Initiation of cell-free simian virus 40 (SV40) DNA replication requires the ... associate with SV40 large T antigen directly under physiological conditions.
Vol. 13, No. 2
MOLECULAR AND CELLULAR BIOLOGY, Feb. 1993, p. 809-820 0270-7306/93/020809-12$02.00/0 Copyright C 1993, American Society for Microbiology
Initiation of Simian Virus 40 DNA Replication Requires the Interaction of a Specific Domain of Human DNA Polymerase ot with Large T Antigen IRENA DORNREITER, WILLIAM C. COPELAND, AND TERESA S.-F. WANG* Laboratory of Expenmental Oncology, Department of Pathology, Stanford University School of Medicine, Stanford, California 94305-5324 Received 27 August 1992/Returned for modification 12 October 1992/Accepted 16 November 1992
Initiation of cell-free simian virus 40 (SV40) DNA replication requires the interaction of DNA polymerase co/primase with a preinitiation complex containing the viral T antigen and cellular proteins, replication protein A, and topoisomerase I or IL To further understand the molecular mechanisms of the transition from preinitiation to initiation, the intermolecular interaction between human DNA polymerase a and T antigen was investigated. We have demonstrated that the human DNA polymerase a catalytic polypeptide is able to associate with SV40 large T antigen directly under physiological conditions. A physical association between these two proteins was detected by coimmunoprecipitation with monoclonal antibodies from insect cells coinfected with recombinant baculoviruses. A domain of human polymerase at physically interacting with T antigen was identified within the amino-terminal region from residues 195 to 313. This domain of human polymerase a was able to form a nonproductive complex with T antigen, causing inhibition of the SV40 DNA replication in vitro. Kinetics of the inhibition indicated that this polymerase domain can inhibit viral replication only during the preinitiation stage. Extra molecules of T antigen could partially overcome the inhibition only prior to initiation complex formation. The data support the conclusion that initiation of SV40 DNA replication requires the physical interaction of T antigen in the preinitiation complex with the amino-terminal domain of human polymerase a from amino acid residues 195 to 313.
alprimase with the preinitiation complex in the immediate vicinity of the origin of replication (41, 42). On the basis of a study using primed M13 phage DNA as the primer template, a model was suggested whereby initiation of DNA synthesis is mediated by a complex between T antigen and polymerase o/primase. T antigen tethers the polymerase ot/primase to the origin at the template (6). Primase synthesizes the ribonucleotide primers, and polymerase ao elongates the primers to synthesize the nascent DNA (40-42). Interaction between T antigen and the polymerase ot catalytic polypeptide has been suggested in previous studies (15, 32). A direct physical interaction between T antigen and the polymerase a catalytic polypeptide with species preference was demonstrated. The amino-terminal 83 amino acids of T antigen were shown to be both necessary and sufficient for interacting with the catalytic polypeptide of polymerase (12). Most recently, an in vitro physical interaction among T antigen, polymerase a/primase, and RP-A was described (11). The report demonstrated that the DNA-binding subunit of RP-A (p7O) interacts with primase as well as polymerase a/primase. T antigen does not interact with any individual RP-A subunit or with the isolated primase (11). In this report, we have identified a domain on human polymerase a that is required for the interaction with T antigen and demonstrated that initiation of SV40 replication requires the interaction of T antigen in the preinitiation complex with this specific polymerase at domain.
The papovavirus simian virus 40 (SV40) has been proven
merase
to be an exceptionally useful model with which to study the
mechanisms of mammalian DNA replication (5, 23, 27, 34). The SV40 genome contains a single well-defined origin for DNA replication. In permissive host cells, the viral genome replicates bidirectionally and the newly replicated DNA complexes with histones, forming minichromosomes similar to cellular chromatin (9). Replication is dependent on cellular replication proteins with the exception of a single SV40encoded protein, T antigen. The development of a cell-free SV40 DNA replication system has provided an effective functional approach to identifying and characterizing the cellular proteins required for the bidirectional replication of SV40 origin-containing duplex circular DNA (ori-DNA) (27). Several laboratories have identified and characterized seven cellular proteins which in combination with T antigen are sufficient to reconstitute SV40 replication in vitro (5, 23, 24, 34). For initiation of SV40 replication, the first step is the recognition and binding of T antigen to the virus core origin. In the presence of ATP, T antigen forms a double-hexamer nucleoprotein complex and either concomitantly or subsequently induces structural changes in the origin region (2). Along with a multisubunit single-stranded DNA-binding cellular protein, replication protein A (RP-A), and topoisomerase I or II, T antigen further unwinds the origin in a bidirectional manner. This protein complex at the origin of replication is termed the presynthesis or preinitiation complex (5, 8, 14, 23, 34, 44). The preinitiation phase has a characteristic 10- to 15-min time lag before initiation (36, 39, 43, 45). Biochemical evidence suggests that initiation of DNA synthesis occurs by a physical interaction of poly-
*
a
MATERIALS AND METHODS
Preparation of SV40 T antigen, recombinant single-subunit human DNA polymerase a, and the four-subunit human polymerase cx/primase complex. T antigen was produced from Sf9 insect cells infected with recombinant baculovirus 941T,
Corresponding author. 809
810
DORNREITER ET AL.
provided by R. Lanford (Southwest Foundation for Biomedical Research, San Antonio, Tex.) (26), and harvested 40 h postinfection. SV40 large T antigen was immunoaffinity purified from 941T-infected cell lysates by T-antigen-specific monoclonal antibody PablOl (18) covalently linked to Sepharose 4B (Pharmacia) and was quantified spectrophotometrically (1.0 A280 as 1 mg/ml) (12, 20). Single-subunit human DNA polymerase a produced from recombinant baculovirus AcHDPa-infected insect cells (7) was immunopurified in a single step from a monoclonal antibody SJK237-71 (37)-linked Sepharose 4B column by alkaline elution (0.1 M K3PO4 [pH 12.0], 10% glycerol). The foursubunit polymerase a/primase complex was immunopurified from SJK237-71-protein A-Sepharose as described previously (7). Antibodies and immunoprecipitation. Hybridomas SJK 237-71 and SJK132-20, specific against polymerase ot/primase complex (37), and PablOl, Pab4l6, and Pab419, against SV40 large T antigen (18, 19), were cultured in Dulbecco's modified Eagle's medium with 10% fetal calf serum (Gemini). All cells were grown at 37°C in a humidified 10% C02-containing atmosphere. Immunoglobulin G (IgG) antibodies were purified by ammonium sulfate precipitation and adsorbed on protein A-agarose (Sigma) in a binding buffer containing 1.5 M glycine (pH 9.0) and 3 M NaCl and were eluted with 0.1 M citric acid (pH 3.0). Polyclonal antibody IDal, against DNA polymerase a, was produced from chickens by using recombinant single-subunit human polymerase a as the antigen. IgY antibodies were purified from egg yolk by polyethylene glycol precipitation (16). Immunoprecipitation by either monoclonal antibody SJK132-20 or PablOl was performed as previously described (29), with modifications described in the figure legends. Rabbit polyclonal antiserum DPN, against the human polymerase a catalytic subunit amino-terminal peptide, was previously described
