The RR, RT and HTC in summers were significantly (Pâ¤0.01) higher than the other ... Polymorphism of Hsp90ab1 gene, evaluated by comparative sequencing ...
Indian J. Anim. Res., 50 (6) 2016 : 856-861
AGRICULTURAL RESEARCH COMMUNICATION CENTRE
Print ISSN:0367-6722 / Online ISSN:0976-0555
www.arccjournals.com/www.ijaronline.in
Polymorphisms in Hsp90ab1 gene and their association with heat tolerance in Sahiwal and Karan Fries cows Lalrengpuii Sailo1, I.D. Gupta*, Archana Verma, Ramendra Das2, M.V. Chaudhari1 and Sohanvir Singh2 ICAR-National Dairy Research Institure, Karnal-132 001, India. Received: 03-06-2015 Accepted: 15-01-2016
DOI: 10.18805/ijar.v0iOF.6662
ABSTRACT Heat shock protein functions as a molecular chaperone and plays an important role in thermotolerance. The study was undertaken to identify single nucleotide polymorphisms (SNPs) of Hsp90ab1 gene by comparative sequencing and to analyze their association with thermo-physiological parameters, viz. respiration rate (RR), rectal temperature (RT) and heat tolerance coefficient (HTC) in different seasons, viz. winter, spring and summer, at probable extreme hours of the day in Sahiwal and Karan Fries cows. The RR, RT and HTC in summers were significantly (P0.01) higher than the other two seasons. Polymorphism of Hsp90ab1 gene, evaluated by comparative sequencing revealed six SNPs, viz. T17871421C, C17871485del, C17872061T, T17872112C, T17872148G and A17872199C, two each located in exon 8, intron 10 and exon 11. SNP loci T17871421C and C17871485del were found to be monomorphic for allele C and Deletion (-) respectively in experimental population. Individuals with AA genotype showed significantly (P 0.01) lower RR than AC genotype. While, individuals with CT genotype recorded significantly (P 0.01) lower RT than CC genotype. Therefore, it is inferred that propagation of AA and CT genotypes may be an aid to selection and breeding programmes to enhance thermo-tolerance in dairy cattle. Key words: Heat stress, Hsp90ab1, Karan Fries SNP, Sahiwal. INTRODUCTION Climate change represents a critical challenge to both agricultural and livestock production systems. Variation in climatic variables like temperature, humidity and solar radiations are recognized as one of the most potential hazards in growth, health, production and reproduction of all domestic livestock species (Bernabucci et al., 2010; Yatoo et al., 2012; Ganaie et al., 2013). Physiological responses like respiration rate, rectal temperature and pulse rate reflect the degree of stress imposed by climatic parameters on animals (Ganaie et al., 2013). Zebu breeds (Bos indicus) of cattle are better able to regulate body temperature in response to heat stress than European breeds (Bos taurus) due to their long time adaptation to tropical climates (Beatty et al., 2006; Gaughan et al., 2010). The problem of heat stress in dairy cattle has recently received increasing attention because of anticipated increases in environmental temperature by global warming (Hansen, 2004; Hoffmann, 2010). Under thermal stress, multiple cellular mechanisms are displayed to counter the stress conditions by altering the expression of several stress genes (Collier et al., 2008). Mammals respond to heat stress by transcriptional activation of a set of proteins known as heat shock proteins (Kregel, 2002). Heat shock proteins (Hsps) play essential roles in immunity of organisms, particularly in relation to heat-
resistance (Song et al., 2006, You et al., 2013). Therefore, identification for SNP markers associated with heatresistance has mainly concentrated on Hsps as the most suitable candidate genes (Rako et al., 2007; Yang et al., 2011; Chen et al., 2013). The chaperone, Hsp90 is one of the most abundant proteins in eukaryotic cells, comprising two major cytoplasmic isoforms, the inducible (Hsp90) and the constitutive (Hsp90) (Chen et al., 2006). The gene hsp90 has been identified and characterized in diverse species and is involved in a variety of cellular processes, including protein regulation, control of apoptosis, and signal transduction in the stress response (Richter and Buchner, 2001). Recently, novel single nucleotide polymorphisms (SNP) were identified at different positions of the bovine Hsp90ab1 gene in Bos taurus, crossbred and Bos indicus cattle. High prevalence of this gene in zebu cattle enable them to survive and perform better to crossbred cattle due to better heat tolerance (Deb et al., 2013; McManus et al., 2014; Sajjanar et al., 2015) The objective of this study was to identify SNPs in the targeted regions of Hsp90ab1 gene in Sahiwal and Karan Fries cows and to analyze the association of genetic variants with thermal stress related physiological parameters, viz. respiration rate, rectal temperature and HTC.
