect. 5: 308–318. Srinivasan V.B, G. Rajamohan, P. Pancholi, K. Stevenson, D. Tadesse, P. Patchanee, M. Marcon and W.A. Gebreyes. 2009. Genetic relatedness and molecular characterization of multidrug resistant Acinetobacter baumannii isolated in central Ohio, USA. Ann. Clin. Microbiol. Antimicrob. 8: 21. Turton J.F, M.E. Kaufmann, J. Glover, J.M. Coelho, M. Warner, R. Pike and T.L. Pitt. 2005. Detection and typing of integrons in epidemic strains of Acinetobacter baumannii found in the United Kingdom. J. Clin. Microbiol. 43: 3074–3082.

174

Taherikalani M. et al.

Taherikalani M., B. Fatolahzadeh, M. Emaneini, S. Soroush and M.M. Feizabadi. 2009. Distribution of different carbapenem resistant clones of Acinetobacter baumannii in Tehran hospitals. New Microbiol. 32: 265–271. Taherikalani M., G. Etemadi, K.N. Geliani, B. Fatollahzadeh, S.  Soroush and M.M. Feizabadi. 2008. Emergence of multi and pan-drug resistance Acinetobacter baumannii carrying blaOXA-type -carbapenemase genes among burn patients in Tehran, Iran. Saudi. Med. J. 29: 623–624.

2

Wang H., P. Guo, H. Sun, H. Wang, Q. Yang, M. Chen, Y. Xu and Y. Zhu. 2007. Molecular epidemiology of clinical isolates of carbapenem-resistant Acinetobacter spp. from Chinese hospitals. Antimicrob. Agents. Chemother. 51: 4022–4028. Zarrilli R., M. Crispino, M. Bagattini, E. Barretta, A. Di Popolo, M. Triassi and P. Villari. 2004. Molecular epidemiology of sequential outbreaks of Acinetobacter baumannii in an intensive care unit shows the emergence of carbapenem resistance. J. Clin. Microbiol. 42: 946–953.

Polish Journal of Microbiology 2011, Vol. 60, No 2, 175–178 Short communication

Host Response to the Presence of Helicobacter spp. DNA in the Liver of Patients with Chronic Liver Diseases MAGDA RYBICKA1, JOANNA NAKONIECZNA1, *, PIOTR STALKE2 and KRZYSZTOF PIOTR BIELAWSKi1

 Intercollegiate Faculty of Biotechnology, University of Gdańsk and Medical University of Gdańsk, Poland 2  Department of Infectious Diseases, Medical University of Gdańsk, Gdańsk, Poland

1

Received 1 December 2010, revised 18 January 2011, accepted 25 January 2011

Abstract Literature data indicate an association between the presence of Helicobacter spp. in the liver and the development of hepatocellular carcinoma (HCC). However, the role of H. pylori infections in chronic liver diseases (CLD) remains controversial. The aim of this study was to detect Helicobacter spp. DNA in patients with CLD, and to investigate the host response to the presence of the bacterium in the liver. Helicobacter spp. DNA was detected in 59% samples. H.pylori was the most prevalent species (94%). We estimated the expression level of IL-1 and IL-8 genes. The presence of Helicobacter spp. did not have a significant effect on the gene expression of IL-8 and IL-1. K e y w o r d s: Helicobacter, interleukin 1, interleukin 8, nested-PCR

On the basis of various epidemiological studies H. pylori has been classified as a type I carcinogen by the Working Group of the World Health Organization International Agency for Research on Cancer in 1994 (IARC 1994). H. pylori is specialized in colonizing human gastric mucosa of more than 50% of world population. It can be a cause of chronic gastritis, peptic ulcers, and gastric adenocarcinoma (Wedi et al., 2002). The bacterium has also been implicated in extra-gastric conditions such as ischemic heart disease, vascular and immunological disorders, halitosis, migraine, and poor growth in children (Pellicano et al., 2008). Recently, Helicobacter spp. DNA has been found in the liver of patients with various chronic liver diseases, such as primary sclerosing cholangitis, hepatocellular carcinoma (HCC), hepatitis C virus-related chronic infection, and cirrhosis. Inflammatory disease is characterized by increased levels of pro-inflammatory cytokines, such as interleukins 1 and 8 (IL-1 and IL-8). The higher prevalence of Helicobacter spp. associated with more advanced stages of the liver disease supports the possibility of their role in the progression of chronic hepatitis towards cirrhosis and HCC (Pellicano et al., 2008). In this study we aimed at detecting Helicobacter spp. genetic material in patients with chronic liver diseases in the population of Northern Poland. Further, the host

