Dipartimento di Medicina Veterinaria
Proceedings of XXII International Congress of Mediterranean Federation for Health and Production of Ruminants Sassari, June 17th-20th, 2015
The texts published in this book are the exact reproduction of the original text submitted by the Authors.
Editing: Vincenzo Carcangiu Maria Consuelo Mura Sebastiano Luridiana
Published by Università degli Studi di Sassari ISBN: 978-88-907678-1-4
2
It is a great honour to have been received the trust by the Mediterranean Federation of Health and Production of Ruminants (FeMeSPRum) to organize this XXII International Congress. In 1991 in Sardinia took place the first Federation’s Congress, but this year for the first time it was held in Sassari at the Department of Veterinary Medicine. Therefore, from 17 to 20 June the city of Sassari hosted the XXII International FeMeSPRum Congress and there was the opportunity for the participants to this event, to admire the architectural and cultural heritage. This Congress was organized with the support of various public and private institutions, that have proven to be interested in the scientific development of the territory. During this Congress, several invited lectures have been organized, that raised the interest of participants for the value of the speakers and the importance of the topics covered. Therefore, the reached great scientific level and the high number of participants, from different countries and continents highlight the interest in our Federation and in its events. Furthermore, the Congress was an important moment for humans contact between researchers that surely will arise in scientific collaborations that will grow our Federation. The Organizing Committee
3
Organising Committee Prof. Vincenzo Carcangiu Prof. Antonio Scala Prof. Eraldo Sanna Passino Dott. Ciriaco Ligios Dott. Ennio Bandino Prof. Giovanni Garippa Prof. Salvatore Pirino Prof. Pier Paolo Bini Dott. Antonio Varcasia Dott.ssa Daniela Bebbere Dott.ssa Francesca Mossa Dott. Filippo Fiore Dott. Sebastiano Luridiana Dott.ssa Maria Consuelo Mura
Scientific Committee Prof. Salvatore Naitana Dott. Bogo Fatur Dott. Antonello Carta Prof. Vincenzo Cuteri Prof. José Ramiro González Montaña Prof. Patrocinio Morondo Pelavo Prof. Francisco Alonso de Vega Dott. Guido Loria Prof. Erman Or Prof. Giuseppe Moniello
University of Sassari - Italy Veterinary - Slovenia Agris Sardegna - Italy University of Camerino - Italy University of Leon – Spain University of Santiago de Compostela – Spain University of Murcia – Spain IZS Sicilia Italy University of Istambul - Turkey University of Sassari - Italy
4
EXECUTIVE COMMITTEE OF THE FEMESPRUM President: Bogo Fatur, Slovenia Vicepresident: José Ramiro González Montaña, Spain Secretary and Treasure: Vicenzo Cuteri, Italy Vincenzo Carcangiu, Italy Patrocinio Morrondo Pelayo, Spain Francisco Alonso de Vega, Spain Guido Loria, Italy
5
INDEX Invited lectures Genetics and history of ruminants in the Mediterranean area
Pag.
13
L'allevamento dei Ruminanti in Sardegna
Pag.
14
New technologies for the genetic management and the valorisation of local breeds of ruminants in Sardinia.
Pag.
15
Cryobanking: a challenge to preserve small ruminants biodiversity
Pag.
20
Exploitation of animal production of the Mediterranean: experiences and results in Sicily
Pag.
26
Reproductive efficiency of sheep and goat breeding: state of the art
Pag.
33
Reproductive system: diagnosis and control strategies of the major pathogens Induzione e sincronizzazione degli estri nella specie ovina e caprina
Pag.
35
Planning of reproduction in small ruminants
Pag.
37
Guide to udder health for dairy sheep: information to help producers and their veterinarians keep dairy sheep producing quality milk
Pag.
38
La mungitura meccanica degli ovini fra tecnologia e benessere
Pag.
42
Health management of mammary gland in small ruminants prevention and control
Pag.
43
Manejo reproductivo natural y asistido en ovinos a campo: la experiencia en uruguay
Pag.
46
Preliminary study on the residual effect of part-time grazing in dairy ewes submitted to ram effect and flushing with lupin
Pag.
50
Preliminary results on reproduction performances in Sarda dairy sheep supplemented with cooked molasses licking block supplementation
Pag.
56
Whorkshop: Valorisation and conservation of animal biodiversity and production of the Mediterranean areas
Workshop: Reproduction and animal production:animal farming and health issues in the sheep and goat breeding (MSD-Italia)
Workshop: Sheep milk quality: integrated approach for better optimization of the productions (Zoetis)
Oral comunications: Production systems: management and healt
6
Some Factors Affecting Reproductive and Productive Traits in Karadi ewes
Pag.
61
Alternatives approach to the early treatment of ovine pregnancy toxaemia.
Pag.
68
Effect of Theranekron on the cows with retained fetal membranes
Pag.
69
Forced apnoea in sheep: easy alternative method for serial urine collection in research protocols.
Pag.
72
Voluntary feed intake and digestibility of indigenous Emirates goats fed Cenchrus ciliaris cv. Laredo, Panicum maximum cv. Guinea, or Rhodes grass (Chloris gayana)
Pag.
73
Plant poisoning of goats in Mongolia: a possible indicator of the global warming related ecosystem changes in the world and potential risk for food safety
Pag.
78
Evaluation of venous blood gas analysis in milk fed calves at different period of livestock cycle.
Pag.
82
Application of a Herd Health Management Program in a dairy farm: preliminary results
Pag.
87
Schmallenberg virus in Sardinia: the state-of-the-art two years after the epidemic episode.
Pag.
95
CREMOPAR: new strategies monitoring and control parasites of ruminants in the Mediterranean area
Pag.
97
Foot and Mouth Disease
Pag.
102
New technologies applied to diagnosis of parasitic diseases
Pag.
110
Foot and mouth disease – recognition and ageing of lesions
Pag.
111
Bovine Pestivirus: an underestimated problematic in central Italy
Pag.
116
Virological and immunohistochemical detection of Bluetongue virus serotype-1 in the genital apparatus of affected sarda rams
Pag.
117
Experimental infection of Sarda breed sheep with Maedi-Visna virus by intratracheal and intravenous exposure
Pag.
120
Immunohistochemical Diagnosis of Pseudorabies (Aujeszky’s disease) in A Cow in Turkey
Pag.
123
Oral Comunications:Animal nutrition and health
Workshop: Emerging and remerging diseases in the Mediterranean Basin: new approches to diagnosis and control
Workshop: Emerging and remerging diseases in the Mediterranean Basin: new approches to diagnosis and control
7
Ovis aries Papillomavirus type 3 (OaPV-3) in sheep squamous cell carcinoma: biomolecular analysis and histological features
Pag.
127
Preliminary studies on paratuberculosis (PTB) in sheep and goats in Southern Italy: I. Prevalence of Mycobacterium avium subspecies paratuberculosis infection in Apulia.
Pag.
133
Prevalence of Mycobacterium avium subsp. paratuberculosis infection on sheep and goats in Sicily region, Italy: II Preliminary data
Pag.
138
Preliminary studies on paratuberculosis (PTB) in sheep and goats in Southern Italy: III. Biological and management risk factors associated with MAP infection in Apulian flocks
Pag.
143
Preliminary studies on paratuberculosis (PTB) in sheep and goats in Southern Italy: IV. Risk factors associated to PTB in Sicilian flocks (Italy)
Pag.
147
Preliminary studies on paratuberculosis (PTB) in sheep and goats in Southern Italy: IV. Comparison of the serum prevalence of paratuberculosis infection in Apulian and Sicilian farms
Pag.
152
Paratuberculosis in Slovenia – a serious threat to dairy industry
Pag.
158
Histopathological and biomolecular evaluations in cattle Tuberculin skin test positive slaughtered according to the eradication program
Pag.
163
Leptospirosis: a serological survey in small ruminants from Sardinia (Italy)
Pag.
168
The prevalence of ruminant brucellosis and bovine tuberculosis in a pilot area in Morocco
Pag.
171
Change of Intra Ocular Pressure (IOP) and Schirmer Test (STT) in sheep naturally affected with Brucella spp
Pag.
176
Ocular field surgery in ruminants
Pag.
180
Toe tumor in Arabian camels (Camelus dromedariaus): Implementing a Database for hematology and serum biochemistry
Pag.
187
Oesophageal groove in sheep: control using vasopressin.
Pag.
192
Multiple anomaly case in a calf
Pag.
193
Pag.
196
Oral Comunications: Disease indicators
Oral Comunications: parasite diseases Manejo Antiparasitario en Ovinos a Campo: Últimas experiencias en Uruguay
8
Prevalence and dynamics of Oestrus ovis (Diptera: Oestridae) infection in sheep in Sicily (southern Italy)
Pag.
199
Effect of climate on bovine hypodermosis in Algeria
Pag.
201
Infection by Sarcocystis in roe deer (Capreolus capreolus) from Spain.
Pag.
205
Infections by Cryptosporidium spp in post-weaned and adult small ruminants
Pag.
210
Prevalence of Anaplasmosys and Smallemberg disease in roe deer from Spain
Pag.
214
Antibody prevalence of Toxoplasma gondii and Neospora caninum in Spanish roe deer.
Pag.
219
Mini-FLOTAC: A new, accurate and precise technique for the diagnosis of gastrointestinal nematodes in sheep
Pag.
224
Relationship between Posidonia Oceanica intake in Murciano Granadina breed and its effect on fresh cheese.
Pag.
229
Influence of feeding murciano-granadina goats with Posidonia oceánica banquettes in milk
Pag.
230
Fecundity genes polymorphisms are related to the antral follicles phenotype in prepubertal Sarda sheep ovaries?
Pag.
231
Relationship between plasma testosterone concentration in peripheral blood of the mother and sex determination of the fetus
Pag.
235
Seasonal variations of blood antioxidant capacity and spermatozoa fertilizing potential in Sarda breed buck.
Pag.
238
Expression of P2X Purinergic Receptors in Sheep
Pag.
241
A conservation action plan for the altamurana sheep breed
Pag.
246
Correlations Between the volume of the corpus luteum and plasma concentration of progesterone in the estrous cycle of the cow
Pag.
251
Pattern of serum protein fractions in goats and ewes during different physiological stages
Pag.
253
Daily rhythm of total activity/rest pattern in goat and sheep
Pag.
256
Poster session: Animal Production
9
Impact of a starch-rich maternal diet in pregnant ewes on body and testicular development in male offspring
Pag.
259
Evaluation of blood chemistry and haemocytometric parameters in milk fed veal calves.
Pag.
262
The technology of organic additive Fator P ® replaces the use of growth promoters in cattle feedlot diet with 90% of concentrate.
Pag.
267
SREBP-1 gene polymorphisms in dairy and meat sheep
Pag.
272
Investigation of polymorphisms in KiSS-1 and GPR54 genes in dairy and meat sheep.
Pag.
276
Reproductive response to melatonin treatment in different periods in Sarda breed sheep
Pag.
279
Influence of polymorphisms at MTNR1A gene on the reproductive response at the male effect in different spring periods in Sarda breed sheep
Pag.
283
Polymorphism detection on fecundity genes in Sarda breed sheep
Pag.
287
Adaptation of Mediterranean local cattle breeds to climate changes: a preliminary study on genome-wide diversity
Pag.
290
Factors of variation of the raw milk in the north-center area of Algeria
Pag.
295
Outcome and milk yield following a 2 step laparoscopic correction of left abomasal displacement in lactating dairy cattle
Pag.
298
Evaluation of homeopathic treatment during lactation in Sarda sheep with subclinical mastitis: preliminary results
Pag.
302
Lait de chamelle : composition et vertus thérapeutiques
Pag.
308
Trace element levels in Kıvırcık sheep suffering from alopecia
Pag.
311
Caprine arthritis encephalitis keeps spreading in sardinian goat herds
Pag.
312
Copper poisoning: a case report in a sheep flock in Sardinia
Pag.
316
Clinical, CSF and MRI findings during the evolution of the Coenurus cerebralis in three small ruminants
Pag.
321
Determination of Resistive Index and Pulsatility Index in healthy adult Sardinian breed Sheep during dry period.
Pag.
322
Poster session : Pathology
10
Determination of minimum alveolar concentration (MAC) of desflurane in mechanically ventilated sheep
Pag.
323
Sevoflurane vs. Isoflurane in sheep. time induction, recovery and hemodynamic profile at minimum alveolar concentration (MAC).
Pag.
324
Performance evaluation of different diagnostic techniques for the detection of Toxoplasma gondii infection in sheep meat for human consumption in Sardinia.
Pag.
325
Preliminary studies on paratuberculosis (PTB) in sheep and goats in Southern Italy: VI. Hematology and some blood chemical parameters as a function of PTB signs in sheep and goats.
Pag.
328
Surgery of teats and mammary gland in small ruminants: personal experiences
Pag.
335
Cardiac Cysticercus ovis in small ruminants of Sicily and Piedmont regions: Pathological investigations
Pag.
340
Analysis of morphological and functional parameters of ram semen stored at 4°c in a commercial extender for up to 24 hours.
Pag.
342
Epidemiology of small ruminant mastitis in Italy
Pag.
346
Species identification and prevalence of Eimeria spp. coccidial parasites in sheep from the North Dalmatia (Croatia)
Pag.
351
Methicillin-sensible Staphylococcus aureus and Methicillin-Resistant Staphylococcus aureus isolated in raw milk from dairy sheep farms located in Central Italy
Pag.
355
Phylogenetic analysis of ruminant pestiviruses circulating in Sardinia
Pag.
359
Antimicrobial-resistance profiles of Streptococcus uberis and Enterococcus faecalis strains isolated from sheep and goat milk samples
Pag.
363
Gli estratti vegetali nel controllo delle parassitosi da nematodi negli ovini: possibile realtà o utopia?
Pag.
368
Morphological and biomolecular characterization of Gongylonema sp. from wild and domestic ruminants in Sardinia, Italy.
Pag.
375
Endoparasites monitoring for the enhancement of the breeding of grazing cattle in Sardinia (Italy)
Pag.
377
Diagnostic efficiency of McMaster and FLOTAC for fluke egg counts in cattle
Pag.
383
In vitro anthelmintic activity of phytochemicals on sheep gastrointestinal nematodes
Pag.
386
11
Denaturing gradient gel electrophoresis (DGGE) a tool to assess diversity of Mycoplasma species in small ruminants
Pag.
389
The slaughterhouse as survey point: updating of Bovine parasites
Pag.
393
Atypical acute coenurosis in a sheep flock
Pag.
401
Principales parasitoses du dromadaire en Tunisie
Pag.
405
12
Invited lectures Genetics and history of ruminants in the Mediterranean area. Paolo Ajmone Marsan Istituto di Zootecnica, PRONUTRIGEN-Centro di Ricerca Nutrigenomica e Proteomica Università Cattolica del Sacro Cuore, Piacenza, Italia
The Mediterranean has witnessed the domestication of three major ruminant species. These have colonised new lands following human migrations, war and conquers and have adapted to a number of different and sometimes harsh environmental conditions. Ruminants demographic and evolutionary history is complex, as complex is the history of the many civilizations that have ruled Southwest Asia, North Africa and Europe in the last 5 millennia. DNA contains traces of this history, traces that may be revealed by interrogating Mediterranean ruminant genome diversity.
Workshop Valorisation and conservation of animal biodiversity and production of the Mediterranean areas Thursday, June 18
L'allevamento dei Ruminanti in Sardegna Marino Contu Associazione Regionale Allevatori Sardegna
L'intervento sarà modulato dando un quadro regionale degli allevamenti ovino, caprino e bovino riferendosi al numero di allevamenti e di capi. Per ogni settore sarà descritta la tipologia di allevamento inquadrandola nel territorio regionale. Saranno analizzate inoltre le produzioni derivanti e i loro mercati. Infine sarà illustrato il ruolo dell'Associazione Regionale Allevatori nell'ambito delle politiche di settore della Regione Sardegna.
14
New technologies for the genetic management and the valorisation of local breeds of ruminants in Sardinia. A. Carta Research Unit Genetics and Biotechnology, AGRIS Sardinia, Loc. Bonassai, 07040, Olmedo (SS), Italy.