*Corresponding author’s e-mail: ++ 1 AG Division, IVRI, Izatnagar, 2DCP Division, National Dairy Research Institute, Karnal.
857
Volume 50 Issue 6 (2016) MATERIALS AND METHODS Experimental animals: The study was conducted on randomly selected 100 cows including 50 Sahiwal and 50 Karan Fries, maintained at Livestock Research Centre of ICAR-National Dairy Research Institute, Karnal. The experimental design and procedure were carefully planned and approved by the Institutional Animal Ethics Committee. Recording physiological parameters: Respiration rate (RR) of each animal was recorded by visual observation of inward and outward flank movements. Rectal temperature (RT) was recorded in centigrade with a digital thermometer by keeping the thermometer in contact with rectal mucosa for about 2 minutes. The parameters, RR and RT were recorded at 6-8 am, 12-02 pm, and 12-02 pm during winter (January), spring (March) and summer (June) respectively. Recording of these parameters was done once in each of the three seasons at the probable extreme hours of day. Heat tolerance coefficient (HTC) was calculated by Benezra Coefficient of Heat Adaptability (Benezra, 1954) with the following formula. HTC= RR/23 + RT/38.33 The denominators 23 and 38.33 in the equation represent the normal RR and RT (°C) of cattle, respectively, under ideal conditions. Blood collection and DNA extraction: Ten ml blood was collected aseptically from all the experimental cows. Genomic DNA was extracted using Phenol-chloroform method as described by Sambrook and Russel (1989) with minor modifications, and detected by 0.7% agarose gel electrophoresis. The content of DNA was estimated by Biospec-nano spectrophotometer. The genomic DNA was diluted to a final concentration of 50 ng /µl, and stored at 20°C for PCR amplification. PCR amplification : Two sets of forward and reverse genespecific oligonucleotide primers were designed using DNASTAR software and gene specific sequence (ENSBTAT00000001034). The working solutions of both forward and reverse primers were prepared to obtain final concentration of 10 pmol for each primer. Final reaction cocktail (25 µl) was comprised of forward primer (0.5 µl), reverse primer (0.5 µl), PCR Master Mix (12.5 µl), Water (8.5 µl) and Template DNA (3.0 µl). PCR amplification was performed using Thermal cycler (MJ Research and BioRad T100). Each tube, containing 25 µl
PCR reaction cocktail was kept in Thermal cycler for amplification of target region of bovine Hsp90ab1 gene. PCR conditions involved initial denaturation at 95oC for 1 minute, followed by 34 cycles with denaturation at 94oC for 30 seconds, primer specific annealing temperature of 59oC and 61oC for 30 seconds to specifically amplify target region 1 and 2 respectively, extension at 72oC for 25 seconds followed by final extension at 72oC for 6 minutes and 30 seconds. Purification and sequencing: Amplified PCR products of both sets of primers Table-1 were custom sequenced from both ends, i.e. 52 and 32 ends. DNA sequencing results for the respective region of bovine Hsp90ab1 gene were visualized and edited using Chromas Lite Software. Each edited sequence was aligned with corresponding reference sequence of Bos taurus using ClustalW multiple sequence alignment program to identify single nucleotide polymorphism (www.ebi.ac.uk/Tools/msa/clustalw2). Temperature humidity index : The outdoor temperature and the relative humidity (RH) (%) were recorded daily during the experiment to calculate Temperature humidity index (THI) value. THI was calculated as per NRC (1971). THI of