response to the presence of Helicobacter spp. in the liver was investigated. The study included 27 patients suffering from different chronic liver diseases (CLD): Hepatitis B (HBV) and C (HCV) virus infections, HBV/HCV double infection, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease with HCV infection, non-alcoholic fatty liver disease with HBV infection, hereditary hemochromatosis, alcoholic steatohepatitis and autoimmunohepatitis. The biopsy from each patient was halved, and used for DNA and RNA extraction, respectively. DNA was extracted using a High Pure PCR Template Preparation Kit (Roche). Twenty-seven DNA sam­ples with high quality and quantity were amplified. Helico­ bacter spp. DNA was detected by nested polymerase chain reaction with genus specific primers targeting Helicobacter spp. 16S rRNA gene. The reaction mixture for the first step contained (25 µl):100 ng of genomic DNA, 1x chelating buffer, 2.5 mM Mg(OAc)2, 0.2 mM dNTP, 0.4 U of Taq DNA polymerase (Fermentas), 0.1 mg/ml of casein, 0.01% (v/v) formamide and 0.125 μM of primers: 1F and 1R (Al-Soud et al., 2003). Amplification conditions for the first PCR were: 94°C for 2 min; then 30 cycles of 94°C for 30 s, 55°C for 30 s, 72°C for 30 s; and finally 72°C for 5 min. The reaction mixture for the second step (25 µl) contained: 1x chelating

*  Corresponding author: J. Nakonieczna, Intercollegiate Faculty of Biotechnology, University of Gdańsk and Medical University of Gdańsk, Poland; Kladki 24, 80-822 Gdańsk, Poland; phone: 48 58 5236332; e-mail: [email protected]

176

2

Rybicka M. et al. Table I Results of liver function test, blood morphology and expression of interleukin 1 and 8 in liver in patients with CLD Helicobacter positive

Helicobacter negative

Range

P*

ALT (alanine aminotransferase) [IU/L]

80.73±107.5

83±78.8

10–409

0.45

AST (aspartate aminotransferase) [IU/L]

59.26±77.31

51.4±39.92

12–316

0.62

97±45.72

87.6±61.5

29–212

0.42

108.53±164.82

178.5±208.86

9–707

0.2

ALP (alkaline phosphatase) [IU/L] GGTP (γ-glutamyl transpeptidase) [IU/L] HGB (hemoglobin) [mg/dL]

13.58±1.88

0.77±0.34

0.24–2.31

0.49

Bilirubin [mg/dL]

0.94±0.61

0.86±0.44

0.24–2.31

1

Liver biopsy grading

1±0.83

0±0.52

0–3

0.13

Liver biopsy staging

0.47±0.74

0.5±1.08

0–3

0.66

IL-8 relative expression (in arbitrary units)

1.1±0.9

1.3±2.5

0–6

0.35

IL-1 relative expression (in arbitrary units)

27±66.1

16±31.4

0.12–259

0.62

P* Statistical significance was assessed by U Mann-Whitney Test

buffer, 2.5 mM MgCl2, 0.2 mM dNTP, 2.5 U of AmpliTaq Gold polymerase, 0.25% (v/v) glycerol, 0.4% (v/v) BSA, 0.125 μM of primers: 2F (5’-AGGGAATATTGCTCAATGGG-3’, designed by the authors) and 2R (Al-Soud et al., 2003), and 1 μl of the first amplification step product. Amplification conditions were: 95°C for 10 min; than 35 cycles of 94°C for 30 s, 55°C for 30 s, 72°C for 30 s; and finally 72°C for 5 min. Helicobacter genus-specific PCR products were sequenced, aligned and compared with the sequences from GenBank database using BLASTN 2.2.1 (http://blast. ncbi.nlm.nih.gov/Blast.cgi). Total RNA was extracted by a RNeasy kit (Qiagen), 100 ng of RNA was used for reverse strand cDNA synthesis according to the manufacturer’s protocol (Quanti Tect Reverse Transcription Kit, Qiagen). Expression of IL-1 and IL-8 genes was quantified using real-time RT-PCR (LightCycler ; Roche Diagnostic). β-glucuronidase gene (GUS) was used as reference (Romanowski et al., 2008). The reaction mixture contained (20 μl): 2 µl of cDNA, 5 μM concentration of each primer, 3 mM of MgCl2 and 2 µl of ready-to-use Light Cycler DNA Master SYBR Green I (Roche Diagnostic). The polymerase was activated at 95°C for 10 min. The following cycling conditions were used in the reaction: 1 s (IL-1, IL-8) and 5 s (GUS) 95°C denaturation step, 15 s annealing at 64°C (IL-1, IL-8) and 60°C (GUS), and 20 s (IL-1, IL-8) and 10 s (GUS) extension at 72°C. Melting-curve analysis followed 45 and 50 cycles of IL-1, IL-8 and GUS genes amplification, respectively. Results were normalized with respect to the reference gene. To determine expression levels of genes of interest in the studied samples, standard curves for IL-1 and IL-8 were generated (serial dilutions of a standard sample used at this step were as follows: 1x, 0.5x, 0.2x, 0.1x). As a standard we used a mixture of all cDNAs. Each