Introduction Livestock systems in the Mediterranean basin have been traditionally based on local breeds well adapted to their environment and linked to typical food products. They have usually played an important role for exploiting marginal areas, maintaining landscape and ecological equilibrium, maintaining economic activities and human population in rural areas. However, the worldwide selection of livestock species for production traits in intensive farming systems had a strong impact also in Mediterranean situations, leading to a large diffusion of few cosmopolite pure breeds and a process of upgrading local breeds by crossbreeding with improved breeds. Some local breeds escaped this process since they were interested by efficient breeding schemes in their own environment as the Sarda dairy sheep breed. Local breeds of other species were submitted to an often unplanned crossbreeding strategy. For example, the genetic improvement of the local cattle breeds has been based on a crossbreeding strategy even if not always well planned. On the contrary, in swine and goats unplanned crossbreedings with several improved breeds have been performed. Where efficient selection schemes have been implemented, yield traits have been the main selection objectives. Selection tools used for improving yield traits were phenotype recording, parentage assignment, artificial insemination and controlled natural mating and genetic evaluations. For the latter BLUP animal-model methodology has been often applied. This methodology is based on the quantitative theory of infinitesimal model and can be considered as a “blind process” in which no knowledge on alleles, frequencies gene effects and genome locations exists. Selection schemes are often limited by the difficult use of AI due to organisational problems, high costs, extensive conditions and increasing problems in using hormonal treatments. Moreover, the use of controlled natural mating is limited by its laboriousness mainly in small ruminants. These constraints lead to a low number of animals with known pedigrees and a poor genetic connectedness between flocks thus reducing the effective size of the selected population. In addition the high costs of phenotype recording, often supported by the public contribution, lead to a reduction of the size of the recorded population, the development of simplified methods of performance recording with low precision and the unfeasibility of the this approach for several traits of recent interest. In fact, due to increasing demand of consumers for healthy food products and animal welfare and the need of reduction of production costs by the producers, several traits are more and more becoming of interest: resistance to diseases, nutritional value of food , safety of food, adaptation to local breeding conditions, feed efficiency, reproduction traits. The present condition of the traditional selection schemes based on the improvement of local breed shows two main constraints: the difficulty to increase the size of herd-book populations and the number of involved breeds and countries and the difficulty to include further traits. Concerning cross-breeding systems, in most cases crosses with improved breeds has been realised in a quite spontaneous way without any care to preserving the original local breeds. The main risks of this no-strategy are: the extinction of local breeds; the loss of genetic variability; the not good adaptation to hard environments of exotic breeds and crosses; modification of the typical food products due to the lack of link with the local breeds. The aim of this presentation is to describe the current use of genomic tools to preserve the local breeds of ruminants in Sardinia. Dairy sheep The Sarda breed is the largest Italian dairy sheep breed with a commercial population of about 3,000,000 ewes. Since early nineties a breeding program based on a pyramidal management of the purebred population, with at the top the selected population (SP) including around 200,000 ewes in 900 flocks, has been implemented. The selection scheme is mainly aimed at increasing milk yield and Scrapie resistance. Milk yield, fat and protein contents and udder morphology are routinely recorded. Hair bulbs of young males and females are also collected to perform PrP gene
15
genotyping. The genetic progress realised in SP is then transferred to the commercial population mainly by natural mating (NM) rams. About 200 young rams born from elite rams, used either for NM or AI, are progeny tested each year in order to select the next generation of elite rams. Further developments of this scheme are difficult due to the strong reduction of public funding. In this situation, people in charge of selection decisions for the Sarda breed are exploring the possibility of routinely including new molecular tools in the breeding program. The recent advent of affordable high-throughput technology for SNP, and also a reduction in sequencing costs, has been resulting in a shift to SNP markers for gene mapping and association studies in sheep. The cattle approach for genomic selection seems still unachievable. The main reasons are the high cost of high-density SNP arrays and the difficulty in finding well-structured reference populations to estimate SNP effects for traits that are either routinely measured or costly to record. One possibility to overcome these issues might be to evolve pre-existing experimental populations created for QTL detection purposes to “genomic flocks” in which representing the genetic variability of the whole population. “The Sarda genomic flock” was established in 1999 by creating an experimental population to detect QTLs for production and functional traits in sheep in a farm located in the southern part of Sardinia The experimental population consisted of ten families originated from F1 Lacaune x Sarda sires. Nine hundred and ten back-cross ewes (G0) were thus generated by mating the F1 sires with 785 Sarda ewes. From 2002 to 2014, 2896 ewes were generated to validate QTLs detected in G0 and possibly detect specific QTLs segregating in the Sarda breed. This population consists of descendants of the back-cross population and Sarda sires chosen among those used by AI in SP. This population has been designed by the National Association of Sheep Breeders (ASSONAPA) and AGRIS as “genomic flock” with the aim of increasing the power of QTL detection and estimating genomic breeding values of the most important blood lines present in SP either for routinely recorded traits or for traits costly to record. All the ewes has been genotyped with the OvineSNP50 Beadchip. In the “genomic flock”, functional and health traits are recorded. The following table lists the phenotypes measured and their recording frequency. Most phenotypes are not routinely recorded in SP. Table 1 – List of recorded phenotypes in the “genomic flock” Measured Trait Frequency of measurement Productive traits Daily Milk yield Fortnightly Fat, Protein and Lactose Content Fortnightly Body Weight (adult ewe) Monthly Body Condition Score Monthly Milkability and udder morphology Kinetics of milk flow Fortnightly Udder Morphology type traits 2-3 times/year linear score Udder’s digital pictures once in 2nd lactation Vacuometer once in 2nd lactation Health Traits Somatic Cell Count Fortnightly Clinical Mastitis visual detection + microbiological essay Faecal Egg Count 2 times/year ELISA test for paratuberculosis 2 times/year Histo-pathological examination for paratuberculosis once at slaughter Elisa quality for Maedi VISNA once per year Milk traits Fatty acid content Reproductive traits Prolificacy Fertility
once in 2nd lactation once/year once/year
16
We will present the main results of the association studies and the genomic selection approach and their perspectives. A further contribution of genomic tools to selection scheme of Sarda dairy sheep is the parentage testing. Parentage testing is essentially used for breeding males only in breeds where natural mating is still the main reproduction technique. In these populations, there is an increasing interest for breeders to move from the simple parentage testing to the paternity assignment for both breeding males and females. This application can avoid the laborious practice of controlled natural mating, allowing multiple sire mating-groups. Through this tool, even large flocks, where the management of several mating groups is difficult, can participate in breeding programs. We are studying a possible cheap approach to provide this service to the Sarda sheep breeders. Cattle and goat The main goal of applying genomic tools to Sardinian cattle and goats is recovering and conserving local breeds with the perspective of implementing selection schemes. For this goal a multi-disciplinary approach have been used. This approach consists of several steps: historical studies of the autochthonous genetic types, their diffusion and utilisation characterisation of the specific environment, farming system and typical products evaluation of the productive abilities (not only yield traits) and visible genetic profiles genetic characterisation by molecular tools and specific genes identification of herds/animals belonging to the local genetic types development of strategies of genetic management (selection and/or conservation schemes – in situ or ex situ).
Sardinian goat Despite the sheep breeding has always been the most important livestock production system in Sardinia, goat farming has always been of some importance, particularly in hilly or mountainous marginal areas. This is because goats are considered to be the only species able to exploit marginal areas covered by ligneous vegetation and unsuitable for tillage or for raising other domestic herbivore species as it is also the case in other Mediterranean regions. Goats in Sardinia have often been raised in conjunction with sheep or cattle. The other species graze on the herbaceous vegetation while the goats browse the leaves and twigs of bushes. In the last century social and economic changes, and the consequent decline in agriculture, led to the progressive abandonment of the areas used for goat farming. In this framework, goats are still of economic relevance in Sardinia. It is the region with the highest goat population in Italy (241,315 head; ISTAT, 2010). The main product is milk, which is mostly used to make cheese. Traditional homemade cheeses are produced directly in the farms, and are mainly destined to domestic consumption or small local markets. Most of the milk is delivered to cheese making factories where it is usually mixed with sheep milk and used to make sheep-goat cheeses. Suckling kids are used for meat, a seasonal product that is locally much appreciated. Concerning the current population of Sardinian goat, farms are located in mountains, low hills and even plans resulting in a quite large variability in terms of feeding and management techniques. We carried out a study on the Sardinian goat farming system based on a survey using interview forms in the main regions interested by the goat breeding. Results of this work showed that the goat farming system in Sardinia is, as a whole, remarkably backward in terms of structural level and productivity. The traditional management is based on extensive exploitation of natural pasture from bushland. Moreover, there is not a planned genetic management of the goat population: there is no well organized pure breed selection scheme in place and unplanned crossbreeding occurs. These conditions mean that productive performances are very low. More precisely, we detected three principal farming systems. There was a more traditional extensive system (ES) with low structural, management and productive levels, based on the exploitation of public land in the mountainous “Ogliastra” region. Here the most frequent genotype was basically the native Sardinian breed. This could be considered as the basis of the goat farming on the island. The second group (SES) was mainly located in Sulcis-Iglesiente region. Once again the structural, management and productive levels were lower than those of dairy sheep but the goat farming was generally better developed than the previous cluster. Finally, they detected a group of farms showing a sort of semi-intensive farming system similar to the dairy sheep
17
one (SIS) with high productive and reproductive performances. Beyond this level of intensification there were few farms. These basically used the housing system typical of Northern Europe. The differences between the two main clusters (ES and SES) in terms of altitude, private ownership, tilled surface areas, and association with dairy sheep, suggested that they were suitable for different types of sustainable development. On the whole, this study clearly demonstrates how varied goat farming in Sardinia and emphasizes the need for development strategies which can take this diversity into account as well as the economic and social aspects that warrant further research. From a genetic point of view, the current Sardinian goat population is a crossbred of autochthonous animals with improved Mediterranean goats, mainly of the Maltese breed. This state reflects the previously mentioned situation of the local breeds in the world that are being replaced in both developed and developing countries by a few high production breeds which, to be successful, require high inputs, skilled management and comparatively benign environments. A study carried out with microsatellite markers showed that the above mentioned clusters corresponded to increasing proportions of native sardinian blood moving from intensive to extensive farming systems. Our studies are now moving to more sophisticated molecular tools such as SNP arrays. Currently, the planned genetic improvement strategy of the Sardinian population would be based on a pyramidal management with at the top the herd book of the Sardinian goat (Libro Genealogico della Capra Sarda) aimed at creating the genetic progress for milk yield and composition. Unfortunately, this strategy is not fully realised due to the lack of artificial insemination and a not consistent genetic evaluation of the breed animals. Moreover, the herd book include animals of either the native Sardinian type or products of its cross with the Maltese breed. Another herd book (Registro Anagrafico della “Capra Sarda Primitiva”) without selection purposes but aimed at recovering the native Sardinian type was set up but is still empty.
Sardinian cattle This species was represented in the island by a single group spread all over the island, the ‘Sardinian breed’, that was constituted by a population with morphological, reproductive and productive characteristics with high variability. This population, characterized by a good adaptation to several environments, rustic nature and resistance, was used mainly for work, meat and milk production for domestic use due to poor ability to production in plain soil with cereal attitude. With the aim to improve both these characteristics, several crossbreedings using improved breeds were carried out. At the end of the 19th century, the breeds that resolved these aspects were identified: Modicana of Sicily for the work in plain soil and Bruna of Switzerland for milk production. With bulls of these breeds the grading up system was used for about 50 years: this method consists in continually mating females of a breed to males of another breed. Thus in each generation, the proportion of the progeny genes traceable to the second breed increases. This type of crossbreeding changed the native Sardinian population into the Sardo-Modicana in the centre and south of the island, and into the Bruno-Sarda, mainly in the North of Sardinia, although the Sardinian breed was still reared as a pure breed in the harsh regions of the island. This process of absorption of the original autochthonous breed with the two exotic breeds more suited to the new productive demand, was extended and lasted until 1950 with the Modicana and until 1975 with the Bruna. Then nowadays there are three main cattle breeds in Sardinia: Sarda (18,013 heads), Sarda-Modicana (3,017 heads) and Sarda-Bruna (24,374 heads). There is a specific herd-book for these three breeds. The conservation of the SardoModicana is currently assured by a well managed strategy of product labelling and valorisation. In the case of the Sarda and Sarda-Bruna, the conservation is assured through the rational use of the terminal cross with beef breeds, mainly Charolais and Limousin, which in the 70s were identified as the most suited for this purpose. A terminal cross program consists of mating females of a breed to males of another breed and using all crossbred progeny as market animals. In general the crossbred progeny never enters the breeding population, but it Sardinia F1 or F2 females are often kept for reproduction in the most favourable areas. Local breeds are well adapted to their environment, but forecasted climate changes are expected to deeply modify natural and human systems on all continents. Adaptive ability of livestock to climate variations will be a factor of first importance in the Mediterranean climate extending area. To understand the genetic basis of adaptation, an international Project (GALIMED "Genetic Adaptation of Bovine Livestock and production systems in
18
MEDiterranean region") has been funded by INRA (metaprogram ACCAF). Galimed proposes a multidisciplinary approach on 14 selected breeds from the north and the south of the Mediterranean area, including the Sardinian ones. This approach combines population genetic, environmental, livestock management and production systems data to characterize Mediterranean cattle, quantify biodiversity, describe the covariation of these different factors, and detect genetic variants and selection signals associated with heat or drought adaptation. The project will enhance the resolution of available data concerning Mediterranean cattle, deliver tools for building guidelines on conservation/breeding objectives, and evaluate management practices and innovation tracks to face the consequences of climate change. References A. Carta, Sara Casu, and S. Salaris. 2009. Invited review: Current state of genetic improvement in dairy sheep. Journal of Dairy Science 92, no. 12: 5814-33. A. Carta, M.G. Usai, T.Sechi, S.Miari, S. Sechi, S.L. Salaris, G. Mulas, F. Barillet, J.M. Elsen, S. Casu, 2014. Exploring the genetic variation between Sarda and Lacaune dairy sheep breeds by genome wide association study on economic traits, 10th WCGALP, Vancouver, Canada, August 17-22, 2014. S. Casu, T. Sechi, MG. Usai, S. Miari, M. Casula, G. Mulas, B. Lazzari, R. Giannicco, A. Stella, A. Carta, Investigating a highly significant QTL for milk protein content segregating in Sarda sheep breed close to the caseins cluster region by whole genome re-sequencing of target animals, 10th WCGALP, Vancouver, Canada, August 17-22, 2014. M G Usai, S. Casu, T. Sechi, S. Miari, G. Mulas, G B Congiu, S. Sechi, S L Salaris and A. Carta, Genome wide association study on milk production traits in a nucleus flock of Sarda breed sheep using a novel method combining linkage and linkage disequilibrium mapping, 10th WCGALP, Vancouver, Canada, August 1722, 2014. M. G. Usai, Sara Casu, G. Molle, M. Decandia, S. Ligios, and A. Carta. 2006. Using cluster analysis to characterize the goat farming system in Sardinia. Livestock Science 104, no. 1-2: 63-76. T. Sechi, M. G. Usai, S. Miari, L. Mura, Sara Casu, and A. Carta. 2007. Identifying native animals in crossbred populations: The case of the sardinian goat population. Animal Genetics 38, no. 6: 614-20.
19
Cryobanking: a challenge to preserve small ruminants biodiversity Naitana S, Berlinguer F, Porcu C, Pasciu V, Satta V, Succu S, Leoni G. Department of Veterinary Medicine University of Sassari, Centro di Competenza Biodiversità Animale, Italy
Abstract The possibility to maintain the potential viability of living cells indefinitely by cryopreservation open a large number of possibilities in medical, agricultural and reproductive fields. During the last years, cryobanking achieved interest but, even though the successful of both gametes and embryos was reached in a variety of animal species, the empirical approaches adopted till now added very little information on the basic knowledge of cell preservation. The use of cryoprotectants and the un-physiological reduction of temperature can cause morphological, biochemical and functional damages to cryopreserved cells. This review focuses on main advantages/disadvantages and modifications caused by cryopreservation and summarize the knowledge on biochemical resumption of cryopreserved sperm, oocytes and embryos in small ruminants. Introduction The first purpose of cryopreservation in mammalian species is to temporally block metabolic activity, minimize external injury, restore reversible damage after resumption of potential viability and help the regeneration of living cells and tissues. In the field of reproduction, long term storage of sperm, oocyte, and embryo is one the most important tool to improve genetic breeding and assisted reproductive technology (ART) in veterinary medicine. Agriculture intensification determined rapid and radical changes in the structure of livestock breeding causing an erosion of animal resources in the Mediterranean area where a large quantity of breeds has been selected during several centuries. Following the theory allocation resources, the resources inside of organism are limited and well balanced to respond, in natural breeding, at all several stress conditions. However, in very intensive breeding conditions characterized by hard genetic selection of few breeds with very high milk/meat production, the animal resources are re-addressed to high efficiently milk/meat production determining physiological problem to fitness. For this reason it need to maintain the biodiversity of animal ecotype in the Mediterranean area for a better sustainability of rural environments and animal production systems. Cryopreservation of both gametes and preimplantation embryos gives a new opportunity to increase genetic selection programs among the breeds, to protect population integrity of local ecotype and to preserve genetic material of endangered wildlife species. The establishing of cryobanks, associated with artificial insemination, embryo transfer programs and in vitro embryo production, could impair the erosion of animal resources and maintain biodiversity in the global world. Cryopreservation procedures At the moment there are two methods for reproductive cells cryopreservation: conventional freezing and vitrification. There are considerable differences between conventional freezing and vitrification in term of phase transition (ice crystal vs glassy), cryoprotectant agents and efficient concentrations (5% vs 40%), cooling rates (10 C°/m vs 23.000 C°/m) and execution time (2 hours vs 10 minutes). The most common CPAs used to vitrification include dimethyl sulfoxide (DMSO), ethylene glycol (EG), glycerol (G) and propylene glycol (PROH) which show low toxicity and high permeation. Usually a mixture of two CPAs is used to limit their specific toxicity and to combine the protection ability of each CPA. In contrast to conventional freezing the vitrification method gives the solidification with glasslike formation preventing the ice crystallization by extreme elevation of viscosity during cooling. Improving the cooling and warming rates is the most important factor that affects the probability of successful vitrification. It has been suggested that the vitrification process can be improved by decreasing the volume of liquid to be cooled to less than 1 µl. The success of vitrification procedures has been enhanced by using new cryo-device system to load the embryos with the Minimun Volume Size of vitrification solution, such as open pulled straws, cryotop, cryoloop.
