PolyinosinicâPolycytidylic Acid Perturbs Ovarian ...

BIOLOGY OF REPRODUCTION (2015) 93(1):11, 1–9 Published online before print 3 June 2015. DOI 10.1095/biolreprod.115.128348

Polyinosinic–Polycytidylic Acid Perturbs Ovarian Functions Through Toll-Like Receptor 3-Mediated Tumor Necrosis Factor A Production in Female Mice1 Keqin Yan, Lijing Cheng, Peng Liu, Zhenghui Liu, Shutao Zhao, Weiwei Zhu, Qing Wang, Han Wu, and Daishu Han2 Department of Cell Biology, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, School of Basic Medicine, Peking Union Medical College, Beijing, China

Viral infections may perturb ovarian functions and female fertility. Mechanisms underlying viral perturbation of ovarian functions are incompletely understood. This study found that intraperitoneal injection of polyinosinic–polycytidylic acid [poly (I:C)] in female mice inhibits estradiol synthesis and induces ovarian granulosa cell apoptosis. Poly (I:C) is a synthetic viral double-stranded RNA analog, which induces innate antiviral responses mimicking a viral infection through activation of pattern recognition receptors, including toll-like receptor 3 (TLR3), retinoic acid-inducible gene I, and melanoma differentiation-associated gene 5. Injection of poly (I:C) significantly induced granulosa cell apoptosis in antral follicles and reduced antral follicle numbers. These effects were significantly diminished in Tlr3 knockout or tumor necrosis factor-alpha (Tnfa) knockout mice. We demonstrated that poly (I:C) induced TNFA production at a relatively high level in wild-type mice compared with that in Tlr3 knockout mice. Notably, TNFA neutralizing antibody significantly reduced poly (I:C)-induced ovarian dysfunction. In vitro assays confirmed that TNFA inhibits estradiol synthesis and induces granulosa cell apoptosis. Results provide novel insights into the mechanisms by which a mimicked viral infection perturbs ovarian functions in mice. ovary, TNFA, toll-like receptor 3, viral infection

INTRODUCTION Several viral infections perturb ovarian functions. Vaccinia viruses preferentially impair ovarian functions [1, 2]. Infection with mumps virus is associated with premature ovarian failure [3], and human immunodeficiency virus may cause ovarian dysfunction [4, 5]. Understanding the mechanisms by which viral infections perturb ovarian functions can aid in the development of preventive and therapeutic strategies for viral ovarian dysfunction. Folliculogenesis and estradiol synthesis are two major functions of the ovary. Folliculogenesis is a highly organized process in which primordial follicles progressively develop into mature follicles through preantral and antral stages [6]. A developing follicle consists of an oocyte surrounded by 1 This work was supported by National Natural Science Foundation of China grants 31171445, 31261160491, and 31371518. 2 Correspondence: Daishu Han, Department of Cell Biology, PUMC & CAMS, 5 Dong Dan San Tiao, Beijing 100005, P.R. China. E-mail: [email protected]

Received: 17 January 2015. First decision: 15 February 2015. Accepted: 26 May 2015. Ó 2015 by the Society for the Study of Reproduction, Inc. eISSN: 1529-7268 http://www.biolreprod.org ISSN: 0006-3363

1 Downloaded from https://academic.oup.com/biolreprod/article-abstract/93/1/11, 1-9/2434167 by U Colorado AMC Health Sciences Library user on 29 June 2018

Article 11

Downloaded from www.biolreprod.org.

granulosa and perifollicular theca cells. The granulosa and theca cells secrete numerous molecules that regulate folliculogenesis. In particular, estradiol synthesized by granulosa cells plays a crucial role in regulating folliculogenesis [7]. Several steroidogenic enzymes are required for estradiol synthesis [8]. Although microbial infections may perturb estradiol synthesis and follicular development [9, 10], the underlying mechanisms remain unclear. Microbial infections immediately induce innate immune responses through activation of pattern recognition receptors (PRRs) [11]. Several subfamilies of PRRs, including toll-like receptors (TLRs), retinoic acidinducible gene I (RIG-I)-like receptors (RLRs), nucleotide oligomerization domain-like receptors (NLRs), and cytosolic DNA sensors, have been intensively investigated. Up to 13 TLRs have been identified in mammals [12]. RLRs include RIG-I, melanoma differentiation-associated gene 5 (MDA5), and laboratory of genetics and physiology 2 [13]. NLRs represent numerous cytosolic PRRs [14]. Studies of viral DNA sensors are developing rapidly [15]. PRRs recognize highly conserved molecules of microorganisms, such as pathogenassociated molecular patterns (PAMPs). PAMPs of viruses can be recognized by various PRRs, including several TLRs, RLRs, NLRs, and cytosolic DNA sensors, thereby initiating innate antiviral responses [16]. TLR3, MDA5, and RIG-I specifically recognize viral double-stranded RNA (dsRNA) and can be activated also by the synthetic viral dsRNA analog polyinosinic–polycytidylic acid [poly (I:C)] [14]. PRR-initiated innate immune responses constitute the frontline of host defense against invading pathogens [11]. However, a PRRinduced inflammatory milieu may also damage tissue functions and induce autoimmune diseases [17]. Increasing evidence shows that TLR-initiated innate immune responses in ovarian cells may perturb ovarian functions [18]. Expression and function of TLRs have been investigated in ovarian cells of different species. Most TLRs are expressed in human normal ovary and ovarian cancers [19]. TLR signaling pathways have been identified in human granulosa cell line [20]. TLR2 and TLR4 in mouse cumulus cells regulate ovulation and fertilization [21–23]. Lipopolysaccharides perturb the endocrine function of bovine granulosa cells and oocyte meiotic progression through TLR4 [9, 24]. TLR signaling in hen ovarian granulosa cells is associated with follicle maturation [25]. TLR2 and TLR4 activation perturbs ovarian functions in bovines and mice [26, 27]. We recently demonstrated that viral dsRNA sensors, including TLR3, MDA5, and RIG-I, initiate innate antiviral responses in mouse ovarian granulosa cells after challenge with poly (I:C), thereby inhibiting estradiol synthesis [28, 29]. To further understand the effects of innate antiviral responses on ovarian functions, the present research aimed to elucidate the mechanisms underlying poly (I:C)-caused ovarian dysfunctions. Results showed that poly (I:C) inhibited estradiol synthesis and

ABSTRACT

YAN ET AL.

induced granulosa cell apoptosis of dominant follicles through TLR3-mediated TNFA production.

