Positive Round Cell Sarcomas of soft tissue and bone

Received Date : 27-Jul-2015

Accepted Article

Revised Date : 29-Mar-2016 Accepted Date : 10-Apr-2016 Article type

: Original Article

CIC-DUX4 Fusion-Positive Round Cell Sarcomas of soft tissue and bone: a single institution morphologic and molecular analysis of 7 cases

Marco Gambarotti [1], Stefania Benini [1], Gabriella Gamberi [1, 2], Stefania Cocchi [1], Emanuela Palmerini [3], Marta Sbaraglia [4], Davide Donati [5], Piero Picci [1], Daniel Vanel [1], Stefano Ferrari [3], Alberto Righi [1], Angelo P. Dei Tos [1,4]

1. Department of Pathology, Rizzoli Institute, Bologna, Italy 2. Department of Biomedical and Neuromotor Science, University of Bologna, Italy 3. Department of Oncology, Rizzoli Institute, Bologna, Italy 4. Department of Pathology, Treviso Regional Hospital, Treviso, Italy 5. Department of Orthopaedic Oncology, Rizzoli Institute, Bologna, Italy

Running title: CIC-DUX4 Fusion-Positive Round Cell Sarcomas

Correspondence to: Alberto Righi, Istituto Ortopedico Rizzoli, Via di Barbiano 1/10, 40136, Bologna, Italy Tel: +39.051.6366665 Fax:+39.051.6366592, e-mail: [email protected]

This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as an 'Accepted Article', doi: 10.1111/his.12985 This article is protected by copyright. All rights reserved.

Conflicts of interest

Accepted Article

All authors affirm that we have no actual or potential conflicts of interest, including any financial, personal, or other relationships with other people or organizations.

Abstract Aims: Round cell sarcomas lacking specific translocations represent a diagnostic challenge. The aim of this study is to describe seven cases of CIC-DUX4 positive sarcomas, including the first reported example arising primarily in bone.

Methods and results: Patients ranged in age from 15 to 44 years (median: 33). Six cases arose from the soft tissues and one from the iliac bone. Morphologically, all cases showed an undifferentiated round cell population with greater atypia and pleomorphism than Ewing sarcoma. Immunohistochemically, all tumours showed focal and weak positivity for CD99 and 5/7 displayed nuclear and/or cytoplasmic positivity for WT1. Five patients had lung metastases at presentation. All patients received chemotherapy according to Ewing sarcoma protocols. All but one patient (the one with a bone tumour) died of disease after a mean of 14.5 months from the diagnosis (range: 8-20 months).

Conclusions: Our series confirms that CIC-DUX4 positive sarcomas are aggressive tumours with an adverse prognosis and with clinical, histological, and genetic differences compared to Ewing sarcoma. The best therapeutic approach needs to be investigated.

Key words: CIC, DUX4, Ewing sarcoma, round cell sarcoma

This article is protected by copyright. All rights reserved.

Accepted Article

Introduction Round cell sarcomas that lack the specific translocations of Ewing sarcoma (ES) or other round cell sarcomas (i.e. poorly differentiated round cell synovial sarcomas, high grade myxoid/round cell liposarcomas, alveolar rhabdomyosarcomas) represent a major diagnostic and therapeutic challenge. The latest WHO classification has recognized this problem by identifying a group of undifferentiated round cell sarcomas1. Broader use of molecular techniques, including next-generation approaches, has recently led to the description of new translocation-specific sarcomas1-3. Of particular relevance among the undifferentiated round cell sarcomas has been the identification of a high prevalence of CIC gene rearrangements. In this setting, CIC generally fuses with one of the DUX4 retrogenes, located either on 4q35 or 10q26.31. CIC-DUX4 fusion-positive round cell sarcomas (CDS) mimic ES clinically and histologically, but fail to demonstrate the cytogenetic abnormality of ES since they lack rearrangement of EWSR1 or other TET family members4. The CIC gene is the human homolog of the Drosophila gene capicua. It encodes a highmobility group box transcription and is involved in the development of the central nervous system1,

2, 5

. The DUX4 gene encodes for a double homeobox transcription factor, two

genomic copies of which are located within polymorphic macrosatellite repeats on 4q35 and 10q262, 5. Its normal function is poorly understood5, suppressed in differentiated cells1,

6

and its expression is normally

5, 6

. DUX4 has been involved in the pathogenesis of

fascioscapulohumeral muscular dystrophy7. The CIC-DUX4 fusion harbors the majority of the CIC gene and does not contain the homeodomains of DUX45. The CIC-DUX4 fusion product seems to act as an aberrant transcription factor with transforming capacity4, 8.


