Journal of Clinical Virology 89 (2017) 5–9
Contents lists available at ScienceDirect
Journal of Clinical Virology journal homepage: www.elsevier.com/locate/jcv
Polyomavirus BK and JC in individuals with chronic kidney failure, kidney transplantation, and healthy controls Talita Castro a,∗ , Maria Cristina Domingues Fink b , Marilia Figueiredo a , Paulo Henrique Braz-Silva a , Cláudio Mendes Pannuti a , Karem Lopez Ortega a , Marina Gallottini a a
University of São Paulo, School of Dentistry, Stomatology Department, Professor Lineu Prestes Avenue, 2227, 05508-000, São Paulo-SP, Brazil University of São Paulo, Laboratory of Virology, Institute of Tropical Medicine of São Paulo, Dr. Eneas Carvalho de Aguiar Avenue, 470, 05403-000, São Paulo-SP, Brazil b
a r t i c l e
i n f o
Article history: Received 13 September 2016 Received in revised form 16 December 2016 Accepted 5 February 2017 Keywords: BK virus JC virus Chronic kidney failure Kidney transplantation Saliva Gingival crevicular fluid
a b s t r a c t Background: New clinical approaches to diagnose and monitor individuals with systemic diseases have been employed through the use of oral fluids. Polyomavirus BK (BKPyV) and JC (JCPyV) infect asymptomatically around 80% of general population worldwide remaining latent in the body. In case of immunosuppression, a replication can occur, leading to diseases. Objective: The aim of this study was to detect and quantify BKPyV and JCPyV in oral fluids of individuals with chronic kidney failure (CKF), kidney transplantation (KT) and controls compared with their detection in blood and urine, traditionally used for this test. Study design: Forty six subjects were included and distributed into 3 groups: 14 with CKF (Group 1), 12 with KT (Group 2) and 20 healthy individuals (Group 3). In a total, 315 samples were collected and analyzed through RT-PCR, being 151 of gingival crevicular fluid, 46 of saliva, 46 of mouthwash, 43 of blood and 29 of urine. Results: All subjects from group 1 were positive for BKPyV in at least one collected samples and 14% were positive for JCPyV. In Group 2, 91.7% were positive for BKPyV and 51.7% for JCPyV. Among subjects of Group 3, 80% were positive for BKPyV and 45% for JCPyV. Conclusions: Oral fluids exhibited high prevalence of BKPyV and JCPyV and were equally efficient compared to urine and blood. The use of oral fluids to detect these polyomaviruses enhances positivity in screening, even in cases of absence of viremia and especially in individuals who are not able to urinate. © 2017 Elsevier B.V. All rights reserved.
1. Background Recently, new clinical approaches for diagnosis and monitoring individuals with systemic diseases have been employed through the use of oral fluids, such as saliva, mouthwash, and gingival crevicular fluid (GCF) [1]. Oral fluids are easily collected and stored, safer than blood to handle, and have specific biomarkers, being ideal for early detection of diseases. Furthermore, molecular biological
Abbreviations: BKPyV, polyomavirus BK; JCPyV, polyomavirus JC; CKF, chronic kidney failure; KT, kidney transplantation; GCF, gingival crevicular flui. ∗ Corresponding author. E-mail addresses:
[email protected] (T. Castro), crisfi
[email protected] (M.C.D. Fink), marilia.fi
[email protected] (M. Figueiredo),
[email protected] (P.H. Braz-Silva),
[email protected] (C.M. Pannuti),
[email protected] (K.L. Ortega),
[email protected] (M. Gallottini). http://dx.doi.org/10.1016/j.jcv.2017.02.003 1386-6532/© 2017 Elsevier B.V. All rights reserved.
techniques applied to oral fluids are showing specificity and sensitivity similar to those obtained from samples of blood and urine [1–4]. GCF is an inflammatory interstitial transudate eliminated via gingival sulcus, produced in inflamed periodontal tissues or coming from the bloodstream [2,5]. It was showed in the literature that antibodies, cytotoxins and viruses, such as Cytomegalovirus, Epstein-Barr, Herpes simplex, Papillomavirus and HIV, can be found in GCF. For this reason, GCF could be a good alternative in the screening of infectious diseases[5,6]. BKPyV infects around 90% of general population and remains latent in urinary tract [7,8]. In the context of an immunosuppressive condition, BKPyV replicates and inducts inflammation, which may lead to diseases [9–11]. One of them is polyomavirus associated with nephropathy, characterized by dysfunction and loss of the kidney [10–12].