(21). ELISA and protein affinity blotting. Enzyme-linked immunosorbent assay (ELISA) and protein affinity blotting were performed as previously described (12). Construction of recombinant pGEX-2T plasmids. On the basis of the predicted secondary structure of human DNA polymerase ao (47), overlapping portions of the human DNA polymerase ao protein were constructed as glutathione S-transferase (GST) fusions and expressed in Escherichia coli. Overlapping DNA fragments of the human DNA polymerase a were amplified by the polymerase chain reaction (PCR) and subcloned into plasmid pGEX-2T for expression in E. coli as GST fusion proteins (33). Each 5' oligonucleotide for the PCR was designed to include a BamHI or BglII site for insertion into the BamHI site of plasmid pGEX-2T, and each 3' oligonucleotide for the PCR included an EcoRI site for insertion into the EcoRI site of pGEX-2T. The template for the PCR was plasmid pT7/HDPa, containing the full-length cDNA for the catalytic polypeptide of human DNA polymerase at as described previously (7). The PCR to generate the la insert was amplified by using 5'-TATAT GGATCCACCATGGCACCTGTGCACGGC-3' as the upstream primer and 5'-TATATGAATTCACTGAGAAACT GCTATCACC-3' as the downstream primer. The 2aL PCR was amplified by using 5'-TATATGGATCCACCATGGTA GGAAGTTTTCTCCCGGATG-3' as the upstream primer and 5'-TATATGAATTCTATCTTGGACCAGTGAGGAG C-3' as the downstream primer. The 3a PCR was amplified by using 5'-TATATGGATCCACCATGGAACTGGAAGTA CTACTGCAG-3' as the upstream primer and 5'-TATATG AATTCAGlTTTCCGGATCTCTCTGGG-3' as the down-
MOL. CELL. BIOL. A
Coomassie stain Lysate T
T/l
Western anti-Pol e; anti-Tag
anti-pol immunoppt a;
T
T/m
eL
kDa kDa
200 -
immnunoppt
imnmunoppt
Detect vith anti-Tag a T/m T
Detect vith s anti-Pol XL T/n I
200 -
11697-
11697-
68-
68-.4-
-w -
434329-
29-
1
2
3
4
5
6
.0q. os. 1 2 3 4 5 6 FIG. 1. Coimmunoprecipitation of SV40 large T antigen and human DNA polymerase a from recombinant baculovirus-infected insect cells. Sf9 insect cells infected with recombinant baculovirus 941T or AcHDPa or coinfected with both viruses were harvested at 40 h postinfection, and cells were lysed as described previously (7). One-half milligram of each lysate was precleared by passage through a Sepharose 4B column and then incubated with either 40 pJl of 1-mg/ml SJK132-20 or PablOl covalently linked onto Sepharose 4B for 1 h at 4°C. Thie Sepharose beads were washed five times with 1 ml of buffer containing 200 mM NaCl, 50 mM KPO4 (pH 7.5), 0.03% SDS, 0.15% sodium deoxycholate, 0.3% Triton X-100, and 3% glycerol. The washed immunobeads were boiled in SDS-gel sample buffer and loaded directly onto an SDS-8% polyacrylamide gel. After electrophoresis, proteins were detected either by Coomassie blue staining or by Western immunoblotting as described in Materials and Methods. (A) Lanes: 1 to 3, 100 ,ug of lysates from 941T-infected cells, 941T- and AcHDPa-coinfected cells, and AcHDPa-infected cells, respectively; 4 to 6, 40 ,ul of immunoprecipitates with SJK132-20 from the respective lysates in lanes 1 to 3. (B) Immunoblots. Lanes 1 to 3 show the immunoblot of SJK132-20 immunoprecipitates probed with PablOl. The SJK132-20 immunoprecipitates were from lysates of insect cells infected with 941T (lane 1), coinfected with 941T and AcHDPa (lane 2), and infected with AcHDPa (lane 3). Lanes 4 to 6 are an immunoblot of PablOl immunoprecipitates probed by the amino-terminal peptide polyclonal antiserum DPN (21). The PablOl immunoprecipitates were from 941T-infected insect cells (lane 4), AcHDPa- and 941T-coinfected insect cells (lane 5), and AcHDPa-infected cells (lane 6). The closed arrow designates the 180-kDa polymerase a catalytic polypeptide, and the open arrow designates the 90-kDa T-antigen (Tag) protein.
stream primer. The 4a PCR was amplified by using 5'-TATA TAGATCTACCATGGAACAGATCCCTGAGTTGCCA GAT-3' as the upstream primer -and 5'-ATATAGAATTCA GAGGGCAACATGTACATGAGG-3' as the downstream primer. The 5a PCR was amplified by using 5'-TATATA GATCTACCATGGCATTGACAAAGGATCCCCAG-3' as the upstream primer and 5'-TATAGAATTCllTlITIlCAAC TACCCCCTCC-3' as the downstream primer. Following 30 cycles, the DNA was digested with BamHI or BglII and EcoRI and inserted into BamHI-EcoRI-digested plasmid pGEX-2T. To further delineate the la fragment, again on the basis of the predicted secondary structure of lao, smaller overlapping subfragments of the polymerase at fusion protein were generated by PCR. The PCR to generate the a(1-116) fragment
T-ANTIGEN-BINDING DOMAIN OF HUMAN POLYMERASE a
VOL. 13, 1993
811
A s
P
N
PS
N I
B P
H
i,
p
1- I
0
3L 313A.&.
a,
Sf3
6.0
275&a
15 of*
zt
B
1
.2 3q 5 6
325&-&
14
40L
364&.&.
2N
1137
js
C 1
2 3 4 5 6
264&.&
D
II"5N
1
2 3
4
5
6 7
8
r_ _ .
MW6
-
aUonRlL. _m_
_
Webb
FIG. 2. Interaction of SV40 T antigen with GST-human polymerase a fusion proteins. (A) GST-human DNA polymerase a fusion proteins. Shown are the five overlapping human DNA polymerase a peptides. Each was constructed with GST fused at the N terminus. N, NcoI; P, PstI; S, SalI; H, HindIII; B, BamHI. (B) Expression of GST fusion proteins. Whole cell lysates of bacterial clones expressing the pGEX-2T-encoded glutathione leader sequence fused with la (lane 1), with 2a (lane 2), with 3a (lane 3), with 4a (lane 4), or with 5a (lane 5) and the pGEX-2T leader sequence only (lane 6) were prepared as described in Materials and Methods. (C) Purified fusion proteins. For each clone represented in panel B, lanes 1 to 6, bacterial lysates were prepared and incubated with glutathione-agarose (lanes 1 to 6, respectively). The glutathione-agarose was then washed, and bound proteins were eluted by incubating the beads with reduced glutathione as described in Materials and Methods. Proteins were resolved by electrophoresis in an SDS-10% polyacrylamide gel and visualized by Coomassie blue staining. (D) Protein affinity blot of fusion proteins. Twenty-microgram samples of purified fusion proteins la (lane 1), 2a (lane 2), 3a (lane 3), 4a (lane 4), and 5a (lane 5), pGEX-2T (lane 6), and bacterial whole cell lysate (lane 7) and 10 p.g of immunopurified recombinant single-subunit human polymerase a (lane 8) were denatured as described previously (28) and separated by electrophoresis in an SDS-10% polyacrylamide gel. The proteins in the gel were renatured and transferred onto nitrocellulose as described previously (13). The membrane was incubated with 5 pg of T antigen per ml in Tris-buffered saline, washed, incubated with 10 p.g of PablOl per ml in Tris-buffered saline, and then analyzed with an alkaline phosphatase-based detection system.
amplified by using the la upstream primer and 5'TATAGAATTCATTCCTCTIrGTCTTTATTGCG-3' as the
was
downstream primer. The PCR to generate the a(102-231) fragment was amplified by using 5'-ATATGGATCCGAT GATGACCTTGAAGATGATG-3' as the upstream primer and 5'-TATAGAATTCATCGCCAGCAAATTCAGCACG3' as the downstream primer. The PCR to generate the a(195-313) fragment was amplified by using 5'-TATAG GATCCTCTGTGCACACCGCCACGGCA-3' as the upstream primer and the downstream primer from the la PCR.
