Primary Structure of Two P-type ATPases Involved in Copper ...

2 downloads 0 Views 2MB Size Report
Jun 15, 2006 - zymes such as lysyl oxidase, cytochrome c oxidase, superoxide dismutase, or dopamine p-hydroxylase. However, copper is very toxic to both ...

Vol. 268, NO. 17, Issue of June 15, PP. 12775-12779, 1993 Printed in U.S.A.

THEJOURNAL OF BIOLOGICAL CHEMISTRY 0 1993 by The American Society for Biochemistry and Molecular Biology, Inc

Primary Structureof T w o P-type ATPases Involved in Copper Homeostasis in Enterococcus hirue* (Received for publication, February 18, 1993, and in revised form, March 29, 1993)

Alex Odermatt$, Heinrich Sutert., Reto Krapfs, and Marc SoliozH From the $Department of Clinical Pharmacology, University of Berne, 3010 Berne a n d the $Cantonal Hospital of St. Gallen, 9007 St. Gallen, Switzerland

of these enWe cloned an operon, copAB, from Enterococcus tivebacteriumEnterococcushirae.Expression hirae encoding two P-type ATPases of 727 and 745 zymes is regulated bythe ambient copper concentration. CopA shows extensive sequence similarity to the recently cloned huamino acids,respectively.Bothenzymesdisplay heavy metal ion binding motifs in their polar N-ter- man Menkes gene that encodes a P-type ATPase, believed to be a copperpump.Copper-translocating ATPases represent a minalregion.WithanantibodyagainstCopB,we copshowed on Western blots that expression of the op- novel mechanism by which cells regulate their cytoplasmic eron is induced byeither lowor high ambient copper per concentration. concentrations. Disruptionof the copA gene renders MATERIALSANDMETHODS the cells dependent, whereas copper disruption of copB results in a copper-sensitive phenotype. CopA The copB gene has been clonedinadvertently from a genomic E. hirae exhibits 35% sequence similarity to CopBand 43% gene bank in E. coli while trying to clone the gene of a potassium similaritytothe ATPaseencodedbytherecently ATPase, using an antiserumwith low specificity(11).The original clone, cloned human Mcl gene, a gene responsible for the pZ3, did not contain the complete copAR sequence and was extended Menkes inborn error of copper metabolism. Ourre- upstream by chromosome crawling. For this, the genomic PvuI fragsults imply that CopA and CopB are heavy metalion ment, whose 3’-end would overlap with our clone, was amplified and ATPases that regulate the cytoplasmic copperactiv- cloned as follows. Total genomicE. hirae DNA was digested with PuuI ity, withCopA serving in the uptake and CopBin the and circularized with T4 ligase. The unknown region of the desired circularized P u u I fragment was then amplified by the polymerase chain extrusion of copper. reaction, primed from within the known sequence stretch of this PuuI fragment (the two primers, directed awayfromeach other, corresponded, respectively,to positions 363-344 and 656-675 of the sequence Regulation of intracellular copper activity is crucially impor-in Fig. 1).The 2.1-kilobase productof the polymerase chain reaction was made blunt ended with Klenow polymerase and cloned into the SmaI tant for cell viability. Copper ions are essential growth elements through their function as cofactors in various redox en- site of M13 mp18. M13 phages, produced in E. coli from two or more such independently generated clones, were then sequenced in both dizymes such as lysyl oxidase, cytochrome c oxidase, superoxide rections by the method of Sanger et al. (12), synthesizing the required dismutase, or dopamine p-hydroxylase. However, copper is very primers to generate overlapping sequences. toxic to both eukaryotic and prokaryotic cells.The mechanisms To measure protein expression, cells were grown to 0.7 OD units (546 whereby cells effect copper homeostasis are poorly understood. nm) in 1 ml of 1%Na2HP0,.2H,0, 1%trypticase peptone, 0.5% yeast the cultures were extract, and 1% glucose,semi-anaerobically,i.e. Genes involved in the control of cytoplasmic copper levels sealed but not deoxygenated. Following induction with the respective have been identified in different bacteria(1-5). In Escherichia genes involved in copper homeostasis agents for 1h under the same conditions, cellextracts were prepared by coli, several chromosomal centrifuging the cultures and adding to the cell pellet 50 plof 10 mg/ml as well as plasmid-borne copper resistance genes have been lysozyme, 1mM EDTA, 10 mM Tris-C1, pH8. Afterincubation for 10 min identified (6).Regulation of cytoplasmic copper activity appearsat room temperature, 10 pl of 1 mg/ml DNase I in 100 mM MgCl, were and efflux pathways in addition to copper to involve influx added, and incubation continued for 5 min. Samples of these extracts containing the same amount of protein were separated on sodium dodemodification in the cytoplasm (7). In copper-resistant strains of Pseudomonas syringaepv. tomato, isolated from copper-treated cy1 sulfate gels (13), which were subjected to Western blotting as detomato cultures, four plasmid-borne genes have been impli- scribed (14). Growth curves were monitored in 1-ml cultures at 550 nm in the (8).Two of the gene products,CopA media given above.The cultures were inoculated from frozen stocksof cated in copper metabolism a n d CopC, were shown to be periplasmic copper binding prologarithmically growing cells 1 h later, followed by addition of either teins that accumulate in cells challenged with high copper lev-AgNO, or CuSO, as detailed under “Results and Discussion.” Antibodies against CopB were raised as follows. The DNA sequence els, thus acting as copper scavengers (9). Similarly, in eukaryotes, ubiquitous small cysteine-rich proteins, the metal- coding forthe 357 C-terminal amino acids of CopB was excised fromthe lothionines, can sequester cytoplasmic copper in an inactive original clone pZ3 (11)with BstEII and SalI, made blunt ended with Klenow polymerase and cloned into the SmaI site of pEX3 to generate form (10). a P-galactosidase-CopB fusionprotein. Details of the procedures to isoWe cloned two P-type ATPases, CopA and CopB, that are late the fusion protein and to generate rabbit polyclonal antibodies have apparently involved in copper homeostasis in the Gram-posi- been described (15). For gene disruptions, an erythromycin resistance gene was excised * This work was supported by Grants 31-28577.90 (to M. S.) and from pVA838 (16) with Hind111 and AuaI and cloned into the following 31-25370.88(to R. K.) from the Swiss National Foundation. The costs of restriction sites, indicated in Fig. 1: SpeI-BstEII for copA-copB disruppublication of this article were defrayed in part by the payment of page tion; Asp700-1612by partial digestion for copA disruption; NcoI for charges. This article must therefore be hereby marked “aduertisement” copB disruption. All cloning was blunt end by filling the restriction sites with Henow polymerase. These constructs were propagated in E. coli in accordance with 18 U.S.C. Section 1734 solely toindicate this fact. The nucleotide sequence(s) reported in this paper has been submitted for plasmid isolation as described (17). The modified copAE sequences to the GenBankTMIEMBL Data Bank with accession number(s)L13292. containing the erythromycin resistance marker were excised from the 1 To whom correspondence should be addressed: Dept. of Clinical plasmids, purified by preparative DNA gel electrophoresis, and 1 pg of Pharmacology, Murtenstrasse 35, 3010 Berne, Switzerland. such linear DNA was introduced into wild-type E. hirae cells by elec-