TUNEL Assay Five-week-old female mice were intraperitoneally injected with poly (I:C) at a dose of 5 lg/g of body weight as previously described [35, 36]. After 48 h, cell apoptosis in the ovary was detected by TUNEL staining using In Situ Cell Death detection kit in accordance with the manufacturer’s instructions.

MATERIALS AND METHODS Animals C57BL/6J mice were obtained from the Laboratory Animal Center of Peking Union Medical College (Beijing, China). Tlr3 knockout (Tlr3/) mice (B6/129S1-Tlr3tm1Flv/J), with an original genetic background of 50% C57BL6 and 50% 129S1, and Tnfa knockout (Tnfa/) mice (B6/129S6Tnftm1GKl/J) with a background of 50% C57BL6 and 50% 129S6 were purchased from Jackson Laboratories (Bar Harbor, ME). Wild-type (WT) mice were obtained by backcrossing gene knockout mice to C57BL/6J mice. All mice were maintained under pathogen-free conditions with 12L:12D light cycle and food and water ad libitum. Mice were treated in accordance with the Guidelines for the Care and Use of Laboratory Animals established by the Chinese Council on Animal Care.

Immunohistochemistry Immunohistochemistry was performed as previously described [37]. Briefly, the ovary was fixed in Bouin solution for 24 h. After being embedded in paraffin, the ovary was cut into 5-lm-thick sections. The sections were incubated with 13 PBS containing 3% H2O2 for 15 min to inhibit endogenous peroxidase activity, then soaked in citrate buffer, and microwave-heated at 1008C for 10 min to retrieve antigens. After blocking with 5% normal rabbit sera in PBS for 1 h at room temperature, the sections were incubated overnight at 48C with antibodies against TNFR1. After being washed twice with PBS, the sections were incubated with horseradish-peroxidase (HRP)-conjugated goat anti-rabbit IgG at room temperature for 30 min. HRP activity was visualized using the diaminobenzidine method. Negative controls were incubated with preimmune rabbit sera as primary antibodies. Sections were counterstained with hematoxylin and mounted for microscopy (model IX-71; Olympus, Tokyo, Japan).

Antibodies and Major Reagents Rabbit anti-mouse TNFA receptor 1 (TNFR1) polyclonal antibodies (code ab19139) and TNFA neutralizing antibodies (code ab176489) were purchased from Abcam (Cambridge, MA). Monoclonal antibodies against b-actin (product A5316) were purchased from Sigma-Aldrich (St. Louis, MO). Horseradish peroxidase (HRP)-conjugated goat anti-rabbit immunoglobulin G (IgG; product ZB-2301) and goat anti-mouse IgG (product ZB-2305) were purchased from Zhongshan Biotechnology Co. (Beijing, China). Poly (I:C) (product no. tlrl-pic) was purchased from InvivoGen (San Diego, CA). Equine chorionic gonadotropin (eCG; product P139119) was purchased from Beijing QiWei YiCheng Tech Co., Ltd. (Beijing, China). Recombinant mouse TNFA (product 315-01A) was purchased from Peprotech (Rocky Hill, NJ). In Situ Cell Death Detection Kit (POD 11684817910) was purchased from Roche Diagnostics GmbH (Mannheim, Germany).

Real-Time Quantitative RT-PCR

Isolation of Granulosa Cells Mouse ovarian granulosa cells were isolated as previously described [30]. Briefly, 4-wk-old female mice were intraperitoneally injected with 5 IU of eCG. After 48 h, the follicles on the ovary surface were punctured with a 25gauge needle to release oocyte–cumulus cell complexes and clumps of mural granulosa cells. After removal of oocytes through a mouth-operated glass fine pipette, the granulosa cells were collected and cultured in F12/Dulbecco modified Eagle medium (Life Technologies, Grand Island, NY) supplemented with 10% fetal calf serum (Life Technologies), 100 U/ml penicillin, and 100 mg/ml streptomycin. The purity of granulosa cells was .95%, based on immunostaining for follicle-stimulating hormone (FSH) receptor, which is a marker of granulosa cells [31]. There was no macrophage contamination in the granulosa cell preparations based on immunostaining for F4/80, a marker of macrophages [32].

Western Blot Analysis Ovaries were lysed using a lysis buffer (Applygen Technologies Inc., Beijing, China). Protein concentration of ovarian lysates was determined using a bicinchoninic acid protein assay kit (Pierce Biotechnology, Rockford, IL). Equal amounts of protein (20 lg) were separated by 10% SDS-PAGE and then electrotransferred onto polyvinyl difluoride membranes (Millipore, Bedford, MA). The membranes were blocked in Tris-buffered saline (TBS, pH 7.4) containing 5% nonfat milk for 1 h at room temperature and then incubated overnight with anti-TNFR1 antibodies at 48C. After being washed twice with TBS containing 0.1% Tween-20, the membranes were incubated with HRPconjugated goat anti-rabbit IgG at room temperature for 1 h. Antigen–antibody complex was visualized using an enhanced chemiluminescence detection kit (Zhongshan Biotechnology Co.).

Cell Viability Assessment Cell viability was assessed using 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide (MTT) assay kit (American Type Culture Collection, Manassas, VA) in accordance with the manufacturer’s instructions. Briefly, granulosa cells were cultured in 96-well microplates at a density of 2 3 104 cells/well. After treatment with poly (I:C) and TNFA neutralizing antibodies (code AnTNFA), the cells were incubated with 10 ll of MTT solution for 2 h. After medium was removed, 100 ll of detergent reagents was added to each well to lyse the cells. Absorbance at 570 nm was recorded using a microplate reader (BioTek, Winooski, VT).

ELISA Mouse blood was collected from tail veins. The ovaries were lysed by grinding in 13 PBS and centrifuged at 800 3 g for 5 min, and supernatants were collected. Levels of TNFA and estradiol in plasma and TNFA in the supernatants were measured using an ELISA kit in accordance with the manufacturer’s instructions. ELISA kit for detecting estradiol (product ES180S-100) was purchased from Beijing 4A Biotech Co., Ltd (Beijing, China), and that for TNFA (product no. BMS607/3) was purchased from eBioscience (San Diego, CA). Detection limits of the ELISA kits were 3 pg/ml for estradiol and 3.7 pg/ml for TNFA.