Expression and purification of GST fusion proteins. GST fusion protein expression and purification were performed as described previously (33), with the following modification. Overnight cultures of E. coli JM105 transformed with either pGEX-2T or pGEX-2a and cultures of E. coli DH5a transformed with pGEX-2T or pGEX-la, -3a, -4ot, -Sa, -a(1-116), -a(102-231), and -a(195-313) were diluted 10-fold in 2xYT medium containing ampicillin (80 ,ug/ml) and cultured at 32°C for 4 h with shaking. For DH5a transformed with pGEX-3a, the culture was grown at 27°C after induction. After 1 h of
growth, isopropyl-3-D-thiogalactopyranoside (IPTG; Bethesda Research Laboratories) was added to a final concentration of 0.1 mM. For analysis of total bacterial protein content, 1-ml aliquots of each culture were harvested, boiled in 200 ,ul of urea-sodium dodecyl sulfate (SDS) cracking buffer (125 mM Tris-HCl [pH 6.8], 10% ,B-mercaptoethanol, 4% SDS, 20% glycerol, 8 M urea), and directly loaded onto an SDS-polyacrylamide gel. Proteins were visualized by Coomassie blue staining. To purify the fusion proteins from cell lysates, 500 ml of cell culture was harvested, resuspended in 1/40 volume of lysis buffer (3 mg of lysozyme in 1 ml of 50 mM Tris-HCl [pH 8.0]-150 mM NaCl-5 mM EDTA-1% Triton X-100) supplemented with 2 ,ug of aprotinin per ml and incubated on ice for 10 min. The cell debris was removed by centrifugation at 20,000 x g for 30 min at 4°C. The clarified cell lysates were rocked for 15 min at room temperature with 1 ml of glutathione-agarose beads (Sigma) which had been previously equilibrated and resuspended 1:1 (vol/vol) in NETN buffer (33) according to the manufacturer's instructions. For anal-
812
DORNREITER ET AL.
MOL. CELL. BIOL.
A 0.6 0.5 0.4 In
0.3 -
single subunit pola
0.2'
la -in--
0.1
22a,3a,4a,5Sa
-
p .'. e
A AS U-
I
.V
2
. T
4
T-
T -. --r-N-T 8 6 .
.
.
10
12
T antigen (Lg)
B 0.7'
0.6' la 2a, 3a, 4cs, 5a
in
0o
0.5'
0
1
2
3
4
5
6
fusion protein (fg) FIG. 3. Competition of fusion protein la with human DNA polymerase a for T-antigen binding. (A) Purified fusion proteins la,
2a, 3a, 4a, and or intact recombinant human polymerase a was immobilized on ELISA plates at 1 pg per well. T antigen was added in the indicated amount to each well and incubated for 1 h. After washing, bound T antigen was detected with 1 PablOl at 1 p,g per well, horseradish peroxidase coupled to an rabbit anti-mouse antibody, and a chromogenic substrate. Bound T antigen was quantitated spectrophotometrically. (B) One microgram of purified T antigen immobilized on an ELISA plate was incubated with 1 p.g of recombinant single-subunit human polymerase a mixed with increasing amounts of each GST fusion protein for 1 h. After washing, the bound single-subunit recombinant polymerase a was detected with SJK132-20 at 1 ,ug per well, horseradish peroxidase coupled to a rabbit anti-mouse antibody, and a chromogenic substrate and then quantitated as described for panel A. Sa
ysis of the bound bacterial proteins, 10 pAl of glutathione beads was boiled in 5 x sample loading buffer and loaded onto SDS-polyacrylamide gels. Proteins were visualized by Coomassie blue staining. For fusion protein recovery from glutathione-agarose beads, the agarose beads were incubated sequentially with 1 ml of 10 and 20 mM glutathione in 50 mM Tris-HCl (pH 8.0) for 5 min at room temperature. In vitro SV40 DNA replication reaction. Cytoplasmic extracts from a human embryonic kidney cell line 293S monolayer were prepared as described previously (27). The extracts were adjusted to 100 mM NaCl-2 ,ug of aprotinin per ml-50 ,uM leupeptin and then centrifuged at 4°C for 1 h at 100,000 x g. The protein concentration of the supematant, designated S100, was determined and ranged from 12 to 20 mg/ml. Supercoiled pUC-HS plasmid DNA carrying the HindIII-SphI fragment of wild-type SV40 ori-DNA (strain SV-S) in pUC18, kindly provided by E. Fanning (University of Munich), was used as the template (38). The in vitro replication reaction mixtures (50 pl) were formulated as described previously (17), with the following modifications: 6 pmol of T antigen; 190 p,g of S100 extract; 70 ng of pUC-HS DNA template; 30 mM N-2-hydroxyethylpiperazine-N'-2-
ethanesulfonic acid (HEPES; pH 7.8); 0.5 mM dithiothreitol; 7 mM magnesium acetate; 1 mM EGTA; 80 ,M each CTP, UTP, and GTP; 4 mM ATP; 0.1 mM each dATP and dGTP; 40 ,uM each dCTP and dTTP; 10 mM phosphenol pyruvate; 0.3 U of pyruvate kinase (Boehringer Mannheim); and 5 ,uCi each of [a-32P]dCTP and [a-32P]dTTJP (3,000 Ci/mmol; Amersham). The inhibitory effects of polymerase a proteins in the SV40 ori-DNA replication assay were analyzed with the four-subunit polymerase alprimase complex and with the single-subunit polymerase a or with GST fusions. For each of these assays, increasing amounts of these proteins were added together with T antigen to the S100 extract on ice. Reaction mixture and template DNA were then added to these protein mixtures. After incubation at 37°C for 2 h, the reactions were terminated with 25 ,ul of stop buffer (1% SDS, 30 mM EDTA, 0.4 ,g of proteinase K per ml), further incubated for 1 h at 37°C, phenol-chloroform extracted, and precipitated with ammonium acetate-ethanol in the presence of 10 p,g of tRNA. DNA replication products were resuspended in 20 ,ul of 10 mM Tris-HCl (pH 7.8)-i mM EDTA. Five microliters of the DNA products was either digested with EcoRI to linearize the DNA, digested with EcoRI and DpnI to remove the unreplicated template DNA, or untreated (27, 31) and analyzed by electrophoresis on a 0.8% agarose gel in Tris-borate buffer. RESULTS The human DNA polymerase a catalytic subunit binds T antigen under physiological conditions. Protein affinity blotting and ELISA were used to demonstrate that T antigen binds to the catalytic subunit of DNA polymerase a (12). To ascertain that T antigen binds to human DNA polymerase a under physiological conditions, insect cells were infected with either recombinant baculovirus 941T containing the T-antigen cDNA (26) or recombinant baculovirus AcHDPa containing the human polymerase a cDNA (7) or were coinfected with both viruses. Cell lysates from these virusinfected cells were analyzed on SDS-gels to ensure that equal amounts of polymerase a and T antigen were expressed (Fig. 1A, lanes 1 to 3). Cells infected with 941T overproduce a T-antigen protein of 90 kDa (Fig. 1A, lane 1). Cells infected with AcHDPa produce a human polymerase a protein of 180 kDa (Fig. 1A, lane 3). Cells coinfected with 941T and AcHDPax produce both T antigen and human polymerase ao (Fig. 1A, lane 2). Immunoprecipitation with anti-human polymerase at monoclonal antibody SJK132-20 (37) from cells infected with 941T did not yield any proteins of the size of polymerase a but produced a weak protein band of the size of T antigen (Fig. 1A, lane 4). This weak protein band may have arisen from nonspecific binding of the excessively overproduced T-antigen protein to the SJK13220-Sepharose beads. However, this small amount of trapped T antigen (Fig. 1A, lane 4) was not immunoreactive in an immunoblot with PablOl (Fig. 1B, lane 1). Immunoprecipitation with SJK132-20 yielded a 180-kDa polymerase a protein from AcHDPa-infected cells (Fig. 1A, lane 6). The immunoprecipitate with SJK132-20 from 941T- and AcHDPa-coinfected cells contained the 180-kDa human polymerase a protein and a T-antigen-size protein of 90 kDa (Fig. 1A, lane 5). The proteins of 50 and 25 kDa in all immunoprecipitates represent the heavy and light chains of the monoclonal IgG. An additional protein band of 60 kDa was present in all immunoprecipitates from each virusinfected insect cell lysate as well as from the coinfected cell