20
Researchers preference for vitrification method could be due to its high potential to future development on the cryopreservation field in particular for oocyte and embryo. Spermatozoa Which cryobanking via to ART ?. Sperm collection is very easy and cheap. It is also possible to sperm collection postmortem from the epididimis within 24-36 hours in relation to the ambient temperature. The flushing collection must be carried on only from cauda epididymis because only in this part the spermatozoa acquire fertilizing potential. Only few males can be used to sperm cryobanking building, while hundred off-springs can be potentially obtained with very low economic cost. The main changes that occurs during freezing are mainly ultrastructural, biochemical and functional, which impair sperm transport and survival in the female reproductive tract, reduce in vitro fertilizing potential and in synchronized goat and sheep. In frozen-thawed goat and ram semen there is a decline in motility, viability and forward progression in the female reproductive tract. These alterations may not affect motility but reduces lifespan, ability to interact with the female reproductive tract causing a reduction in fertilizing potential of spermatozoa. In light of these information from the literature, frozen/thawed spermatozoa deposited in the female genital tract undergo a series of events that alter the stability and permeability of the cell membrane and triggers internal signaling cascades ending with functional and structural changes termed ‘capacitation process’, which render the spermatozoa competent to fertilize. At the same time capacitation process can also be induced in vitro by incubation in suitable medium for in vitro fertilization of oocytes and embryo production. Computerassisted-semen-analysis (CASA) provides objective and reproducible data on a number of sperm viability and motility parameters. In recent years there has been an increase in the use of these systems to evaluate semen quality resulting in high correlations between several CASA parameters and the fertilizing potential of frozen-thawed sperm. The viability is better in bull (70-80%) than ram and buck spermatozoa (50-60%). Greater damages have been observed in cytoplasma, acrosomal and mitochondrial membranes and nuclear DNA integrity. The membrane status of spermatozoa (intact, capacitated and acrosome reacted) can be evaluated using specific stain and ATP concentration. The damage of cytoplasmic membrane determines a great reduction of sperm viability while the alteration of acrosome membrane arouse low fertilization rate. Energy metabolism is a key factor supporting sperm function. ATP is one of the basic components in a sperm cell and is used not only as a energy source but also for protein phosphorylation in cell signaling. The functional integrity of mitochondria is believed to be important for sperm survival in the female genital tract. Among other sperm tests, the evaluation of DNA integrity (comet assay) has been considered important as early embryo development depends on the presence of normal DNA by. After cryopreservation spermatozoa are particularly susceptible to DNA damage since freezing and thawing procedures lead to significant reduction in the level of spermatozoa antioxidant. Therefore the assessment of DNA integrity is of high value in determining frozen/thawed semen quality. Studies on sperm demonstrated that semen cryopreservation is associated with increased generation of Reactive Oxygen Species (ROS).The excessive production of ROS might have serious implications on sperm structure and functionality, because spermatozoa are particularly susceptible to damage induced by ROS represented by superoxide anion, singlet oxygen. For these reasons, different exogenous antioxidants as glutathione, superoxide dismutase, L-carnitine, vitamin E, melatonin, have been included in the freezing extender to restore the equilibrium between ROS and antioxidants Their ability to effectively improve sperm quality and function after thawing has been reported in several experimental studies, thus providing indirect evidence that oxidative stress during cryopreservation harms these cells. Spermatozoa incubated under antioxidant molecules have revealed numerous biochemical and physiological changes that accompany the capacitation process thus minimizing premature acrosome reaction. Previous our studies in the ovine species confirmed the protective effect of melatonin, on the mitochondria sperm and ATP production. Male animals can be classified as ‘‘good freezers or ‘‘bad freezers’’ depending on the capacity of their semen to support freezing and recover cryopreservation injuries. There are some characteristics of the membrane structure, which may depend on individual characters determining better resistance of spermatozoa to cryopreservation. This supports the idea that cryopreservation could be under genetic control. At moment sperm cryopreservation stays in static condition due to low viability and fertility of cryopreserved spermatozoa and low economic value cost of small ruminants. There are available two method to insemination. The
21
cervical insemination is very easy and quick, but at the same time it shows low fertility and lambing rate (15-35%) using very high number of spermatozoa 200-400 x106. This is unacceptable to low cost of the animals. The intrauterine insemination have high cost determined by specific equipment and well qualified technicians for laparoscopy with good fertility and lambing rate (60-80%) using low number of spermatozoa 40 x106. However, in Norway and Sweden, for animal welfare reasons, not allowed and in these countries the prevailing AI technique is based on cervical insemination with better results. Although most in vitro fertilization (IVF) studies use freshly ejaculated spermatozoa, buck and ram frozen-thawed spermatozoa have been used in IVF trials for embryo production. Usually in our lab we used in vitro fertilization, during embryo production procedures, a concentration of 1x106 frozen-thawed ram sperm having a range of 70-90% fertilization rate and of 45-55% blastocyst rate. Oocyte Which cryobanking via to ART ?. Oocyte is less attractive than sperm because small ruminant species are mono or bi-ovulatory. For this reason several females are needed to obtain a satisfactory number of oocytes. The investigation on the oocyte cryopreservation of small ruminants is relatively recent. To increase oocytes number, the female donors must be treated with gonadotrophin for superovulatory treatment requiring high competent technicians for laparoscopic ovum pick-up (LOPU). For this, at moment, oocyte cryobanking is very expensive. Oocytes are extremely sensitive to slow freezing, therefore, vitrification could be an alternative approach to oocyte cryobanking. Female gamete shows considerable morphological and biochemical modifications during the cryopreservation procedure which are highly variable among and within the species, depending by the procedures, cryoprotectant agents, sources and developmental stages (germinal vescicle or metaphase II). It is know that some species are more resistant than others depending on the quantity and quality of lipid inside of oocytes. In order to reduce total lipid content, mechanical or chemical delipidation using oocyte centrifugation has been proposed; also to change membrane composition it has been suggested to increase the ratio of unsaturated to saturated fatty acids by dietary modifications. A further difficulty to preserve this reproductive cell derives also by the volume of the mammalian oocyte in the range of three to four orders of magnitude larger than that of the spermatozoa, thus substantially decreasing the surface-to-volume ratio and affecting cryoprotectant flow across membranes. In this direction cryodevices used to hold oocytes during chilling and storage affect drop volume and contact to liquid nitrogen. Our group observed the different effect of distinct cryodevices on oolemma integrity, developmental potential after IVF, as well as MII spindle morphology and some expression of specific transcripts activity of vitrified MII ovine oocytes. Additional cryoinjuries have been observed after vitrification of ovine oocytes at GV stage, as fracture of ZP adjacent to cumulus cells, rupture of gap junction and loss of the communication between oocytes and cumulus cells altering maturation process consecutive to oocyte vitrification and consequently their developmental competence. At moment, embryo development, after vitrified oocytes at M II, is very low with only 17% of the oocytes developing to blastocysts, compared with 55% for untreated oocytes. More recently, better results are obtained with vitrified oocytes at germinal vescicle stage with 29% of blastocysts. Embryo Which cryobanking via to ART?. Embryo cryobanking summarizes both gametes maintaining complete genome and mtDNA for population reconstitution. The source of in vivo embryo production requires superovulation protocol to improve a good number of embryos. A competent team collect 80% of superovulatory responses from uterine flushing. Obviously all these aspects improve the cost of this technique giving it more expensive. Also this technique requires surgical procedures that impair repeated embryo collection from same donors. Oocytes source can be recovered from female of high genetic value by LOPU without adhesions and fibroses with low invasive procedure. After collection the cumulus oocytes are in vitro matured (22h) and in vitro fertilized (27h) and cultured up to blastocyst stage (7days). In vitro embryo production is less efficiently with 55% of blastocyst, also embryos are more sensitive to low temperature and have less cryotolerance than those collected in vivo, due to deficiencies in the in vitro culture conditions. Therefore, advances in embryo survival following vitrification could be achieved by improving their culture conditions, or by selecting embryos for vitrification based on the kinetics of their development. A single exposure to a CPA subjects the embryos to an increased risk of osmotic shock, particularly
22
when the concentration is extremely high. Depending on the duration of exposure, a single immersion may not allow enough time for adequate CPA permeation into the blastocoelic cavity. Survival rates after vitrification improved with the evolution of two-step protocols. In the two-step protocols, the embryos is allowed to equilibrate for a small time at a lower CPA concentration before a short exposure to the vitrification solution at a higher concentration. In ovine species has been observed that IVP embryos showed a low survival rate in term of hatching rates (80 vs 95), pregnancy rates (60 vs 80) and lambing rates (35 vs 80) compared to those in vivo produced. The developmental stage, at which the embryos are cryopreserved, is considered to be a critical factor for the viability of the embryo after vitrification. Among early stage embryos produced in vitro, those cultured to the blastocyst stage before cryopreservation had the highest rate of survival rate after warming. The higher cryotolerance of ovine blastocyst compared with those at earlier stages might be related to the higher resistance of their cellular membranes to osmotic and toxic stress after the formation of the blastocoelic cavity. The increase of Na/K ATPase activity which occurs during blastocoelic formation in trophoblastic cell membranes may determine more active transport mechanisms of cryoprotectants leading to a decrease exposure time and to low concentration of cryoprotectants needed during cryopreservation. Furthermore, the blastomeres of the blastocyst have a higher surface area to volume ratio than early stage embryos which may contribute in the former to higher permeability coefficient to water and cryoprotectants in the latter. Therefore, blastocysts are more tolerant to osmotic stress than early stage embryos. Indeed, developmentally compromised or low competent embryos may be lost during early development in vitro, such that the latter stages represent a selected group of more competent embryos. In our previous studies we observed that mitotic activity, measured as BrDU incorporation in neo-synthesized DNA, was delayed in vitrifiedwarmed blastocysts compared to those not vitrified. BrDU incorporation was evidenced in a small portion of nuclei after 3 hours of post warming culture, but only after 9-12 hours the rate of BrDU positive nuclei was similar to not vitrified embryo. It has been proposed that other aspects like chromosomal abnormalities can influence the viability of embryonic cells. Conclusion Results obtained with different procedures confirm that reproductive cell cryopreservation have to be seen not just a way to preserve cell lineages but as a more complex method to enhance genetic survival and developmental capacity. An appropriate equilibrium must be adopted among all factors involved in the cellular response to cryopreservation including quality of embryos, permeable and non permeable CPAs, time of exposure in order to minimize structural/functional injuries and to improve the potential capacity to use in the ART. It is needed to improve our knowledge on the cryopreservation procedures of reproductive cells, which is often derived from empirical experimentation with a low understanding of the cryobiological basic process and using only survival and developmental rate to assess the quality of cryopreserved spermatozoa, oocytes and embryos. Cell preservation by lyophilisation will be an interesting alternative to traditional method for cryopreserve cells without the use LN, but more studies are needed to increase efficiently and effectively of this new procedure for practical application, with the aim to facilitate the storage at room temperature and promote germplasma exchange among the breed of small ruminants in Mediterranean area. The Mediterranean environment has permitted a high expression of animal genetic diversity with large number of breeds, proportionally greater than those found on a world scale for this it need to preserve this biodiversity of small ruminants for the future generation. However, to low cost of small ruminants the building of cryobanking will be possible only through public support References Arav A. Cryopreservation of oocytes and embryos. Theriogenology. 2014 1;81:96-102. Barbas JP, Mascarenhas RD. Cryopreservation of domestic animal sperm cells. Cell Tissue Bank. 2009;10(1):49-62. Benson JD, Woods EJ, Walters EM, Critser JK. The cryobiology of spermatozoa. Theriogenology. 2012;78:1682-99. Berlinguer F, Madeddu M, Pasciu V, Succu S, Spezzigu A, Satta V, Mereu P, Leoni GG, Naitana S. Semen molecular and cellular features: these parameters can reliably predict subsequent ART outcome in a goat model. Reprod Biol Endocrinol. 2009, 9;7:125.
23
Berlinguer F, Ledda S, Rosati I, Bogliolo L, Leoni G, Naitana S. Superoxide dismutase affects the viability of thawed European mouflon (Ovis g. musimon) semen and the heterologous fertilization using both IVF and intracytoplasmatic sperm injection. Reprod Fertil Dev. 2003;15:19-25. Bogliolo L, Murrone O, Piccinini M, Ariu F, Ledda S, Tilocca S, Albertini DF. Evaluation of the impact of vitrification on the actin cytoskeleton of in vitro matured ovine oocytes by means of Raman microspectroscopy. J Assist Reprod Genet. 2015;32:185-93. Bogliolo L, Ledda S, Innocenzi P, Ariu F, Bebbere D, Rosati I, Leoni GG, Piccinini M. Raman microspectroscopy as a non-invasive tool to assess the vitrification-induced changes of ovine oocyte zona pellucida. Cryobiology. 2012;64:267-72. Chelucci S, Pasciu V, Succu S, Addis D, Leoni GG, Manca ME, Naitana S, Berlinguer F. Soybean lecithin-based extender preserves spermatozoa membrane integrity and fertilizing potential during goat semen cryopreservation. Theriogenology. 2015 1;83:1064-74. Cseh S, Faigl V, Amiridis GS. Semen processing and artificial insemination in health management of small ruminants. Anim Reprod Sci. 2012;130:187-92. Dattena M, Ptak G, Loi P, Cappai P. Survival and viability of vitrified in vitro and in vivo produced ovine blastocyst. Theriogenology. 2000;53:1511-9. Ledda S, Bogliolo L, Succu S, Ariu F, Bebbere D, Leoni GG, Naitana S. Oocyte cryopreservation: oocyte assessment and strategies for improving survival. Reprod Fertil Dev. 2007;19:13-23. Leibo SP. Cryopreservation of oocytes and embryos: optimization by theoretical versus empirical analysis. Theriogenology. 2008 1;69:37-47. Leoni G, Berlinguer F, Rosati I, Bogliolo L, Ledda S, Naitana S. Resumption of metabolic activity of vitrified/warmed ovine embryos. Mol Reprod Dev. 2003;64:207-13. Leoni GG, Berlinguer F, Succu S, Bebbere D, Mossa F, Madeddu M, Ledda S, Bogliolo L, Naitana S. A new selection criterion to assess good quality ovine blastocysts after vitrification and to predict their transfer into recipients. Mol Reprod Dev. 2008;75:373-82. Leoni GG, Succu S, Satta V, Paolo M, Bogliolo L, Bebbere D, Spezzigu A, Madeddu M, Berlinguer F, Ledda S, Naitana S. In vitro production and cryotolerance of prepubertal and adult goat blastocysts obtained from oocytes collected by laparoscopic oocyte-pick-up (LOPU) after FSH treatment. Reprod Fertil Dev. 2009;21:901-8. Liu J, Phy J, Yeomans E. Theoretic considerations regarding slow cooling and vitrification during cryopreservation. Theriogenology. 2012;78:1641-52. Loi, P., Matsukawa, K., Ptak, G., Clinton, M., Fulka, J. Jr., Nathan Y. & Arav, A. 2008.Freeze-dried somatic cells direct embryonic development after nuclear transfer. PLoS One, 3:e2978. Mara L, Casu S, Carta A, Dattena M. Cryobanking of farm animal gametes and embryos as a means of conserving livestock genetics. Anim Reprod Sci. 2013;138(1-2):25-38. Mullen SF, Fahy GM. A chronologic review of mature oocyte vitrification research in cattle, pigs, and sheep. Theriogenology. 2012;78:1709-19. Moawad AR, Zhu J, Choi I, Amarnath D, Chen W, Campbell KH. Production of good-quality blastocyst embryos following IVF of ovine oocytes vitrified at the germinal vesicle stage using a cryoloop. Reprod Fertil Dev. 2013;25(8):1204-15 Naitana S.. Dattena M. Gallus M. Loi P. Branca A Ledda S. Cappai P. Recipient synchronization affects viability of vitrified ovine blastocysts. Theriogenology 1995,43, 1371-1378. Pereira RM, Marques CC. Animal oocyte and embryo cryopreservation. Cell Tissue Bank. 2008;9:267-77. Pribenszky C, Vajta G. Cells under pressure: how sublethal hydrostatic pressure stress treatment increases gametes' and embryos' performance. Reprod Fertil Dev. 2011;23:48-55. Ptak G, Dattena M, Loi P, Tischner M, Cappai P. Ovum pick-up in sheep: efficiency of in vitro embryo production, vitrification and birth of offspring. Theriogenology. 1999 15;52:1105-14.
24
Rodríguez-Dorta N, Cognié Y, González F, Poulin N, Guignot F, Touzé JL, Baril G, Cabrera F, Alamo D, Batista M, Gracia A, Mermillod P. Effect of coculture with oviduct epithelial cells on viability after transfer of vitrified in vitro produced goat embryos. Theriogenology. 2007 1;68:908-13. Succu S, Berlinguer F, Pasciu V, Satta V, Leoni GG, Naitana S. Melatonin protects ram spermatozoa from cryopreservation injuries in a dose-dependent manner. J Pineal Res. 2011;50:310-8. Succu S, Berlinguer F, Leoni GG, Bebbere D, Satta V, Marco-Jimenez F, Pasciu V, Naitana S. Calcium concentration in vitrification medium affects the developmental competence of in vitro matured ovine oocytes. Theriogenology. 2011 1;75:715-21. Succu S, Bebbere D, Bogliolo L, Ariu F, Fois S, Leoni GG, Berlinguer F, Naitana S, Ledda S. Vitrification of in vitro matured ovine oocytes affects in vitro pre-implantation development and mRNA abundance. Mol Reprod Dev. 2008;75: 538-46. Succu S, Leoni GG, Bebbere D, Berlinguer F, Mossa F, Bogliolo L, Madeddu M, Ledda S, Naitana S. Vitrification devices affect structural and molecular status of in vitro matured ovine oocytes. Mol Reprod Dev. 2007;74:1337-44. Yániz JL, Soler C, Santolaria P. Computer assisted sperm morphometry in mammals: A review. - Anim Reprod Sci. 2015;156:1-12. John Morris G, Acton E, Murray BJ, Fonseca F. Freezing injury: the special case of the sperm cell. Cryobiology. 2012;64:71-80.
25
Exploitation of animal production of the Mediterranean: experiences and results in Sicily M.L. Scatassa (1), L. Arcuri (2), M. Todaro (3) (1), Istituto Zooprofilattico sperimentale della Sicilia “A.Mirri, via Gino Marinuzzi, 3, 90143 Palermo, Italy; (2) Local Health Unit 6, Via Carmelo Onorato, 6 90129 Palermo; (3) Department of Agricultural and Forest Science (SAF), University of Palermo, Viale delle Scienze, 13, 90128 Palermo
European sheep and goat production are important economic, environmental and sociological issues for Mediterranean countries. Today sheep and goats are reared in all continents, but their origins is the Mediterranean area and Middle East and Asian territories. The development of sheep and goat is deeply tied to the economic and cultural historians of the Mediterranean populations. These conditions have resulted in the strong local presence of most of the sheep and goat populations specialized to milk production. Table 1 report the consistency of dairy sheep and milk and cheese production obtained in the world. The number of reared dairy ewes and milk and cheese production showed the importance of this area for the sheep breeding word wide. A comparison between the number of animals (30.1%) and milk products (44.6%) shows that the production capacity of animals reared in the Mediterranean is considerably higher than that of other countries. The high efficiency of the dairy industry in the Mediterranean countries is evident from the percentage of cheese production, that represent the 57.3% of the world, that is justified by the centuries-old tradition of breeding dairy, particularly at north of the Mediterranean basin, together with the level of expertise of the farms (breeding techniques, animal genetics and dairy technology). Table 1 - Dairy sheep, milk production (ton) and cheese yielded (FAOSTAT, 2013). Continent Dairy ewes Milk Yield n. % ton. % Africa 75,303,658 34.3 2,250,650 22.2 Americas 1,513,500 0.7 42,095 0.4 Asia 112,964,933 51.4 4,823,340 47.6 Europe 29,904,550 13.6 3,021,664 29.8 World 219,686,641 100 10,137,749 100 Mediterranean area 66,080,622 30.1 4.517.239 44.6
Cheese Yield ton. 45,965 7,682 265,174 339,983 658,803 377270
Table 2 - Goat, milk production (ton) and cheese yielded (FAOSTAT, 2013). Continent Goats Milk Yield n. % ton. % Africa 64,774,163 35.8 4184887 23.3 Americas 8,508,010 4.6 592500 3.3 Asia 112,861,354 55.1 10653509 59.3 Europe 850,225 4.5 2526426 14.1 Oceania 1,450 0,00 50 0.00 World 219,686,641 100 10,137,749 100 Mediterranean area 19,656,996 9,8 2,520,207 14.0
Cheese Yield ton. 150,290 23,293 98,243 19,5261 658,803 189,223
% 6.6 1.2 23.4 10.2 100 57.3
% 32.2 5.0 21.0 41.8 100 40.5
Substantial differences are observed for goat rearing. Over 80% of the world's goat population is reared in Asia (55.1%) and Africa (35.8%), while only 6% is reared in European, Asian and African countries bordering to the Mediterranean basin. Despite the low number of goat farms in the countries of the Mediterranean basin, it is observed the increased production of cheese, accounting for 40.5% of world production, confirming the great dairy tradition of these countries. The distribution of breeding and production of sheep and goat evidently affected the social and economic conditions of the various continents. The goat farm also features rusticity typical of the species is able to ensure the livelihood of the poorest people by providing milk and meat. Tables 3 and 4 present the data distribution in the continents of sheep and goats slaughtered and their meat production (FAOSTAT, 2013). More than half of the sheep and goat from meat are reared in Asia and Africa, while
26
in the countries of the Mediterranean basin are raised only 16% of sheep and goats 7.8%. Meat production reflects the distribution of sheep and goat populations both in the various continents and also in this case, it is probably influenced by economic and cultural factors. Table 3 - Sheep slaughtered and meat yield (FAOSTAT, 2013). Continent Africa Americas Asia Europe Oceania World Mediterranean area
Sheep slaughtered n. 122,262,417 25,121,973 262,128,248 73,163,250 54,066,368 536,742,256 87,622,381
% 22.8 4.7 48.8 13.6 10.1 100 16.3
Meat yield ton. 1,687,934 406,510 4,254,075 1,130,147 1,110,589 8,589,257 1,406,559
% 19.7 4.7 49.5 13.2 12.9 100 16.4
Table 4 - Goats slaughtered and meat yield (FAOSTAT, 2013).