Kawamura-Saito et al8 demonstrated that when the C-terminal region of DUX4 fuses to CIC,

Accepted Article

the CIC–DUX4 chimera acquires transforming activity against NIH 3T3 fibroblasts, indicating that CIC–DUX4 acts as a dominant oncogene8. The transcriptional activity of CIC is enhanced as a result of the fusion, with subsequent deregulation of downstream targets. Specifically, the CIC-DUX4 fusion oncoprotein upregulates the PEA3 (polyoma enhancer activator-3) subfamily of ETS, including ETV1, ETV4, and ETV5l, thereby sharing its molecular pathogenesis in part with ES2,

4, 6, 8

. The transcriptional profile of CIC-DUX4-

positive sarcomas does, however, appear to be distinct from that of ES, in parallel with a somewhat distinctive morphology and different clinical behavior4, 9. CDS tend in the main to occur at extraskeletal sites. Interestingly, 92% of the reported rare variant translocations of EWSR1 (EWSR1-ETV1, EWSR1-ETV4, or EWSR1-FEV) also occur in soft tissue10.

Seventy-nine cases of CDS have been reported so far in the literature, mostly arising in deep or superficial soft tissue or, very rarely, in viscera1,

11-21

. Some of these cases are

characterized by molecular variants of the classic CIC-DUX4 translocation, including CIC and alternative fusion partners. A sarcoma harboring a t(18;19)(q23;q13.2) translocation has recently been reported22, thus raising the question of whether t(18;19) could be a variant of t(4;19). A case of CIC-FOXO4 translocation23 and one of t(4;22)(q35;q12) EWSR1-DUX4 have also been reported7. Interestingly, no primary bone tumour has yet been described.

The aim of this study was to retrospectively analyze all cases of ES and Ewing-like sarcoma of bone and soft tissue presenting at our Institute between 1982 and 2014 in order to identify cases of CDS.


Accepted Article

Material and methods Cases Between 1982 and 2014, 1209 cases of ES were diagnosed and treated at our center. Of these, 1108 cases occurred primarily in the bone and 101 in the soft tissue. All

cases

were

reviewed

morphologically

and

immunophenotypically

for

CD99

immunopositivity. In bone cases, the presence of EWSR1 or FUS gene rearrangements was systematically investigated from 2006 onwards (298 cases); before 2006, molecular analysis of the EWSR1 and FUS gene was instead performed on the bone cases for which frozen material was available (82 cases). Molecular testing for EWSR1 and FUS gene was performed in all soft tissue neoplasms. The CIC-DUX4 fusion transcript was tested by RT-PCR in cases negative for EWSR1 and FUS gene rearrangements evaluated by RT-PCR and FISH. All the CIC-DUX4 positive cases were further tested by reverse transcription quantitative PCR (RT-qPCR), gene sequencing, and by FISH analysis with CIC break apart probe. All procedures were performed in compliance with relevant legislation and institutional guidelines and were approved by the appropriate institutional committee in May 2015.

Immunohistochemistry The tissue was fixed in 4% buffered formalin, routinely processed and embedded in paraffin; 4μm-thick tissue sections were cut, heated at 58°C for 2 hours, deparaffinized and immunostained on a Ventana BenchMark following the manufacturer’s guidelines (Ventana Medical Systems, Tucson AZ, USA or Dako Autostainer Plus, Dako Glostrup, Denmark). The sections were immunostained with the following antibodies: CD99 (Ventana, Monoclonal antibody O13, prediluted) and WT1 (Cell Marque, Mouse Monoclonal Antibody,


6F-H2, prediluted). Antibody detection was performed using UltraView Universal DAB

Accepted Article

Detection Kit (Ventana Medical Systems, Tucson AZ, USA). Pretreatment for antigen retrieval was performed at 95°C with Tris-EDTA ph 8 for 20 minutes. When necessary, endogenous tissue peroxidase was blocked by treating the sections with 0.3% H2O2. The slides were stained with hematoxylin and then rehydrated and coverslipped. Appropriate positive and negative controls were included in each run.

Molecular Methods Total RNA was extracted from the specimens which frozen material was available using a modified method including Trizol Reagent (Invitrogen, Carlsbad, CA, USA) and RNeasy Mini Kit spin columns (Qiagen GmbH, Hilden, Germany). Sections from the frozen specimens were stained with H&E and examined under light microscopy to evaluate tumour cellularity. The purity of the RNA was determined by the ratio of its spectophotometry readings at 260 and 280 nm (A260/A280). The RNA (from 0.1μg to 3μg) was then reverse transcribed to cDNA using Super Script VILO Master Mix (Applied Biosystems, Foster City, CA, USA). The PCR was performed in a total volume of 25 μl, with each reaction mixture using Ampli Taq Gold 360 Master Mix (Invitrogen, Carlsbad, CA, USA), 0.4mM of each sense and antisense primer. PCR was carried out to detect t(11;22) EWSR1-FLI1, t(21;22) EWSR1-ERG, t(7;22) EWSR1-ETV1, t(17;22) EWSR1-E1AF,