12775

12776 -60

Copper ATPases of E. hirae

TCAAGCGACAGAGATTTGTCAAGCAATCAATGAATTAGGCTATC~GCA~GTG~TTTG 24 uLysIleThrValGluGlnThrAsnThrLysAsnRsnLeuGlnGluHisGlyLysM~tG1

.

Ne01 2341 AAATATGGATCAACACCATACGCATGGACACATGGAACGGCACCAACAGATGGACCATGG 44 uAsnMetAspGlnHisHisThrHisGlyHisMetGluArqHisGlnGlnMetAspHisGl

.

ACACATGAGCGGAATGGATCATAGCCATATGGATCATGAATCA

2401 6 4 yHisMetserGlyMetAspHisSerHisMetAspHisGluAspMetSerGlyMetAsnHi

2461 TAGCCACATGGGTCATGATATGAGTGGAATGGATCATTCTATGCACATGGGGAACTT 8 4 ~HisMetGlyHisGluAsnMetSerGlyMetAspHisSerMetHisMetGlyAsnPh

TAAGC~TTTTGGCTTTCTCTGATTTTAGCGATTCC;ATTATTCTTTTTTCACCGA~ GATGGGGAT;~TCCTTTCCTTTTCAAGTGA~GTTTCCTGG~TCTAATTGG~TGGTGTTGG~

2521 104 eLySGlnLy~PheTr$euSerLauIleLeuAlaIleProllelleLeuPheSerP~oMe

2581 241 GCTGAGGAGAAACAAACCTATTTAAGRAAAATGAAGTTTGATCTTATCTTTAGTGCGATC 8 1 A ~ a G ~ U G l u L y S G l n T h r T y r L e u A r q L y s M e t L y s P h e A s ~ e u I l e P h e s e r A ~ ~124 ~ ~ etMetGlyMetSerPh~ProPheG1nValThrPheProGlySerAsnTr~a1ValLeuVa 301 TTGACTCTACCCTTGATGTTAGCAATGATTGCCATGATGCTTGGAAGTCATGGACCAATT 2641 TCTGGCAACGATTTTATTTATTTATGGCGGACAACCATT~TAAGCGGAGCCAAAATGGA 101 ~ ~ U T h ~ L e U P r O L e U M e t L e u A l a M e t I l e A l a M e t M e t M e t L e u G l ~ e r H i s ~ l y p144 r ~ 1LeuAlaThrIleLeuPheIleTyrGlyGlyGlnProPheLeuSerGlyAl~ysMetG1 ~

361 ~GTCGTTCTTCCATCTGTCTCTTGTGCAGTTGCTCTTTGCTTTGCCTGTGCAATTTTAT 2701 ATTGAAACAAAAAAGTCCAGCAATGATGACACTGATTGCTATGGGGATTACCGTCGCATA 121 ValSerPhePheHisLeuSerLeuValGlnLeuLeuPh~AlaLeuProva~inp~e~yr164 uLeuLysGlnLysSerProAl~etMetThrLeulleAlaMetGlyIleThrValAlaTy 2761 GTTTATAGTGTGTA TCTTTTA AGCCAACCTCATCAACCCCCATACACATGTCA GTAGGTTGGCGCTTTTATAGGAGCCTATCATGCATTI\ 184 ~-+llaAsnLeuI.leAsnProHisThrHi+&