Africa Americas Asia Europe Oceania World Mediterranean area
Goats slaughtered n. % 115,281,611 26.3 9,773,698 2.2 301,830,696 68.9 10,266,451 2.3 1,167,915 0.3 438,320,371 100.0 20,543,431 4.7
Meat yield ton. 1,301,339 125,835 3,805,642 112,260 27,329 5,372,407 274,377
% 24.2 2.3 70.8 2.1 0.5 100.0 5.1
Table 5 – Distribution of small ruminant population in the Mediterranean countries (FAOSTAT, 2013). Dairy Sheep Dairy Goat Meat Sheep Meat Goat Albania 1,380,607 643,092 1,755,000 975,000 Algeria 15,000,000 2,738,000 16,200,000 1,850,000 Bosnia and Herzegovina 285,642 96,735 Croatia 92,800 34,00 163,700 17,000 Cyprus 250,000 185,00 160,521 107,483 Egypt 2,000,000 1,305,000 2,343,500 2,707,000 France 1,238,433 885,559 6,092,000 1,176,000 Greece 7,198,000 3,300,000 6,834,000 3,528,300 Israel 180,000 90,00 448,000 272,900 Italy 4,848,000 565,000 3,794,900 166,075 Lebanon 270,00 330,000 238,40 193,789 Libya 2,175,000 515,000 2,50,000 880,000 Malta 8,012 3,100 6,300 3,200 Montenegro 128,550 25,600 Morocco 960,000 1,700,000 10,500,000 2,363,000 Occupied Palestinian Territory 613,415 180,872 390,000 191,999 Spain 2,950,000 1,226,000 10,312,037 1,213,751 Syrian Arab Republic 11,884,926 1,522,425 4,096,848 473,933 Tunisia 330,00 490,000 3,640,000 756,000 Turkey 14,287,237 3,943,318 18,375,000 3,668,000 Total Mediterranean area 66,080,622 19,656,966 87,622,381 20,543,431 In table 5 are reported the distribution of sheep and goats reared in the Mediterranean countries; the higher number of sheep is present in Algeria, Turkey and Syrian. Considering the size of the national population in the country of the Mediterranean area, we can state that Algeria, Turkey and Syrian Arab Republic are leaders in milk sheep flocks, instead within the EU countries, the leader are Greece and Italy. For the goat the leader is Turkey while within
27
European Union Greece and Spain. As far as meat sheep, Turkey, Algeria and Morocco are the major countries, while the Spain is the leader within UE. Goats are more present in Turkey and Greece. Table 6 shows the data available on FAOSTAT related to the production of sheep and goat cheese. The major producers of sheep's cheese are Greece, Spain and Syria. For cheeses goat, the leader is France, which has a remarkable tradition of cheese production of fresh goat cheese made with acid coagulation followed by Greece and Spain. The same data were aggregated into two groups according to the degree of economic development of the Mediterranean countries. Inside the primacy productive of the Mediterranean countries, the 72% of the sheep cheeses and 92% of the goat cheeses comes from the most industrialized countries of the Mediterranean area (EU countries and Israel). Comparing the data on a global scale we can see that 41% of the sheep cheeses and 37% of the goat cheeses produced in the world comes from the industrialized countries of the Mediterranean area. Of these, France and Italy take the lead with different types of production and excellence, many of which PDO (Protected Designation Origin). Table 6 - Sheep milk and cheese yielded in the countries of the Mediterranean Area (FAOSTAT, 2013). Country Sheep milk cheese Goat milk cheese ton % ton. % Albania 1,200 0.32 1,000 0.53 Croatia 990 0.26 0.00 Cyprus 2,400 0.64 1,120 0.59 France 28.470 7.55 93,455 49.39 Greece 125,000 33.13 40,000 21.14 Israel 1,170 0.31 0.00 Italy 52,502 13.92 1,249 0.66 Lebanon 810 0.21 809 0.43 Malta 162 0.04 6.6 0.00 Morocco 2,765 0.73 6,200 3.28 Occupied Palestinian Territory 6,901 1.83 0.00 Spain 62,400 16.54 37,800 19.98 Syrian Arab Republic 60,500 16.04 6,000 3.17 Tunisia 0.00 1,480 0.78 Turkey 32,000 8.48 104 0.05 Total Medirranean area 377,270 100 189,223 100 Countries with greater economic 272,104 72.1 173,631 91.8 Countries with lower economic 105,165 27.9 15,593 8.2 Mediterranean UE Countries and Israel; (b) Mediterranean non UE Countries In Italy the distribution of small ruminants is 6,782,179 sheep reared in 51,096 flocks and 861,942 goats reared in 22.759 flocks (ISTAT, 2010). The Italian state has a non-uniform distribution of sheep and goats, due to reasons similar to those seen for the countries of the Mediterranean basin. In fact, over 55% of the sheep is bred in the islands of Sardinia and Sicily and in two regions of central Italy, Lazio and Tuscany, where for historical reasons related also to the migration of skilled labor from Sardinia and Southern Italy, has established dairy sheep. In Figures 1 and 2 are reported the breakdown of the sheep and goat, heads and flocks, divided for 4 most representative Italian regions (Sardinia, Sicily, Lazio and Tuscany), the northern regions and the remaining regions of central and southern Italy. The goat is more significant present in other regions of North Italy and central and southern Italy. This difference, respect the sheep breeding, is probably due to greater hardiness of goat, that is well adapted to the mountainous areas of the Alps and the Apennines. From the figures it is possible to detect the ratio of the number of animals per flocks, in Sardinia there are farms with a high number of heads, that is an index of agropastoral system highly specialized and efficient. Conversely, the high number of small goat farms present in the North Italy is related to limited availability of land, typical of mountain areas.
28
Figure 1 - Distribution (%) of sheep in the Italian regions (ISTAT 2010)
Figure 2 - Distribution (%) of goats in the Italian regions (ISTAT 2010)
The production of milk and cheese in Italy are not reported in detail and on time, the ISTAT data, latest report for 2012, a production of 406,177 tons of sheep milk and 27,944 tons of goat milk destined for cheese making industry. In the analysis of dairy products, lamb and goat Italian must remember that the few productions are surveyed regarding certified products (PDO) whose spread on territories is indicative of a good efficiency of the production and good marketing strategies. In fact, in Sardinia, Italian region leader in milk sheep, the 80% of the milk yielded is used to produce PDO cheese, Tuscany and Lazio 43% and 30% respectively. In 2012 the marketing of PDO cheeses was 31,313 tons, of which 81% was for PDO Pecorino Romano cheese, 7% for PDO Pecorino Sardo cheese and the remaining 2% shared between PDO Canestrato Pugliese, PDO Sicilian Pecorino and PDO Fiore Sardo cheeses (Cabiddu, 2014). In Sicily they are produced a wide variety of traditional and historical cheeses made with sheep and goat milk, but only three of them have been awarded of PDO: PDO Pecorino Siciliano, PDO Vastedda della valle del Belìce and PDO Piacentinu Ennese. Table 7 shows the number of dairies and the amount of sheep PDO cheeses certified in 2014. By the small size of the data shows that only a small portion (approximately 1.5%) of the sheep milk yielded is used for the PDO cheeses
29
production. For the development of the sector it is therefore essential to encourage the production of excellence and invest in research to product innovation so that we can ensure a wider offer in terms of variety. All must be supported by adequate marketing strategies. Table 7 – PDO Sicilian sheep cheeses (certified product) Dairies Cheese Cheese (n.) (n. forms) (kg) PDO Pecorino Siciliano (a) 11 4,167 33,300 PDO Vastedda della valle del Belìce (b) 7 30,720 16,944 PDO Piacentinu Ennese (b) 5 3,540 14,397 (a)Corfilac – Ragusa (b)Istituto Zooprofilattico Sperimentale della Sicilia - Palermo The SWOT analysis (ISMEA, 2014) of the strengths and weaknesses of the dairy sheep and goat industries (Tab. 8) provides a fairly clear picture of the critical subject of possible improvement plans to maintain and possibly increase production. The inclusion of the weaknesses of strict EU sanitary-European is likely to be attributed to the additional costs that must be borne by the producers. Conversely, the high level of health guarantee that results is, if properly exploited, a strength in terms of consumer countries with an advanced level of welfare. For the southern regions and Italian island that take advantage during the summer of notable tourist flow is particularly critical of the current seasonality of parts and therefore of productions that just in the summer months are particularly low. Table 8 - SWOT analysis (ISMEA, 2014) Sheep and goat chain Strengths Social and environmental relevance for the disadvantaged and marginal areas Farm
Dairy industries Product
Dairy processing Reasonable level of know-how of farmer (techniques and genetic) Typical products Ability to make the raw material Presence of high quality brands (14 PDO cheeses) Strong ties with the territory
weaknesses Structural constraints (nature territory, fragmented ownership, advancing age, lack of attractiveness of the sector Seasonal productions Health and hygiene rules Low efficiency of the cooperative system Fragmented system of dairy processing Excessive specialization of product (pecorino) and market (USA) Deficit of market strategies, product positioning and market valuation
Among the weaknesses of the ISMEA SWOT analysis, the seasonality of sheep milk production as a factor of asynchrony over demand. This criticality has been the subject of scientific studies and research aimed at finding strategies for the seasonal adjustment of parts and consequently of dairy production (Todaro et al., 2015). The typical sheep Italian breeding system, utilized mainly for the Sarda and Comisana ewes, implies one lambing per year, with mating season starting in late spring for mature ewes, and in early autumn for young ewes (about 20% of the flock) that are successfully mated only when their body weight is about 65-70% of normal adult weight. Lambing period for mature ewes occurs between October and December, to exploit the seasonal availability of natural pasture at its best, and commonly the older the ewes the earlier the lambings; whereas, late winter is the lambing period of primiparous ewes. In milk recorded flocks, only 75% of the mated young ewes is pregnant and lamb; the other ones are successfully mated only in the next spring, lamb at about 24 months of age, in autumn, i.e., during the lambing season of mature ewes. Milking starts after a suckling period of about 30 days. Despite different periods of lambing, young and mature
30
ewes simultaneously stop the milk secretion and come in dry when the pasture forage dry up because of the high summer environmental temperatures. The reproduction management described above supposes that young ewes are in early lactation in spring, when pasture availability, temperatures and photoperiod favor milk production. Instead, mature ewes, which start milking early in winter, can find favorable conditions only during an advanced lactation stage (Carta et al., 1995). Despite this seasonal production systems involves most of the sheep reared in Italy, there are two breeds, the Massese in Tuscany and the Valle del Belice in Sicily, for which the reproduction is less seasonal and allows a milk production almost equally distributed over the year. The ewes of Valle del Belice breed are recognized as the highest milk producing (Giaccone et al., 2004), and this is the reason because the rams of this breed are largely used as enhancers in most of the sheep population, resulting in a crossbreeding diffusion and a reduction in the heads number of the other sheep breeds. In Sicily, the sheep mating activity traditionally begins on 19th March, the day of St. Joseph celebration, with the main lambing season in September and October. A second lambing period occurs in winter, and generally lasts from December to February. Accordingly, the sheep milk production shows a seasonal trend, with a great variability throughout the year and an almost complete interruption in the summer, particularly linked to the seasonal availability of grazed forage. In Sicily, indeed, the sheep farming systems are based mainly on the extensive use of the pasture, the availability and quality of which differs by season: pasture forages are green from October to midMay, show the maximum vegetative growth in the spring, and dry up in the other period. Nevertheless, generally sheep graze pastures every day of the year, and when the available forage cannot meet their need for fiber, they receive a supplement of hay and/or straw. A farm or commercial concentrate (400–800 g/d per head) is provided to ewes in early lactation (100,0 >100,0 >100,0 >100,0 65,6 86,3 >100,0 36,9 0 91,7% (IC 95%:83,8-99,6)
True farm prevalence Se = 69.9% Sp = 99.2% 55,5 >100,0 >100,0 99,0 74,4 63,2 >100 0,0 0 81,3% (IC 95%: 69,5-93,0)
True farm prevalence Se = 37% Sp = 98.5% >100,0 >100,0 >100,0 >100,0 >100,0 >100,0 >100,0 69.9 0 >100% (IC 95%:160-190)
True farm prevalence Se = 37% Sp = 98.5% 52.0 >100 >100 94.7 70.6 59.5 >100 < 0.0 0 77.2% (IC 95%: 65.888.7)
140
Tab. 5 Sheep: Sampling, ELISA results and prevalences Specie Prov Heads Pos Susp Neg s
Sheep
AG CL CT EN ME PA RG TP SR Tot sheep
4.356 4.424 1.324 7.180 9.883 2.915 3.764 1.539 0 35.385
247 317 104 251 173 54 181 7 0 1.33 4
43 21 21 32 59 15 42 6 0 239
4.066 4.086 1.199 6.897 9.651 2.846 3.541 1.526 0 33.812
Tab. 6 Goats: Sampling, ELISA results and prevalences Species Prov Heads Pos Susp Neg
Goats
Tot goats
AG CL CT EN ME PA RG TP SR
819 1.768 493 657 7.325 348 671 20 0 12.101
46 92 32 48 110 11 50 0 389
8 10 3 13 4 12 1 0 51
765 1.666 461 606 7.202 333 609 19 0 11.661
Apparent head prevalence
6,7% 7,6% 9,4% 3,9% 2,3% 2,4% 5,9% 0,8% 0% 4,4% (IC 95%: 4,7)
4,2-
True head prevalence Se = 69.9% Sp = 99.2% 8,5% 9,9% 12,5% 4,5% 2,2% 2,3% 7.4% 0.1% 0% 5,3% (IC 95%: 5,05,6)
Apparent head prevalence
6,6% 5,8% 6,5% 7,8% 1,7% 4,3% 9,2% 5,0% 0% 3,6 % (IC 95%: 3,34,0)
True head prevalence Se = 69.9% Sp = 99.2% 8,4% 7,2% 8,2% 10,1% 1,3% 5,1% 12.2% 6.1% 0% 4,1% (IC 95%: 3,64,6)
True farm prevalence Se = 73% Sp = 97.5% 5.9% 7.3% 9.8% 2.0% 0.0% 0.0% 4.9% 0.0% 0% 2.8% (IC 95%: 2.53.1)
True farm prevalence Se = 73% Sp = 97.5% 5.8% 4.6% 5.7% 7.5% 0.0% 2.6% 9.6% 3.5% 0% 1.6% (IC95%: 1.11.6)
141
Conclusion The most important aspect to consider is the high prevalence of the MAP into sicilian flocks. In fact, regardless of the serological test performance seems that MAP circles in most flocks in Sicily. The low intra-farm prevalence recorded is in line with the pathogenesis of the disease and the dynamics of antibody production in infected animals. In conclusion considering the serious damage that this disease caused to animal production and it’s zoonotic implications the high prevalence found in sheep and goat farms of Sicily should be seriously taken into account by the regional authorities, in order to set up, even for sheep and goats, a control and monitoring plan of the disease, with the aim of protecting public health, animal health and the quantity and the salubrity of the animal productions. References Atreyaa R., Bülteb M., Gerlachc G-F, Goethed R., Hornefe M.W., Köhlerf H., Meensd J., Möbiusf P., Roebg E., Weissh S. (2014) On behalf of the Zoo MAP Consortium, Facts, myths and hypotheses on the zoonotic nature of Mycobacterium avium subsp. paratuberculosis. International Journal of Medical Microbiology, Volume 304, Issue 7 Pages 858–867; Attili A.R., NguNgwa V., Preziuso S., Pacifici L., Domesi A., Cuteri V. (2011) Ovine paratuberculosis: A Seroprevalence Study in Dairy Flocks Reared in the Marche Region, Italy. Veterinary Medicine International; Gumber S., Eamens G., Whittington R.J. (2006) Evaluation of a pourquier Elisa Kit in relation to agar gel immunodiffusion (AGID) test for assessment of the humoral immune response in sheep and goats with and without Mycobacterium paratuberculosis infection. Veterinary microbiology 115. 91-101; Manual of Diagnostic Tests and Vaccines for Terrestrial Animals (2014) Chapter 2.1.11.Paratuberculosis (Johne’s disease) (NB: Version adopted in May 2014); Nielsen S.S., Toft N. (2009) A Review of prevalences of paratuberculosis in farmed animals in Europe. Preventive Veterinary Medicine 88: 1-14; Nielsen S.S., Toft N. (2008) Ante mortem diagnosis of paratuberculosis: a review of accuracies of ELISA, interferon-gamma assay and fecal culture techniques. Vet. Microbiol., 129, 217–235; Pistone D., Marone P., Pajoro M., Fabbi M, Vicari N., Daffara S., Dalla Valle C., Gabba S., Sassera D., Verri A., Montagna M., Epis S., Monti C., Strada EG., Grazioli V., Arrigoni N., Giacosa A., Bandi C. (2012) Mycobacterium avium paratuberculosis in Italy: commensal or emerging human pathogen? Digestive and Liver Disease, 44: 461-465; Rogan W.J., Gladen B. (1978) Estimating prevalence from the results of a screening test. American Journal of Epidemiology 107:71-76; Sergeant E.S., Marshall D.J., Eamens G.J., Kearns C., Whittington R.J. (2003). Evaluation of an absorbed ELISA and an agar-gel immuno-diffusion test for ovine paratuberculosis in sheep in Australia. Prev. Vet. Med., 61(4), 235–248.