t(2;22) EWSR1-FEV, t(4;19) and t(10;19) CIC-

DUX4 rearrangements (the primers used are listed in Table 1). RNA integrity was assessed with primers for the housekeeping genes β-actin (220bp, see Table 1 for primer sequences) for RT-PCR and albumin (180bp, gene expression assay Hs00897003_m1, ref seq NM_000477.5 Thermo Fisher Scientific, Waltham, MA) for RT-qPCR. Negative controls (RNA from normal tissue or other types of tumours, and a water blank) were included in each RT-PCR reaction. Amplicons were identified by 2% agarose gel electrophoresis followed by Gel Star (Lonza, Rockland ME, USA) staining. The RT-qPCR analysis was


carried out in the samples positive for CIC-DUX4 fusion transcript in RT-PCR. The RT-qPCR

Accepted Article

analysis was performed using forward primer CICex19 (Table 1), reverse primer DUX4ex2q 5’

CCGCGGAGTGGAGTCTCT

and

CIC

break

apart

probe

5'

FAM-

TCAGGACCATGGCTTCTTC-MGB in a total volume of 25 μl, with 1X TaqMan Universal Master Mix II with UNG (Invitrogen, Carlsbad, CA, USA), 0.9 μM of each sense and antisense primer, and 0.5 μM of probe. PCR reactions were carried out using an initial denaturing step (95°C for 10 min) followed by 44 cycles of amplification including denaturation (95°C for 15 sec) and annealing/extension (60°C for 1 min). qRT-PCR was performed using STEPONE (Applied Biosystems, Foster City, CA, USA), according to the manufacturer’s protocol.

Sequencing of RT-PCR Products The cases testing positive for CIC-DUX4 were analyzed by automatic sequencing. RT-PCR products, performed with forward primer CICex19 and reverse primers DUX4ex2, were separated by electrophoresis on 2% agarose gel and purified using QIAquick, following the manufacturer’s guidelines (Qiagen GmbH, Hilden Germany). The sequencing was performed

by

Bio-Fab

Research

(http://www.biofabresearch.it/index2.html,

(Bio-Fab

Research,

Rome,

Italy)

accessed 14/01/16). Computer analysis of

sequences was conducted by Basic Local Alignment Search Tool (BLAST) sequence similarity searches, using the National Center of Biotechnology Information Database, NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed 14/01/2016) and compared with the sequences of CIC (NM_015125.4, 19-MAR-2015) and DUX4 (NM_001293798.1, 31-DEC2015).


Fluorescence in situ hybridization (FISH)

Accepted Article

FISH analysis for EWSR1 and FUS genes was carried out using the EWSR1 (22q12) and FUS (16p11) VYsis LSI Dual Color break-apart DNA probes (Abbott Molecular, Des Plaines, IL, USA), and CIC break-apart probes (Empire Genomics, Buffalo, NY, USA), according to the manufacturers’ protocols. 4-μm tissue sections were mounted on positively charged slides (Menzel-Glaser Superfrost Plus, Gerhard Menzel GmbH – Braunschweig, Germany), a hematoxylin-eosin stained section from each tumour was prepared, and areas of representative non-necrotic neoplasm were marked. Sections were deparaffinized with xylene and treated with TE solution (TRIS 5 mM-EDTA 1 mM) at 96°C for 15 minutes, rinsed in distilled water, and digested with pepsin (0.04%) in 0.01N HCl at 37°C for 10 to 15 minutes. The samples and probes were co-denaturated in a Dako Hybridizer (Dako, Glostrup, Denmark) at 85°C for 1 minute and incubated overnight at 37°C. The following day, the coverslips were removed and the slides were washed for 2 minutes at 73°C ±1°C in 0.4 X SSC/0.3%NP40 and for 1 minute at room temperature in 2 X SSC/0.1% NP40. Tissue sections were then left to dry in the dark at room temperature, counterstained with DAPI I (Vector Laboratories, Inc. Burlingame CA, USA), and examined with a fluorescence microscope (Olympus, Hamburg Germany) at 100X under oil immersion using an appropriate filter set. A minimum of 100 tumour cell nuclei with intact morphology, as determined by DAPI counterstaining, were counted in the previously marked neoplastic area. A positive result was defined as the presence of a visible translocation (separation of red and green signals > 3 signal diameters) in more than 10% of the cells.