®

®

®

®

sample was studied in three repetitions and normalized with respect to the reference gene. The role of H. pylori in various gastric and duodenal diseases is well documented. In recent years H. pylori DNA has been identified in the bile, gallbladder and liver tissue of patients with different hepato-biliary diseases. Recently published detection rates of Helicobacter spp., in tissue samples collected from patients with liver cancer, varied from 0% to 100% (Avenaud et al., 2000; Nilsson et al., 2001; Verhoef et al., 2003; Huang et al., 2004; Ito et al., 2004; Rocha et al., 2005; Vivekanandan and Torbenson 2008). In our study we selected 16S rDNA as the target because it contains both conserved and highly variable regions and gene sequences for almost all Helicobacter species available in public data bases. We identified Helicobacter genus-specific PCR products in 16/27 (59%) of the liver specimens, which constitutes a more than 2-fold increase of the detection frequency in comparison to the data previously published by our group (Stalke et al., 2005). The differences in detection level might be related to improvements in PCR reaction conditions. Previously only BSA was used to avoid the inhibitory effect of bile, whereas at present we used several PCR facilitators which improved the frequency of Helicobacter spp. DNA detection. Moreover, the amount of DNA per reaction, which we used as a template was 20 ng, whereas previously 5 μl of each DNA solution was added, regardless of the concentration. Additionally, in the previously published study, diluted product from the first PCR reaction was used as a template in the second step, while here, we added undiluted product. All this differences could influence detection sensitivity. The DNA sequence of 15 out of 16 (94%) positive samples showed the highest similarity to H. pylori 16S rRNA gene, whereas in 1 sample (6%), H. cetorum-like DNA was detected. Detailed chromatogram analysis

2

177

Short communication

revealed that 3 samples contained mixed DNA material. In those three samples H. rodentium-like DNA was identified based on double fluorescent signals in positions where the 16S rRNA genes differ for H. pylori and H. rodentium. This may indicate that in humans, different isolates of particular Helicobacter species may exist, like it was found in other species (Nilsson et al., 2004). In our recently published results we also found H. rodentium-like DNA by means of denaturing gradient gel electrophoresis (DGGE) and subsequent DNA sequencing (Nakonieczna et al., 2010). This H. rodentium-like DNA was actually the most prevalent one in the previously studied group of patients, which in comparison to the presented data was less heterogeneous. Literature data indicate that expression levels of IL-1 and IL-8 are higher in gastric epithelial cells of H. pyloriinfected than in uninfected patients (Backhed et al., 2003). As the phenomenon of Helicobacter species presence in the human liver is widely discussed with respect to its participation in disease state and/or progression, we analyzed the level of IL-8 and IL-1 in the group of patients, in which Helicobacter DNA was detected. As a control group, patients with negative result of nestedPCR were used. There were no differences in IL-8 gene expression between Helicobacter-positive and Helicobacter-negative patients. The biopsy samples obtained from H. pylori-positive patients expressed about two times higher levels of IL-1, however this data was not statistically significant (Table I). Moreover, comparison of Helicobacter spp. positive and negative group did not show any statistically relevant differences in the functional liver test, including the levels of alanine aminotransferase, aspartate aminotransferase, γ-glutamyl transpeptidase, alkaline phosphatase, hemoglobin and bilirubin (Table I). However, we did not study the status of cytotoxin associated gene A (cagA) in the Helicobacter-positive group, which might have influenced the results. It is known that cagA+ strains are associated with enhanced secretion of interleukins, especially IL-8 (Backhed et al., 2003; Rieder et al., 2005). The relatively low expression level of the studied interleukins can be explained by defective immune system of investigated individuals or their general low immunity. Another interpretation might be low bacterial load and their adaptation to a  special environment. Besides, the expression level of cytokines is associated with disease progression and is highly increased at the initial stage of disease. Because the investigated material originated from patients with chronic liver diseases we can suppose that levels of IL-1 and IL-8 were low. Lack of significant differences in expression levels of studied genes may be associated with the fact that H. pylori possesses lipopolysaccharide (LPS) with a lower virulence compared to the typical bacterial endotoxins, such as Escherichia coli LPS. Furthermore, H. pylori

adheres and is internalized into hepatocytes more efficiently than into gastric epithelial cells. It appears that H. pylori may survive inside hepatocytes and effectively avoid host response (Ito et al., 2008). Sequence analysis showed that H. pylori is the most prevalent species (94%) in the studied population. In contrast to gastric epithelial cells, the presence of H. pylori in the liver of patient with CLD had no influence on IL-8 and IL-1 mRNAs status as well as biochemical parameters describing liver functioning. Acknowledgments This study was funded by University of Gdańsk, grant no B051-5-0315-8 and Medical University grant no BW 155 and ST no 79.