winter (49.7), spring (64.65), and summer (86.44) obtained from ICAR-CSSRI, Karnal were the three subclasses of THI considered in association analysis. THI = 0.72 (Wb + Db) + 40.6 Where, Wb is wet bulb temperature and Db is dry bulb temperature in °C Association of SNP genotype with thermo-physiological parameters: Genotypic and allelic frequencies were calculated using POPGENE software package (Yeh et al., 1999). The association of SNP genotype with rectal temperature (RT) and respiration rate (RR), heat tolerance coefficient was analyzed using GLM procedure of SAS. The effect of SNP genotype on physiological parameters was analyzed using the following model: Yijklmn = µ + Ti + Gj + Gk + Gl+ Gm + eijklmn Yijklmn= nth observation on RR/RT of cows in ith THI, jth genotype, kth genotype, lth genotype and mth genotype µ= Overall mean Ti= Effect of ith THI Gj= Fixed effect of jth genotype Gk= Fixed effect of kth genotype Gl= Fixed effect of lth genotype Gm= Fixed effect of mth genotype eijklmn= Random error associated with Yijklmn observation and assumed to be NID (0, 2e)
Table 1: Sequence of primers, targeted regions and amplicon sizes of bovine Hsp90ab1 gene.
Primer set 1 2
Primer sequence (5’-3’) F: AGTGAGTATCTTTTGCCCTAATG (23) R:TCTCCTCTAACCGAATGAAAAA (22) F: GCTGCTGCGCTATCACACG (19) R: GCCCTCCTTGGTCACAGA (18)
Note: The number within parenthesis indicates base pairs.
Targeted regions
Amplicon size
17871343-17871801
459 bp
17871892-17872278
387 bp
858
INDIAN JOURNAL OF ANIMAL RESEARCH
RESULTS AND DISCUSSION Identification of SNPs: In the present study, 846 bp was amplified and comparative sequencing analysis revealed six SNPs, viz., T17871421C, C17871485del, C17872061T, T17872112C, T17872148G and A17872199C, two SNPs were observed in each exon 8, intron 10 and exon 11. First targeted region: It comprises part of intron 7, exon 8, intron 8 and part of intron 9, the SNP loci T17871421C and C17871485del were found to be monomorphic for allele C and deletion (-), respectively in all the cows (Table-2). Genotypes CC (T17871421C) and — (C17871485del) were therefore, not considered for subsequent analysis. Second targeted region: It comprises part of exon 10, intron 10 and exon 11, exhibited two monomorphic SNP at loci C1787061T (CC) and A17872199C (AA) in KF and Sahiwal cows respectively. These monomorphic loci were also not considered for subsequent analysis. The frequencies of genotypes in the population was in accordance with HardyWeinberg equilibrium (P>0.05). Allele and genotype frequencies are presented in Table 2. The calculated allele frequency indicated that allele “T” (Sahiwal= 0.83, KF= 0.63) was predominant than mutant allele “C” at T17872112C locus in both the breeds. Similarly, the frequency of allele “T” (0.63) was more in Karan Fries cows as compared to mutated allele “G” at T17872148G locus, but opposite pattern was observed in Sahiwal cows where frequency of mutated allele “G” (0.94) was more than the wild type. Association between the polymorphism of Hsp90ab1 gene and physiological parameters: Associations between sequence variants to thermal stress permit screening of animals having presence or absence of desirable or
undesirable alleles (Collier et al., 2008). Several studies have shown significant association of SNPs with physiological parameters (RR, PCV, RT and HTC) to evaluate the heat tolerance/stress in cattle (Liu et al., 2010; Liu et al., 2011; Charoensook et al., 2012; Sajjanar et al., 2015). Heat tolerance traits such as RR, RT and HTC of both Sahiwal and Karan Fries cows differed significantly (p