Accepted Article

Results Cases We found 51 cases (21 soft tissue and 30 bone lesions) that were negative for EWSR1 and FUS gene rearrangements evaluated by RT-PCR and/or FISH.

In these 51 cases we tested by RT-PCR for CIC-DUX4 chimeric transcript: 25 were negative and 7 showed the CIC-DUX4 chimeric transcript (Figure 1A and Table 2). The remaining 19 cases were not adequate due to the absence of representative tissue or failure to amplify the housekeeping genes.

All positive cases were sequenced. Two different fusion points were identified, which differed in respect to fusion points in CIC. In 5 cases (case 1,2,3,6 and 7) CIC exon 20, nucleotide 4552 was fused with DUX4 exon 2, nucleotide 1284; in 2 cases (case 4 and 5) CIC exon 20, nucleotide 4579 was fused with DUX4 exon 2, nucleotide1284 (Figures 1B and 2).

All 7 positive cases were confirmed by RT-qPCR (Figure 1C and Table 2); all but one case (not evaluable by FISH) showed CIC rearrangements (Figure 1D and Table 2).

Patients with CDS ranged in age from 15 to 44 years (median: 33). The male to female ratio was 3:4. Three cases arose from deep or superficial soft tissues of limbs (3/7), three from soft tissues of the trunk/hip/shoulder girdle (3/7), and 1 case (1/7) arose from the iliac bone, and represents the first primary bone CDS described in the literature.


Imaging

Accepted Article

Imaging was available in all patients: radiographs, angiography, bone scan, CT-scan, and MRI. The bone lesion was purely lytic, well-circumscribed with a thin rim of peripheral sclerosis, without a periosteal reaction. It destroyed the cortex extensively, invading the soft tissues (Figure 3). The imaging of soft tissue tumours was very variable: heterogeneous on injected CT, T2W and injected MRI images (Figure 4 A-D). No calcifications were seen. Bone invasion was observed in two soft tissue cases.

Histopathology All cases were composed of a rather undifferentiated round cell population featuring abundant geographic necrosis (Figure 5A). In contrast to classic ES, greater atypia and pleomorphism were seen (Figure 5B). Cytoplasm tended to be larger, assuming epithelioid morphology in some cases and carcinoma–like morphology was observed in one case (Figure 5C). Tumour cells frequently featured clear cytoplasm (Figure 5D) and were arranged in nodules separated by fibrous septa (Figure 5E). Three cases showed remarkable myxoid changes of the stroma (Figure 5F). In two cases, the neoplastic cells exhibited spindle cell morphology. One case showed “rhabdoid” features represented by paranuclear cytoplasmic condensation (Figure 5G). Immunohistochemically, the tumours were only focally positive or negative for CD99 (Figure 5H), and all but two showed cytoplasmic and/or nuclear immunoreactivity for WT1 (n-terminus).

Treatment and follow-up All patients were referred to and treated in our Institute between 1984 and 2009. The related clinical, treatment and pathological data, summarized in Table 2, were as follows:


Case 1: A 44-year-old woman with a localized bone tumour, arising from the supra-

Accepted Article

acetabular region of the right hip. The patient underwent neoadjuvant chemotherapy with doxorubicin (DOX), ifosfamide (IFO), cyclophosphamide (CTX), vincristin (VCR), etoposide (ETO) at standard doses, due to age23. She underwent preoperative radiotherapy and wide tumour resection one month after the end of chemotherapy. Necrosis was 71% and she is alive and disease free after about 6 years. Case 2: A 23-year-old male with bilateral lung metastases from a soft tissue mass in the left iliac region. He underwent chemotherapy according to the ISG-SSG IV protocol24, with busulphan (BU) and melphalan (CY), together with stem cell support, achieving a radiologically complete response in the lungs. Treatment of the primary tumour consisted of a combination of preoperative radiotherapy (30 Gy), followed by surgery at the end of treatment, with 60% necrosis. Lung recurrence occurred after 6 weeks and the patient died 16 months after diagnosis. Case 3: A 32-year-old male with lung metastases from a soft tissue mass in the left foot. The disease never responded to treatment: 1st line hyper-VAI (IFO, VCR, DOX), CE (CTX, ETO); 2nd line HDIFO (15gr/m2 IFO); 3rd line: TEMIRI (temozolamide, irinotecan). Necrosis after leg amputation was 30%. He died of disease after 8 months. Case 4: A 40-year-old female undergoing wide primary resection of a subcutaneous dorsal lesion. She underwent postoperative standard dose chemotherapy23, developing scalp and lung metastases. She died 18 months after diagnosis. Case 5: A 34-year-old female presenting with lung metastases from a soft tissue lesion in the left leg. She underwent primary chemotherapy according to the ISG-SSG IV protocol25, achieving a complete response. Primary tumour treatment was preoperative radiotherapy, followed by excision (necrosis 38%). After 1 year, due to local relapse, she underwent thigh amputation and died after 20 months.