Follicle Count Ovarian follicle numbers were counted as previously described [33]. Briefly, ovaries were fixed in Bouin solution for 24 h. After being embedded in paraffin, serial sections at 5-lm thickness were stained with hematoxylin and eosin (H&E). Every 20th section starting with the first one containing a follicle was selected for follicle count and classification. Only follicles containing oocytes with nuclei were counted. Follicles were classified in accordance with previously described standards [34]. Primordial/primary, preantral, and antral follicles corresponded to those containing 1, 2 to 6, and .6 layers of granulosa cells, respectively. Follicles in bilateral ovaries of three mice were counted.

Flow Cytometry Flow cytometry analysis was performed using a FACSCanto flow cytometer (BD Biosciences, San Diego, CA) in accordance with the manufacturer’s instructions. Briefly, granulosa cells in 50 ll of PBS containing 3% bovine serum albumin were incubated with FITC-conjugated Annexin V on ice for 30 min.


Article 11


Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA) in accordance with the manufacturer’s instructions. RNA was treated with RNase-free DNase I (Invitrogen) to remove genomic DNA contamination. Absence of genomic DNA was confirmed by PCR amplification of Actb prior to reverse transcription. RNA (1 lg) was reverse transcribed into cDNA in 20 ll of reaction mixture containing 2.5 lM random hexamers, 2 mM deoxynucleoside triphosphates, and 200 U of Moloney murine leukemia virus reverse transcriptase (Promega, Madison, WI). PCR was performed using Power SYBR Green PCR Master Mix kit (Applied Biosystems, Foster City, CA) in a Prism 7300 real-time cycler (Applied Biosystems). Relative mRNA levels of target genes compared with those of controls were obtained by normalization to Actb mRNA by using the 2DDCt formula (user bulletin no. 2; part number 4303859; Applied Biosystems). Primer sequences are listed in Table 1.

TLR3 AND OVARIAN FUNCTION TABLE 1. Primers used for real-time PCR. Primer pairs (5 0 –3 0 ) Target genes Actb P450arom P450scc Hsd3b Tnfr1

Forward

Reverse

GAAATAGTGCGTGACATCAAAG CGGAGGAATGCACAGGCTCGAG AGGTCCTTCAATGAGATCCCTT TATTCTCGGTTGTACGGGCAA CCGGGAGAAGAGGGATAGCTT

TGTAGTTTCATGGATGCCACAG CGATGTACTTCCCAGCACAGC TCCCTGTAAATGGGGCCATAC GTGCTACCTGTCAGTGTGACC TCGGACAGTCACTCACCAAGT

(I:C) on plasma estradiol level in WT mice (Fig. 2D). AnTNFA alone insignificantly affected estradiol level. Results confirmed that poly (I:C) inhibits estradiol synthesis through TLR3mediated TNFA production.

Statistical Analysis All data are means 6 standard error of the mean (SEM). Statistical significance between individual comparisons was determined using Student ttest. ANOVA with a Bonferroni post hoc test was used for multiple comparisons. Calculations were performed with SPSS version 11.0 statistical software (SPSS Inc., Chicago, IL). P values ,0.05 indicated statistical significance.

Effect of Poly (I:C) on Follicle Development

Involvement of TLR3 and TNFA in Poly (I:C) Inhibition of Estradiol Synthesis We recently demonstrated that poly (I:C) inhibits estradiol synthesis in female mice [29]. Given that poly (I:C) induces TNFA production through TLR3 signaling, we investigated the potential roles of TLR3 and TNFA in poly (I:C) inhibition of estradiol synthesis by using Tlr3/ and Tnfa/ mice. We confirmed that intraperitoneal injection of poly (I:C) at a dose of 5 lg/g of body weight significantly reduced plasma estradiol levels in WT mice at 48 h after injection (Fig. 1A, left panel). By contrast, poly (I:C) did not significantly reduce the estradiol levels in Tlr3/ mice (Fig. 1A, middle panel) and Tnfa/ (Fig. 1A, right panel) mice. Accordingly, the expression of the major steroidogenic enzyme genes, including cytochrome P450 aromatase (P450arom), cytochrome P450 side chain cleavage (P450scc), and 3b-hydroxysteroid dehydrogenase (Hsd3b), were significantly downregulated at mRNA levels in the ovary of WT mice 12 h after poly (I:C) injection (Fig. 1B, left panel). Poly (I:C) did not affect steroidogenic enzyme expression in the ovary of Tlr3/ (middle panel) and Tnfa/ (right panel) mice. These results suggest that poly (I:C) inhibits steroidogenesis through TLR3-mediated TNFA production. The different time points were selected to examine plasma estradiol and enzyme mRNA according to the time-dependent responses to poly (I:C) injection [29]. TNFA Levels in Plasma and Ovary To confirm that TNFA was responsible for poly (I:C) inhibition of estradiol synthesis, we measured the TNFA levels in plasma and ovary. Poly (I:C) injection significantly increased the plasma TNFA level in a time-dependent manner in WT mice (Fig. 2A). The plasma TNFA level peaked at 8 h and sharply decreased at 24 h after poly (I:C) injection. Although poly (I:C) significantly increased plasma TNFA level in Tlr3/ mice at 8 h after injection (Fig. 2B), the TNFA level was approximately 5-fold lower (0.6 versus 3 ng/ml) than that in WT mice. Similarly, the TNFA level was significantly increased in the ovary of WT and Tlr3/ mice at 8 h after poly (I:C) injection (Fig. 2C). Ovarian TNFA level in Tlr3/ mice was significantly lower than that in WT mice after poly (I:C) injection. TNFA was undetectable in Tnfa/ mice. Notably, co-injection of TNFA-neutralizing antibodies (AnTNFA) and poly (I:C) significantly reversed the inhibitory effect of poly

FIG. 1. Effect of poly (I:C) on ovarian steroidogenesis. A) Plasma estradiol levels. Four-week-old WT, Tlr3/, and Tnfa/ female mice were intraperitoneally injected with poly (I:C) at a dose of 5 lg/g of body weight. Mice injected with an equal volume of PBS served as control (Ctrl). At 48 h after poly (I:C) injection, blood was collected from tail veins. Plasma estradiol levels were measured using ELISA. Each dot indicates estradiol level of individual mice. Data are means 6 SEM (n ¼ 10). B) Expression of steroidogenic enzymes. Mice were injected with poly (I:C) as described in the legend to A. Total RNAs were extracted from ovaries at 12 h after poly (I:C) injection. mRNA levels of P450 aromatase (P450arom), cytochrome P450 side chain cleavage (P450scc), and 3bhydroxysteroid dehydrogenase (Hsd3b) were determined using real-time qRT-PCR by normalization to those of Actb. Results are shown as relative mRNA levels of targeting genes in treated mice compared with those in control mice (set as 1.0). Data are means 6 SEM of three experiments (n ¼ 3 mice in each experiment). **P , 0.01.