VOL. 13, 1993
T-ANTIGEN-BINDING DOMAIN OF HUMAN POLYMERASE
lysate. This protein was later found to be a cross-reactive baculovirus protein, since we reproducibly did not detect this protein in mock immunoprecipitates from uninfected insect cells (data not shown). An additional protein of 70 kDa was detected in immunoprecipitates from cells infected with AcHDPa alone or from cells coinfected with 941T and AcHDPa (Fig. 1A, lanes 5 and 6). The invariant presence of this 70-kDa protein in AcHDPa-infected cells suggests that this protein might be the 70-kDa subunit of the insect cell polymerase a which could associate with the overproduced recombinant human polymerase a catalytic subunit. To verify that the 90-kDa protein in the immunoprecipitate of the coinfected cells (Fig. 1A, lane 5) is indeed T antigen, the three immunoprecipitates shown in Fig. 1A, lanes 4 to 6, were transferred onto a membrane and probed with anti-Tantigen monoclonal antibody PablOl (Fig. 1B, lanes 1 to 3). The 90-kDa protein coimmunoprecipitated with recombinant polymerase a was verified as T antigen by its reactivity to PablOl (Fig. 1B, lane 2). The coimmunoprecipitation of T antigen and polymerase a was further demonstrated by immunoprecipitation of the infected cell lysates with anti-Tantigen monoclonal antibody PablOl (Fig. 1B, lanes 4 to 6). The coimmunoprecipitation of human polymerase a was demonstrated by immunoblotting with polyclonal anti-human polymerase a antiserum DPN (21) (Fig. 1B, lane 5). This set of experiments clearly demonstrated that T antigen interacts with polymerase a under both in vitro (12) and physiological conditions. Furthermore, the interaction also occurs in the absence of SV40 origin DNA in nonpermissive cells. A domain of human polymerase a physically interacts with T antigen. It was previously reported that the amino-terminal 83 amino acid residues of T antigen are both necessary and sufficient for interacting with polymerase a (12). In this study, we investigated the protein domain(s) of polymerase a that interacts with T antigen. Two strategies were used to identify the T-antigen-binding domain(s) of human DNA polymerase a. First, on the basis of the predicted secondary structure of the polymerase a catalytic subunit, the protein was divided into five overlapping fragments. Each fragment was constructed into a fusion protein with GST (see Materials and Methods). The five overlapping fusion proteins are designated la, 2a, 3a, 4a, and 5a (Fig. 2A). Each fusion construct was transformed into E. coli and overproduced in the appropriate E. coli strain (see Materials and Methods). The presence of each fusion protein in E. coli cell lysates is depicted in Fig. 2B. The intact fusion proteins are marked by arrowheads in lanes 1 to 5. Lysate from cells transformed with a GST vector containing GST alone was used as a negative control (lane 6). Fusion proteins in either intact or partially proteolyzed forms were purified from transformed E. coli cell lysates by affinity chromatography with glutathione-agarose (Fig. 2C). These GST fusion proteins along with a GST control (lane 6 of each panel), E. coli lysates (Fig. 2D, lane 7), and intact recombinant single-subunit human polymerasea (Fig. 2D, lane 8) were separated on an SDS-gel and transferred onto a nitrocellulose membrane. The nitrocellulose membrane was incubated with T antigen, and bound T antigen was detected with anti-T-antigen monoclonal antibody PablOl. Fusion protein la containing the aminoterminal 313 amino acids of polymerase a and the intact polymerasea catalytic subunit demonstrated the ability to bind T antigen (Fig. 2D). The T-antigen-binding domain of polymerase a was verified by ELISA (Fig. 3). Intact single-subunit polymerasea or each of the five overlapping GST fusion proteins was immo-
813
a
A S
PlH
N
P
.. c
7
1ot. & 313az.
I
q (-
6)
=(10221) fV2
B
--*-
z 0
d
c
60
I
-----
single
subunit
polac
aK \-- i95-313)
C's
40-
_
3~. 0
i,~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ e L.
200
I
T--T
I,
-I,
20
80
60
40
100
120
fold of molar excess T antigen
.4
1
2 3
1
2
&a Ao
3
1
2 3
1
4-
2 3 1 2 3 1
2 3
B.
C. 1ix (1-313) Control
b
a
ax (195.313) -Tag
d
c
a
L
_
b
c
d
.r1 JL e s6
--*
4tw
,
vi.X
1
2
3
1
2 3
1
2
3
1
2
3 1
2
3 1
2 3
1
2 3
1 2 3
1
2 3 1
2 3
FIG. 6. Inhibition of cell-free SV40 DNA replication by the T-antigen-binding domain of human DNA polymerase. (A) Effects of the four-subunit polymerase a/primase and the single-subunit recombinant human DNA polymerase a on cell-free replication. Reaction mixtures (50 pl) were formulated as described in Materials and Methods. The control reaction mixture contained no added human DNA polymerase a protein. The reaction mixture with the four-subunit polymerase a/primase contained 10 U of polymerase a/primase complex. In reaction mixtures containing the single-subunit human DNA polymerase a, purified recombinant polymerase a protein in 1-, 5-, 10-, and 20-fold molar excesses over T antigen was added (reactions a to d, respectively). After incubation for 2 h at 37°C, reaction products were purified as described in Materials and Methods. The DNA reaction products were treated as follows: lanes 1, no restriction digestion; lanes 2, digested with EcoRI; lanes 3, digested with EcoRI and DpnI. Samples were analyzed by electrophoresis on a 0.8% agarose gel and autoradiographed. (B) Inhibition by fusion protein la. Reaction mixtures were formulated as described. The control incubation contained no added fusion protein la. Incubations a to d contained fusion protein la at 5-, 25, 50-, and 100-fold excesses over T antigen, respectively. No T antigen was added in the -Tag reaction mixture. Lanes 1 to 3 represent products treated as described for panel A. (C) Inhibition by subfragment fusion protein a(195-313). Fusion protein of subfragment a(195-313) in 5-, 25-, 50-, and 100-fold molar excesses over T antigen was added to reactions a to d, respectively. Lanes 1 to 3 represent products treated as described for panel A. (D) Quantitation of the inhibition by polymerase a proteins. The replication products indicated by arrows in lanes 3 in panel A to C were scanned and quantitated. 815
816
DORNREITER ET AL.