Case 6: A 15-year-old female presenting with bilateral lung metastases (max size 3 cm)

Accepted Article

from a soft tissue lesion in the right shoulder. She underwent primary chemotherapy according to the ISG-SSG IV protocol25, achieving a complete response. Primary tumour treatment was radiation therapy. The patient died after 12 months from lung disease. Case 7: A 33-year-old male with lung metastases from a left thigh soft tissue tumour. He underwent intralesional surgery, then chemotherapy (DOX, IFO, CTX, VCR, ETO) at standard doses24. Six months later he underwent new surgery for local recurrence and salvage chemotherapy with high dose IFO (3 gr/m2/die for 5 days) due to lung metastasis progression. He died of disease 13 months after diagnosis.

Discussion CDS represents a well described entity, with 59 cases reported in the literature1, 11-20. In the current WHO classification they are still embedded within the group of “undifferentiated round cell sarcomas”. However, clinical, morphologic, immunohistochemical and molecular evidence suggests that they should be considered a distinct entity compared to ES4, 26. The anatomic distribution is different, with CDS occurring almost exclusively in the soft tissues of the extremities and trunk, and rarely at visceral sites, whereas ES more frequently arise in the bone19, 23, 26. CDS mainly affect young adults with a peak incidence in the third decade, whereas ES occur in a younger population (mean age at diagnosis, 15 years)1, 26. Some distinctive morphologic features of ES, such as Homer-Wright rosettes, have never been reported in CDS, whereas the morphologically distinctive features frequently observed in CDS (i.e. myxoid change of the stroma, nuclear spindling and overt multifocal cytologic atypia) are very rare in ES1, 19, 26.


Accepted Article

The immunophenotype of CDS is also distinct from ES, with CD99 being diffusely positive in only 25% of cases,2,

19, 26

, but only rarely showing the distinctive strong thick membrane

positivity typical of ES. In all our cases, CD99 was negative or focal and/or weak (Figure 5H). Cytoplasmic and/or nuclear positivity for WT1 is described in CDS1, 26 and not in ES. We herein report 7 new cases of CDS with genetic confirmation. All but one case arose primarily in the soft tissue. One case originated from the right acetabulum, thus representing the first primary bone CDS reported to date. Interestingly, this is the only patient in our series who is alive and disease-free. All tumours in our series matched the morphologic features of CDS as described in the literature1, 2, 9, 19,

26

. All cases variably featured nuclear atypia, clearing of cytoplasm, and

myxoid changes of the stroma. One case had “carcinoma-like” areas and one “rhabdoid” features of the neoplastic cells. All tumours in our series showed only focal and/or weak positivity or negativity for CD992, 19, 26

. As shown elsewhere by others, all but two tumours in our series and other cases in the

literature26 displayed nuclear and/or perinuclear/cytoplasmic positivity for WT1. Our data further confirm that CDS are characterized by remarkably distinctive morphologic features that allow them to be separated from ES, and may prompt pertinent confirmatory molecular analysis. All cases received multidrug chemotherapy according to ES standard protocols24-26. For all patients undergoing surgical removal of the primary tumour after preoperative chemotherapy, tissue response was evaluated according to the Bologna System designed for ES27, and all were poor responders.


In 6 metastastic patients with RECIST measurable disease, the objective responses were

Accepted Article

impressive, with 3 (50%) patients achieving a complete radiologic response. These responses were nonetheless short-lasting, with all patients relapsing and dying of disease within 2 years of initial diagnosis. This supports the literature, with cases occasionally showing complete remission after standard chemotherapy for ES, while the majority appear to be less sensitive than ES, showing rapid progression and higher disease-associated mortality1, 2, 4, 20. Our data demonstrate that these patients do respond to drugs approved for ES, but the short PFS interval might suggest considering “maintenance” treatment strategies in this subset of patients.

Conclusions We describe seven new cases of CDS, and also report the very first example of primary bone CDS. CDS appear to be a homogeneous morphologic and molecular group of round cell sarcomas clinically, histologically, and genetically distinct from ES. Morphologic features such as myxoid stromal change, nuclear atypia and clear cell cytology seem to predict the presence of a CIC-DUX4 translocation. Our series confirms that CDS are very aggressive tumours, often presenting with lung metastases at onset and generally marked by a dismal prognosis. Further studies are needed to investigate the best neo-adjuvant and adjuvant chemotherapeutic approach. In any event, when included in clinical protocols designed for ES, it seems justified to evaluate these patients separately.


Accepted Article

Bibliography 1.