Article 11


Considering that estradiol level is critical for ovarian follicle development, we examined the effect of poly (I:C) on follicle numbers. Four-wk-old female mice were injected with poly (I:C). After 1 wk, follicle numbers at different developmental stages were determined by histological analysis after H&E staining (Fig. 3A). Ovarian follicles were divided into three groups, namely, primordial/primary follicles containing 1 layer

RESULTS

YAN ET AL.

3B, pri) and preantral follicles (Fig. 3B, pre) were insignificantly changed after poly (I:C) injection. Poly (I:C) injection did not reduce the antral follicle ratios in Tlr3/ and Tnfa/ mice (Fig. 3C). Moreover, co-injection of poly (I:C) and AnTNFA did not significantly reduce antral follicle numbers. Notably, the atresia of the antral follicle, which was characterized by a degenerative oocyte (Fig. 3D, arrows) and sloughing off the granulosa cells (Fig. 3D, arrowheads) was frequently observed in the ovary of WT mice injected with poly (I:C) (Fig. 3D, left panel). The percentage of the atretic antral follicles in total antral follicles was significantly increased in the ovary of WT mice, but insignificantly changed in Tlr3/ and Tnfa/ mice (Fig. 3D, right panel). Granulosa Cell Apoptosis

Expression of TNFA Receptor 1 Given that TNFA induces cell apoptosis through TNFR1 [38], we analyzed TNFR1 expression in the ovaries. Real-time qRT-PCR results showed that poly (I:C) significantly upregulated Tnfr1 mRNA levels in the ovaries of WT mice at 48 h after injection (Fig. 5A). Western blot analysis confirmed that TNFR1 is constitutively expressed in the ovaries and evidently upregulated after poly (I:C) injection (Fig. 5B). Immunohistochemistry showed that TNFR1 is predominantly located in granulosa cells (black arrows) and theca cells (white arrows) in control mice (Fig. 5C, upper panel). By contrast, TNFR1 was undetected in stromal cells (black arrowheads). Notably, relatively high TNFR1 signal was observed in the granulosa cells of some antral follicles (asterisks) compared with preantral follicles after poly (I:C) injection (Fig. 5C, lower panel).

FIG. 2. Poly (I:C)-induced TNFA production. A) Plasma TNFA level. Four-week-old WT female mice were injected with poly (I:C) or PBS (Ctrl). Plasma TNFA levels were measured using ELISA at the indicated time points after poly (I:C) injection. B) Tlr3/ mice were treated, and plasma TNFA levels were determined using the same protocols described in the legend to A. C) TNFA levels in ovaries. Mice were treated as described in A. At 8 h after injection, ovaries were lysed, and TNFA levels in ovarian lysates were measured using ELISA. ND ¼ not detectable. D) Effect of antibodies against TNFA (AnTNFA) on poly (I:C)-inhibited estradiol synthesis. WT mice were injected with poly (I:C) or co-injected with poly (I:C) and AnTNFA (30 ng/g of body weight). Plasma estradiol levels were measured using ELISA at 48 h after injection. Data are means 6 SEM of six mice. *P , 0.05; **P , 0.01.

P450arom Expression and Granulosa Cell Apoptosis In Vitro To further confirm the involvement of TLR3-mediated TNFA production in the poly (I:C) effects on the ovaries, we examined P450arom expression and apoptosis in primary granulosa cells in vitro. Exogenous addition of 5 lg/ml poly (I:C) in culture medium inhibited P450arom expression in the granulosa cells of WT mice in a time-dependent manner (Fig. 6A). The lowest P450arom mRNA level was detected at 16 h after poly (I:C) stimulation. Notably, the poly (I:C) inhibition of P450arom expression was significantly reversed by the presence of AnTNFA. MTT assay showed that poly (I:C) and AnTNFA insignificantly affected cell survival at 16 h after treatment (Fig. 6B). Poly (I:C) did not significantly inhibit P450arom expression in Tnfa/ and Tlr3/ granulosa cells

of granulosa cells (arrows), preantral follicles containing 2 to 6 layers of granulosa cells (Fig. 3A, arrowheads), and antral follicles containing more than 6 layers of granulosa cells (Fig. 3A, asterisks). Poly (I:C) injection significantly reduced the percentage of antral follicles (Fig. 3B, an) in WT mice (Fig. 3B). By contrast, the percentages of primordial/primary (Fig. 4

Downloaded from https://academic.oup.com/biolreprod/article-abstract/93/1/11, 1-9/2434167 by U Colorado AMC Health Sciences Library user on 29 June 2018

Article 11


To understand the mechanisms underlying poly (I:C) inhibition of antral follicle development, we examined ovarian cell apoptosis. TUNEL staining results showed that poly (I:C) injected in 4-wk-old WT mice evidently increased the numbers of apoptotic granulosa cells (Fig. 4A, black arrows) at 48 h (Fig. 4A, right panels). By contrast, poly (I:C) did not induce apoptosis of stromal (Fig. 4A, black arrowheads) and theca (Fig. 4A, white arrows) cells. Notably, granulosa cell apoptosis predominantly occurred in the antral follicles (Fig. 4A, asterisks). The apoptotic cells-to-total granulosa cell ratios in the follicles with oocyte nuclei were significantly higher in WT mice after poly (I:C) injection than in control mice (Fig. 4B). By contrast, poly (I:C) did not significantly induce the apoptosis of ovarian granulosa cells in Tlr3/ and Tnfa/ mice. Moreover, AnTNFA also significantly inhibited the poly (I:C)-induced granulosa cell apoptosis in WT mice.