MOL. CELL. BIOL.
A
B 1
30'
15'
111'
5'
60O'
coll Irol
I
[
I
control
i
-Tag
15I
10 It'
('
I
30O'
601'
1
.
fi 4
.
246~-
m
1
1 2 3 1 2 3 1 id.
1
2 3
1 2
3 1 2 3
1
...._ do.1
a
1
2 3
1
2 3 1 2 3
2 3
1 2 3
1
2 3
2 3
2 3 1 2 3
FIG. 7. Inhibition kinetics of the cell-free replication reaction. (A) Kinetics of cell-free SV40 replication. Reaction mixtures were formulated as described in Materials and Methods. At the times indicated, the reactions were terminated with 25 ,ul of stop solution, and the mixtures were further incubated for up to 2 h at 37°C. The control reaction mixture was incubated for 2 h at 37°C. Reaction products were purified and analyzed by gel electrophoresis as described in Materials and Methods. The DNA products were treated as follows: lanes 1, no restriction enzyme digestion; lanes 2, digested with EcoRI; lanes 3, digested with both EcoRI and DpnI. (B) Kinetics of inhibition by fusion protein la. The reactions were performed as described in Materials and Methods. The control reaction mixture contained no added fusion protein la. T antigen was omitted in the -Tag reaction. To the reaction mixtures, 0.55 nmol of fusion protein lao was added at the time points indicated. All reaction mixtures were incubated for 2 h. Lanes 1 to 3 represent products treated as described for panel A and analyzed as described in Materials and Methods.
6B, lanes a3 to d3). In the absence of T antigen, no replication was detected, and only a minor amount of repair synthesis was observed (Fig. 6B, -Tag lane 2). Addition of subfragment fusion protein a(195-313) in 5-, 25-, 50-, and 100-fold molar excesses over T antigen resulted in 4, 14, 58, and >96% inhibition of replication, respectively (Fig. 6C, lanes a3 to d3). The extent of the inhibition of cell-free SV40 replication by intact full-length polymerase a catalytic polypeptide, la, and a(195-313) was densitometrically quantified and summarized (Fig. 6D). These results suggest that the inhibition of cell-free SV40 replication by the singlesubunit polymerase a, fusion protein lot, and fusion protein a(195-313) is due to depletion of functionally active T antigen by the formation of a nonproductive complex. The results are also quantitatively in agreement with the results observed in the ELISA experiments described above (Fig. 3A and 5), in which the intact single-subunit polymerase a had a higher affinity for T antigen than did fusion protein la and subfragment fusion protein a(195-313). This set of experiments provides functional evidence that the T-antigen-binding domain of human polymerase a is within the aminoterminal region from amino acid residues 195 to 313. Fusion protein la inhibits SV40 in vitro replication only prior to the initiation stage. Since the fusion polymerase a proteins or subfragmented proteins had no effect on the ability of polymerase a to elongate the primers of gapped DNA but inhibited cell-free SV40 DNA replication, we further investigated the effects of these fusion proteins on initiation of SV40 DNA replication. The cell-free SV40 replication reaction has a characteristic time lag of 10 to 15
min prior to the start of DNA synthesis. This time lag has been documented and defined as the preinitiation phase (2, 3, 8, 36, 39, 40, 43, 44). To test whether the interaction between T antigen and the domain of human polymerase a has a biological effect on the transition from the preinitiation phase to the initiation phase, we reexamined the kinetics of the cell-free SV40 DNA replication reaction. Cell-free SV40 DNA replication reactions were terminated with stop solution after 5, 10, 15, 30, and 60 min, and the mixtures were further incubated for up to 2 h at 37°C (Fig. 7A). The resulting reaction products were compared with the product of the control reaction, which was terminated after 2 h of incubation at 37°C (Fig. 7A, lane 3 of control sample). No newly replicated DNA was found in the first 15 min of incubation (Fig. 7A, lanes 3 of 5- to 15-min samples), and only a low amount of product was found in the 30-min reaction. It was thus confirmed that preinitiation complex formation requires 15 min. Comparison of reaction products from the 30- and 60-min incubations with that of the 2-h control reaction clearly demonstrated that DNA replication was not near completion after 30 or 60 min. On the basis of the kinetics of the cell-free SV40 DNA replication reactions shown above, we studied the inhibition kinetics of fusion protein la. Fusion protein la at a level that could completely abolish cell-free SV40 DNA replication was added at the onset of the reaction (0 min) and then at 5, 10, 15, 30, and 60 min after the start of the reaction at 37°C. The reaction mixtures were incubated for up to 2 h, and the reactions were terminated with stop solution (Fig. 7B). Results showed that inhibition by fusion protein la was
T-ANTIGEN-BINDING DOMAIN OF HUMAN POLYMERASE a
VOL. 13, 1993 51
0r
control
30)'
15'
10'
60'
"
.w
i
nr
r
6
a
a Jo
I
2
3
1
2
3
1
2
3
1
2
3
2
3
1
2
3
2
3
FIG. 8. Kinetics of overcoming the inhibition with extra molecules of T antigen. Reaction mixtures were assembled as described in Materials and Methods. The control reaction mixture contained no added fusion protein la. Fusion protein la was added to the reaction mixtures at the onset of the incubation. An extra 6 pmol of T antigen was added to the cell-free SV40 DNA replication reaction at time points indicated. Reaction products were purified and analyzed as described in Materials and Methods. Lanes 1 to 3 represent products treated with no restriction enzyme, EcoRI, and EcoRI and DpnI, respectively. All reaction products were loaded onto a single agarose gel with upper- and lower-row wells. Reaction products from the control incubation the and 0-, 5-, and 10-min incubations were loaded onto the wells in the upper row of the agarose gel, while products from 15-, 30-, and 60-min incubations were loaded onto the lower-row wells. The entire gel containing the upper- and lower-row samples was exposed to a single X-ray film. Thus, the autoradiograms of all incubations were exposed for the same length of time.