142
Preliminary studies on paratuberculosis (PTB) in sheep and goats in Southern Italy: III. Biological and management risk factors associated with MAP infection in Apulian flocks. R. Sardaro1, A. Conte2, A. Miccolis2, L. Casoli2, D. Scaltrito3, F. Petazzi1 1
DETO - Sez. Cliniche Veterinarie e Produzioni Animali, Università di Bari Freelance veterinary doctor 3 Istituto Zooprofilattico Sperimentale della Puglia e della Basilicata. 2
Summary This work reports the preliminary data obtained analysing a combination of biological, management and environmental factors supposedly impacting on environmental survivability of Mycobacterium avium subsp. paratuberculosis (MAP), and hence the distribution of paratuberculosis (PTB) in Apulian sheep and goat farms. Information were gathered through a structured farm questionnaire developed to interview farmers. Uni- and multivariate analyses were performed on a dataset including 6,760 animals (3.801 sheep and 2.959 goats) in 134 farms (sheep, goat and mixed flocks) located in Apulia. The actual survey questionnaire data let us to evaluate differences in attitudes and skills among farmers, providing greater insight into our understanding of how they perceive diseases in general and PTB in particular. The identification in this study of significant modifiable risk factors will help Apulian farmers and their veterinary practitioners to control this disease. The implications of these preliminary results are worthy of further elaboration directed to the development of a sustainable control plan for the infection at regional scale. Introduction The PON EPISUD project n° PON01_ 01841, funded by MIUR (Italian Ministry for University and Research) aimed to study PTB in sheep and goats in Southern Italy; thanks to its results, for the first time, an effective high presence of MAP is well established in sheep and goats both in Apulia and Sicily (Fiasconaro et al. 2015a, Fiasconaro et al. 2015b Scaltrito et al., 2015). Given that there is a zoonotic potential of Mycobacterium avium subsp. paratuberculosis (MAP), this study aims at investigating the predisposing causes of its spread with the potential to trigger the disease in Apulian sheep and goat farms. Since a clear-cut cause effect relationship can be applied to only few diseases, notably some genetic disorders, the concept of multifactorial etiology says diseases result from complex interactions of host characteristics, pathogenic agents and environmental influences. According to Kahrs (2008), the “disease iceberg analogy” compares infectious diseases to iceberg. The submerged portion of an iceberg supports the visible iceberg. Similarly, there are unobserved agent-host-environment interactions that push infection to a point where there are observed signs, symptom or death. In this analogy the water’s surface represent the clinical threshold, and the observed disease is just the tip of the iceberg. Monitoring and surveillance can lower the clinical threshold by exposing otherwise unobserved disease factors. Environmental factors are significant determinants of the outcome of infections in both individuals and populations. They include weather, stress levels, quality and quantity of available feed and water and population density. Aggregation of animals enhances the pathogenic effects of infections that could be insignificant in healthy, wellnourished and unstressed animals in established social systems. Management practice also influence economic losses associated with infectious diseases. Drainage, moisture level in areas where animals are housed, timely removal of manure and uneaten feed, and activities to eliminate crowding of animals all influence the incidence of diseases in livestock. In synthesis, livestock diseases require to be addressed on a population basis, since the complexity of the agent-hostenvironment interactions influencing them, complicate their diagnosis, control, prevention, and the assessment of associated risk. Then, in this paper we report on the preliminary findings from a work based on the results of the epidemiological survey of Apulian sheep and goat farms (Scaltrito et al.2015) and focused on the analysed of a
143
combination of biological, management and environmental factors supposedly impacting on environmental survivability of MAP and hence the distribution PTB. Methods A cross-sectional study was conducted from August 2013 to February 2015. Data were collected first through a form of the Experimental Veterinary Institute of Apulia and Basilicata, filled during farm inspections and concerning age, sex, species, breed and positivity to MAP (by ELISA test); then a structured farm questionnaire was developed to gather information about factors hypothesized to influence the spread of PTB infection within and/or between flocks. In particular, the questionnaire had several questions grouped into four main topics: flock health status, reproductive management, nutrition and other farm-related practices. The questions were of a closed type with two or three options. The questionnaires were administered by “face to face” interviews mainly by the Veterinarians involved in the project. The interviews took between 20 to 30 minutes and were done at the farmer’s convenience in connection to MAP ELISA tests. Overall data from 134 farms (sheep, goat and mixed flocks) and 6.760 heads (3.801 sheep and 2.959 goats) in Apulia were collected (Table 1). In the univariate analysis, a first selection of the most significant variables was carried out through the correlation matrix, based on the calculation of the Cramer's phi (Sheskin, 1997). Subsequently, a multivariate conditional logistic model was implemented, in which the animal was the experimental unit, the positivity or negativity on the ELISA test was the dependent variable and the biological (sex, age, and species), management and sanitary factors were the independent variables. Table 1 - Data set overview. N.
%
Negative
Positive
Ovine herds
48
36
21
27
Caprine herds
51
38
10
41
Mixed herds
35
26
11
24
Total
134
100%
42
92
Number of sheep heads
3.801
56
3.649
152
Number of goat heads
2.959
44
2.424
535
Total
6.760
100%
6.073
687
As the response variable can assume just the values 0 and 1, indicating respectively the negativity or positivity to MAP of each head, let x be a vector of predictors, so that the probability π=Pr(Y=1|x) that a head is affected by MAP is: π ' logit (π ) = log =α +β x 1− π In particular, a stepwise multivariate logit model (Torgo, 2010; Brauer and Castillo-Chavez, 2012) was carried out with threshold value set to 0.2.
Results and Discussion Univariate analysis of Epidemiological Parameters In the univariate analysis, factors relating to herd size as well as births and grassland management were found to be significantly associated with herd PTB status (P100 (CI 95%: 136-156
82.2 (CI 95%:76.3-88.1)
Table 2–MAP average prevalence for the ovine and caprine heads. True head Apparent head Positive prevalence (%) Region Heads prevalence heads *Se: 69.9%Sp 99.2% (%) **Se: 41.5%Sp 99.4% 3.6 4.1 Sicily 47.486 1.723 (CI 95%:3.5-3.8) (IC 95%: 3,6-4,6)7.1 **15.8 Apulia 26.272 1.853 (CI 95%: 6.7 -7.4) (CI 95%: 15.0-16.5)
True head prevalence (%) Se 73% Sp97.5% 1.6 (CI95%:1.4-1.8) 6.5 (CI 95%:6.0-6.9)
153
Table 3, 4, 5 and 6 showed data of the ovine and caprinefarms in Sicily and Apulia: in Sicily the apparent prevalence in the ovine farms (64.2%) was slightly higher than the goat one (56.9%), while in Apulia the apparent prevalence in the goat farms (81.2%) was much higher than the sheep one (48.5%). The apparent prevalence of sheep farms in Sicily is higher than that found in Apulia; however considering the real prevalence, the results were similar. Conversely, as far as the goat farms were concerned, both the apparent and the real prevalence in Apulia were significantly higher than that detected in Sicily.
Table 3. MAP prevalence within Sicilian ovine farms. Specie
Prov.
Sampled farms
Positive farms
Sheep
Ag Cl Ct En Me Pa Rg Tp Sr
33 37 10 61 78 43 12 19 -
25 31 8 45 36 26 12 5 -
Total ovine farms 293
188
Apparent prevalence (%)
farm
75.8 83.8 80.0 73.8 46.2 60.5 100.0 26.3 64.2 (CI 95%: 58.5-69.4)
True Farm prevalence (%) Se69.9% Sp 99.2% >100.0 >100.0 >100.0 >100.0 65.6 86.3 >100.0 36.9 91,7 (CI 95%:83.8-99.6)
True farm prevalence (%) Se 37% Sp98.5% >100.0 >100.0 >100.0 >100.0 >100.0 >100.0 >100.0 69.9 >100 (CI 95%:160-190)
Table 4.MAP prevalence within Apulian ovine farms. Specie
Prov.
Sampled farms
Sheep
Ba Br Bt Fg Le Ta
49 24 19 155 43 44
22 13 14 60 28 25
334
162
Total farms
Positive farms
Apparent prevalence (%)
farm
44.9 54.2 73.7 38.7 65.1 56.8 48.5 (CI 95%: 43.2-53.8)
True Farm prevalence (%) Se 41.5% Sp 99.4% >100.0 >100.0 >100.0 93.2 >100.0 >100.0 100 (CI95%: 104-130)
True Farm prevalence (%) Se37% Sp98.5% >100.0 >100.0 >100.0 >100.0 >100.0 >100.0 >100 (CI 95%:117-147)
154
Table 5.MAP prevalence within Sicilian caprine farms. Specie
Sampled Prov. farms
Positive farms
Goat
Ag Cl Ct En Me Pa Rg Tp Sr
23 19 8 13 67 9 3 2 -
9 16 6 9 35 4 3 -
144
82
Total farms
Apparent prevalence (%)
farm
39.1 84.2 75.0 69.2 52.2 44.4 100.0 0.0 56.9 (CI 95%:48.8-64.7)
Table6.MAP prevalence within Apulian caprine farms. Apparent farm Sampled Positive prevalence Specie Prov. farms farms (%) Ba 6 6 100 Br 39 36 92.3 Bt 4 4 100 Goats Fg 70 54 77.1 Le 31 23 74.2 Ta 42 33 78.6 81.2 Total farms 192 156 (CI 95%: 75.1-86.1)
True Farm prevalence (%) Se 69.9% Sp 99.2% 55.5 >100.0 >100.0 99.0 74.4 63.2 >100 0.0 81.3 (CI 95%:69.5 - 93.0)
True Farm prevalence (%) Se73% Sp 97.5% 52.0 >100 >100 94.7 70.6 59.5 >100 100.0 >100.0 >100.0 >100.0 >100.0 >100.0 >100 (CI 95%: 1.83-2.10
True Farm prevalence (%) Se73% Sp97.5% >100.0 >100.0 >100.0 >100.0 >100.0 >100.0 >100 (CI95%:103-119
Table7–MAP prevalence in Sicilian sheep. Specie
Prov.
Heads Pos.
Susp.
Sheep
Ag Cl Ct En Me Pa Rg Tp Sr
4.356 4.424 1.324 7.180 9.883 2.915 3.764 1.539 -
43 21 21 32 59 15 42 6 -
Total heads
247 317 104 251 173 54 181 7 -
35.385 1.334
239
True head Apparent head prevalence (%) Neg. prevalence Se 69.9% (%) Sp 99.2% 4.066 6.7 8.5 4.086 7.6 9.9 1.431 9.4 12.5 6.897 3.9 4.5 9.651 2.3 2.2 2.846 2.4 2.3 3.541 5.9 7.4 1.526 0.8 0.1 4.4 5.3 34.044 (CI 95%: 4.2-4.7) (CI 95%: 5.0-5.6)
True head prevalence (%) Se73% Sp97.5% 5.9 7.3 9.8 2.0 0.0 0.0 4.9 0.0 2.8 (CI 95%: 2.5-3.1)
155
The comparison of the results obtained in the two regions analysing the sheep heads showed a similar apparent prevalence of about 5% (Table 7 and 8). On the contrary, for goats (Table 9 and 10), the apparent and true prevalence in Apulia was much higher than in Sicily.
Conclusion In conclusion, the most impressive points of this first comparative analysis are the high serological positivity of farms in both regions (> 50 percentage) and then the high positivity of the Apulian goats compared to the Sicilian ones. It seems that the Apulian goats are more susceptible to MAP, thus further investigation of the possible interactions between MAP and genetic (breed), environmental and management factors are required. However, thanks to this project, for the first time, an effective high presence of MAP is well established in sheep and goats in the considered regions and, given that, there is a zoonotic potential of this pathogen, there is ground for alerting health authorities of the Apulia and Sicily. In particular, they should be sensitized and made aware of the seriousness of the problem, which concerns both public health and economic aspects, thus requiring implementing control measures. Table8. MAP prevalence in Apulian sheep. True head True head Apparent head prevalence (%) prevalence (%) Heads Pos. Susp. Neg. Specie Prov. prevalence Se 41.5% Se 73% (%) Sp 99.4% Sp 97.5% Ba 2.583 98 2.485 3.8 7.8 1.8 Br 883 25 858 2.8 5.5 0.5 Bt 1.203 48 1.155 4.0 8.3 2.1 Sheep Fg 7.652 109 7.543 1.4 2.0 0.0 Le 2.612 103 2.509 3.9 8.2 2.0 Ta 1.970 116 1.854 5.9 12.9 4.8 3.0 5.8 0.6 Total heads 16.903 499 16.404 (CI 95%: 2.7-3.2) (CI 95%: 5.1-6.4) (CI 95%: 0.3-1.0) Table9–MAP prevalence in Sicilian goats. Specie Prov.
Goats
Ag Cl Ct En Me Pa Rg Tp Sr
Total heads
Heads
Pos.
Susp.
Neg.
819 1.768 493 657 7.325 348 671 20 -
46 92 32 48 110 11 50 -
8 10 3 13 4 12 1 -
747 1.666 461 606 7.195 333 609 19 -
12.101
389
51
11.636
Apparent prevalence (%)
head
6.6 5.8 6.5 7.8 1.7 4.3 9.2 5.0 3.6 (CI 95%:3.3-4.0)
True head prevalence (%) Se 69.9% Sp 99.2% 8.4 7.2 8.2 10.1 1.3 5.1 12.2 6.1 4.1 (CI 95%:3.6-4.6)
True head prevalence (%) Se 73% Sp 97.5% 5.8 4.6 5.7 7.5 0.0 2.6 9.6 3.5 1.6 (CI95%: 1.1-1.6)
156
Tabella 10. MAP prevalence in Apulian goats. Specie
Prov.
Heads
Pos.
Susp.
Neg.
Goats
Ba Br Bt Fg Le Ta
315 1.587 165 4.278 1.412 1.612
55 379 23 377 208 312 1.35 4
-
260 1.208 142 3.901 1.204 1.300
Total heads
9.369
8.015
True head prevalence (%) Se 41.5% Sp 99.4% 17.5 41.2% 23.9 56.9% 13.9 32.6% 8.8 20.1% 14.7 34.5% 19.4 45.9% 14.5 33.9 (CI 95%: 13.8-15.2) (CI 95%: 32.1-5.6)
Apparent prevalence (%)
head
True head prevalence (%) Se 73% Sp 97.5% 21.2% 30.1% 16.2% 9.0% 17.3% 23.9% 17 (CI 95%: 13.8-15.2)
References 1. Attili A. R.,NguNgwa V.,Preziuso S., Pacifici L., Domesi A.,Cuteri V. (2011). Ovine paratuberculosis: A Seroprevalence Study in Dairy Flocks Reared in the Marche Region. Italy. Veterinary Medicine International. 2. FryM.,Kruze J., Collins (2008). Evaluation of four commercial enzyme-linked immunosorbent assays for the diagnosis of bovine paratuberculosis in of Chilean dairy herds. J VetDiagnInvest 20.329-332. 3. Gumber S.,Eamens G., Whittington R. J. (2006). Evaluation of a pourquier Elisa Kit in relation to agar gel immunodiffusion (AGID) test for assessment of the humoral immune response in sheep and goats with and without Mycobacterium patauberculosis infection. Veterinary microbiology. 115.91-101. 4. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals (2014).Chapter 2.1.11: Paratuberculosis (Johne’s disease) (Version adopted in May 2014). 5. NielsenS.S.,ToftN. (2009). A Review of prevalences of paratuberculosis in farmed animals in Europe. Preventive Veterinary Medicine 88. 1-14. 6. Nielsen S. S.,Toft N. (2008). Ante mortem diagnosis of paratuberculosis: a review of accuracies of ELISA. interferon-gamma assay and faecal culture techniques. Vet. Microbiol., 129. 217–235. 7. Pistone D., Marone P.,Pajoro M.,Fabbi M., Vicari N.,Daffara S., Dalla Valle C., Gabba S.,Sassera D., Verri A., Montagna M.,Epis S., Monti C., Strada E. G., Grazioli V.,Arrigoni N., Giacosa A., Bandi C. (2012). Mycobacterium aviumparatuberculosis in Italy: commensal or emerging human pathogen? Digestive and Liver Disease. 44.461-465. 8. Raja Atreyaa. Michael Bülteb. Gerald-F. Gerlachc. Ralph Goethed. Mathias W. Hornefe. Heike Köhlerf.JochenMeensd. Petra Möbiusf.ElkeRoebg. Siegfried Weissh (2014). Facts. myths and hypotheses on the zoonotic nature of Mycobacterium avium subspecies paratuberculosis. International Journal of Medical Microbiology.304 (7). 858–867. 9. RoganW.J.,Gladen B. (1978). Estimating prevalence from the results of a screening test. American Journal of Epidemiology. 107. 71-76. 10. Sergeant E. S., Marshall D. J.,Eamens G. J., Kearns C., Whittington R. J. (2003). Evaluation Of An Absorbed Elisa And An Agar-Gel Immuno-Diffusion Test For Ovine Paratuberculosis. In: Sheep In Australia. Prev. Vet. Med., 61(4). 235–248.