421 141 ValGlyTrpArgPheTyrLysGlyAlaTyrHisAlaLeuLysThrLysAlaProAs~et

GGA

4 8 1 GATGTCTTAGTTGCGATTG;AACATCTGCAGCCTTCG~ATTAAG~ATTT~TAATGGTTTT2821 TTTTTTCTGGGAATTAGCAACGTTAATCGTAATCATGTTATTGGGACATTGGATCGAAAT 204 pPhePheTrpGluLeuAlaThrLeuIleVallleMetLeuLe~lyHisTrpIleGluMe 161 As~a~LeuValA~aIle~~yThrSerAlaAlaPheAlaLeuSerIleTyrAsnGlyPhe 2881 G A A T G C A G T C T C T A A T G C C A G C G A T G C T T T A C A 4 A A A T T A T C 541 TCCCTAGCCATTCCCATGATCTTTATTTTGAAAGTAGCAG~AT~AT~A~TA~~TTGATT 224 tAsnAlaVa1SerAsnAlaSerAspAlaLeuGlnLysLeuAlaGluLeuLeuProGluSe 181 ~ r o S e r H i s S e r H i s A s ~ ~ u T y r P h ~ G l u s e r ~ e r S e r M e t I l e l l e ~ h ~ ~eu ~~e

TTACTTGGRAAGTATTTAGACATACAGC;~AAAAGT&CAGGCGATG~~ATC-CA~

2941 GGTAAAACGATTGAAAAAAGACGGAACTGAAGAAACCGTCTCTTTAAAAGAAGTCCATGA 601 201 ~ ~ y s T y r L e U G l u H i s ~ r A l a L y s S e r L y s T h r G l y A s p A l a I l e L y s G l n 244 rValLysArgLeuLysLysAspGlyThrGluGluThrValSerLeuLysGluValHisGl 661 ATGATGTCCCTTCAGACICAGCACAAGTTTTAAGAGATGGCAAAGAAGAGACGATT 221 MetMetSerLeuGlnThrLysThrAlaGlnValLeuArgAspGlyLysGluGluThrIle

3001 AGGTGATCGTCTAATTGTTCGTGCTGGAGACAAGATGCCAACGGATGGGACGATCGACAA 264 uGlyAspArgLeuIleValArqAlaGlyA~pLysMetProThrAspGlyThrll~AspLy

3061 721 GCAATTGATGAGGTCATGATCGATGACATCTTAGTGATTCGTCCTGGTGAACAAGTACCT 241 A~alleAspGluVa~MetIleAspAspIleLeuValIleArqProGlyGluGlnvalP~o 284 SpeI 3121 781 ACAGATGGACGGATCATTGCTGGCACTAGTGCATTGGATGAAAGCATGTTGACAGGAGAA 304 261 ThrASpGlyArqIleIleAlaGlyThrSerAlaLeuA~pGluSerMetLeuThrGlyGlu

.

.

sGlyHisThrlleValAspGluSerAlaValThrGlyGluSerLysGlyValLysLysG1 AGTGGGCGATTCGGTCATTGGTGGATCAATTAATGGCGACGGAACAATTG~TTACTGT nValGlyAspSerValIleGlyGlySerIleAsnG~yA~pGlyThrIleGluIleThrVa

.

BStEII 3181 AACAGGTACTGGCGAAAATGGTTACCTTGC.~GTAATGGAGATGGTACGAAAAGCCCA 324 1ThrGlyThrGlyGluAsnGlyTyrLeuAlaLysVal~etGluMetValArgLysAlaGl

841 AGTGTACCTGTTGAGAAAAAAGWGATATGGTTTTTGGTGGAACGATCAATACCAAT 281 SerValProValGluLysLysGluLysAspMetValPheGlyGlyThrIleAsnThrAsn 901 GGATTGATCCAAATACAAGTTTCTCAGATAGGAAAAGATACGGTGTTGGCACAAATCATC 301 GlyLeuIleGlnlleGlnValSerGlnIleG~yLysAspThrValLeuAlaGlnIleIle 961 CAAATGGTGGAAGATGCTCAAGGAAGTAAAGCACCGATCCAACAAATTGCTGACAAGATT 32i GlnMetValGluAspAlaGlnGlySerLysAlaProIleGlnGlnIleAlaAspLysIle 1021 TCA 341 Se

AGGACATACCATTGTTGATGAATCTGCTGTTACGGGTGAGCA

3241 AGGAGITCTAAATTAGAGTTTCTATCAGATAAAGTAGCAAMTGGTTATTTTATGT 344 n G l y G l u L y ~ s e r L y s L e u G l u P h e L e u S e r A s p L y s V a l A l ~ L y s T r ~ u P h e T y r V a 3301 GGCTTTAGTAGTTGGGATCATCGCCTTTAiTGCTTGGCTCTTCCTAGCAAATTTACCAGA 3 64 lAlaLeuValValGlyIleIleAlaPheIleAlaTrpLeuPheLeuAl~snLeuProAs BstEII 3361 TGCACTAGAACGAATGGTCACCGTGTTCATCATTGCTTGTCCGCATGCACTGGGACTTGC 384 pAlaLeuGluArgMe~alThrValPheIleIleAlaCysProHisAlaLeUGlyLeuAl

PVUI GGATTTTCGTACCGATCGTTTTGTTTTTAGCATTGGTGACACTATTAGTTACAGGA lyIlePheValProlleValLeuPheLeuAlaLeuAl~LeuValThrLeuL~uvalThrGly

.