effective only during the first 15 min of reaction. After 15 min of incubation, fusion protein la exhibited little inhibitory effect. Because of the 15-min time lag, the 30- and 60-min reactions were actually 15- and 45-min reactions in the DNA synthesis stage that were not near completion of replication (Fig. 7A). After 30 and 60 min of the replication reaction, fusion protein la had no inhibitory effect (Fig. 7B). Identical inhibition kinetics were observed with a(195-313) (data not shown). These inhibition kinetics suggest that fusion protein la either interferes with correct assembly of the preinitiation complex or competes with cellular polymerase a/primase for T-antigen binding during the transition from the preinitiation phase to the initiation phase. Addition of extra T-antigen molecules can partially overcome the inhibition only prior to the initiation stage. We further investigated the kinetics of overcoming the inhibition caused by la and a(195-313) by adding extra molecules of T antigen. Six picomoles of T antigen was added to a reaction mixture simultaneously with la fusion protein prior to the start of the replication reaction (0 min), or T antigen was added 5, 15, 30, and 60 min after the replication reaction started. The inhibition was partially overcome when T antigen was added simultaneously with lt at the onset of the reaction (0 min) or 5, 10, and 15 min after the reaction started. After incubation with lot for 30 and 60 min, T antigen was unable to overcome the inhibition (Fig. 8). Inhibition
817
caused bya(195-313) was overcome by extra molecules of T antigen in a kinetics pattern identical to that of la (data not shown). These experiments demonstrated that the inhibition is caused by binding of fusion protein la to T antigen, thus blocking the interaction of cellular polymerase a with T antigen which is required for the transition from the preinitiation stage to the initiation stage. Effects of other fusion proteins on the cell-free SV40 replication reaction. We also investigated whether other fusion proteins contain domain(s) interacting with cellular factors required for the cell-free replication reaction. The effects of all eight polymerase a fusion proteins on cell-free SV40 DNA replication were tested. Fusion proteins were added to the reaction mixture at a 100-fold molar excess over T antigen at the onset of the SV40 replication reaction. As expected, la and a(195-313) inhibited cell-free SV40 DNA replication. Surprisingly, 2a and 4a also inhibited cell-free SV40 DNA replication (Fig. 9A). It is possible that 2a and 4a also contain T-antigen-binding domains that are not detected by protein affinity blotting or ELISA. Alternatively, these two fusion proteins might contain domains that interact with other cellular proteins which are essential for SV40 replication. To investigate these two possibilities, we added extra molecules of T antigen to the inhibited reaction mixtures. Six picomoles of T antigen was added to the la, a(195-313), 2a, 4a cell-free replication reaction mixtures 7 min after the reaction started (Fig. 9B). Only the inhibitions caused by la(195-313) and a(195-313) could be partially overcome by the extra molecules of T antigen. Inhibitions caused by 2a and 4a were unable to be overcome by the addition of extra T-antigen molecules (Fig. 9B). Furthermore, kinetic experiments to overcome the inhibition indicated that the inhibition caused by 2a and 4a could not be overcome by adding extra T-antigen molecules from the onset of the reaction to 2 h after initiation of the reaction (data not shown). These results strongly suggest that fusion proteins 2a and 4a contain domains that interact with other cellular proteins which are essential for cell-free SV40 DNA replication. DISCUSSION Initiation of chromosomal DNA replication is a precisely regulated event that defines the transition of cells from G1 to the S phase of the cell cycle. Initiation is likely regulated through various pathways occurring with precise timing and coordination with other events of the cell cycle. The assembly of a multiprotein complex at the replication origin and posttranslational modification of these proteins are predicted to be pivotal for the initiation event. To begin to understand the initiation process at the molecular level, we used SV40 DNA replication as a model with which to thoroughly investigate the interaction between viral large T antigen and cellular DNA polymerase a. Studies from several laboratories have described the observation of an initial 10- to 15-min lag of dNTP incorporation followed by brisk and linear DNA synthesis for 60 to 120 min. The 10- to 15-min lag period is defined as the presynthesis or preinitiation phase. The initial delay in DNA synthesis can be abolished by preincubation of T antigen with SV40 ori-DNA and the cellular extract for 10 to 15 min prior to the addition of dNTPs. Thus, the kinetics of cell-free SV40 DNA replication with use of S100 extracts were proposed to have multiple distinct stages (14, 35, 39, 43, 46). The preinitiation stage requires T antigen, RP-A, and topoisomerase I or II. In this study, we identified a domain of
818
DORNREITER ET AL. A K
.GC'-
MOL. CELL. BIOL.
B -I
-1
stc o n-m -
¢
o
M
I
'10
sc
T
o
c-
I'-'
;0M
d
-1
-
-I
--l
'
-T
t :11;
A
:i:
i.
i1
--pop
I .. 0 1 2 3
1 2 3
1
2 3
1
3
X1 2
3
123
1 23
1 2 3
12 3 4.
1 2 3
1 2
3
1 2 3
1 2 3
FIG. 9. Effects of other fusion proteins on the cell-free replication reaction. (A) Inhibitory effects of all polymerase a fusion proteins. Reactions were performed as described in Materials and Methods. The control incubation contained no added polymerase a fusion protein. At the onset of incubation, each fusion protein was added to the reaction mixture in a 100-fold molar excess over T antigen. Lanes 1 to 3 represent replication products treated with no restriction enzyme, with EcoRI, and with EcoRI and DpnI, respectively. (B) Inability of T antigen to overcome the inhibition caused by 2a and 4a. Seven minutes after the DNA replication reaction started, 6 pmol of extra T antigen was added to the cell-free SV40 replication reaction mixtures which contained 0.55 nmol of la, 2a, or 4a at the onset of the incubation. The control reaction mixture contained no additional T antigen. Replication products were analyzed as described for panel A.
polymerase a that interacts with T antigen. Our data suggest that interaction between this specific domain of polymerase a and T antigen in the preinitiation complex is a critical step for the transition from the preinitiation stage to the initiation stage of DNA replication. The protein domain of polymerase a defined in this study interacts with T antigen in the absence of core ori-DNA. Data of this study, however, do not distinguish whether polymerase a interacts with the monomeric or the hexameric form of T antigen at the origin. Since T antigen also directly interacts with RP-A (11), it is not yet known whether the presence of RP-A and/or the SV40 origin sequence will enhance the interaction between T antigen and polymerase a. Results from ELISA experiments and from the inhibition of cell-free SV40 DNA replication have demonstrated that the intact full-length polymerase a polypeptide binds T antigen with a higher affinity than do fusion proteins la and a(195-313) (Fig. 3A, 5, 6C, and 6D). The finding that only la but not the other fusion proteins could compete with the full-length polymerase a to bind T antigen (Fig. 3B) strongly suggests that the T-antigen-interacting domain is primarily located within the amino-terminal 313 amino acid residues. The weaker binding capacity of the fusion proteins suggests that the two bacterially produced fusion proteins might not have the correct folding. It is also possible that other domains of polymerase a which do not directly interact with T antigen can enhance the interaction. We have demonstrated that the four-subunit polymerase a/primase did not inhibit the cell-free SV40 replication reaction (Fig. 6A). In contrast, single-subunit polymerase a
or the N-terminal fusion proteins la and a(195-313) as well as 2a and 4a inhibited the cell-free SV40 replication reaction effectively (Fig. 6A to C and 9A). This finding suggests that the added purified four-subunit polymerase a/primase is able to substitute for the cellular polymerase alprimase in cellfree SV40 replication. The data also suggest that at the onset of the reaction, polymerase a/primase is not yet tightly associated with T antigen or other cellular replication factors. The inhibition kinetics of fusion la and the ability of extra T antigen to partially overcome this inhibition (Fig. 7 and 8) suggest that the protein-protein association is reversible during the initial 15 min. This time period corresponds to the preinitiation stage of DNA replication. Thus, the two sets of kinetic data strongly suggest that fusion protein la interferes with the interaction between T antigen and cellular polymerase a/primase during the transition from preinitiation to initiation. Once the reaction proceeds from the preinitiation stage to the initiation stage, neither the singlesubunit polymerase a nor fusion proteins la or a(195-313) was able to interfere or disrupt the DNA replication complex (Fig. 7 and 8). However, during the transition from preinitiation to initiation prior to the onset of initiation, when the initiation complex has not yet been assembled, these polymerase a proteins were able to form nonproductive complexes with T antigen. This nonproductive complex formation resulted in blockage of formation of the productive initiation complex between T antigen and cellular polymerase alprimase. A model describing the effects of these polymerase a proteins on the transition from preinitiation to initiation of SV40 DNA replication is shown in Fig. 10. Results of this study support the conclusion that initiation of
VOL. 13, 1993
T-ANTIGEN-BINDING DOMAIN OF HUMAN POLYMERASE a
Pre-Initiation 0
Initiation
min
15
_ 5,
min
T antigen 3'
1111111
antigen
r I
a ~~~~~~~~~~~~~~polymerase
Q
RP-A
prinane
Topo I orII
5'
I-
3'
polymerase,a 0
extra T antigen
CD
Io(x-313) o.(195-313)
5' 5'
3'
3'
5'
'3
11
5,5 5M
FIG. 10. Model of the interaction between T antigen during the transition from preinitiation to initiation SV40 origin of DNA replication. The preinitiation stage assembly of T antigen, RP-A, and topoisomerase (Topo) the origin. We proposed that the interaction between
and
merase a
the
requires
the
I
or
a
domain of DNA polymerase and T antigen in the complex is the critical step for the transition from initiation of DNA replication. The consequence of this primer and nascent DNA synthesis.