TLR3 AND OVARIAN FUNCTION

Downloaded from www.biolreprod.org. FIG. 3. Follicle count. A) H&E staining. Four-week-old female mice were injected with poly (I:C) or PBS (Ctrl). After 1 wk, ovaries were cut at 5-lm thicknesses. Paraffin sections of the ovaries were stained with H&E. Images are of WT mice. Bar ¼ 200 lm. Arrows, arrowheads, and asterisks indicate primordial/primary, preantral, and antral follicles, respectively. B) Percentage of follicles at different stages. WT mice were injected with PBS (Ctrl), poly (I:C), or poly (I:C) and AnTNFA. Primordial/primary (pri), preantral (pre), and antral follicle (an) numbers were counted serially every 20th section. C) Effect of poly (I:C) on antral follicle ratios. Indicated mice were injected with PBS (Ctrl), poly (I:C), or poly (I:C) and AnTNFA. After 1 wk, percentages of antral follicles were determined as described in legend to B. D) Atresia of antral follicles. Mice and ovaries were treated as described in legend to A. Images are of the ovary of WT mice after poly (I:C) injection (left panel). Arrow and arrowhead indicate degenerative oocyte and sloughing off granulosa cells, respectively. Percentages of the atretic antral follicles in total antral follicles were analyzed in WT, Tlr3/, and Tnfa/ mice (right panel). At least 20 antral follicles were counted for each ovary. Data are means 6 SEM of bilateral ovaries of three mice. *P , 0.05; **P , 0.01.

(data not shown). To confirm that TNFA inhibits P450arom expression, the granulosa cells were treated with recombinant mouse TNFA. TNFA inhibited P450arom expression in WT granulosa cells in a time-dependent manner (Fig. 6C), as well as in a dose-dependent manner (Fig. 6D). TNFA also significantly inhibited P450arom expression in Tlr3/ and Tnfa/ granulosa cells (Fig. 6E). Granulosa cell apoptosis was analyzed by flow cytometry. Poly (I:C) did not induce granulosa cell apoptosis in vitro at 48 h after treatment (Fig. 6F). However, TNFA significantly induced WT cell apoptosis in a dose-dependent manner (Fig. 6G). Although 0.5 ng/ml TNFA did not significantly induce granulosa cell apoptosis, 2

and 5 ng/ml TNFA significantly increased the ratios of apoptotic cells. Similarly, TNFA induced apoptosis of Tlr3/ and Tnfa/ granulosa cells in a dose-dependent manner (data not shown). Effects of TNFA on Ovarian Functions To directly prove the inhibitory effect of TNFA on estradiol synthesis in vivo, we intraperitoneally injected recombinant TNFA. The TNFA injection reduced plasma estradiol level of WT mice in a dose-dependent manner at 48 h (Fig. 7A). TNFA significantly reduced estradiol level at doses of 2 and 5 ng/g body weight. The time course of the TNFA effect showed that 5


Article 11

YAN ET AL.

FIG. 5. Expression of TNFA receptor 1 (TNFR1). A) Tnfr1 mRNA level. WT mice were injected with poly (I:C) or PBS (Ctrl). After 48 h, total RNA was extracted from the ovary. Relative mRNA levels were determined using real-time qRT-PCR by normalization to that of Actb. Data are means 6 SEM of three experiments. B) TNFR1 protein level. Mice were treated as described in the legend to A. TNFR1 protein was determined by Western blot analysis using specific antibodies. C) Distribution of TNFR1 in the ovaries. Immunohistochemistry was performed in paraffin sections, using antibodies specifically against TNFR1. Black arrows, black arrowheads, and white arrows indicate granulosa, stromal, and thecal cells, respectively. Insets (upper right corners) represent negative controls in which pre-immune rabbit sera were used as primary antibodies. Images are from at least three experiments. Bar ¼ 20 lm.

the plasma estradiol levels were significantly reduced at 24, 48, and 72 h after TNFA injection at a dose of 2 ng/g body weight (Fig. 7B). The lowest level of estradiol was observed at 48 h after TNFA injection. Notably, TNFA also significantly reduced plasma estradiol levels in Tlr3/ and Tnfa/ mice similarly with the observations in WT mice (data not shown).

Various doses of poly (I:C) from 2 to 20 lg/g of body weight were used, as in previous studies [35, 36]. We found that 5 lg/g of body weight poly (I:C) significantly inhibited ovarian functions. This dose has no relevance to physiological exposure to viral infection because viral doses in natural infections can be different depending on virus types. poly (I:C) only activate viral RNA sensors and induce innate antiviral responses [41], whereas intact virus particles can replicate in hosts and activate multiple PRRs because some viral proteins may also activate other PRRs beyond RNA sensors. Therefore, as a synthetic viral dsRNA, poly (I:C) treatment cannot represent natural viral infection and disease model. The establishment of virus infectious models in the mouse ovary using specific virus types is an interesting issue that is worthy of investigation. We demonstrated that poly (I:C) injection impaired ovarian functions in WT mice and that these effects were significantly diminished in Tlr3/ mice. These results suggest that TLR3 plays a critical role in poly (I:C)-induced

DISCUSSION Microbial infections are associated with ovarian dysfunction [39, 40]. Mechanisms by which viral infections impair ovarian functions are not fully understood. We recently demonstrated that poly (I:C) initiates innate antiviral responses in ovarian granulosa cells and inhibits steroidogenesis [28, 29]. In the present study, we further investigated the effects of poly (I:C) on ovarian functions and the underlying mechanisms. Intraperitoneal injection of poly (I:C) significantly reduced the estradiol level and antral follicle numbers and induced granulosa cell apoptosis in antral follicles. TLR3-mediated TNFA production contributes to poly (I:C)-induced ovarian dysfunction. 6


Article 11


FIG. 4. Apoptosis of granulosa cells. A) TUNEL staining. Four-week-old female mice were injected with poly (I:C) or PBS (Ctrl). At 48 h after injection, paraffin sections were stained with TUNEL. Images are ovarian sections of WT mice. Black arrows indicate apoptotic granulosa cells. Bars ¼ 50 lm. Black arrowheads and white arrows indicate stromal and thecal cells, respectively. *Follicles with apoptotic granulosa cells. B) Quantitative analysis of apoptotic granulosa cells. Indicated mice were injected with PBS (Ctrl), poly (I:C), or poly (I:C) and AnTNFA. Percentages of apoptotic cells to total granulosa cells on antral follicles with oocyte nuclei were calculated. Thirty follicles were analyzed in three mice. At least three sections were counted for each follicle. Data are mean 6 SEM of bilateral ovaries of three mice. **P , 0.01.