3421 1081 TGGCTCACGAAGGATTGGCAGTTAGCATTGCTTCATAGTGTGTCCGTTTTAGTCATTGCT 404 361 ~ h r L y s A s p T r p G l n L e u A l a L e u L e u H i s S e r V a l S e ~ a l L e u V a l I l e A l a 3481 1141 TGCCCATGTGCGCTTGGTTTAGCAACACCAACTGCCATCATGGTAGGAACAGGGGTCGGT 424 381 CysProCysAlaLeuG1yLeuAlaThrProThrAlaIleMetValGl~hrGlyValGly 3541 1201 GCTCATAATGGGATATTGATCAAAGGTGGCGAAGCGTTAGAAGGAGCCGCTCATCTAAAT 444 401 AlaHisAsnGlyIleLeuIleLysGlyGlyGluAlaLeuGluGlyAlaAlanisLeuAsn 3601 1261 AGTATTATTTTGGATAAAACTGGAACGATTACACAAGGCCGACCAGAAGTAACAGATGTC 464 421 SerIleI~eLeuAspLysThrGlyThrIleThrGlnGlyArgProGluValThrAspVal 3661 G A T T G G G A T M T G A A T T A T T T A A A A G ~ ~ - ~ ~ G A T T A C T C C T T A T C A A G C A C A G G A A C A 1321 ATCGGTCCC-GAGATCATTTCCCTTTTCTATTCCCTTGAACATGCTTCTGAACATCCT 484 alleGlyIleMetAsnTyrLeuLysGluL~~LysIleThrProTyrGlnAlaGlnGluG1 4 4 1 IleGlyProLysGluIleIleSerLeuPheTyrSerLeuGluHisAlaSerGluHisPro 3721 AAAAAATTTAGCAGGTGTTGGTTTAGAAGCAACTGTGGAAGACAAAGATGTTUAATTAT 1381 TTAGGAAAAGCTATTGTTGCTTATGGTGCAAAAGTCGGTGCRAAAACTCAGCCAATCACT 504 nLysAsnLeuAlaGlyValGlyLeuGluAlaThrValGluAspLysAspValLysIleI1 461 LeuGlyLysAlaIleValAlaTyrGlyAl~LysValGlyAlaLysThrGlnProIleThr 3781 TAATGAAAAAGAAGCAPAACGTTTAGGACTWTCGACCCTGAACGATTAAMAACTA 1441 GATTTTGTTGCTCATCCTGGTGCAGGAATCAGTGGAACGATCAACGGTGTTCATTA~TT 524 eAsnGluLysGluAlaLysArgLeuGlyLeuLysIleAspProGluArgLeULysAsnTy 481 AspPheValAlaHisProGlyAlaGlyIleSerGlyThrIleAsnGlyValHisTyrPhe 3841 TGAAGCTCRRGGAAACACTGTCAGCTTTTTAGTAGTTTCAGATAAATTAGTGGCTGTGAT 1501 GCTGGGACTAGAAAGAGACTAGCTGAAATGAACCTTTCATTTGATGAATTTCAAGAACAG 544 rGluAlaGlnGlyAsnThrValSerPheLeuValValSerAspLysLeuValAlavall1 501 AlaGlyThrArqLysArgLeuAlaGluHetAsnLeuSerPheAspGluPheGlnGluGln Asp700 3901 TGCTCTAGGAGATGTCATTAAACCAGAAGCAAAAGAGTTTATCCAAGCGATCAAAGAAA~ 1561 GCGTTAGAATTAGAACAGGCAGGGAAAACAGTGATGTTTTTAGCCAACGAAGAACAGGTT 564 eAlaLeUGlyAspValIleLysProGluAlaLysGluPheIleGlnAlaIleLysGluLy 521 AlaLeUGluLeuG1uGlnAlaGlyLysTh~ValMetPheLeuAlaAsnGluGluGlnVal 3961 A A A T A T T A T C C C A G T C A T G T T G A C T G G G G A T A A C C C C A G C A G T A G C C G A 1621 CTTGGAATGATTGCCGTTGCTGATCAAATCAAAGAAGATGCAAAACAAGCAATCGAGCAA 584 sAsnIleIlePrOValMetLeuThrGlyRSPAspAsnProLysAl~AlaGlnAlaValAlaGl 541 LeuGlyMetIleAlaValA~aAspGlnIleLysGluAspAlaLysCl~AlaIleGluGln 4021 [email protected]+.GAGGCGATCGT 1681 CTACAACRAAAAGGTGTCGATGTGTTTATGGTTACGGGAGATAATCAACGAGCCGCTCAA 604 uTyrLeuGlyIleAsnGluTyrTyrGlyGlyLeuLeuProAspAspLysGluAlalleVa 561 LeuGlnGlnLysGlyValAspValPheM~tValThrGlyA~pAsnGlnArgAlaAlaGln Asp700 4081 1741 GCAATCGGCAAI\CAAGTAGGAATTGATTCCGACCATATCTTTGCAGAAGTTTTACCTGAA 624 