poly-
at
II
at
specific
preinitiation
preinitiation interaction
SV40 DNA replication requires the interaction of in the preinitiation complex with the amino-terminal of polymerase at from amino acid residues 195 finding of T antigen and polymerase a catalytic interaction occurring under physiological conditions suggests that this interaction might also occur during tion ofSV40 DNA replication in vivo. Fusions 2a and 4a also demonstrated inhibitory cell-freeSV40 DNA replication (Fig. 9A). However, tion of extra molecules of T antigen could not overcome inhibition (Fig. 9B). In an ELISA experiment fusion proteins 2a and 4a were unable to compete at for T-antigen binding. single-subunit polymerase findings suggest that 2a and 4a may contain domains able to interact with other cellular replication ies are now in progress to identify these components. Studies of bacterial and viral DNA replication lished that initiation of DNA replication in these involves the binding of initiator proteins to
819
been the quest to identify origins of replication on chromosomal DNA. In Saccharomyces cerevisiae, a family of well-characterized short chromosomal sequences known as autonomously replicating sequences (ARSs) was discovered. These cis-acting sequences allow the extrachromosomal maintenance of plasmids in yeast cells and serve as replication origins (22, 30). A recent achievement is the identification and purification of a group of proteins, termed origin recognition proteins (ORC), which are able to bind to the ARS1 sequence in an ATP-dependent manner (1). This finding was further supported by a complementary study of genomic footprinting in vivo which demonstrated protection of the ARS1 sequence by cellular proteins similar to that generated by ORC proteins (10). These results strongly suggest that ORC proteins are a group of yeast proteins that may play a role similar to that of DnaA protein at oriC during the prepriming reaction. The orderly protein-DNA and multiple protein-protein interactions during oriC-directed initiation of E. coli and the identification of ORC proteins in a lower eukaryotic organism have served as a paradigm for initiation in higher eukaryotes. Initiation in higher eukaryotes most likely also involves an ordered recognition of cis-acting sequences by origin recognition proteins followed by multiple protein-protein interactions between the origin recognition proteins and other proteins to form a preinitiation (or prepriming) complex. Studies presented in this report demonstrated that the interaction between T antigen in the assembled preinitiation complex and a domain on polymerasea from amino acid residues 195 to 313 plays a critical role in the transition from preinitiation to initiation of DNA replication. It is attractive to speculate that there might be a cellular protein factor(s) like SV40 T antigen or E. coli DnaA, DnaB, and DnaC proteins that is responsible for the initiation of DNA replication. The interaction between polymerasea and the putative cellular initiator protein(s) might be regulated by cell cycle-dependent phosphorylation and/or by interaction with additional proteins at the onset of S phase of the cell cycle.
T antigen domain
to
313.
The
polypeptide (Fig.
1)
initia-
the
3B),
the
These
that
factors.
have
two
a
acting
E.
to
are
Stud-
estab-
systems
specific
For initiation of the bacteria system, DnaA protein first cooperatively binds 9-mer repeat (dnaA boxes) to form a protein-DNA melting three AT-rich 13-mer repeats in an manner (4, 25). The DnaA protein and the structure of the melted DNA strand presumably sequester DnaB in complex with DnaG together protein to form a prepriming complex (25). A major to understanding higher eukaryotic DNA sequence.
ccli
the
cis-
oriC
four-
complex,
ATP-dependent
single-stranded are
able
with
to
Hu
obstacle
replication
I.D. is a postdoctoral fellow supported by the Deutsche Forschungsgemeinschaft. This research was supported by NIH grant
on
addi-
with
clonal antibodies for T antigen.
CA14835 from the National Cancer Institute.
effects
(Fig.
ACKNOWLEDGMENTS We thank Carol Prives and Jim DeCaprio for providing mono-
REFERENCES
1. Bell, S. P., and B. Stillman. 1992. ATP-dependent recognition of eukaryotic origins of DNA replication by a multiprotein complex. Nature (London) 357:128-134.
2. Borowiec, J. A., F. B. Dean, P. A. Bullock, and J. Hurwitz. 1990. Binding and unwinding-how T antigen engages the SV40 origin of DNA replication. Cell 60:181-184. 3. Borowiec, J. A., and J. Hurwitz. 1988. ATP stimulates the binding of simian virus 40 (SV40) large tumor antigen to the SV40 origin of replication. Proc. Natl. Acad. Sci. USA 85:6468. 4. Bramhill, D., and A. Kornberg. 1988. A model for initiation at origins of DNA replication. Cell 54:915-918. 5. Challberg, M. D., and T. J. Kelly. 1989. Animal virus DNA replication. Annu. Rev. Biochem. 58:671-717. 6. Collins, K. L., and T. J. Kelly. 1991. Effects of T antigen and replication protein A on the initiation of DNA synthesis by DNA polymerasea-primase. Mol. Cell. Biol. 11:2108-2115. 7. Copeland, W. C., and T. S.-F. Wang. 1991. Catalytic subunit of human DNA polymerase a overproduced from baculovirusinfected insect cells. J. Biol. Chem. 266:22739-22748. 8. Dean, F. B., P. Bullock, Y. Murakami, C. R. Wobbe, L.
820
DORNREITER ET AL.