157
Paratuberculosis in Slovenia – a serious threat to dairy industry J. Starič1, J. Ježek1, M. Pate2, T. Pirš2, M. Ocepek2 1
Clinic for Ruminants and Ambulatory Clinic, Veterinary Faculty, University of Ljubljana, Gerbičeva 60, 1000 Ljubljana, Slovenia Institute of Microbiology and Parasitology, Veterinary Faculty, University of Ljubljana, Gerbičeva 60, 1000 Ljubljana, Slovenia
[email protected]
2
Abstract Partuberculosis is a chronic usually fatal disease of ruminants caused by Mycobacterium avium subsp. paratuberculosis (MAP). The disease is characterised by a long incubation period of up to ten years. However, with enormous bacterial challenge in some herds, the incubation period can be as short as one to two years. MAP causes granulomatous enteritis characterised by a substantial thickening of the intestinal wall. Clinical features of the disease include wasting, weakened immune system, lower production and hypoproteinaemia and watery diarrhoea in terminal stage. Beside economic losses and welfare issues that the disease causes, it is also a potential zoonosis as there is some evidence that it might be linked to Crohn’s disease in humans. In Slovenia, paratuberculosis was diagnosed and confirmed for the first time already in 1914. Since then, the disease has been followed systematically in a few seroprevalence studies only. The last study dates back in 2008, when 38.374 animals (20% of Slovenian cattle herds) were serologically tested and only 228 animals were seropositive (2.77% cattle herds). Relatively favourable status of paratuberculosis in Slovenia was questioned when a survey was performed in eight big dairy herds, consisting of 126 to 350 animals. The seropositive animals were found in all herds and MAP was detected in 50% of herds. Furthermore, a detailed screening of two big dairy herds revealed up to 89% infected cows. When big dairy farms are infected, a serious threat exists that the disease could spread rapidly across Slovenia. It is therefore advisable that Slovenia begins with monitoring of the disease and approaching the status of disease-free herds. Many European countries have already implemented restrictions to MAP positive herds, and a lack of control could soon lead to reduced value of Slovenian products and animals on European market. Introduction Partuberculosis, also known as Johne's disease, is a chronic fatal disease of ruminants caused by a bacterium Mycobacterium avium subsp. paratuberculosis (MAP). A characteristic of the disease is a long latency period of up to ten years. However, with enormous bacterial challenge in some herds, the latency could be as low as one to two years. The most important route of infection is oral - faecal, with food, water, cow`s teats or milk contaminated by MAP (Collins, 2003; Crossley et al., 2005; McKenna et al., 2006; Nielsen et al., 2008; Nielsen and Toft, 2009). Transplacental infection is possible especially in the clinical phase of the disease (Collins, 2003). Many infected cows also shed MAP with colostrum and milk, which can lead to calf infection (Baumgartner and Khol, 2006). Calves are the most susceptible to infection (Whitlock and Buergelt, 1996; Clark, 1997). A clinically diseased animal exerts chronic diarrhea, weight loss, emaciation and death due to granulomatous enteritis. During the subclinical infection the milk production is reduced. Additionally, the infection is responsible for premature culling, lower slaughter value and increased incidence of other diseases (Ott et al., 1999; Wells and Wagner, 2000; Muskens et al., 2000). Furthermore, in the last decade, several reports suggest that paratuberculosis may be a zoonosis and that MAP may cause inflammatory bowel disease (Crohn’s disease) in humans (Abubakar et al., 2008., Naser et al., 2009). Thus, MAP infections cause great economic losses in cattle industry. The disease should be on a high priority list for eradication from a herd. With regard to the control of paratuberculosis, different obstacles are encountered, e.g. inadequate diagnostic tests and frequently hidden indirect losses in the herd, which diminish the interest of breeders for controlling the disease. Consequently, paratuberculosis has been successfully spreading in the developed world, including Slovenia, in the last years (Ocepek et al, 1999; Baumgartner and Khol, 2006; Radostits et al., 2007; Kušar et al., 2011). The diagnosis of paratuberculosis is challenging because of the long incubation period and low sensitivity and specificity of diagnostic tests. The most common tests are cultivation of MAP from faeces and detection of
158
antibodies in blood serum and milk with ELISA (Kalis et al., 1999; Nielsen et al., 2001). Molecular methods are also commonly used for MAP detection (Logar et al., 2012). Most control programs include management changes to decrease the transmission of MAP, test and cull practice to eliminate sources of infection and vaccination of replacers to increase their resistance to infection (Bastida and Juste, 2011). To a great extent, animal vaccination prevents the occurrence of clinical signs of the disease, and diminishes, but not arrests, the shedding of bacteria with excrements and milk (Körmendy, 1994; Juste et al., 2009; Sweeney et al., 2009; Patton, 2011; Alonso-Hearn et al., 2012). Decreased financial losses after vaccination were reported from several countries (Benedictus et al., 2000). Due to hindered diagnostics (serological methods are not applicable after vaccination) and cross-reactios with tuberculin skin test, opinions on the suitability of vaccination are heavily divided (Baumgartner and Khol, 2006; Radostits et al., 2007). In the present paper, paratuberculosis prevalence in cattle in Slovenia since 1997 is reviewed and discussed.
Material and methods Journal and conference papers about paratuberculosis prevalence in Slovenia since 1997 were summarized and evaluated in retrospective. Results In Slovenia, paratuberculosis was diagnosed for the first time already in 1914 close to a town of Postojna (Tunkl et al., 1964). Until 1960s, there were no reports of the disease in Slovenia. In 1962, it was diagnosed again in 2 imported Jersey cows at the Clinic for ruminants of the Veterinary faculty in Ljubljana (original medical record). Systematic screening of paratuberculosis in order to estimate the prevalence and geographic distribution in Slovenia began in 1995. It was based on complement fixation test. In the years 1997 and 1998, 3% and 5% of cattle (mostly older animals in 1998) in all herds were tested, respectively, using ELISA, which became the most commonly used assay for MAP antibody screening (Ocepek et al., 1999). In 1999, 10-15% of cows and pregnant heifers were tested, while in 2000 and 2001, the survey was limited to bulls’ mothers herds because of their significant involvement in selection for reproduction (Ocepek et al., 2002). In the seroprevalence study conducted in 2008, 20% Slovenian herds were randomly tested for MAP antibodies in blood serum of animals older than 2 years (Kušar et al., 2011). Results of the serological screening of Slovenian cattle herds in different years are summarised in Table 1. Table 1: Summary of apparent and true seroprevalence of paratuberculosis at animal and herd level in Slovenia from different studies Study year
ANIMALS N +
1997 1998 1999 20002001 2008
11513 12082 38469 9388 38374
HERDS N +
47 140 1305 41
AP (%) 0.41 1.16 3.39 0.44
TP (%) -31.12 -19.39 15.50 2.91
1690 2423 26088 302
228
0.59
3.96
6779
Test
Ref.
Ocepek 1999 Ocepek 2001
48 157 1055 35
HAP (%) 2.84 6.48 4.04 11.59
HTP (%) 6.89 63.74 25.69 77.26
A A A B
188
2.77
18.49
B
et
al.,
et
al.,
Kušar et al., 2011 Legend: N – number of tested animals / herds, + - number of positive animals / herds, AP – apparent seroprevalence at animal level, HAP - apparent seroprevalence at herd level, TP – true seroprevalence at animal level, HTP – true seroprevalence at herd level (Nielsen and Toft, 2009); ELISA kits for cattle sera manufactured by Idexx Laboratories Inc., USA (A) and Institut Pourquier, France (B); Ref. - reference
159
In 2011, epidemiological study was performed on 8 big dairy farms, breeding Slovenian Black and White cows. The average herd size in the tested farms was 184.37 dairy cows. Twenty to 25 animals in the second or higher lactation were randomly selected from each herd. Blood and milk samples were collected; in addition, 2 pooled samples of manure were obtained from areas of the barn that were the most used by animals (side of the alley to the milking parlour, base of the first cubicle at the alley). MAP antibodies were confirmed in animals on all farms and MAP was cultivated from samples on 4 big dairy farms (Starič et al., 2011). Discussion Prevalence of infected animals varies between countries and regions, and reaches up to 84.7% MAP positive animals in some herds (Baumgartner and Khol, 2006). The last large scale serological testing of cattle for paratuberculosis in 2008 (Kušar et al., 2011) showed relatively low seroprevalence compared to many other countries (Nielsen and Toft, 2009). In the 8-year period after the testing in 2000/2001, there was also no increase in seroprevalence, which appeared favourable. But the differences between sampling years could be also interpreted differently. To some extent, differences in prevalence at both animal and herd level observed over the years in Slovenia, reflect not only the actual prevalence but also the different populations tested, number of animals and herds included in the testing and the use of ELISA kits with different sensitivities. The increase in prevalence may be partially explained by the improvement of the Idexx ELISA test reported by the manufacturer in 1998. Increase in herd true prevalence in 2000 could be attributed to older animals selected for testing (bulls’ mothers) and the ELISA kit manufactured by Institut Pourquier, with higher specificity and sensitivity (Nielsen and Toft, 2009). In 2008 study, more animals per herd were tested than in 1999, besides the use of more sensitive and specific ELISA. This can partly explain the decrease of herd true prevalence in 2008. But the study in 2011 showed that Slovenia needs to stay alert for paratuberculosis as all 8 big dairy farms in the vicinity of Ljubljana had seropositive animals; on four farms MAP was isolated from pooled samples. Infected big dairy farms pose serious threat also to smaller family farms as they sell young stock and spread contaminated manure to pastures and fields. Currently, about 20% of dairy cattle population is aggregated on big farms. The apparently good paratuberculosis situation from previous large scale testings could quickly worsen, given that there are no preventive measures against the spread of the disease in force in Slovenia. It is therefore necessary to assess the prevalence in Slovenian cattle herds again and implement control measures accordingly.
References Abubakar I, Myhill D, Aliyu SH, et al., 2008, Detection of Mycobacterium avium subspecies paratuberculosis from patients with Crohn's disease using nucleic acid-based techniques: a systematic review and meta-analysis. Inflamm. Bowel Dis. 14:401-410. Alonso-Hearn M, Molina E, Geijo M, et al., 2012, Immunization of adult dairy cattle with a new heat-killed vaccine is associated with longer productive life prior to cows being sent to slaughter with suspected paratuberculosis, J Dairy Sci, 95, 618-29. Bastida F, Juste RA, 2011, Paratuberculosis control: a review with a focus on vaccination, J Immune Based Ther Vaccines, 9, 8. Baumgartner W, Khol JL, 2006, Paratuberculosis (Johne´s disease) in ruminants – An ongoing story. Slov. Vet. Res. 43 (1), 5 – 10. Benedictus G, Verhoeff J, Schukken YH, Hesselink JW, 2000, Dutch paratuberculosis programme history, principles and development, Vet Microbiol, 77, 399-413. Clark CJ, 1997, The pathology and pathogenesis of paratuberculosis in ruminants and other species, J Comp Pathol, 116, 217-61. Collins MT, 2003, Paratuberculosis: review of present knowledge, Acta Vet Scand, 44, 217-21. Crossley BM, Zagmutt-Vergara FJ, Fyock TL, Whitlock RH, Gardner IA, 2005, Fecal shedding of Mycobacterium avium subsp. paratuberculosis by dairy cows, Vet Microbiol, 107, 257-63.
160
Juste RA, Alonso-Hearn M, Molina E, et al., 2009, Significant reduction in bacterial shedding and improvement in milk production in dairy farms after the use of a new inactivated paratuberculosis vaccine in a field trial, BMC Res Notes, 2, 233-8. Kalis CHJ, Hesselink JW, Barkema HW, 1999, Comparison of culture of individual and strategically pooled bovine faecal samples for Mycobacterium avium subsp. Paratuberculosis, In: Manning EJB, Collins MT, eds, Proceedings of the 6th international colloquium on paratuberculosis, Melbourne: International Colloquium of Paratuberculosis, 344-8. Körmendy B, 1994, The effect of vaccination on the prevalence of paratuberculosis in large dairy herds, Vet Microbiol, 41, 117-25. Kušar D, Ocepek M, Logar K, Pate M, Krt B, 2011, Seroprevalence of cattle paratuberculosis in Slovenia in 2008 and a comparison of data from current and previous studies, Slov Vet Res, 48, 39-44. Logar K, Kopinč R, Bandelj P, Starič J, Lapanje A, Ocepek M, 2012, Evaluation of combined high-efficiency DNA extraction and real-time PCR for detection of Mycobacterium avium subsp. paratuberculosis in subclinically infected dairy cattle : comparison with faecal culture, milk real-time PCR and milk ELISA, BMC Vet Res, 8, 1-22. McKenna SLB, Keefe GP, Tiwari A, VanLeeuwen J, Barkema HW, 2006, Johne’s disease in Canada Part II: Disease impacts, risk factors, and control programs for dairy producers, Can Vet J, 47, 1089-99. Muskens J, Barkema HW, Russchen E, van Maanen K, Schukken YH, Bakkeer D, 2000, Prevalence and regional distribution of paratuberculosis in dairy herds in Netherlands, Vet Microbiol, 77, 253-61. Nase SA, Collins MT, Crawford JT, et al., 2009, Culture of Mycobacterium avium subspecies paratuberculosis (MAP) from the blood of patients with Crohn's disease: A follow-up blind multi-center investigation. The Open Inflamm. J. 2: 22-23. Nielsen SS, Nielsen KK, Huda A, Condron R, Collins MT, 2001, Diagnostic techniques for paratuberculosis, Bull Int Dairy Fed, 362, 5-17. Nielsen SS, Bjerre H, Toft N, 2008, Colostrum and milk as risk factors for infection with Mycobacterium avium subspecies paratuberculosis in dairy cattle, J Dairy Sci, 91, 4610-5. Nielsen SS, Toft N, 2009, A review of prevalences of paratuberculosis in farmed animals in Europe. Prev Vet Med; 88: 1-14. Ocepek M, Posedi J, Pislak M, 1999, Prevalence of bovine paratuberculosis in Slovenia in 1997 and 1998. Zb Vet Fak Univ Lj; 36: 111-9. Ocepek M, Krt B, Pate M, Pogačnik M, 2002, Sero- prevalence of paratuberculosis in Slovenia between 1999 and 2001. Slov Vet Res; 39: 179-85. Ott SL, Wells SJ, Wagner BA, 1999, Herd-level economic losses associated with Johne's disease on US dairy operations, Prev Vet Med, 40, 179-92. Patton EA, 2011, Paratuberculosis vaccination, Vet Clin North Am Food Anim Pract, 27, 573-80. Paratuberculosis (Johne’s disease). In: Radostits, O.M., C.C. Gay, K.W. Hinchcliff and P.D. Constable (Eds.) (2007): Veterinary Medicine. A textbook of the diseases of cattle, horses, sheep, pigs and goats. Edinburgh: Saunders (1017 - 1044). Starič J, Zadnik T, Logar K, Ocepek M, Diagnostic of paratuberculosis on 8 big dairy farms in central Slovenia. V: 12th middle European buiatric congress, Pula - Croatia, May 18th - 22nd, 2011. KOS, Josip (ur.), SAMARDŽIJA, Marko (ur.). Book of proceedings : supplement, (Veterinarska stanica, ISSN 0350-7149, Supplement 1, Supplement 2, Vol. 42, 2011). Zagreb: Croation Veterinary Institute, 2011, 42, suppl. 1, 7881. Sweeney RW, Whitlock RH, Bowersock TL, et al., 2009, Effect of subcutaneous administration of a killed Mycobacterium avium subsp. paratuberculosis vaccine on colonization of tissues following oral exposure to the organism in calves, Am J Vet Res, 70, 493-7. Tunkl, Bratanović U, Kalinski S, Katić I, Kocjan L, 1964, Paratuberculosis in cattle in Jugoslavia. Vet Glasnik, 5, 533-5.
161
Wells SJ, Wagner BA, 2000, Herd-level risk factors for infection with Mycobacterium paratuberculosis in US dairies and association between familiarity of the herd manager with the disease or prior diagnosis of the disease in that herd and use of preventive measures, J Am Vet Med, 216, 1450-7. Whitlock RH, Buergelt C, 1996, Preclinical and clinical manifestations of paratuberculosis (including pathology), Vet Clin North Am Food Anim Pract, 12, 345-56.