Downloaded from www.biolreprod.org. FIG. 6. P450arom expression and granulosa cell apoptosis in vitro. A) Poly (I:C) inhibition of P450arom expression. WT granulosa cells were seeded in 6-well plates at a density of 2 3 105 cells/well. After 24 h, 5 lg/ml poly (I:C) alone or poly (I:C) with AnTNFA were exogenously added to the cell culture. At indicated time points after treatment, total RNA was extracted, and relative mRNA levels of P450arom were determined using real-time qRT-PCR. B) Cell viability. Granulosa cells were treated as described in the legend to A. Cell viability was assessed using MTT assay. C and D) Inhibition of P450arom by TNFA. Cells were seeded as described in legend to A. After 24 h, recombinant mouse TNFA was added to medium at indicated doses. Effect of TNFA on P450arom expression in a time-dependent (C) and dose-dependent (D) manner was examined by determining relative mRNA levels, using real-time qRTPCR. E) TNFA inhibition of P450arom expression in Tlr3/ and Tnfa/ granulosa cells. Cells were seeded as described in the legend to A. After 24 h, 1 ng/ ml TNFA was added to the medium. At 8 h after presence of TNFA, relative mRNA levels of P450arom were determined using real-time qRT-PCR. F) Cell apoptosis. WT granulosa cells were seeded in 30-mm dishes at a density of 5 3 105 cells/dish. After 24 h, 5 lg/ml poly (I:C) was added to the medium. At 48 h after presence of poly (I:C), cells were collected and labeled with FITC-conjugated Annexin V. Apoptotic cells were determined using flow cytometry. G) TNFA-induced cell apoptosis. WT granulosa cells were treated with different doses of TNFA. After 48 h, cell apoptosis was analyzed using flow cytometry. Data are means 6 SEM from three independent experiments. *P , 0.05; **P , 0.01.


Article 11

YAN ET AL.

FIG. 7. Effect of TNFA on estradiol synthesis. A) A dose response of TNFA on estradiol synthesis. Four-week-old WT female mice were intraperitoneally injected with recombinant mouse TNFA at the indicated doses. At 48 h after TNFA injection, blood was collected, and the plasma estradiol level was measured using ELISA. B) A time response of TNFA on estradiol synthesis. Mice were injected with 2 ng/g of body weight of TNFA. Plasma estradiol levels were measured at the indicated time points. Data are means 6 SEM from five mice. *P , 0.05, **P , 0.01.

ovarian dysfunction. Although MDA5 and RIG-I can be activated by poly (I:C), these receptors are cytosolic RNA sensors. Therefore, the cellular internalization of poly (I:C) is required to activate MDA5 and RIG-1 [42]. Intraperitoneal injection of poly (I:C) would not activate MDA5 and RIG-I. By contrast, TLR3 belongs to the transmembrane protein that localizes on the cell surface and endosomes in various cell types, and the extracellular presence of poly (I:C) can trigger TLR3 signaling [43, 44]. The mechanism that TLR3 traffic to cell surface upon stimulation was recently revealed [45]. We recently demonstrated that exogenously added poly (I:C) triggered TLR3 signaling but did not activate MDA5 or RIGI in primary ovarian granulosa cells [28]. Notably, TLR3 deficiency did not completely block poly (I:C)-induced TNFA production, suggesting that poly (I:C) also induced TNFA production in a TLR3-independent manner, which remains clarification. Four-week-old female mice were used to examine follicle development, because the antral follicles are formed mainly from 4 wk to 5 wk after birth [46]. Ovarian follicle development is a highly organized process from primordial to mature follicles. In this study, poly (I:C) injection significantly reduced the antral follicle numbers. By contrast, the numbers of early stage follicles were insignificantly affected by poly (I:C) injection. Consistent with this observation, poly (I:C) predominantly induced granulosa cell apoptosis in the antral follicles. Poly (I:C) injection also significantly reduced the estradiol levels in the plasma and ovaries. Notably, the effects of poly (I:C) on ovarian functions were diminished in Tlr3/ and Tnfa/ mice. Poly (I:C) injection remarkably induced TNFA production in WT mice, but the TNFA level was much lower in Tlr3/ mice than in WT mice after poly (I:C) injection. In particular, AnTNFA significantly reversed the poly (I:C) effects on estradiol synthesis, follicle development, and granulosa cell apoptosis in WT mice. These results suggested that TLR3-mediated TNFA production is responsible for poly (I:C)-caused ovarian dysfunction. Furthermore, we confirmed that peritoneal injection of recombinant TNFA at a dose of 2 ng/g of body weight significantly reduced plasma estradiol level. This dose is lower than plasma TNFA level in WT mice 8 h after poly (I:C) injection (Fig. 2A) but has no physiological relevance to real viral infection. Notably, 4-wk-old mice are prepubertal, and ovarian function is different from that in adult mice. Although circulating FSH level is important for the ovarian function, we did not inject FSH in conjunction with poly (I:C) into mice. Therefore, whether poly (I:C) impacts FSH secretion and thus perturbs ovarian function remains 8


