George J. MulliganSQ, Wei GuoSlI, Steven WormsleyS, and David M. Helfman$I(. From the $Cold Spring Harbor ~ r a t o ~ ,. Cold Spring Harbor, New York 11 ...
THEJOURNAL OF BIOLOGICAL CHEMISTRY 0 1892 by The American Society for Biochemistry and Molecular Biology, IRC.
VOl. 267,No.35, Issue of December 15, pp. 25480-25487,1992
Printed in U.S.A.
Polypyrimidine Tract Binding Protein Interacts with Sequences Involved in Alternative Splicing of &Tropomyosin Pre-mRNA* (Received for publication, June 25, 1992)
George J. MulliganSQ,Wei GuoSlI, Steven WormsleyS, and David M. Helfman$I( From the $Cold Spring Harbor ~ r a t oCold ~ ,Spring Harbor, New York 11724, the ~ ~ e and~ ~ e~v eul o p~ ~ nrBiobgy ta~ Graduate Promam, State University of New York, Stony Brook, and the TDepartment of Biochemistry and Cell Bwbgy, State University of New .York, Stony Brook; New York .I 1790
Previous studiesof alternative splicing of the rat @- cells, only a few non-snRNP factors have been identified that tropomyosin gene have shown that nonmuscle cells are required for splicing (Ast et al., 1991; Fu and Maniatis, contain factorsthat block the use of the skeletalmuscle 1990; Krainer and Maniatis, 1985; Krainer et al., 199Ob; exon 7 (Guo, W., Mulligan, G. J., Wormsley, S., and Patton et al., 1991; Perkins et al., 1986; Kramer and Utans, Helfman, D. M. (1991)Genes di Deu. 5, 2095-2106).1991; Zamore and Green, 1989, 1991). Proteins that interact Using an RNA mobility-shift assay we have identified with the 3”splice site include U2AF (U2 auxiliary factor), factors in HeLa cell nuclear extracts that specifically which is necessary for the binding of U2 snRNP to the branch interact withsequences responsible for exon blockage. point and for splicing complex assembly (Zamore and Green, Here we present the purification toapparent homogeneity of a protein that exhibits thesesequence specific 1989, 1991). In addition, a number of RNA-binding proteins RNA binding properties. This protein is identical to have been identified, some of which exhibit sequence-specific the polypyrimidine tract binding protein (PTB)which binding to pre-mRNA, and are associated with spliceosomes other studies havesuggested is involved in the recog- (Choi et al., 1986; Garcia-Blanco, 1989; Gerke and Steitz, nition andefficient use of $’-splice sites. PTB bindsto 1986; Patton et al., 1991; Tazi et aZ., 1986).Two proteins that two distinctfunctional elements within intron 6 of the UV cross-link to 5”splice sites may play a role in splice site @-tropomyosinpre-mRNA: 1)the polypyrimidine tract selection (Stolon and Berget, 1991). The critical pyrimidine sequences required for theuse of branch points asso- stretch also has specific interactions with hnRNP proteins ciated with the splicing of exon 7,and 2) the intron A1, C, and D (Bandziulus, 1989; Choi et al., 1986; Dreyfus, regulatory element that is involved in the repression 1986; Pinol-Roma et al., 1988), a 70-100-kDa intron binding of exon 7.Our results demonstrate that the sequence protein (Gerke and Steitz, 1986; Tazi et aL, 1986), and PTB are different thanpre- (Garcia-Blanco et al., 1989; Mullen et aZ., 1991; Patton et al., requirements for PTB binding viously reported and shows that PTB binding cannot 1991). In uitro experiments have indicated that USAF (Zabe predicted solely on the basis of pyrimidine content. more and Green, 1989, 1991), PTB (Patton et al., 1991), and I n addition, PTB fails to bind stably to sequences some hnRNP proteins (Choi et al., 1986; Mayedaand Krainer, within intron 5 and intron 7 of @-TMpre-mRNA, yet 1992; Sierakowski et al., 1986) can play a functional role in forms a stable complex with sequences in intron 6, which is not normally spliced in HeLa cells in vitro splicing. Despite the partial characterization of these activiand in vivo. The nature of the interactions of PTB ties it is still mechanistically unclear how they contribute to within this regulated intron reveals several new details the high degree of specificity and fidelity observed in general about thebinding specificity of PTB andsuggests that splice site selection. Considerable progress has been made on alternativesplicing PTB does not function exclusively in a positive manner in Drosophila, where