581 AlaIleGlyLysGlnValGlyIleAspSerAspHisIlePheAlaGluValLeuProGlu 4141 GCCAAGCTTAGCACGGGCAACGATAGGTATGGCAATCGGAGCAGGAACTGATATTGCGAT 1801 GAAAAAGCCAACTATGTAGAAAAACTACAGAAAGCTGGLAAGAAAGTTGGCATGGTCGGT 644 aProSerLeuAlaArqAlaThrIleGlyMetAlaIleGlyAlaGlyThrAspIl~AlaIl 601 GluLysAlaAsnTyrValGluLysL.euGlnLysAlaGlyLysLysValGlyMetValG~y 4201 TGATTCTGCAGATGTTGTCTTAACGAACAGTGACCCCAAGATATCTTGCATTTCTTAGA 1861 GATGGAATCAATGATGCCCCAGCGCTACGTTTAGCAGATGTTGGGATTGCAATGGGAAGT 6 6 4 eAspSerAlaAspValValLeuTh~A~~SerAspProLysAspIleLeuHisPheLeuGl 621 AspGlylleAsnAspAlaProAlaLeuArgLeuAlaAspValGlyIleAlaMe~GlySer 4261 ATTAGCAAAAGAAACAAGAAGWTGATCCAAAATCTTTGGTGGGGCGCTGGTTATAA 1921 GGRACCGATATTGCGATGGRCAGCTGATGTGACATTAATGAATAGTCATTTAACTTCT 684 uLeuAlaLysGluThrArqArgLysMetIleGlnAsnLeuTrpTrpGlyAlaGlyTyrAs 641 GlyThrAspIleAlaMetGluThrAlaAspValThrLeuMetAsnSerHisL~uThrSer 4321 TATTATTGCTATTCCTTTAGCAGCAGGA4?CTTAGCACCAATCGGACTTATTTTAAGCCC 1981 A T C A A T C A A A T G A T T T C T T T A T C A G C T G C C A C A T T A A A A T T T G T T T 704 ~leIleAlaIleProLeuAlaAlaGlyIleLeuAlaProIleGlyLeuIleLe~erPr 661 I l e A s n G l n M e t I l e S e r L e u S e r A l a A l a T h r L e u L y s L y s I l e L y s G l n A s ~ PVUI 4381 AGCAGTGGGAGCAGTCTTGATGTCACTAAGTACAGTGGTCGTTGCGCTCAACGCCTTAAC 2041 T G G G C A T T C A T T T A T A A T R S G I \ T C G G G A T T C C T T _ T T G C C C C A 724 $laValGlyAlaValLeuMetSerLeuS~rThrValValValAlaLeuAsnAlaLeuTh 681 TrpAlaphelleTyrAsnThrlleGlyIleProPheAlaAlaPheGlyPheLe~snPro 4441 TTTAAAATRRGTTGTTAACGTTACTTGAT?.AACGAGTGAGTGTAAAAATAGWGAC 2101 ATCATTGCTGGTGGCGCAATGGCCTTTAGTTCAATCAGTGTATTATTGAATTCTTTAAGC y s 145 744 s 701 ~llelleAlaGlyGlyAlaMetAlaPheSerSerIleSerValLeuLeuAsnSerLeuSer copa 4501 AATCTTTAAGGACAAACACAAGCAAATTTATTCAAATGAAAACTGGCAAGCAGCTATTTT 2161 T T A A A T C G A A A A A C G A T C A T A A A T C G T T T C A G A G G L A A G S I G A T G A A T A A 4561 TCAGCGAATCAATTTTAGCAGGTCGTT~-~GATTGTCTTTTTTATTTATGTAGACAAA t A s n A sW s n A 7 r2 g7 LysThr 7I 2l 1e L y s 4621 ATGAAAAGAAAAAATGGCAGGAGAAMGTTGAGAGAGGGATTCAAGAAATAATCAGTAAC 4681 CATAGTTGTTCCCATTGTACGAAATTTTGC.~CAGTTCAATGTGTGACGGTAAG~ 2221 TGGAATAGATCCTGAGAATGAAACAAAT?,AAAAGGGCGCTATTGGAAAGAATCCTGAGGA 4141 TAGCAGTAGTTMCTTTTTCGATCTGTTACAATTAGAATTTAATGAATTTCGTTTGAATTA 4 nGlyIleAspProGl~snGluThrAsnLysLysGlyAlaIleGlyLysAsnProGluGl 4801 A A G A A G ~ T G T T T T T T T C G T A A T T ~ . ~ T A T A T A G G G A G A T G T A T T A A T C T A T A G T T 4861 GATCGTGCTCCTGAAACACACAGTAAAALXTAAGTGAGGGAACGCCAATGAAGTGGCAAA 2281 AAAAATAACTGTAGMCAAACGAATICCAAGAATAATTTACAGGAACATGGAAAAATGGA 4921 GATTATTGTCAMAUTGTACAAAATCTATYTATATT 4957