6
T. Castro et al. / Journal of Clinical Virology 89 (2017) 5–9
JCPyV affects asymptomatically up to 70% of healthy adults and remains latent in the kidney [13]. During immunosuppression, JCPyV can infect oligodendrocytes causing demyelination, known as progressive multifocal leukoencephalopathy (PML) [13–15]. PML is a rare and usually fatal disease characterized by physical disabilities, altered state of consciousness and visual disturbances [13]. Since both BKPyV and JCPyV remain latent in renal tissue, individuals with chronic kidney failure (CKF) or with kidney transplant (KT) are subjects of great interest to have the viruses-detection analyzed in order to prevent viral infection [14–16]. Early diagnosis and immunological status recovery are the treatment cornerstone of BKPyV and JCPyV infection [14]. Noninvasive screening can facilitate the detection of new cases and monitor previously known cases [16]. Few studies have demonstrated the detection of BKPyV and JCPyV in saliva of imnunocompetent and imunodeficient individuals [17–19]. To our knowledge, there are no studies that investigated their presence in GCF. The hypothesis of this study are that oral fluids are useful in BKPyV and JCPyV detection and that there is a concordance of viral detection in oral fluids and in urine and blood. 2. Objective The aim of this study was to investigate the presence of BKPyV and JCPyV in oral fluids (saliva, mouthwash and gingival crevicular fluid) of individuals with chronic kidney failure, kidney transplantation and healthy controls compared with their detection in blood and urine. 3. Study design 3.1. Subjects This case-control study was approved by the Research Ethics Committee of the University of São Paulo (USP) School of Dentistry, and all participants gave written informed consent. Forty-six subjects were enrolled and distributed into 3 age and sex matched groups: Group 1 was composed by 14 individuals with CKF on hemodialysis; group 2 was composed by 12 kidney transplanted individuals; and group 3 was the control group, composed by 20 healthy subjects. Demographic and basal data were collected, including information about frequency and duration of hemodialysis and immunosuppressive drugs. The inclusion criteria were being over 18 years old. Exclusion criteria included the use of antiviral drugs in 3 months before samples collection, being HIV positive, or had undergone multi-visceral transplant. The subjects of this study are part of a convenience sample, since they sought the Special Care Dentistry Center in University of São Paulo for dental treatment or who followed your relatives who came to our center and were invited to compose the control group. 3.2. Samples A total of 315 samples from the 46 participants were collected, being 151 of gingival crevicular fluid (GCF), 46 of saliva, 46 of mouthwash, 43 of blood, and 29 of urine. All types of samples were collected at the same appointment. The GCF was collected in 4 different sites in the mouth using ® PerioPaper (GCF Collection Strips − Oraflow Inc. New York, USA) that remained in the gingival margin for 30 s. The selected teeth were isolated to avoid the risk of contamination with saliva. ® Periopapers that were visibly contaminated with saliva or blood ® were excluded. The PerioPapers containing the GCF were placed
Table 1 Oligonucleotides and probes responsible for amplification of the fragments in realtime PCR. Sequence Forward Reverse BKPyV Probe JCPyV Probe
5 GAAACTGAAGACTCTGGACATGGA 3 5 GGCTGAAGTATCTGAGACT TGGG 3 CAAGCACTGAATCCCAATCACAATGCTC AGGATCCCAACACTCTACCCCACCTAAAAAGA
®