Antonescu C. Round cell sarcomas beyond ewing: Emerging entities. Histopathology

2014; 64: 26-37. 2.

Marino-Enriquez A, Fletcher CD. Round cell sarcomas - biologically important

refinements in subclassification. Int J biochem Cell Biology 2014; 53: 493-504. 3.

Panagopoulos I, Gorunova L, Bjerkehagen B, Heim S. The "grep" command but not

fusionmap, fusionfinder or chimerascan captures the cic-dux4 fusion gene from whole transcriptome sequencing data on a small round cell tumour with t(4;19)(q35;q13). PloS One 2014; 9: e99439. 4.

Wei S, Siegal GP. Round cell tumours of bone: An update on recent molecular

genetic advances. Adv Anat Pathol 2014; 21: 359-372. 5.

Yoshimoto M, Graham C, Chilton-MacNeill S et al. Detailed cytogenetic and array

analysis of pediatric primitive sarcomas reveals a recurrent cic-dux4 fusion gene event. Cancer Genet Cytogenet 2009; 195: 1-11. 6.

Kajtar B, Tornoczky T, Kalman E, Kuzsner J, Hogendoorn PC, Szuhai K. CD99-

positive undifferentiated round cell sarcoma diagnosed on fine needle aspiration cytology, later found to harbour a cic-dux4 translocation: A recently described entity. Cytopathology 2014; 25: 129-132. 7.

Sirvent N, Trassard M, Ebran N, Attias R, Pedeutour F. Fusion of EWSR1 with the

DUX4 facioscapulohumeral muscular dystrophy region resulting from t(4;22)(q35;q12) in a case of embryonal rhabdomyosarcoma. Cancer Genet Cytogenet 2009; 195: 12-18. 8.

Kawamura-Saito M, Yamazaki Y, Kaneko K et al. Fusion between CIC and DUX4 up-

regulates PEA3 family genes in ewing-like sarcomas with t(4;19)(q35;q13) translocation. Hum Mol Genet 2006; 15: 2125-2137.


9.

Smith SC, Buehler D, Choi EY et al. CIC-DUX sarcomas demonstrate frequent MYC

Accepted Article

amplification and ETS-family transcription factor expression. Mod Pathol 2015; 28: 57-68. 10.

Wang L, Bhargava R, Zheng T et al. Undifferentiated small round cell sarcomas with

rare ews gene fusions: Identification of a novel ews-sp3 fusion and of additional cases with the ews-etv1 and ews-fev fusions. J Mol Diagn 2007; 9: 498-509. 11.

Alaggio R, Bisogno G, Rosato A, Ninfo V, Coffin CM. Undifferentiated sarcoma: Does

it exist? A clinicopathologic study of 7 pediatric cases and review of literature. Hum Pathol 2009; 40:1600-1610. 12.

Graham C, Chilton-MacNeill S, Zielenska M, Somers GR. The CIC-DUX4 fusion

transcript is present in a subgroup of pediatric primitive round cell sarcomas. Hum Pathol 2012; 43: 180-189. 13.

Haidar A, Arekapudi S, DeMattia F, Abu-Isa E, Kraut M. High-grade undifferentiated

small round cell sarcoma with t(4;19)(q35;q13.1) CIC-DUX4 fusion: Emerging entities of soft tissue tumours with unique histopathologic features--a case report and literature review. Am J Case Rep 2015; 16: 87-94. 14.

Rakheja D, Goldman S, Wilson KS, Lenarsky C, Weinthal J, Schultz RA.

Translocation (4;19)(q35;q13.1)-associated primitive round cell sarcoma: Report of a case and review of the literature. Pediatr Dev Pathol 2008; 11: 239-244. 15.

Richkind KE, Romansky SG, Finklestein JZ. T(4;19)(q35;q13.1): A recurrent change

in primitive mesenchymal tumours? Cancer Genet Cytogenet 1996; 87: 71-74. 16.

Roberts P, Browne CF, Lewis IJ et al. 12q13 abnormality in rhabdomyosarcoma. A

nonrandom occurrence? Cancer Genet Cytogenet 1992; 60: 135-140. 17.

Bielle F, Zanello M, Guillemot D et al. Unusual primary cerebral localization of a cic-

dux4 translocation tumour of the ewing sarcoma family. Acta Neuropathol 2014; 128: 309-


311.

Accepted Article

18.

Machado I, Cruz J, Lavernia J et al. Superficial EWSR1-negative undifferentiated

small round cell sarcoma with CIC/DUX4 gene fusion: A new variant of ewing-like tumours with locoregional lymph node metastasis. Virchows Arch 2013; 463: 837-842. 19.