Article 11


unknown. However, in vitro study results support the fact that poly (I:C) inhibits ovarian functions without FSH involvement. Increased TNFA level in the plasma can result from multiple tissues in response to poly (I:C) challenge because intraperitoneal injection of poly (I:C) may stimulate different tissues. The ovary can locally produce TNFA after poly (I:C) injection [29]. Thus, circulating and locally produced TNFA will affect ovarian functions. TNFA functions through TNFR1 and TNFR2 by activation of distinct signaling pathways. TNFR1 signaling induces cell apoptosis [38], whereas TNFR2 signaling facilitates cell survival [47]. Notably, TNFR1 is constitutively expressed in the ovary and significantly upregulated after poly (I:C) injection. Increased TNFR1 was observed predominantly in the granulosa cells of antral follicles. This result corresponds to the observation that poly (I:C) predominantly induces granulosa cell apoptosis in the antral follicles. Mechanisms underlying the poly (I:C)-induced TNFR1 upregulation in the granulosa cells of antral follicles are interesting and worthy of investigation. The follicles containing apoptotic granulosa cells would go to atresia because preantral follicles were insignificantly affected and more atretic antral follicles were observed after poly (I:C) injection. Follicle development is regulated by various circulating and locally synthesized hormones. Estradiol plays a critical role in regulating follicle development. Estradiol is synthesized by ovarian granulosa cells through aromatization of androgens secreted by theca cells [48]. Multiple steroidogenic enzymes are required for steroid hormone synthesis. P450arom is a critical enzyme for estradiol synthesis. Androgens are synthesized by theca cells using several enzymes, including P450scc and 3b-HSD. In the current study, poly (I:C) injection inhibited the expression of P450arom, P450scc, and Hsd3b through TNFA production. The downregulation of steroidogenic enzymes will not attribute to cell apoptosis because apoptosis was undetected in the theca cells. In vitro studies confirmed that poly (I:C) inhibits P450arom expression in primary granulosa cells through TLR3-mediated TNFA production. By contrast, poly (I:C) did not induce apoptosis of primary granulosa cells in vitro. These results also suggest that poly (I:C) inhibition of P450arom expression will not attribute to granulosa cell apoptosis. The mechanism by which TNFA suppresses steroidogenic enzyme expression in Leydig cells has been revealed [49]. We demonstrated that recombinant TNFA inhibits p450arom expression and induces granulosa cell apoptosis in a dose-dependent manner. Notably, 0.5 ng/ml TNFA significantly inhibited p450arom expression but did not induce cell apoptosis. By contrast, 2 and 5 ng/ml TNFA significantly induced apoptosis of granulosa cells. Poly (I:C) induced TNFA production at much higher level in vivo than in vitro (data not shown). The different TNFA levels can explain the observation that poly (I:C) induces granulosa cell apoptosis in vivo but not in vitro. However, reduced estradiol level may contribute to granulosa cell apoptosis because estradiol inhibits granulosa cell apoptosis [50]. Consequently, granulosa cell apoptosis should reduce estradiol synthesis. The interplay among TNFA, estradiol level, and granulosa cell apoptosis in poly (I:C)-induced ovarian dysfunction merits further investigation. In summary, the present study demonstrated that intraperitoneal injection of poly (I:C) in female mice perturbs ovarian functions through TLR3-mediated TNFA production. Considering that poly (I:C) can trigger innate antiviral responses, mimicking viral infections, the present results provide novel insights into the mechanisms underlying ovarian dysfunction caused by viral infection.


REFERENCES 1. Zhao Y, Adams YF, Croft M. Preferential replication of vaccinia virus in the ovaries is independent of immune regulation through IL-10 and TGFbeta. Viral Immunol 2011; 24:387–396. 2. Karupiah G, Coupar B, Ramshaw I, Boyle D, Blanden R, Andrew M. Vaccinia virus-mediated damage of murine ovaries and protection by virus-expressed interleukin-2. Immunol Cell Biol 1990; 68(pt 5):325–333. 3. Morrison JC, Givens JR, Wiser WL, Fish SA. Mumps oophoritis: a cause of premature menopause. Fertil Steril 1975; 26:655–659. 4. Cejtin HE, Kalinowski A, Bacchetti P, Taylor RN, Watts DH, Kim S, Massad LS, Preston-Martin S, Anastos K, Moxley M, Minkoff HL. Effects of human immunodeficiency virus on protracted amenorrhea and ovarian dysfunction. Obstet Gynecol 2006; 108:1423–1431. 5. Ohl J, Partisani M, Demangeat C, Binder-Foucard F, Nisand I, Lang JM. Alterations of ovarian reserve tests in human immunodeficiency virus (HIV)-infected women [in French]. Gynecol Obstet Fertil 2010; 38: 313–317. 6. Picton HM, Harris SE, Muruvi W, Chambers EL. The in vitro growth and maturation of follicles. Reproduction 2008; 136:703–715. 7. Berisha B, Pfaffl MW, Schams D. Expression of estrogen and progesterone receptors in the bovine ovary during estrous cycle and pregnancy. Endocrine 2002; 17:207–214. 8. Miller WL. Steroidogenic enzymes. Endocr Dev 2008; 13:1–18. 9. Herath S, Williams EJ, Lilly ST, Gilbert RO, Dobson H, Bryant CE, Sheldon IM. Ovarian follicular cells have innate immune capabilities that modulate their endocrine function. Reproduction 2007; 134:683–693. 10. Sheldon IM, Noakes DE, Rycroft AN, Pfeiffer DU, Dobson H. Influence of uterine bacterial contamination after parturition on ovarian dominant follicle selection and follicle growth and function in cattle. Reproduction 2002; 123:837–845. 11. Pandey S, Kawai T, Akira S. Microbial sensing by Toll-like receptors and intracellular nucleic acid sensors. Cold Spring Harb Perspect Biol 2014; 7: a016246. 12. Moresco EM, LaVine D, Beutler B. Toll-like receptors. Curr Biol 2011; 21:R488–R493. 13. Loo YM, Gale M Jr. Immune signaling by RIG-I-like receptors. Immunity 2011; 34:680–692. 14. Barbalat R, Ewald SE, Mouchess ML, Barton GM. Nucleic acid recognition by the innate immune system. Annu Rev Immunol 2011; 29:185–214. 15. Orzalli MH, Knipe DM. Cellular sensing of viral DNA and viral evasion mechanisms. Annu Rev Microbiol 2014; 68:477–492. 16. Thompson MR, Kaminski JJ, Kurt-Jones EA, Fitzgerald KA. Pattern recognition receptors and the innate immune response to viral infection. Viruses 2011; 3:920–940. 17. Marshak-Rothstein A. Toll-like receptors in systemic autoimmune disease. Nat Rev Immunol 2006; 6:823–835. 18. Sheldon IM, Bromfield JJ. Innate immunity in the human endometrium and ovary. Am J Reprod Immunol 2011; 66(suppl 1):63–71. 19. Zhou M, McFarland-Mancini MM, Funk HM, Husseinzadeh N, Mounajjed T, Drew AF. Toll-like receptor expression in normal ovary and ovarian tumors. Cancer Immunol Immunother 2009; 58:1375–1385. 20. Price JC, Cronin J, Sheldon IM. Toll-like receptor expression and function in the COV434 granulosa cell line. Am J Reprod Immunol 2012; 68: 205–217. 21. Shimada M, Hernandez-Gonzalez I, Gonzalez-Robanya I, Richards JS. Induced expression of pattern recognition receptors in cumulus oocyte complexes: novel evidence for innate immune-like functions during ovulation. Mol Endocrinol 2006; 20:3228–3239. 22. Shimada M, Yanai Y, Okazaki T, Noma N, Kawashima I, Mori T, Richards JS. Hyaluronan fragments generated by sperm-secreted hyaluronidase stimulate cytokine/chemokine production via the TLR2 and TLR4 pathway in cumulus cells of ovulated COCs, which may enhance fertilization. Development 2008; 135:2001–2011. 23. Liu Z, Shimada M, Richards JS. The involvement of the Toll-like receptor family in ovulation. J Assist Reprod Genet 2008; 25:223–228. 24. Bromfield JJ, Sheldon IM. Lipopolysaccharide initiates inflammation in bovine granulosa cells via the TLR4 pathway and perturbs oocyte meiotic progression in vitro. Endocrinology 2011; 152:5029–5040. 25. Woods DC, Schorey JS, Johnson AL. Toll-like receptor signaling in hen ovarian granulosa cells is dependent on stage of follicle maturation. Reproduction 2009; 137:987–996.