genetic approaches haveallowed the in therecognition and use of 3‘-splice sites. identification and subsequent characterization of developmentally regulated proteins that specifically alter splicing patterns. In genes of the sex determination pathway, suppresThe splicing of pre-mRNA requires small nuclear ribonu- sor of white apricot and P element transposase, alternative cleoproteins (snRNPs; U1, U2, U4, U5 and U6),’ as well as a splicing is subject to regulation by factors that either inhibit large number of non-snRNP factors, and occurs in a complex or activatethe use of alternative 5’- or 3”splice sites (Hedley termed the spliceosome (Krainer and Maniatis, 1988; Green, andManiatis, 1991;McKeown,1990; Maniatis, 1991). For 1991; Guthrie, 1991; Rubyand Abelson, 1991). In mammalian example, the sex lethal(Sxl) protein is a female-specific activity that binds to sequences in the pre-mRNA and blocks * The costs of publication of this article were defrayed in part by the use of a particular 3”splice site (Hedley and Maniatis, the payment of page charges. This article must therefore be hereby 1991). This allows the use of a competing downstream 3’marked ~ ‘ a d v e r ~ ~ e in ~ naccordance t’’ with 18 U.S.C. Section 1734 splice site and theproduction of a protein required for femalesolely to indicate this fact. specific differentiation. In the suppressor of white apricot 11 Supported by Grants GM43049 and CA46370 from the National transcript a 3”splice site isblocked by the suppressor of white Institutes of Health, a grant from the Muscular Dystrophy Association, anda grant from the Council for Tobacco Research. An Estab- apricot protein, thereby autoregulating its own production lished Investigator of the American Heart Association. TO whom (Bingham et al., 1988). In contrast, much less is known about the cellular factors correspondence should be addressed Cold Spring Harbor Laboratory, P.O. Box 100, Cold Spring Harbor, NY 11724. Tel.: 516-367-8838; that mediate alternative splicing in vertebrate systems. TisFax; 516-367-8815. sue-specific regulators of splicing, similar to those identified l The abbreviations used are: snRNP, small nuclear ribonucleoprotein; PTB, polypyrimidine tract binding protein; 0-TM, P-tropomy- in Drosophila systems, have not yet been identified in mamosin; kb, kilobase(s); SDS-PAGE, sodium dodecyl sulfate-polyacryl- malian cells. The lack of functional systems that reproduce tissue-specific alternative splicing patterns in vitro has hindamide gel electrophoresis.
25480
25481
RNA-binding Proteins in Alternative Splicing
eredthe biochemical characterization of cell-type specific the distantbranch pointsused upstream of exon 7. The second factors (Maniatis,1991). At present, the only factors reported element is located between the polypyrimidine tract and the t o alteralternative splice selection include studies of the 3”splice site of exon 7. This region contains an important essential splicing factor ASF/SF2 and hnRNPprotein A1 (Ge determinant in alternative splice site selection, because deleand Manley, 1990; Krainer et al., 1990a; Mayeda and Krainer, tions or clustered point mutations in this regulatory element 1992). I n vitro studies have demonstrated that at high con- result in the use of the skeletal musclespecificexon in centrations ASF/SF2 promotes the use of proximal 5”splice nonmuscle cells (Guo et al., 1991; Helfman et al., 1990). sites (Ge and Manley, 1990; Krainer et al., 1990a), and the Extensive mutational analyses indicated that the critical cishnRNP protein A1 can antagonize this effect (Mayeda and acting elements that block the use of exon 7 in nonmuscle Krainer, 1992). These studies show that modulation of alter- cells are confined to sequences within exon 7 and theupstream native splice site selection can, in principle, be achieved by intron (Guo et al., 1991). Using partially purified protein changes in the levels of general splicing factors. fractions we found that theregulatory sequences in the intron We have been using the rat 8-tropomyosin (/3-TM) geneas upstream of exon 7 interact with RNA-binding proteins in a model system to study the molecular basis for developmental HeLa nuclear extracts (Guo et al., 1991). We also demonand tissue-specific