Literature Al-Soud W.A., M. Bennedsen, S.L. On, I.S. Ouis, P. Vandamme, H.O. Nilsson, A. Ljungh and T. Wadström. 2003. Assessment of PCR-DGGE for the identification of diverse Helicobacter species, and application to faecal samples from zoo animals to determine Helicobacter prevalence. J. Med. Microbiol. 52: 765–771. Avenaud P., A. Marais, L. Monteiro, B. Lebail, P. Bioulac Sage and C. Balabaud. 2000. Detection of Helicobacter species in liver of patients with and without primary liver carcinoma. Cancer 89: 1431–1439. Backhed F., E. Torstensson, D. Seguin, A. Richter-Dahlfors and B. Rokbi. 2003. Helicobacter pylori Infection Induces Interleukin-8 Receptor. Expression in the Human Gastric Epithelium. Infection and Immunity 71: 3357–3360. Huang Y., H.G. Fan, Z.M. Wang, J.H. Zhou, X.F. Tian and N. Li. 2004. Identification of Helicobacter species in human liver samples from patients with primary hepatocellular carcinoma. J. Clin. Pathol. 57: 1273–1277. IARC Working Group on the Evaluation of Carcinogenic Risks to Humans. Shistosomes, liver flukes and Helicobacter pylori. Lyon: IARC monographs, 1994: 177–243. Ito K., M. Nakamura, G. Toda, M. Negishi, A. Torii and T. Ohno. 2004. Potential role of Helicobacter pylori in hepatocarcinogenesis. Int. J. Mol. Med. 13: 221–227. Ito K., Y. Yamaoka, H. Ota. 2008. Adherence, Internalization, and Persistence of Helicobacter pylori in Hepatocytes. Dig. Dis. Sci. 53: 2541–2549. Nakonieczna J., P. Stalke, W.A. Al-Soud, T. Wadström and K.P. Bielawski. 2010. Detection of Helicobacter rodentium-like DNA in the liver tissue of patients with chronic liver diseases by polymerase chain reaction-denaturing gradient gel electrophoresis and DNA sequence analysis. Diagn Microbiol Infect Dis. 68: 201–7. Nilsson H.O., R. Mulchandani, K.G. Tranberg. 2001. Helicobacter species identified in liver from patients with cholangiocarcinoma and hepatocellular carcinoma. Gastroenterology 120: 323–324. Pellicano R., A. Ménard. 2008. Helicobacter species and liver diseases: association or causation? Lancet Infect Dis. 8: 254–60. Rieder G., W. Fischer. 2005. Interaction of Helicobacter pylori with host cells: Function of secreted and translocated molecules. Curr. Opin. Microbiol. 8: 67–73. Rocha M., P. Avenaut, A. Menard, B. Le Bail, C. Balabaud and P. Bioulac-Sage. 2005. Association of Helicobacter species with hepatitis C cirrhosis with or without hepatocellular carcinoma. Gut 54: 396–401.

178

Rybicka M. et al.

Romanowski T., K. Sikorska and K.P. Bielawski. 2008. GUS and PMM1 as suitable reference genes for gene expression analysis in the liver tissue of patients with chronic hepatitis. Med. Sci. Monit. 14: 147–152. Stalke P., W.A. Al-Soud, K.P. Bielawski, A. Bakowska, H. Trocha and J. Stępiński. 2005. Detection of Helicobacter species in liver and stomach tissue of patients with chronic liver diseases using polimerase chain reaction-denaturin gradient gel electrophoresis and immunohistochemistry. Scand. J. Gastroenterol 40: 1032–1041.

2

Verhoef C., R.G. Pot, R.A. de Man, P.E. Zondervan, E.J. Kuipers, J.N. Ijzermans and J.G. Kusters. 2003. Detection of identical Helicobacter DNA in the stomach and in the non-cirrhotic liver of patients with hepatocellular carcinoma. Eur. J. Gastroenterol. Hepatol. 15: 1171–1174. Vivekanandan P. and M. Torbenson. 2008. Low frequency of Helicobacter DNA in benign and malignant liver tissues from Baltimore, United States. Human Pathology 39: 213–216. Wedi B. and A. Kapp. 2002. Helicobacter pylori infection in skin diseases: a critical appraisal. Am. J. Clin. Dermatol. 3: 273–282