Article 11


26. Price JC, Bromfield JJ, Sheldon IM. Pathogen-associated molecular patterns initiate inflammation and perturb the endocrine function of bovine granulosa cells from ovarian dominant follicles via TLR2 and TLR4 pathways. Endocrinology 2013; 154:3377–3386. 27. Bromfield JJ, Sheldon IM. Lipopolysaccharide reduces the primordial follicle pool in the bovine ovarian cortex ex vivo and in the murine ovary in vivo. Biol Reprod 2013; 88:98. 28. Yan K, Zhu W, Yu L, Li N, Zhang X, Liu P, Chen Q, Chen Y, Han D. Toll-like receptor 3 and RIG-I-like receptor activation induces innate antiviral responses in mouse ovarian granulosa cells. Mol Cell Endocrinol 2013; 372:73–85. 29. Yan K, Liu P, Liu Z, Zhao S, Cheng L, Han D. Polyinosinic-polycytidylic acid initiates ovarian innate antiviral response and inhibits steroidogenesis in female mice. Biol Reprod 2014; 90:11. 30. Vanderhyden BC, Telfer EE, Eppig JJ. Mouse oocytes promote proliferation of granulosa cells from preantral and antral follicles in vitro. Biol Reprod 1992; 46:1196–1204. 31. Camp TA, Rahal JO, Mayo KE. Cellular localization and hormonal regulation of follicle-stimulating hormone and luteinizing hormone receptor messenger RNAs in the rat ovary. Mol Endocrinol 1991; 5: 1405–1417. 32. Hume DA, Perry VH, Gordon S. The mononuclear phagocyte system of the mouse defined by immunohistochemical localisation of antigen F4/80: macrophages associated with epithelia. Anat Rec 1984; 210:503–512. 33. Shirota M, Soda S, Katoh C, Asai S, Sato M, Ohta R, Watanabe G, Taya K, Shirota K. Effects of reduction of the number of primordial follicles on follicular development to achieve puberty in female rats. Reproduction 2003; 125:85–94. 34. Pedersen T, Peters H. Proposal for a classification of oocytes and follicles in the mouse ovary. J Reprod Fertil 1968; 17:555–557. 35. Onore CE, Schwartzer JJ, Careaga M, Berman RF, Ashwood P. Maternal immune activation leads to activated inflammatory macrophages in offspring. Brain Behav Immun 2014; 38:220–226. 36. Chen L, Zhai H, Lu L, Chen S, Ning Y, Wang W. Effects of polyinosinicpolycytidylic acid (poly I:C) on naloxone-precipitated withdrawal in morphine-dependent mice. Neurosci Lett 2011; 487:341–344. 37. Wang H, Chen Y, Ge Y, Ma P, Ma Q, Ma J, Xue S, Han D. Immunoexpression of Tyro 3 family receptors–Tyro 3, Axl, and Mer–and their ligand Gas6 in postnatal developing mouse testis. J Histochem Cytochem 2005; 53:1355–1364. 38. Chen G, Goeddel DV. TNF-R1 signaling: a beautiful pathway. Science 2002; 296:1634–1635. 39. Karsch FJ, Battaglia DF, Breen KM, Debus N, Harris TG. Mechanisms for ovarian cycle disruption by immune/inflammatory stress. Stress 2002; 5: 101–112. 40. Jin M, Yu Y, Huang H. An update on primary ovarian insufficiency. Sci China Life Sci 2012; 55:677–686. 41. Yoneyama M, Fujita T. Recognition of viral nucleic acids in innate immunity. Rev Med Virol 2010; 20:4–22. 42. Yoneyama M, Fujita T. Function of RIG-I-like receptors in antiviral innate immunity. J Biol Chem 2007; 282:15315–15318. 43. Matsumoto M, Oshiumi H, Seya T. Antiviral responses induced by the TLR3 pathway. Rev Med Virol 2011; 21:67–77. 44. Matsumoto M, Kikkawa S, Kohase M, Miyake K, Seya T. Establishment of a monoclonal antibody against human Toll-like receptor 3 that blocks double-stranded RNA-mediated signaling. Biochem Biophys Res Commun 2002; 293:1364–1369. 45. Pohar J, Pirher N, Bencina M, Mancek-Keber M, Jerala R. The role of UNC93B1 protein in surface localization of TLR3 receptor and in cell priming to nucleic acid agonists. J Biol Chem 2013; 288:442–454. 46. Peters H. The development of the mouse ovary from birth to maturity. Acta Endocrinol (Copenh) 1969; 62:98–116. 47. Faustman D, Davis M. TNF receptor 2 pathway: drug target for autoimmune diseases. Nat Rev Drug Discov 2010; 9:482–493. 48. Wood JR, Strauss Iii JF. Multiple signal transduction pathways regulate ovarian steroidogenesis. Rev Endocr Metab Disord 2002; 3:33–46. 49. Hong CY, Park JH, Ahn RS, Im SY, Choi HS, Soh J, Mellon SH, Lee K. Molecular mechanism of suppression of testicular steroidogenesis by proinflammatory cytokine tumor necrosis factor alpha. Mol Cell Biol 2004; 24:2593–2604. 50. Billig H, Furuta I, Hsueh AJ. Estrogens inhibit and androgens enhance ovarian granulosa cell apoptosis. Endocrinology 1993; 133:2204–2212.

PolyinosinicâPolycytidylic Acid Perturbs Ovarian ...

PolyinosinicâPolycytidylic Acid Perturbs Ovarian ...

PolyinosinicâPolycytidylic Acid Perturbs Ovarian ...

PolyinosinicâPolycytidylic Acid Perturbs Ovarian ...