.

.

.

.

.

~

FIG.1.

12777

Copper ATPases of E. hirae M E T A LB I N D I N G

*

* *

I O NT R A N S D U C T I O N C P C O L G L A T C P C A L [ V I SIT C P m A L GL AI1

* *

*

*

*

*

*

P H O S P H O R Y L A T I O NS I T E CopA

; -1

Menkes CadA

Cop0

L D K T G T GI T R - 4 3 4 F D K T G T I T HG T -1053

-

424

L D K T G T L T Q G K - 4 4 9

FIG.2. Protein sequence alignments of key features ofCopA and CopB with related proteins involved in heavy metal ion metabolism. MerA, chromosomal mercuric reductaseof Thiobacillus ferrooxidans(26);CadA,cadmium efflux ATPase of S. aureus (25); Menkes, copper ATPase encoded by the Menkes gene (23); MerP, periplasmic component of a mercury transport system from Serratia marcescens (27). Regions of sequence identity are boxed, and amino acid residues identical in all three sequences are marked with an asterisk. The functional significance of the alignmentsis discussed in the text. The sequences were aligned with the programof Pileup the Genetics Computer Group(35).

alignments are depicted in Fig. 2. While CopA and CopB display extensive overall sequence similarity, their N-terminal first 100 residues are completely different. The N terminus of CopB contains three repeats of the consensussequence Met-Xaa-His-Xaa-Xaa-Met-Ser-Gly-MetXaa-His-Ser (underlined in Fig. 1). Closely similar repeats are present in the P. syringae protein CopA, which was demonstrated to be a periplasmic copper binding protein (9). This suggests that the N-terminalregion of the CopB ATPase constitutes a copper binding domain. CopA features, in its polar N-terminal region, the conserved motif Gly-Xaa-Thr-Cys-Xaa-Xaa-Cys. The alignments inFig. 2 show that this motif is also found in MerA, a protein that belongs to a family of highly similar mercuric reductases that RESULTS AND DISCUSSION reduce Hg2+ toHgO (26). MerP, a periplasmic mercury binding Fig. 1 shows the DNA sequence encoding CopA and CopB. protein (27) and the cadmium-transporting ATPase, CadA (281, There aretwo open reading frames,727 and 745 amino acids in also displaythis consensus sequence.In theMenkes gene prodlength, thatencode proteins withpredicted M , values of 78,387 uct, this motif is present six times in theextended N-terminal and 81,522, respectively. Both genes are preceded by a ribo- region (231, and only the last repeat is shown. Thus, the consome binding site. There are no known transcription initiation served Gly-Xaa-Thr-Cys-Xaa-Xaa-Cys appears to be a general signals in thesequence, indicating that thepromoter region is heavy metal ion binding site. located upstream and thatcopA and copB are partof the same The putative ion transduction regions ofCopA and CopB operon. containaproline that is located in a hydrophobic domain. CopA and CopB exhibit 35% sequence similarity and are also While this proline residue isconserved in allP-type ATPases, it similar to other P-type ATPases. The protein most closely re- appears to be flanked by cysteines only in heavy metal ionlated to CopA is the human Menkes gene product (22-241, translocating enzymes (6). Interestingly, the fixZ gene of Rhizodisplaying 43% sequence similarity (33% similarity to CopB). bium meliloti, encoding a P-type ATPase of unknown function, In Menkes disease, anX-linked disorder of copper metabolism, also containsanintramembranous Cys-Pro-Cys (29) that copper accumulates in intestinal mucosa, kidney, and connec- would indicate a role of this protein in heavy metal ion transtive tissue. The candidate Menkes gene encodes a P-type AT- location. The Menkes gene product and CopA exhibit 91% poPase of 1500 amino acids that was proposed to be a copper- sitional identityover the 32-amino acid stretch depicted in Fig. transporting ATPase. Also closely relatedto CopA is the 2. This startling similarity between two evolutionarily very cadmium (and zinc) efflux ATPase of Staphylococcus aureus distant proteins points to a highly conserved feature of these (25),exhibiting35%sequence similarity (26% similarity to two enzymes, most likely associated with the transduction of CopB). Other known P-type ATPases do not display significant copper ions. sequence similarity outsideconserved features involved in ATP The phosphorylation site is constituted by the pentapeptide binding and phosphorylation, resulting in overall similarities Asp-Lys-Thr-Gly-Thr. This sequence, present in all known Pin the range of 22-27%. Key features of the most significant type ATPases, contains the aspartic acid residue thatforms the troporation (18). Erythromycin-resistant recombinants were selected on 20 pg/ml erythromycin. To verify homologous integration of the erythromycin marker into the genome, chromosomalDNA was prepared by the mini-preparation method describedby Ausubel et al. (19), digested with various restriction enzymes, and subjected to Southern blot analysis (20). All manipulations of DNA were conducted by published procedures (21). E . hirae (ATCC9790, formerly called Streptococcus faecalis or faecium) was obtained from the American Type Culture Collection. Sequenase was purchased fromU. S. Biochemical Corp., growth media additives from BBL, and deoxyadenosine 5’-a-[35Slthiotripho~phate for sequencing from Amersham.All other molecular biology reagents and materials were obtained from Boehringer-Mannheim. o-Phenanthroline,8-hydroxyquinoline,erythromycin, andotherchemicals were bought from Sigma and wereof the highest grade available.

FIG.1.DNAsequence and protein translation of copAB. The putative ribosome binding sites double are underlined, and relevant restriction sites are indicatedabove the sequence. The deduced protein sequencesfor CopA and CopB are given below the DNA sequence in the three-letter amino acid code. The threecopper binding motifs in the N-terminal region of CopB are underlined, and putative transmembranous domains are boxed.

Copper ATPases of E. hirae

12778

acyl phosphate intermediate characteristic of these enzymes (30, 31). Both CopA and CopB have a remarkably low cysteine content. CopA only contains four cysteines: two in the putative N-terminal metal binding domain and two flanking the conserved intramembranous proline in the ion transduction domain; CopB features a single cysteine,located in the latter domain. The very small number of cysteine residues in CopA and CopB obviously disfavors nonspecific interaction (inactivation) of these ATPases with heavy metal ions. 1 2 3 4 5 6 7 8 9 1011 12131415

~"m-""

Expression of the cop genes was investigated with an antibody directed against CopB. Enhanced expression of CopB was observed with increasing copper concentrations in the media, reaching a maximum at 2 mM CuS04 (Fig. 3). Induction was also observed in response to 5 p~ Ag' or 5 p~ Cd2', concentrations that significantly inhibited growth. No effect was seen with maximally tolerated concentrations of Ca2', CrR+, Mn2+, Co2 , Ni2+, Zn2" , Sr2', Ba2', La"', Au3 ', Hg2+, Pb2+, and Bi3'. Surprisingly, full induction of CopB was also apparentif 100 pnl of the heavy metal ion chelators o-phenanthroline or 8-hydroxyquinoline wasadded.The induction effect of the chelating agents was abolished if equimolar concentrations of Cu2' were added simultaneously. It thus appears that either low or high concentrationsof copper ions leadto induction. The operon-like arrangement of the copA and copB genes implies that both genes underlay the same control. To illuminate the roles of CopA and CopB in metal ion homeostasis, we constructed gene-disrupted strains. Cellsdisrupted incopB, or in copA and copB, lost theirhigh level copper resistance, being fully inhibitedin theirgrowth by 6 mM CuS04 (Fig. 4A); in contrast, disruption of copA alone had no significant effect on the copper tolerance of E. hirae. However,