162
Oral Comunications: Disease indicators
Histopathological and biomolecular evaluations in cattle Tuberculin skin test positive slaughtered according to the eradication program A. Giagu, A.G. Anfossi, V. Vitiello, M. Sanna, E. Antuofermo, G.P. Burrai, S. Pirino, T. Cubeddu, S. Rocca. Department of Veterinary Medicine, Via Vienna 2, 07100, Sassari University, Italy
Summary Bovine Tuberculosis is a chronic granulomatous disease of cattle, caused by Mycobacterium bovis, and subject to eradication. In this study we characterized tuberculous lesions in animals from tuberculosis outbreaks. Also we detected Mycobacteria within lesions, analysing especially no visible lesion cases. Histopathology confirmed lesions previously observed at post-mortem macroscopic examination. Mycobacterial DNA was detected by PCR in 19 samples, 37% of which showed both no visible lesions and no acid-fast bacilli (AFB) after Ziehl Neelsen staining. Detection of bacteria in animal without lesion emphasizes the unresolved problem of latent phase of tuberculosis, which probably is the key element in understanding immune-pathology of bovine tuberculosis for its future eradication in European Union (EU). Introduction Bovine tuberculosis (bTB) remains an unsolved problem in animal science. Caused by Mycobacterium bovis, the disease is chronic and characterized by granulomatous lesion mainly in respiratory tract, lung and associated lymph nodes (Pollock and Neill, 2002). The disease has serious economic repercussions but also public health impact because of its zoonotic risk (Reviriego Gordejo et al., 2006; Müller et al., 2013). Therefore the eradication of bTB represents one of the great challenges for EU since Economic European Community was founded. Although in European countries there is low prevalence of M. bovis infection in humans, the reported cases were founded in countries with high prevalence of bTB in cattle (Müller et al., 2013). Member states of EU are obliged to draw and apply eradication programmes to reach an “officially tuberculosis-free status” and a high level of animal and public health (Reviriego Gordejo et al., 2006.). Specifically, in Italy D.M. of 15th December 1995 gives guidelines for disease eradication, which consists in three fundamental steps: 1) identification of each animal and their registration; 2) ante-mortem examination of cattle before movement and execution of intradermal Tuberculin Skin Test (TST); 3) slaughtering of TST reactor animals and consequent official post-mortem examination. The officially primary diagnostic test available in live animals, the TST, is based on detection of Delayed Type Hypersensivity stimulated by a single intradermal inoculation of bovine Purified Protein Derivatives from Culture of M. bovis (PPD-B). To increase the level of diagnosis, INF-γ test is performed for evaluating cellular mediated immune response by measuring the release of INF-γ from lymphocytes stimulated by PPD-B (OIE, Chapter 2.4.7. Bovine tuberculosis, 2007). However, because INF-γ test does not have sufficiently specificity to allow its use as a main screening tool, it is performed in parallel to TST. Cattle that show positivity to TST must be removed from the herd, slaughtered and underwent to post-mortem examination. Interestingly, often, organs of TST positive animals have not macroscopically visible lesions (NVL). Furthermore, the microscopic evaluation of target organs, such as lung or lymph node reveals granulomatous lesions
163
harbouring bTB. In order to limit spreading of infection in herd, wildlife and humans, new diagnostic tools are needed in order to improve the identification of infected animals in the early stage of pathology. The aims of this study are to characterize granulomatous lesions in TST positive animals, to analyse their distribution and to detect mycobacteria by histological and molecular analysis, especially in non visible lesions Materials and methods For this study 22 cattle showing TST positivity are removed from herd and slaughtered, in accordance to current legislation. Of these animals, samples from lung, liver, udder, tonsil and lymph nodes were collected. Tissues were fixed in 4% buffered paraformaldehyde and paraffin embedded (FFPE). From each FFPE sample, 3m sections were collected and stained with both Haematoxyline and Eosin (HE) and Ziehl–Neelsen (ZN) following standard techniques. According to Palmer et al. (2007) HE stained sections were evaluated by light microscopy to characterize lesions in the following four different stages: Stage 1 (initial): non-capsulated lesions constituted by epithelioid macrophages, scarce number of lymphocytes and neutrophils without necrosis; in this stage Langhans cells can be present. Stage 2 (solid): prevalence of epithelioid macrophages, neutrophils and lymphocytes are sometime present; AFB detectable in phagocytic cells and within necrotic tissue, which is minimal present. Stage 3 (minimal necrosis): encapsulated lesions with necrotic centre, a layer of epithelioid macrophages and scattered multinucleated giant cells and lymphocytes. Stage 4 (necrotic and mineralized): compact fibrous capsule, necrotic foci mineralized in the centre surrounding by epithelioid macrophages and multinucleated giant cells with infiltration of lymphocytes; AFB are detectable in necrotic core. For PCR analysis the DNA was purified from 10 sections of each FFPE sample, using QIAamp DNA FFPE Tissue Kit (Qiagen), according to the manufacturer’s instructions. Briefly, samples were deparaffinized in xylene, lysed under denaturing conditions with proteinase K digestion, incubated at 90°C to reverse formalin crosslinking. The DNA was bound to the membrane, residual contaminants was washed away, eluted in Buffer ATE, and stored at – 20°C until use. PCR analysis was performed using IS6110F 5’-CCTGCAGCGTAGGCGTCGG-3’ and IS6110R 5’GTCCAGCGCCGCTTCGG-3’ primers, to amplify a fragment of the insertion sequence IS6110 as described by Eisenach et al. (1990), in a thermal cycler GeneAmp PCR System 9700 (Applied Biosystems), and results, after electrophoresis, were stained with GelRed and UV light visualized. Results and discussion At post-mortem examination, 10 out of 22 slaughtered animals showed yellowish and caseous lesions partially encapsulated suggestive of tuberculous granulomas that were microscopically confirmed. In the collected samples (n=118), histological lesions ranged in four different stages (Fig. 1) of development (I-IV), whereas lymph nodes (12/118 samples) and lungs (3/118 samples) showed advanced necrotic-mineralizated (stage IV) lesions (Tab.1). Mediastinal lymph nodes were the most affected organs (8/23). At high power magnification all Ziehl Neelsen stained granulomas were paucibacillary (data not shown).
164
Figure 1. Histopathological grading of granuloma in bovine tuberculosis. Sections of lung and mediastinal lymph nodes from animal showing macroscopically visible granulomatous lesions. HE staining, 4X magnification. A: Lung. Stage 1, granuloma without fibrous capsule and necrosis. B: Medistinal lymph node. Stage 2, solid granulomas partially encapsulated. C: Mediastinal lymph node. Stage 3, well-encapsulated granulomas with minimal necrosis in the center. D: Mediastinal lymph node. Stage 4, granuloma characterized by necrosis and mineralization.
IS6110 PCR was positive in 10 samples of 118 (8,5%): 1 lung, 1 liver, 1 udder and 7 lymph nodes, 4 of which did not display macroscopic nor microscopic granulomatous lesions. Considering all positive samples (n=19) for ZN and/or PCR (Tab.1): 15% of samples (3/19) were positives for both analysis, 45% (9/19) were positive only in ZN stain, and 37 % (7/19) were only PCR positive.
165
Animals
Sample
Macroscopic Lesions
Microscopic Lesions
AFB Presence
IS6110 PCR
1
Lung
+
+ (I-II-III-IV)
+
+
2
Liver
+
+ (I-II-III-IV)
+
+
3 4 5
Tracheal LNs Tracheal LNs Mediastinal LNs
+ +
+ (III-IV) Reactivity + (III-IV)
+
+ + -
6
Mediastinal LNs
+
+ (II-III-IV)
+
-
7
Mediastinal LNs
+
+ (IV)
+
-
8 9 10
Mediastinal LNs Mesenteric LNs Parotid LN
+ +
+ (II) Hyperplastic tissue + (IV)
+ +
+ -
11
Mediastinal LNs
+
+ (IV)
+
-
12
Parotid LN
+
+ (IV)
+
-
13
Mesenteric LNs
+
+ (I)
+
-
14 15 16
Parotid LN Sub-iliac LNs Sub-iliac LNs
+
Follicular hyperplasia + (III-IV)
+ + -
+ +
-
+ + +
17 Mediastinal LNs + + (III) 18 Udder 19 Mammary LNs Table 1. Summary of results of ZN and/or PCR all positive samples (n=19).
The lesions were identified mainly in the respiratory tract and in mediastinal lymph nodes, confirming that the most common route of infection is the airborne transmission of Mycobacterium bovis (Neill et al., 2001; Pollock and Neill, 2002). Granulomas visible at macroscopic evaluation were confirmed microscopically in all samples except tonsils, where lesions were related to foreign body granuloma (data not shown). Mycobacteria were detected in both ZN and PCR in only 15% of positive samples, while the remaining cases in which only one test was positive can be justified because bacteria may exist in different states: live, dormant and dead. Varello et al. (2008) defined ZN staining as a high specificity technique with low sensitivity, due to a low survival rate of mycobacteria in the environment within central caseation. Despite bacterial vitality is confirmed by detecting DNA with PCR, residues of bacterial wall can be coloured by ZN. Therefore we can consider ZN+/PCR- lesions as devitalized because of the presence of dead bacteria within. However, Mycobacterium bovis may exist in a dormant state that can be considered a possible mechanism involved in latency of tuberculosis, there is a persistence of tuberculous infection lesions without symptoms clinically evident. This peculiar phase of the disease is most studied in human tuberculosis than in animals. Dormancy of Mycobacteria in combination with immune-pathological events in the host creates a complex interaction between bacteria and host, inducing and maintaining a state called latent infection (Pollock et Neill, 2002). Consequently, PCR+ and ZNlesions can contain dormant bacteria no ZN colourable for modifications in bacterial wall, biochemically and morphologically different from growing states. To better understand immune-reactivity of examined cattle, we compared ZN and PCR results with additional INF-γ analysis (data not shown). All three tests are positive in only one animal where active phase of disease was confirmed by Histological and PCR results (paucibacillary granulomas and detection of DNA) in association to development of T-cells immune-response (INF-γ). PCR+ and INF-γ- results can be indicate a latent phase of disease.
166
Conclusion This study confirmed that mycobacterial DNA could be detected even when macroscopic lesions suggestive of bTB are not present. Meat from TST positive carcasses can be laid down in commerce after post-mortem examination and curettage of eventual localized lesions, in accordance with current EC regulation 854/2004. Moreover, detection of lesions in animals without evident clinical symptoms emphasizes the importance of latency in bTB. In fact, these animals may bear tuberculous lesions and can spread the disease after reactivation of dormant bacteria within granuloma when the delicate balance between bacteria and immunity of host is broken. In people, reactivation of latent granulomas can occur in immunosuppressed people giving birth to new outbreaks in low endemic areas (Cassidy, 2006). New strategy in studying human latent tuberculosis involve tool such as use of bovine models, because in cattle latency resembles human latency. Likewise, studies on immune-pathology of human tuberculosis can help us to better understand pathologic mechanism that drives bacteria into dormant state. In summary, failure of current diagnostic procedures prevents the achievement of a total eradication of bTB in European countries. Above all, further study will be necessary for improving knowledge about mechanism responsible for latency, which represents a crucial missing piece in bTB pathology puzzle. References Pollock JM and Neill SD. Mycobacterium bovis Infection and Tuberculosis in Cattle. The Veterinary Journal, 2002, 163, 115±127. Müller B, Dürr S, Alonso S, Hattendorf J, Laisse CJM, Parsons SDC, van Helden PD, and Zinsstag J. Zoonotic Mycobacterium bovis– induced Tuberculosis in Humans. Emerging Infectious Diseases, 2013, Vol. 19, No. 6, June 2013. Reviriego Gordejo FJ, Vermeersch JP. Towards eradication of bovine tuberculosis in the European Union. Veterinary Microbiology, 2006, 112, 101–109. Office International des Epizooties (2009) Chapter 2.4.7 Bovine tuberculosis. OIE Terrestrial Manual 2010. Palmer MV, Waters WR and Thacker TC. Lesion Development and Immunohistochemical Changes in Granulomas from Cattle Experimentally Infected with Mycobacterium bovis.
Vet Pathol, 2007, 44: 863
DOI: 10.1354/vp.44-6-863. Eisenach KD, Cave MD, Bates JH, Crawford JT. Polymerase Chain Reaction Amplification of a Repetitive DNA Sequence Specific for Mycobacterium tuberculosis. JID, 1990; 161. Neill SD, Bryson DG, Pollock JM. Pathogenesis of tuberculosis in cattle. Tuberculosis, 2001, 81(1/2), 79I86^ 2001 Harcourt Publishers Ltd. Varello K, Pezzolato M, Mascarino D, Ingravalle F, Caramelli M, Bozzetta EJ. Comparison of histologic techniques for the diagnosis of bovine tuberculosis in the framework of eradication programs. VET Diagn Invest, 2008, 20: 164 DOI: 10.1177/104063870802000204. Pollock JM and Neill SD. Mycobacterium bovis Infection and Tuberculosis in Cattle. The Veterinary Journal, 2002, 163, 115±127. Cassidy JP. The pathogenesis and pathology of bovine tuberculosis with insights from studies of tuberculosis in humans and laboratory animal models. Veterinary Microbiology, 2006, 112, 151–161.
167
Leptospirosis: a serological survey in small ruminants from Sardinia (Italy) Ponti M.N.1, Palmas B.1, Noworol M.1 Falchi A.1, Pintore A.1, Piredda I.1 1
Istituto Zooprofilattico Sperimentale della Sardegna, via Vienna 2, Sassari - Italy
Summary The aim of the present study is to determine the seroprevalence of different leptospira serovars in small ruminants of Sardinia. From January 2010 to December 2014, 3842 sera were collected from sheep and goats and 115 serum samples from wild ruminants. All samples were examined by Microscopic Agglutination test (MAT) to detect antibodies against 8 Leptospira serovars. Thirty-eight sheep, 19 goats, 9 deer, and 5 mouflons tested seropositive with titers higher than 1/100. L. bratislava and L. icterohaemorrhagiae serogroup were the most common in domestic ruminants. L. grippotyphosa and L. copenhageni had the second most common prevalence. In wild ruminants were predominantly reactive against L. icterohaemorrhagiae serogroup followed by L. pomona, L. bratislava, L. icterohaemorrhagiae and L. grippotyphosa. In view of these results, in Sardinia, sheep and goats are mainly affected by serovar L. bratislava and L. icterohaemorrhagiae. Several studies have demonstrated that sheep are maintenance hosts mostly for L. hardjo, in our survey only three animals showed positive results for this serovar. Sardinian small ruminants are considered less susceptible to leptospirosis than other animal species, as cattle or swine. Introduction Leptospirosis is a worldwide zoonotic disease which affects wild and domestic animals and humans. Infected animals excrete the organisms in their urine and contaminate the environment and human infection occurs through contaminated water or direct exposure to the urine of infected animals (Bharti et al., 2003; Ko et al., 1999). Leptospirosis in small ruminants may present in an acute form, with increased body temperature, anorexia, depression, jaundice, and anemic or hemorrhagic syndromes (Adler and de la Peña Moctezuma 2010). Nevertheless, the chronic form, with impaired fertility, neonatal deaths, abortions, and decreased milk production, occurs more frequently, causing substantial economic losses. Goats and sheep are considered less susceptible to leptospirosis than other domestic farm animal species, e.g. cattle (Leon-Vizcaino et al., 1987; Ciceroni et al., 2000). And besides, small ruminants are able to develop chronic renal infection and maintain persistent leptospiruria, disseminating bacteria to other animal species as well as to humans. Material and methods From January 2010 to December 2014, 3842 sera were collected from sheep and goats. In addition 115 serum samples from wild ruminants was also tested. All samples were examined by Microscopic Agglutination test (MAT) to detect antibodies against 8 Leptospira serovars which included all the serogroups of Leptospira have been so far found in Sardinia (Tab. 1). Briefly, serum samples were serially diluted by twofold dilutions in phosphate-buffered saline, added to wells containing live antigen, incubated, and the end point defined at least 50% agglutination with one or more serovars visualized at under dark-field microscopy.
168
Genospecies L. interrogans L. kirschneri L. interrogans L. interrogans L. borgpetersenii L. interrogans L. interrogans L. interrogans
Serogroup Sejroe Grippotyphosa Australis Pomona Tarassovi Icterohaemorrhagiae Icterohaemorrhagiae Canicola
Serovar Hardjo Grippotyphosa Bratislava Pomona Tarassovi Icterohaemorrhagiae Copenhageni Canicola
Tab. 1 Antigens used by MAT Results Thirty-eight sheep (1,3%), 19 goats (1,8%), 7 deer (Cervus elaphus corsicanus), 2 deer (Dama dama) and 5 mouflons (Ovis gmelini musimon) resulted positive by MAT with titers higher than 1/100 (Tab 2). L. bratislava and L. icterohaemorrhagiae were the most common in sheep (55%) and in goats (42%) respectively. L. grippotyphosa (21%) in sheep and L. grippotyphosa (15,8%) and L. copenhageni (15,8%) had the second most common prevalence. In wild ruminants, deer (Cervus Corsicanus) was predominantly reactive against L. icterohaemorrhagiae serogroup followed by L. pomona, whereas mouflons resulted positive for L. bratislava, L. icterohaemorrhagiae and L. grippotyphosa (Tab. 3). Species Sheep Goats Deer Mouflons Total
Samples tested 2836 1006 41 74 3957
Reactive 38 19 9 5 71
Tab. 2 MAT results of sera examined Species
Serovars
Sheep Goats
bratislav a 21 2
Deer Mouflon s Total
icterohaemorrhagia e 4 8
grippotyphos a 8 3
pomon a 2
6
1
4
2
1
1
1
25
19
13
7
copenhagen i 2 3
hardj o 3
5
3
tarassov i
batavi e
2
1
2
1
Tab. 3 Seroreactivity and distribution of Leptospira serovars Conclusion In view of these results, in Sardinia, sheep and goats are mainly affected by serovars bratislava and icterohaemorrhagiae. Interestingly, although several studies have demonstrated that sheep are maintenance hosts mostly for L. hardjo, in our survey only three animals were positive for this serovar. The presence of detectable levels of serum antibodies in some animals could be indicative of the previous contact with leptospira spp without
169
disease development. In the past attempts of isolation have been made but the agent was never recovered by bacteriological culture in these species. Sardinian small ruminants are considered less susceptible to leptospirosis than other animal species, as cattle or swine. No classical symptomatic form (pyrexia, jaundice, hemorrhagic syndrome) was observed, suggesting that these species would not play an important role in the epidemiology of leptospirosis. References Adler, B. and de la Peña Moctezuma, A., 2010. Leptospira and leptospirosis. Vet. Microbiology, 140, 287-96 Bharti, A.R., Nally, J.E., Ricaldi, J.N., Matthias, M.A., Diaz, M.M., Lovett, M.A., Levett, P.N., Gilman, R.H., Willig, M.R., Gotuzzo, E., Vinetz, J.M., 2003. Leptospirosis: a zoonotic disease of global importance. Lancet Infect. Dis. 3, 757–771 Ciceroni, L., Lombardo, D., Pinto, A., Ciarrocchi, S., Simeoni, J., 2000. Prevalence of antibodies to Leptospira serovars in sheep and goats in Alto Adige-South Tyrol. Journal of Veterinary Medicine series B 47, 217– 223 Ko, A.I., Galva ˜o Reis, M., Ribeiro Dourado, C.M., Johnson Jr., W.D., Riley, L.W., 1999. Urban epidemic of severe leptospirosis in Brazil. Salvador Leptospirosis Study Group. Lancet 354, 820–825 Leon-Vizcaino, L., Mendoza, M. H. and Garrido, F., 1987. Incidence of abortions caused by leptospirosis in sheep and goats in Spain. Comparative Immunology, and Infectious Diseases, 10, 149-153
170
The prevalence of ruminant brucellosis and bovine tuberculosis in a pilot area in Morocco Yahyaoui Azami, H.1,4, Ducrotoy, M. J.2, Bouslikhane, M.1, Hattendorf, J.4, Thrusfield, M.2, Conde Alvarez, R.3, Moriyon, I.3, Welburn, S.2 1
Agronomic and Veterinary Institute Hassan II-Rabat-Maroc University of Edinburgh-Scotland University of Navarra-Spain 4 Swiss Tropical and Public Health Institute-University of Basel-Switzerland 2 3
Introduction Tuberculosis and brucellosis are endemic zoonoses, in Morocco and have an important impact both on human and animal health. This dual burden results in substantial societal socioeconomic cost, due to livestock productivity losses and the cost of treating human disease. The last national tuberculosis survey in cattle was undertaken in 2004 and demonstrated a herd and individual prevalence of 18%, and 33% respectively (1). For bovine brucellosis, national epidemiological surveys undertaken in Morocco, in 1996, and 2010, in addition to the national statistics of the 10 previous years have shown that brucellosis is endemic in different regions of the country, especially in the north-west coastal and central zones where cattle density is highest, with a mean herd prevalence ranging from 2.1 % to 4.9 % (2). The distribution of brucella melitensis again reflects the distribution of its preferential host, and is most prevalent in the east where small ruminant production is widespread, especially in regions sharing a border with Algeria. A mass vaccination campaign in the oriental region was implemented in 1996 and is reported to have successfully reduced the prevalence of small ruminant brucellosis. Since this period, however, no epidemiological investigations have been undertaken to evaluate the brucellosis situation since this short-lived vaccination intervention; however, case reports from veterinary services in this region would suggest that brucellosis is still endemic. Many other sero-prevalence surveys were performed in different regions of Morocco in small ruminants, and revealed a small prevalence rates of brucellosis, in 1990: 2% (3), in 1992: 1,8% (4). However, those results have not been based on a representative sampling frame, then they could be only considered as a qualitative indication of the disease (2). Material and methods The present study is a component of a large collaborative EU project entitled the Integrated Control Of Neglected Zoonoses (ICONZ, www.iconzafrica.org). One of the overall objectives of the work undertaken in Morocco was to update epidemiological data on bacterial zoonoses in ruminants in Sidi Kacem Province, northwest Morocco. Sidi Kacem was selected as a case study area because previous evidence had suggested co-existence of 5 of the zoonoses of interest in the ICONZ project, including bacterial zoonoses (BTB, brucellosis) and dog-transmitted zoonoses (rabies, cystic echinococcosis, leishmaniasis). Sidi Kacem also has a diverse livestock production character, with more extensive livestock rearing and small herds in the North or ‘rainfed zone’ and intensive livestock production in the south or ‘irrigated zone’. The objective of study on bacterial zoonoses was to investigate the prevalence of BTB in cattle and brucellosis in cattle and small ruminants and respective risk factors, in parallel to collecting socioeconomic data at household level on knowledge, attitudes and practices of relevance to the transmission of these diseases. This information was then used to inform a community and school-based education intervention. A cross-sectional survey was undertaken using the two-stage cluster sampling methodology of Bennett et al. (5) and Thrusfield (6) implemented in C-Survey version 2.00 (7) was used. The epidemiological unit or cluster in this context was the village or douar. The survey was designed for parameters specified for BTB in cattle to give the largest sample size and sample sizes thus obtained were then interpreted in the context of known parameters for brucellosis in cattle and small ruminants. They survey focused on the household as its basic sampling unit (5). 62
171
villages were selected by simple random sampling and 2 households were randomly selected per village, giving a total of 164 households minimum sample size. All animals in a herd or flock were sampled (Figure 1).