in a 2.0 mL) sterile plastic tube which contained 1 mL of TRIzol ® (TRIzol Reagent − Life Technologies, CA, USA). Approximately 3 mL of non-stimulated saliva was collected in a 50 mL Falcon tube through drainage method, being the first minute of collection dis®
carded. The mouthwash was done for 30 s with 5 mL of Listerine [20] and collected in a 50 mL Falcon tube. All oral fluid samples were aliquoted and frozen at −20◦ Celsius. Five milliliters of blood was collected and put in a tube containing coagulation factor which was centrifuged and serum was separated and analyzed for BKPyV and JCPyV. Urine was collected in subjects of Groups 2 and 3 but not from Group 1, because none of the 14 subjects of this group had preserved diuresis. 3.3. DNA extraction and quantitation by quantitative real-time PCR All samples were analyzed through real-time Polimerase Chain Reaction (RT-PCR) at Laboratory of Virology, Institute of Tropical Medicine of São Paulo. DNA extraction was performed using the QIAamp DNA extraction QIAGEN kit and the chosen protocol for RTPCR has been reported by Pal et al., 2006 [21] which uses specific primers and probes for gene encoding the Ag-T of BKPyV and JCPyV, yielding a fragment of 80pb (Table 1). The protocol employed has a high analytical sensitivity of the tests with a detection limit of 1000 copies per milliliter (cp/mL) of BKPyV and 600cp/mL of JCPyV. Moreover, the tests also show a 100% specificity in identifying such DNA polyomavirus [21]. 3.4. Statistical analyses ®
Statistical analysis was performed using PASW statistics program. Chi-square test and Freeman-Halton extension of the Fisher exact probability test were performed to access association between variables. One-way ANOVA was applied to compare means of virus count between the possibilities of association between groups. All tests were performed considering a significance level of 0.05. 4. Results Demographic and baseline characteristics of the subjects are resumed in Table 2. BKPyV was positive in at least one type of sample in 14 (100%) subjects from Group 1, in 11 (91.7%) from Group 2, and in 16 (80%) from Group 3. JCPyV was positive in at least one collected sample in 2 (14.3%) subjects from Group 1, in 5 (41.7%) from Group 2 and in 9 (45%) from Group 3. There was no significant difference in viral detection frequency of BKPyV or JCPyV among the 3 studied groups, considering all types of samples (p > 0.05) (Table 3). BKPyV was quantified in several samples of saliva, with average of 2,956cp/mL in group 1, 3,526cp/mL in group 2 and 3,421cp/mL in group 3, showing no significant difference among groups (p > 0.05). The same occurs in mouthwash and GCF (Table 3). BKPyV was quantified in blood (viremia) only in 2 subjects of Group 1 (1019 cp/mL), in 3 of Group 2 (average: 2414cp/mL; SD: 578) and in 3 of Group 3 (average: 3660cp/mL; SD: 2973). JCPyV was quantified in saliva
T. Castro et al. / Journal of Clinical Virology 89 (2017) 5–9
7
Table 2 Demographic characteristics and medical therapy of the participants. Group
(total n)
Gender
Group 1 (14 CKF) Group 2 (12 KT) Group 3(20 controls)
n (%)
Female
Male
7 (50%) 4 (33.3%) 14 (70%)
7(50%) 8 (66.6%) 6 (30%)
Mean age in years(SD)
Treatment
49 (11.2) 48 (7.8) 48 (9.49)
Hemodialysis Immunosuppressive drugs No therapy
Legend: (n) number of participants; (SD) standard deviation; (CKF) chronic kidney failure; (KT) kidney transplantation.
Table 3 Detection and viral load of BKPyV and JCPyV in all samples. Groups (total n)
Saliva n(%)
Mouthwash n(%)
Gingival Fluid n(%)
Urine n(%)
Blood n(%)
BKPyV
JCPyV
BKPyV
JCPyV
BKPyV
JCPyV
BKPyV
JCPyV
BKPyV
JCPyV
Group 1 (14)
7 (50%)
2 (14.3%)