Weissbach, and J. Hurwitz. 1987. Simian virus 40 (SV40) DNA replication: SV40 large T antigen unwinds DNA containing the SV40 origin of replication. Proc. Natl. Acad. Sci. USA 84:1620. 9. Depamphilis, M. L. 1987. Replication of simian virus 40 and polyoma virus chromosomes, p. 1-40. In Y. Aloni (ed.), Molecular aspects of papovaviruses. Martinus Nijhoff, Boston. 10. Diffley, J. X., and J. H. Cocker. 1992. Protein-DNA interactions at yeast replication origin. Nature (London) 357:169-172. 11. Dornreiter, I., L. F. Erdile, I. U. Gilbert, D. von Winkler, T. J. Kelley, and E. Fanning. 1992. Interaction of DNA polymerase a-primase with cellular replication protein A and SV40 T antigen. EMBO J. 2:769-776. 12. Dornreiter, I., A. Hoss, A. K. Arthur, and E. Fanning. 1990. SV40 T antigen binds directly to the large subunit of purified DNA polymerase a. EMBO J. 9:3329-3336. 13. Dunn, S. D. 1986. Effects of the modification of transfer buffer composition and the renaturation of proteins in gels on the recognition of proteins on Western blot by monoclonal antibodies. Anal. Biochem. 157:144-153. 14. Fairman, M. P., and B. Stillman. 1988. Cellular factors required for multiple stages of SV40 DNA replication in vitro. EMBO J. 7:1211-1218. 15. Gannon, J. V., and D. P. Lane. 1987. p53 and DNA polymerase a compete for binding to SV40 T antigen. Nature (London) 329:456458. 16. Gassmann, M., P. Thommes, T. Weiser, and U. Hubscher. 1990. Efficient production of chicken egg yolk antibodies against a conserved mammalian protein. FASEB J. 4:2528-2532. 17. Guo, Z.-S., C. Gutierrez, U. Heine, J. M. Sogo, and M. L. Depamphilis. 1989. Origin auxiliary sequences can facilitate initiation of simian virus 40 DNA replication in vitro as they do in vivo. Mol. Cell. Biol. 9:3593-3602. 18. Gurney, E. G., R. 0. Harrison, and J. Fenno. 1980. Monoclonal antibodies against simian virus 40 T antigens: evidence for distinct subclasses of large T antigen and for similarities among nonviral T antigens. J. Virol. 34:752-763. 19. Harlow, E., L. V. Crawford, D. C. Pim, and N. M. Williamson. 1981. Monoclonal antibodies specific for simian virus 40 tumor antigen. J. Virol. 39:861-869. 20. Hoss, A., I. Moarefi, K.-H. Scheidtmann, L. J. Cisek, J. L. Corden, I. Dornreiter, A. K. Arthur, and E. Fanning. 1990. Altered phosphorylation pattern of simian virus 40 T antigen expressed in insect cells by using a baculovirus vector. J. Virol. 64:4799-4807. 21. Hsi, K.-L., W. C. Copeland, and T. S.-F. Wang. 1990. Human DNA polymerase a catalytic polypeptide binds ConA and RCA and contains a specific labile site in the N-terminus. Nucleic Acids Res. 18:6231-6237. 22. Huberman, J. A., L. D. Spotila, S. M. Nawotka, El-Assouli, and L. R. Davis. 1987. The in vivo replication origin of the yeast 2 micron plasmid. Cell 51:473-481. 23. Hurwitz, J., F. B. Dean, A. D. Kwong, and S.-H. Lee. 1990. The in vitro replication of DNA containing the SV40 origin. J. Biol. Chem. 265:18043-18046. 24. Kelly, T. J. 1988. SV40 DNA replication. J. Biol. Chem. 263:17889-17892. 25. Kornberg, A., and T. A. Baker. 1992. DNA replication. W. H. Freeman & Co., New York. 26. Lanford, R. E. 1988. Expression of simian virus 40 T antigen in insect cells using a baculovirus expression vector. Virology 167:72-81. 27. Li, J. J., and T. J. Kelly. 1984. Simian virus 40 DNA replication in vitro. Proc. Natl. Acad. Sci. USA 81:6973-6977. 28. Miskimins, W. K., M. P. Roberts, A. McClelland, and F. H. Ruddle. 1985. Use of a protein-blotting procedure and a specific DNA probe to identify nuclear proteins that recognize the promoter region of the transferrin receptor gene. Proc. Natl.
MOL. CELL. BIOL.
Acad. Sci. USA 82:6741-6744. 29. Nasheuer, H.-P., A. Moore, A. F. Wahl, and T. S.-F. Wang. 1991. Cell cycle dependent phosphorylation of human DNA polymerase a. J. Biol. Chem. 266:7893-7903. 30. Newlon, C. S. 1988. Yeast chromosome replication and segregation. Microbiol. Rev. 52:568-601. 31. Peden, K. W. C., J. M. Pipas, S. Pearson-VWhite, and D. Nathan. 1980. Isolation of mutants of an animal virus in bacteria. Science 209:1392-1396. 32. Smale, S., and R. Tjian. 1986. T-antigen-DNA polymerase alpha complex implicated in simian virus 40 DNA replication. Mol. Cell. Biol. 6:4077-4087. 33. Smith, D. B., and K. S. Johnson. 1988. Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 67:3140. 34. Stillman, B. 1989. Initiation of eukaryotic DNA replication in vitro. Annu. Rev. Cell Biol. 5:197-245. 35. Stillman, B., J. X. Diffley, G. Prelich, and R. A. Guggenheimer. 1986. DNA-protein interactions at the replication origins of adenovirus and SV40. Cancer Cells 4:453-463. 36. Stillman, B. W., and Y. Gluzman. 1985. Replication and supercoiling of simian virus 40 DNA in cell extracts from human cells. Mol. Cell. Biol. 5:2051-2060. 37. Tanaka, S., S.-Z. Hu, T. S.-F. Wang, and D. Korn. 1982. Preparation and preliminary characterization of monoclonal antibodies against human DNA polymerase a. J. Biol. Chem. 257:8386-8390. 38. Traut, W., and E. Fanning. 1988. Sequence-specific interactions between a cellular DNA-binding protein and the simian virus 40 origin of replication. Mol. Cell. Biol. 8:903-911. 39. Tsurimoto, T., M. P. Fairman, and B. Stiliman. 1989. Simian virus 40 DNA replication in vitro: identification of multiple stages of initiation. Mol. Cell. Biol. 9:3839-3849. 40. Tsurimoto, T., T. Melendy, and B. Stillman. 1990. Sequential initiation of lagging and leading strand synthesis by two different polymerase complexes at the SV40 DNA replication origin. Nature (London) 346:534-539. 41. Tsurimoto, T., and B. Stillman. 1991. Replication factors required for SV40 DNA replication in vitro. I. DNA structure specific recognition of a primer-template junction by eukaryotic DNA polymerases and their accessory proteins. J. Biol. Chem. 266:1950-1960. 42. Tsurimoto, T., and B. Stillman. 1991. Replication factors required for SV40 DNA replication in vitro. II. Switching of DNA polymerase a and 8 during initiation of leading and lagging strand synthesis. J. Biol. Chem. 266:1961-1968. 43. Wobbe, C. R., F. Dean, L. Weissbach, and J. Hurwitz. 1985. In vitro replication of duplex circular DNA containing the simian virus 40 DNA origin site. Proc. Natl. Acad. Sci. USA 82:57105714. 44. Wobbe, C. R., L. J. Weissbach, J. A. Borowiec, F. B. Dean, Y. Murakami, P. Bullock, and J. Hurwitz. 1987. Replication of simian virus 40 origin-containing DNA in vitro with purified proteins. Proc. Natl. Acad. Sci. USA 84:1834-1838. 45. Wold, M. S., and T. Kelly. 1988. Purification and characterization of replication protein A, a cellular protein required for in vitro replication of simian virus 40 DNA. Proc. Natl. Acad. Sci. USA 85:2523-2527. 46. Wold, M. S., J. J. Li, and T. J. Kelley. 1987. Initiation of simian virus 40 DNA replication in vitro: large-tumor-antigen- and origin-dependent unwinding of the template. Proc. Natl. Acad. Sci. USA 84:3643-3647. 47. Wong, S. W., A. F. Wahl, P.-M. Yuan, N. Arai, B. E. Pearson, K.-I. Arai, D. Korn, M. W. Hunkapiller, and T. S.-F. Wang. 1988. Human DNA polymerase a gene expression is cell proliferation dependent and its primary structure is similar to both prokaryotic and eukaryotic replicative DNA polymerases. EMBO J. 7:3747.