Choi EY, Thomas DG, McHugh JB et al. Undifferentiated small round cell sarcoma

with t(4;19)(q35;q13.1) cic-dux4 fusion: A novel highly aggressive soft tissue tumour with distinctive histopathology. Am J Surgical Pathol 2013; 37: 1379-1386. 20.

Italiano A, Sung YS, Zhang L et al. High prevalence of CIC fusion with double-

homeobox (DUX4) transcription factors in EWSR1-negative undifferentiated small blue round cell sarcomas. Genes Chromosomes Cancer 2012; 51: 207-218. 21.

Yoshida A, Goto K, Kodaira M, et al. CIC-rearranged Sarcomas: A Study of 20

Cases and Comparisons With Ewing Sarcomas. Am J Surg Pathol 2016; 40: 313-323. 22.

Riccardi GF, Stein C, de la Roza G, Damron TA. Newly described translocation

(18;19)(q23;q13.2) in abdominal wall soft-tissue tumour resembling ewing sarcoma/primitive neuroectodermal tumour. Cancer Genet Cytogenet 2010; 201: 1-5. 23.

Sugita S, Arai Y, Tonooka A et al. A novel CIC-FOXO4 gene fusion in

undifferentiated small round cell sarcoma: A genetically distinct variant of ewing-like sarcoma. Am J Surg Pathol 2014; 38: 1571-1576. 24.

Bacci G, Balladelli A, Forni C et al. Adjuvant and neoadjuvant chemotherapy for

ewing sarcoma family tumours in patients aged between 40 and 60: Report of 35 cases and comparison of results with 586 younger patients treated with the same protocols in the same years. Cancer 2007; 109: 780-786. 25.

Luksch R, Tienghi A, Hall KS et al. Primary metastatic ewing's family tumours:

Results of the italian sarcoma group and scandinavian sarcoma group ISG/SSG IV study


including myeloablative chemotherapy and total-lung irradiation. Ann Oncol 2012; 23: 2970-

Accepted Article

2976. 26.

Specht K, Sung YS, Zhang L, Richter GH, Fletcher CD, Antonescu CR. Distinct

transcriptional signature and immunoprofile of CIC-DUX4 fusion-positive round cell tumours compared to EWSR1-rearranged ewing sarcomas: Further evidence toward distinct pathologic entities. Genes Chromosomes Cancer 2014; 53: 622-633. 27.

Picci P, Rougraff BT, Bacci G et al. Prognostic significance of histopathologic

response to chemotherapy in nonmetastatic ewing's sarcoma of the extremities. J Clin Oncol 1993; 11: 1763-1769.

Author contributions Marco Gambarotti, Alberto Righi, Piero Picci performed the research. Angelo Paolo Dei Tos, Daniel Vanel designed the research study. Stefania Benini, Gabriella Gamberi, Stefania Cocchi performed the immunohistochemical and the molecular analysis. Stefano Ferrari, Davide Donati contributed essential clinical data. Marco Gambarotti, Alberto Righi, Marta Sbaraglia, Angelo Paolo Dei Tos, Daniel Vanel wrote the paper.

Figure legends: Figure 1 (A) Identification of CIC-DUX4 chimeric transcript by RT-PCR analysis (M,100bp DNA Ladder; C-, negative control). (B) DNA sequence analysis showing CIC-DUX4 gene fusion with two different break points (case 1 on left side; case 4 on right side). (C) RT-qPCR with positive results for CIC-DUX4 gene fusion compared to the housekeeping gene (albumin) (case 1) (D) FISH analysis revealed the presence of CIC rearrangement (arrows) (case 1).


Figure 2 Nucleotide sequences of CIC and DUX4 genes with primer sequences and

Accepted Article

translocation breakpoints. Top, Partial nucleotide sequence of the CIC gene (RefSeq NM_015125.4), with CICex19 forward primer sequences underlined and two different translocation breakpoints (▼ ) on position 4552 and 4579. Bottom, Partial nucleotide sequence of the DUX4 gene (RefSeq NM_001293798.1) with DUX4ex2 reverse primer sequences underlined and the translocation breakpoint (▼ ) after nucleotide 1284. In grey is the sequence of the probe and in bold is the reverse primer, used on RT-qPCR.