FIG.3. Induction of CopB by heavy metal ions or chelators. Logarithmically growingE . hirae cells were induced withthe respective agents for 1 h and cell lysates tested for the expression of CopB on Western blots withan antiserum against CopB. Details ofthe procedure are given under "Materials andMethods." The arrowhead indicates the band corresponding to CopB a t t h erelative molecular massof 80 kDa. Lanes 1 4 , wild type induced with 0, 0.2, 2, and 6 rnM CuSO,, respectively; lanes 5-7, copAB-disrupted, copB-disrupted, and copA-disrupted strains, respectively, in the presence of 2 rnM CuSO,; lanes 8-10, wild type in the presence of 100 pv o-phenanthroline plus0.100,and 200 pv CuSO,,, respectively; lanes 11-15, wild type with the following additions: lane 11, 100 phf 8-hydroxyquinoline; lane 12, 5 pv Cd", lane 13, 1 mlf Co2'; lane 14, 5 pv Ag-; lane 15.4 pu Hg'.

"

A

400

(

,

,

.

.

I

"

"

I

'

,

.

,

'

.

~

.

600

I

,

'

'

Residuenumber

B

Copper binding

Phosphatase

Aspartyl kinase

Time (h)

-

5

1 out

W

e

n 0

1

2

3

4

5

6

7

8

FIG.5. Model of the membrane topologyof CopB. A, hydropathy

LD v

0.1

0.01

0

1

2

3 4 5 Time (h)

6

7

FIG.4. Growth of wild-type and mutant E. hirae in the presence of heavy metal ions. 6 mht CuSO, (A) or 5 pv AgNO, ( B )was added to the cultures 1 h after inoculation. Growth was monitored by measuring the optical density a t 546 nm. Other detailsare given under "Materials and Methods." B, wild type; X, copA-disrupted; A , cop€?disrupted; 0, copAB-disrupted.

profile calculated by the method of Kytc and Doolittle (33)using a span of 20 amino acids. Upward deflections indicate hydrophobic domains. B, folding model for the CopB ATPase. The transmembranous helices are labeled 1-8. The bulk of the protein protrudes on the cytoplasmic ( i n ) face of the membrane.H..MGM indicates the three putative canonical copper binding sites in the Copper binding domain. The following sequence featurescommon to all P-type ATPases are also indicated: TGES is partof the Phosphatase domain, DKTGT is the siteof aspartyl phosphate formation, and VGDGINDAP is predicted to form a Mg"-mediated salt bridge to y-phosphate of ATP in theAspartyl kinase domain. The conserved proline in helix6 is surroundedby two cysteines inCopA and the Cd"-ATPase, and by cysteine and histidine in CopB and is believed to be the ion transduction site.All these assignmentsare based on site-directed mutagenesis and the analysis of several other P-type ATPases (36-38).

Copper ATPases of E. hirae copA-disrupted cells ceased to grow after two to three generations whenheavy metal ions in the media were complexed with 8-hydroxyquinoline, conditions that do not affect the growth of wild-type cells (not shown). This suggests that CopAis required for copper import under limitingconditions. Silver is known to replace copper in some processes (321, and we tested its effect on gene-disrupted strains (Fig. 4B). Disruption ofcopA rendered the cells considerably more tolerant t o Ag+ than strains possessing a functionalCopAATPase, supporting a role of CopA in heavy metal ion import. The hydropathy profiles calculated by the method of Kyte and Doolittle (33) are very similar for CopA and CopB (only shown for CopB, Fig. 5A). Based on these hydropathy profiles and on the most favorable distribution of charged residues between the two faces of the membrane (341, we propose a membrane topology for CopA and CopB with eight transmembranous helices and the N and C termini and the bulk of the protein exposed to thecytoplasm (Fig.5B 1. This model deviates from those put forth for related ATPases, such as the CadA cadmium ATPase of S. aureus, in which two rather than four transmembranous helices are predicted t o lie between the N terminus and the first cytoplasmic loop (6). Other features of our model are described in the legend t o Fig. 5. Taken together, our results propound that copA and copB encode ion-motive ATPases that effect translocation of copper and other metal ions across the cell membrane. This proposal rests on the following evidence: (i) CopA and CopB are P-type transport ATPases based on sequence similarity,(ii) theseATPases are inducible by either high or low ambient copper concentrations,(iii) CopA and CopB show N-terminalandintramembranous features typical of heavy metal ion binding proteins, (iv) disruptionof copB leads to copper-sensitive cells, (v) disruption of copA renders the cells copper-dependent and silver-resistant, and (vi)CopA shows extensive sequence similarity to the putative copper-transportingATPase encoded by the Menkes gene. Thus, CopB most likely serves in the extrusion of copper, while CopA appears to be responsible for its uptake. Copper-transporting ATPases represent a novel mechanism for the control of cytoplasmic copper. The occurrence of similar enzymes in such diversespecies as man andE. hirae suggests that ATP-driven copper transport is a widely used mechanism of copper homeostasis. Acknowledgments-We thank Denise Hess-Bienz for preparing the antibody against CopB and Thomas Seebeck for critical discussion.