alternative RNA splicing (Helfman et al., strated that mutations in the pre-mRNA that result in the 1986). This gene spans 10 kb of DNA with 11 exons and use of the skeletal muscle exon in vivo in HeLa cells, disrupt encodes two distinct isoforms (Fig. lA). Exons 1-5, 8, and 9 the binding of these proteins to thepre-mRNA in vitro (Guo are common to all mRNAs expressed from this gene. Exons et al., 1991). This led us to propose that nonmuscle cells 6 and 11 are used in fibroblasts as well as smooth muscle, whereas exons 7 and 10 are used exclusivelyin skeletal muscle. containfactors that interact with specific regulatory seOur previous studies of tropomyosin pre-mRNA splicing with quences in the pre-mRNA to block the use of the skeletal HeLa cell (nonmuscle) systems revealed an ordered pathway muscle exon. To further study the precise nature of the factors that of splicing in which either of the internalalternatively spliced interact with sequences in the 8-TM pre-mRNA, we have exons (exons 6 or 7) must first be joined to the downstream purified to apparent homogeneity a protein that interacts common exonbefore they can be spliced to the upstream common exon (Helfman et al., 1988). Characterization of the specifically with the intron regulatory element upstream of branch points used during in vitro splicing of exons 5 to 7 muscle specific exon 7. This protein is identical to the PTB (skeletal muscle type splice) revealed the use of multiple which otherstudies have indicated to be involvedin the branch points that are located an unusually long distance (> recognition and efficient splicing of 3”splice sites (Garcia140 nucleotides) from the 3”splice site of exon 7 (Helfman Blanco et al., 1989; Patton et al., 1991). Our analysis of several and Ricci, 1989). Subsequent investigations of the sequences different introns in the tropomyosin pre-mRNA indicates that between the 3”splice site of exon 7 and the distant branch PTB binds only to theintron upstream of the skeletal musclepoints demonstratedthat two distinct functional elements are specific exon 7. The nature of the interactions in this intron present in this region (Helfman et al., 1990). The first element reveals several new details about the binding specificity of comprises a polypyrimidine tract located 89-143 nucleotides PTB andsuggests that PTBdoes not function exclusively in upstream of the 3”splice site, which specifies the location of a positive manner in the recognition and use of 3”splice sites. A CAP SITE
5‘-UNTRANSLATED REGION
-
189
I 1
I
1
I
I
1
I
I
I
-
-
PdyA
258 - 284
213
V/BA
PolyA
I
I
V a
Skeletal muscle 6 - T M Fibroblast TM I (smoolh muscle)
B
Exon 5 G P G N X G U c C U 50 ~ ~ u a g g g a u a c c c c g g g u g u g a ~ “ g g a a c 100 g a augggaugauagaacucggccugagggcucagcggugggacccugggcac 150 aggcaguuccccaggccagaggccacaggaauaggcuuuguccucugau= 200 Exon 6 u a u g c c c g c u g c c c c c u g c c c c c a p 250
0 900 Oguaguagccucucuaggccuuucu~ggcaauggcac=uuuu=u=a~uuc 350 acgucccuccccagcucagcaucucaggcuacuacugucucucuccugcggua 400 f
*
*
ggagggggcgggggcggagcuuccaaacagccugcugucacucucauca~ 450 uuuqcucuucucuuuucuccuccuccccuccuccacuquqccaccccuc~500
cccu!&cccacccccucaccccgucgucgcgccaccccacu&cucacc
550
ucacugugcccucacgcu~auccugccacacgccc Exon c u g c7a g600 ~~ 650 4 OMOCCCUICX3UilCLLOgUauagW999eg999c9cgugugaggaaggg 700 gcugugccgagagqaggggagggcuu~9~agggagggcuaggugcu~aa 750 ugaagaucaacccggagccugagggguucagugucugcgaagguuucagg 800 Exon 8
aucacugaagcgguucacugscggcacggcacgu~uuu9ucucuuaaagUAWCC8 5 0
” WGGLGgugagacuacuucgcggaaacugagggg
...
900
FIG. 1. A , schematic diagram of the rat P-tropomyosin gene. Open boxes represent constitutive exons; hatched and solid boxes represent tissue-specific exons, as indicated. Horizontal linesrepresent introns(not drawn to scale). The amino acids encoded by each exon are indicated. The cap site and polyadenylation sites are also indicated. B , nucleotide sequence of the @-tropomyosinpre-mRNA. The nucleotide sequence of exon 5 through exon 8 are shown. The long polypyrimidine tract that functions to position the branch points upstream of exon 7 is underlined. The position of the lariat branch pointsused upstream of exon 7 are indicated by an asterisk above. The “Ex 7” probe is indicated by > and