Figure 3 (case no. 1): A CT without contrast medium injection. Purely lytic tumour of the iliac bone, destroying the cortex and invading the soft tissues. Figure 4 (case no. 2): (A) CT with contrast medium. Heterogeneous tumour of the pelvis and root of the thigh. Coronal MRI examination, T1W (B: TR/TE: 450/15), proton density with fat presaturation (C: TR/TE: 1200/40), and T1W after contrast medium injection (d: TR/TE: 450/15). Heterogeneous mass, with limited peritumoural edema in the soft tissues and pubis bone. Figure 5 Morphologic features of CIC-DUX4 fusion-positive round cell sarcoma observed in our cases. (A) At low power, most tumours are composed of sheets of undifferentiated round cells surrounding areas of confluent coagulative necrosis (geographic necrosis). (B) In contrast with wing sarcoma, multifocal nuclear

atypia is often seen. (C) Epithelioid

morphology represents a relatively common feature of CIC-DUX4 fusion-positive round cell sarcoma. (D) Clear cell change is frequently observed. (E) Tumour nodules are separated by fibrous septa. (F) Myxoid changes of the stroma were observed in three cases. (G) One case showed abundant eosinophilic cytoplasm featuring “rhabdoid type” intracytoplasmic inclusions. (H) Focal positivity for CD99 in neoplastic cells.


ccepted Articl

Table 1: Primer sequences. Primer name

Primer name

Forward primers

F-EWS 22ex7

5’ TCCTACAGCCAAGCTCCAAGTC

R-FLI1 11ex9

5’ACTCCCCGTTGGTCCCCTCC

t(21;22)

EWS Lew

5’CCAAGTCAATATAGCCAACAG

ERG Lew

5’TCCAGGAGGAACTGCCAAAG

t(7;22)

F-EWS 22ex7

5’TCCTACAGCCAAGCTCCAAGTC

ETV1 7ex12 5’TAGTAATAGCGGAGTGAACGGC

F-EWS 22ex7


E1AF 17ex12

F-EWS 22ex7


R-FEV 2ex3 5’TAGCGCTTGCCATGCACCTT

CICex19

5’GAGGACGTGCTTGGGGAGCTAGAGT

DUX4ex2

5’CCGCGGAGTGGAGTCTCTCACCG

CICex19

5’GAGGACGTGCTTGGGGAGCTAGAGT

DUX42R2

5´CGCTGTGTGGAGTCTCTCACCG

β-actin F

5’AAAGACCTGTACGCCAACACAGTGCTGTCTGG

β-actin R

5’CGTCATACTCCTGCTTGCTGATCCACATCTGC

t(11;22)

t(17;22)

t(7;22) t(4;19)

t(10;19)

β-actin


Reverse primers

5’GCTGGCCGGTTCTTCTGGATGC

ccepted Articl

Table 2: Clinicopathologic features of cases showing the CIC-DUX4 chimeric transcript

RECIST

Age/

N

Site

IHC

RT-qPCR/

Stage

Treatment

Chemotherapy

neoCT, RT/surgery

ADM, IFO, CTX, VCR, ETO

Sex

44/F

(bone)

CD99 +f, WT1 +f

+/+

Localized

2

23/M

left iliac region

CD99 +f, WT1 -

+/+

Lung Mets

3

32/M

left foot

CD99 +f, WT1 +f

+/+

Lung Mets

4

40/F

trunk

CD99 +f, WT1 +

+/+

Localized

CD99 +f, WT1 -

+/NE

5

34/F

Necrosis

SD

71%

Pattern of Relapse / Progression

Yes

NA

Yes

Lung Mets

No

Lung Mets

Outcome (months)

FISH

right ileum

1

Best response

Complete Remission

left leg

CT, pre-RT, surgery

CT, surgery

surgery, CT

Lung Mets

CT, pre-RT, surgery


hyper-VAI + CE

hyper-VAI , CE, HDIFO, TEMIRI


hyper-VAI + CE

CR

PD

60%

30%

NED 70

DOD 16

DOD 8

Lung Mets,

NA

DOD 18 NA

(no neoCT)

Yes

Scalp Met

CR

38%

Yes

Local Recurrence

DOD 20

ccepted Articl 6

7

15/F

33/M

NA

right shoulder

CD99 +f, WT1 +

+/+

left thigh

CD99 +f, WT1 +

+/+

Lung Mets

CT, RT

hyper-VAI + CE

CR

No

Lung Mets

DOD 12

(no surgery)

surgery, Lung Mets CT


NA PD

No

Local Recurrence,

(no neoCT) Lung Mets

Legend: NE=not evaluable, DOD=dead of disease, NED=no evidence of disease, NA=not applicable, f=focally, CT=chemotherapy, RT=-radiotherapy, neoCT =neoadjuvant chemotherapy, adj=adjuvant, pre=preoperative, Mets=metastases, CR: complete response, ADM=adrimycin, IFO=ifosfamide, CTX=cyclophospamide, VCR=vincristin, ETO=etoposide, hyper-VAI =VCR, ADM, IFO, CE=CTX, ETO, HDIFO=15gr/m2 IFO, TEMIRI=temozolamide, irinotecan


DOD 13

Accepted Article This article is protected by copyright. All rights reserved.