12779 REFERENCES

1. Tetaz, T. J., and Luke, R. K. J. J. (1983) J . Bacteriol. 154, 1263-1268 2. Rogers, S. D., Bhave, M. R., Mercer, J . F. B., Camakaris, J., and Lee, B. T. 0. J. (1991) J. Bacteriol. 173,6742-6748 3. Erardi, F. X., Failla, M. L., and Falkinham, J. 0 . (1987) Appl. Enuiron. Microbiol. 53, 1951-1954 4. Garde, S., and Bender, C. L. (1991) Appl. Enuiron. Microhiol. 57, 2435-2439 5. Bender, C. L., and Cooksey, D. A. J . (1987) J . Bacteriol. 1 6 9 , 4 7 0 4 7 4 6. Silver, S., and Walderhaug, M. (1992) Microhiol. Reu. 66, 195-228 7. Brown, N. L., Camakaris, J., Lee, B. T.O., Williams, T.,Morby, A. P., Parkhill, J., and Rouch, D. A. J. (1991) Cell. Biochem. Funct. 46, 106-114 8. Mellano, M. A,, and Cooksey, D. A. J. (1988) J. Bacteriol. 170, 2879-2883 9. Cha, J.-S., and Cooksey, D. A. (1991) Proc. Natl. Acad. Sci. U. S.A . 88, 89158919 10. Kagi, J. H. R., and Schaffer, A. (1988) Biochemistry 27,8509-8515 11. Solioz, M., Mathews, S., and Furst, P. (1987) J . Biol. Chem. 262, 735G7362 12. Sanger, F., Bicklen, S., and Coulson, A. R. (1977)Proc. Natl. Acad.Sci. U. S.A . 74, 5463-5467 13. Laemmli, U. K., and Favre, M. (1973) J. Mol. Biol. So, 575-599 14. Towbin, H., Staehelin,T., and Gordon, J . (1979)Proc. Natl. Acad. Sei. U. S. A. 76,4350-4354 15. Gray, M. R., Mazzara, G. P., Reddy, P., and Rosbash, M. (1987) Methods Enzymol. 154,129-135 16. Macrina, F. L., Tobian, J . A., Jones, K. R., Evans, R. P., and Clewell, D. B. (1982) Gene ( A m s t . )19,345-353 17. Humphreys, G. O., Willshaw, G. A,, andAnderson,E. S. (1975) Biochim. Biophys. Acta 3 8 3 , 4 5 7 4 6 3 18. Waser, M., and Solioz, M. (1990) Biachimie 72, 279-283 19. Ausubel, F. M., Brent, R., Kingson, R. E., Moore, D. D., Seidman, F, G., Smith, A,, and Kevin, S. (1988) in Current Protocols in Molecular Biology, WileyInterscience, New York 20. Southern, E. (1975) J . Mol. Biol. 98, 503-517 21. Maniatis, T., Fritsch, E. F., and Sambrook, J . (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor,

NY 22. Mercer, J. F. B., Livingston, J., Hall, B., Paynter, J. A,, Begy, C.,Chandrasekharappa, S., Lockhart, P., Grines, A,, Bhave, M., Siemieniak, D., and Glover, T. W. (1993) Nature Genetics 3, 20-25 23. Vulpe, C., Levinson, B., Whitney, S., Packman, S., and Gitschier, J . (1993) Nature Genetics 3, 7-13 24. Chelly, J., Tiimer, Z., Tonnesen, T., Petterson, A,, Ishikawa-Brush, Y.,Tommerup, N., Horn, N., and Monaco, A. P. (1993)Nature Genetics 3, 14-19 25. Nucifora, G., Chu, L., Misra,T. K., and Silver, S. (1989) Proc. Natl. Acad. Sci. U. S. A . 86,3544-3548 26. h u e , C., Sugawara, K., Shiratori, T., Kusano, T., and Kitagawa, Y. (1989) Gene (Amst. 84.47-54 27. Nucifora, G . , Chu, L., Silver, S., and Misra, T. K. (1989) J. Bacteriol. 171, 42414247 28. Silver, S., Nucifora, G., Chu, L., and Misra, T. K. (1989) Dends Biochem. Sci. 14, 76-80 29. Kahn, D., David, M., Domergue, O., Daveran, M.-L., Ghai, J., Hirsch, P. R., and Batut, J. (1989) J . Bacteriol. 171, 929-939 30. Pederson, P. L., and Carafoli, E. (1987) Dends Biochem. Sci. 12, 146-150 31. Pederson, P. L., and Carafoli, E. (1987) Dends Biochem. Sci. 12, 186-189 32. Winge, D. R., Nielson, K. B., Gray, W. R., and Hamer, D. H. (1985) J. Biol. Chem. 260, 14464-14470 33. Kyte, J., and Doolittle, R. F. J. (1982) J . Mol. Biol. 157, 105-132 34. Von Heijne, G . (1992) J . Mol. Biol. 225, 4 8 7 4 9 4 35. Devereux, J., Haeberly, P., and Smithies, 0 . (1984) Nucleic AcidsRes. 12, 387-395 36. Serrano, R. (1988) Biochim. Biophys. Acta 947, 1-28 37. Inesi, G., and Kirtley, M. R. (1992) J . Bioenerg. Biomemhr. 24, 271-283 38. Horisberger, J.-D., Lemas, V., Kraehenbuhl, J.-P., and Rossier, B. C. (1991) Annu. Reo. Physiol. 53, 565-584

Suggest Documents