Figure 1: BTB parameters entered in C survey to determine sample size
Tuberculin testing (single intradermal comparative skin test, OIE interpretation criteria) and blood sampling was undertaken in 1194 cattle across the 125 households selected. In addition 1082 small ruminants from those 125 households that owned them were blood sampled. All sera were screened using the Rose Bengal Test, firstly in the field, and then under laboratory conditions. The rationale for undertaking field serology was to collect milk samples from a RBT positive lactating females for bacteriological investigations. Bacteriology was undertaken on 21 milk samples from seropositive cattle and isolates typed at species level using the Bruceladder multiplex® PCR kit. Milk samples were inoculated on CITA and Farrell’s media. Suspicious colonies were replated on the same media on which they grew and a preliminary identification carried out, including staphylococcus co-agglutination test, oxydase test, urease test. All suspicious colonies were stored in DMSO/TBE for further typing to be undertaken at the University of Navarra.
172
Table 1 : Sample size Cattle
Blood sample 1194
Milk sample 21
Test used Rose Bengale test Intra dermal skin test Bacteriological diagnosis
Small ruminant
1082
0
Rose Bengale test
A total period of 40 days and a team work of 6 persons were necessary to complete the field work in the targeted province; the daily work was established as illustrated in figure 2.
Figure 2 : Planning of the daily field work in the pilot area (Sidi Kacem province)
173
Results and discussion Our results show an individual and herd prevalence of 18.8% and 56% respectively for bovine tuberculosis,. The bovine brucellosis prevalence, according the RBT serological testing, was 1.3% and 6.8% at individual and herd level respectively. The prevalence in small ruminants was found to be 0%. Brucella was isolated from three samples and characterised as B. abortus. The prevalence of BTB and bovine brucellosis was higher in the intensive livestock production system as compared to extensive farms. The higher stocking density, larger herd size, propensity to buy in animals and higher calving frequency in intensive systems may account for this difference through increased risk of transmission. Extensive systems, where animals are grazed on communal pasture, may have a lower risk of transmission because of the effect on the sun and heat on Brucella environmental contaminants. Many risk factors for the potential transmission of the two zoonoses to humans were investigated in this study, and two were found to be statistically significanctly associated with presence of animal disease at the 5% level. The frequency of households engagement in risky behaviour in the study area was 8.6% for informal milk sale, and 100% for the consumption of raw milk. The table below (Table 1) summarises the risk factors investigated and their frequency in terms of number of households to which they apply.
Table : Analysis of the risk factors studied Risk factor
Nb. responses
Nb. households to which factor applies (%)
BTB
Bruc.
× ×
× ×
123 123
32 (26) 11 (8.9)
Disposal of abortion products
×
123
109 (88.6)
Manipulation of products of abortion
×
123
109 (88.6)
×
101
57 (56.4)
×
123
92 (74.8)
×
×
124
111 (89.5)
×
×
123
123 (100)
×
120
59 (49.2)
Factors linked to human behavior Emergency slaughtering Informal milk marketing
Environmental and livestock factors Contact between cattle and small ruminants from the same farm Contact with neighboring farms × Distance of livestock from family home Factors related to eating habits
Consumption of raw milk and dairy products Consumption of milk from cows that have aborted
The analysis of the socio economic survey showed that the level of education of the local population is very low, and almost of 30% of interviewees had never been in school. Knowledge of brucellosis as a cause of abortion in livestock was nil, as none of the interviewees were aware of the disease. Knowledge of BTB was slightly better, with some people knowing of the disease in cattle. Knowledge of the potential for BTB transmission to humans was poor, although people knew about tuberculosis as a condition of humans.
174
Conclusion Based on the evidence that a solid and sustainable control program cannot be achieved without the contribution of all the stakeholders, and while the local population is considered as a substantial stakeholder, we have to start from the bottom and roll-out an adapted awareness program to make the local population aware about the necessity of a national control program. As a second and key step, trans-disciplinary workshops should be organized with the contribution of stakeholders so they can contribute to the success of the control programme. Community education is essential as a component of an integrated control strategy, based on the finding that knowledge of these diseases is poor whilst prevalence is high. Cross-sectorial socio-economic analysis of the cost of both diseases is long overdue. Vaccination has been showed to be the best way to control Brucellosis in many other countries, such as Spain, which has been able to decrease the prevalence of Brucellosis in ruminants to a very low level, however vaccination should be accompanied by an adequate organisation of veterinary services, a strict control of animal movements and a providing of adequate economic compensation to affected farmers (6). For BTB test and slaughter was shown to be the best control strategy, unfortunately, as a result of the need to provide compensation for culled animals, this option is currently deemed unaffordable for a developing country like Morocco. More evidence and advocacy is necessary convince policy-makers and communities that this is cost-effective control strategy. The evaluation of the cost of BTB has to take into account the cost of the human disease, and for this purpose an investigation of the prevalence of M. bovis in humans is required, as well as a calculation of the direct and indirect cost of a human TB case. References 1. Organisation des nations unies pour l’alimentation et l’agriculture, Représentation en Maroc. Principales réalisations depuis l’ouverture de la Représentation de la FAO à Rabat en 1982. Report No.: ISBN 978-925-206938-6. 2. Benhabyles N, Benkirane A, Boudilmi B, Benchouk S, Bouayoun H. Epidemiologie de la brucellose humaine et animale au Maghreb. CIHEAM Publ [Internet]. 1992 [cited 2014 Jan 18]; Available from: http://agris.fao.org/agris-search/search/display.do?f=2012/OV/OV201208627008627.xml;NL19930109413 3. Benkirane A, Jabli N, Rodolakis A. Fréquence d’avortement et sé ropré valence des principales maladies infectieuses abortives ovines dans la région de Rabat (Maroc). Ann Rech Vet. 1990;21:267–73. 4. Hamzy el Idrissi A, Manyari A, Benkirane A. Fréquence des avortements infectieux des ovins au Maroc (régions des Zaer et du Moyen Atlas). Rev Marocaine Sci Agron Vét. 2011 Jun 3;15(4):11–4. 5. Bennett S, Woods T, Liyanage WM, Smith DL. A simplified general method for cluster-sample surveys of health in developing countries. World Health Stat Q Rapp Trimest Stat Sanit Mond. 1991;44(3):98–106. 6. M. Thrusfield. Veterinary Epidemiology. (third ed.)Blackwell Science Limited, USA; 2007. 180-81 p. 7. Farid, M. N., Frerichs, R. R. C-Survey version 2.0. 2007.
175
Change of Intra Ocular Pressure (IOP) and Schirmer Test (STT) in sheep naturally affected with Brucella spp Timpanaro M., Pugliese M., Foti M., Ragusa M, Niutta P.P. Pugliese A DVM, Enna(Italy); Dep. of Veterinary Science, University of Messina, Polo Universitario Annunziata, Messina, Italy
Summary Brucellosis continues to represent a pitfall of the Mediterranean basin for the serious effects not only on animals but also in humans. As far in most states, this disease has been largely eradicated, in other countries in developing is re-emerging with an alarming incidence. This note reports the results of an ophthalmologic study carried out on a group of sheep reared in Sicily (Italy) naturally infected in order to evaluate some changes related to the infection. It was also investigated the possibility of using the tear secretion for diagnostic purposes. A group of 90 sheep, 72 seropositive and 18 seronegative (control group) was subjected to ophthalmological examination evaluating the clinical aspects of 180 eyes, eye pressure and tear secretion. At the clinical examination no subject showed lesions but it was possible to record a decrease in the Intra Ocular Pressure (IOP) and an increase of the Schirmer test (STT) in infected subjects. In seropositive animals values (mean value 11,75 mmHg) were significant compared to the control data (mean value 22.80 mmHg) and those reported in the literature (23.40 ± 1.71 mmHg.). Relatively to the tear secretion the STT has recorded mean values higher than the control group, respectively 20,11 mm/min and 15,33 mm /min; the same data are also higher than those reported in the literature (16,13mm / min) From what has been reported is clear an interesting variability both in eye pressure and in the production of tears. According to these data it can be hypothesized, as pointed out in humans, that even in sheep chronic brucellosis can cause lesions in the eye most likely related to a modification of the elements constituting the aqueous humor. Introduction Among zoonosis, brucellosis still plays a significant importance in terms of spread, since it affects all continents (Europe, America, Asia, Africa, etc.,) especially with endemic nature around the Mediterranean basin, for the health implications it determines in man and lastly, but not less important, for the economic damages to livestock production. Bacteria of the genus Brucella spp support this infectious disease and in ovine species, it often manifests itself as an infection with a chronic course, unapparent, essentially characterized by abortion in females and inflammatory processes borne genitalia in males. The route of entry we are mostly interested in are oral mucosa, nasal-pharyngeal, conjunctival, respiratory, vaginal, semen, blood and of course solutions continuously. In farming, the infection spreads mainly by ingestion of food or water, contaminated colostrum or milk. Nowadays the complex machinery of the National Health System has undoubtedly led to a significant decrease of cases of brucellosis in animal and human. However, the risks associated with this entity nosological still constitute a serious problem for both sanitary character that economic character, to the substantial costs of management and treatment. More exposed to infection are the "experts": farmers and business staff, veterinarians, technicians agro-livestock, laboratory technicians, etc. who are directly involved with varying degrees of responsibility and management of the problem, to deal with an infection, no longer emerging but highly endemic and still unfortunately still worthy of note. Man is especially receptive to, Brucella melitensis, Brucella abortus and Brucella suis (1). Brucellosis in humans is manifested by a great variability of symptoms, although rarely fatal, affecting different organs and systems with injury of any severity. The organs most affected seem to be the spinal cord, joints, nervous system and the eye. In the latter case are reported episcleritis, uveitis, optic neuropathies endophthalmitis, keratoconjunctivitis dacryoadenitis and in humans (2) (3) (4) (5) Despite the well documented presence of Brucella spp. eye in the apparatus of sheep (6), data on the ocular changes in the course of infection in this species are very much lacking. Studies conducted in 2006 showed
176
variations in load and aqueous humor of the lacrimal gland, in fact in animals infected with Brucella spp. there has been a net increase in the values of potassium and phosphorus (9). In addition, other authors have demonstrated the presence of specific IgA and IgG in tears mutton. (7) Based on this knowledge, we wanted to investigate further the ophthalmic pathology brucella ovis in order to develop new diagnostic and at the same time to provide new data for a comparative study with human infection. For this purpose, in sheep naturally infected, were taken into account: the presence of any gross lesions, the analysis of tears (Agglutination Direct antigen Rose Bengal and STT- Schirmer Test) and the evaluation of intraocular pressure with direct measurement by Tono-PenVet. Materials and methods The research was conducted on 90 adult sheep, race Comisana, Valle del Belice and intersections, aged between 5 and 7 years, females, belonging to five farms located in the province of Enna (Sicily) Of these 72 were found to be affected with brucellosis and 18 are part of a company "officially free" as the control group. Of all animals was performed the following protocol: -Visit ophthalmological -Withdrawals biological (tears, blood). Ophthalmological: All animals underwent complete eye examination of both eyes, using a slit lamp portable and examining: symmetry and volume of the eyeballs, the presence or otherwise, of any secretions, nystagmus, eyelid ptosis, prolapsed third eyelid, transparency and injuries of the cornea, iris changes. Subsequently the Schirmer test was performed, for the quantitative evaluation of lacrimal secretion, and the measurement of intra-ocular pressure (IOP) by means of an applanation tonometer (Tono-Pen VET, Medtronic Solan-USA) after instillation of eye drops anesthetic (Novesina 0.4% -ossibuprocaina hydrochloride). Withdrawal of tears. Tears, taken through traumatic disposable plastic pipette, were placed in sterile tubes containing 0.25 ml of sterile saline for the left eye and 0.25 ml of Phosphate Buffered Saline (PBS) for the right eye. On both eyes were carried conjunctival swabs subsequently placed in sterile tube containing 0.25 ml of saline (0.9% NaCl). The samples obtained were numbered and recorded in reference to the master number to identify each subject (ear tags). Blood sample: The blood was taken from the jugular vein, using the system Venoject® Holder with disposable needles Vacutainer® tubes and Venoject ®plain silicone coated Z., in order to obtain a serum sample to be tested to confirm the results official notified Heads 72 positive, 18 negative (control group). Both samples of tears of blood, immediately refrigerated at 4 ° C, were transported, always at a controlled temperature, at the laboratory of the Section of Infectious Diseases, Department of Veterinary Science, University of Messina where they were processed with traditional method of serum rapid antigen agglutination with Rose Bengal. Results Ophthalmological examination no lesions were found worthy of note. The results of the Schirmer test and IOP are reported respectively in Table 1 and Table 2.
Table-1 STT Infected animals Non-infected animals
Media Eye DX ± SD
Media Eye SX ± SD
20.95 ± 8.27 15.05 ± 1.89
19.27 ± 4.34 15.61 ± 2.17
Media Eye DX-SX ± SD 20.11 ± 6.93 15.33 ± 2.02
Probability (P) 0.10) in initial weight, weight starting carcass and carcass yield, as shown in Table 2. In the division of lots the average weight was 423.6 and 423.8 for FP and VM, respectively. After adaptation there was statistical difference (P T), 981 (G>T) exon 3 , 1686 (C>T) exon 5, 5448 (C>T) exon 15, 5657 (G>A), 5688 (G>A) exon 16 and 4294 ( C>T) Intron11. SNPs at position 981 and 5688 resulted in amino acid change: Glycine/Valine and Glycine/Serine, respectively. Two SNPs in the exons 3 and 15 were detected only in Sarda sheep. The detected SNPs in the fragment 5, 16 and 11 (coding regions 5 and 16, introns 11) were shared among the studied breeds. These results improved information about genetic polymorphisms in SREBP-1 gene and could be useful to scan genetic markers for milk and meat production in sheep. Introduction Sterol regulatory element binding protein (SREBP) is basic helix-loop-helix-leucine zipper (bHLH-Zip) transcription factor synthesized as an inactive precursor in the endoplasmic reticulum (ER) membrane. It is transported to the Golgi apparatus for proteolytic cleavage prior to entering the nucleus and activating the sterol responsive elementcontaining genes (Eberle et al., 2003). SREBP-1 gene regulates the expression of the major genes involved in the biosynthesis of cholesterol and fatty acids including the FASN (Fatty acid synthase) and ACACA (acetyl-CoA carboxylase alpha) genes (Shimano et al., 2001). Some polymorphisms and an insertion/deletion (ins/del) of 84 bp in intron 5 of the SREBP-1 gene were associated with different milk composition (Hussein et al., 2013), production and fatty acid content in some cattle breeds (Han et al., 2013; Hoashi et al., 2007). The SREBP1 pathway plays a key role in the regulation of milk fat synthesis; the identification of phenotypic variation is important to improve nutritional and technological aspects of milk (Rincon et al., 2012) and milk and meat fatty acid composition. Materials and Methods The research was conducted on 80 Sarda sheep (a dairy purebred), 33 Jezersko Solčavska X Romanov (a meat crossbred) and 14 Bovec X East Friesian (a dairy crossbred). DNA was extracted from whole blood using a commercial DNA extraction kit (Genomic DNA from blood Macherey–Nagel Germany) and kept at -20°C until use. Primers for the amplification of 5 fragment including the coding regions and partial sequences of the adjacent introns, were designed based on the reference sequences of the bovine SREBP-1 gene with Primer 3 plus software (Table 1).
272
Table 1: PCR programs and primers used for fragments amplification. Fragments Initial Ciclic Primers name and denat. denat. lenght F3 5’ AGCCCCAGCCTTCATCTCT 3’ 95°C 95°C 238bp 5’ TCCCTGATGCCAGCCAGAC 3’ 2'30" 20" F5 5’ CCTGACGACCATGAAAACAG 3’ 95°C 95°C 436bp 5’ TATTAGGGCCTCAGCCCACA 3’ 2'30" 20"
62°C 30" 61°C 30"
72°C 16" 72°C 29"
72°C 10' 72°C 10'
F11 387bp F15 276bp F16
5’ ATGGGTATGCGGGTGAGG 3’ 5’ GCTGTTGAGGAGGGAATGG 3’ 5’ GCTGAGTTTCTGCCTCCTGT 3’ 5’ CTCTGCCCTGGTTCTGGAT 3’ 5’ ATCCAGAACCAGGGCAGAG 3’
95°C 2'30" 95°C 2'30" 95°C
95°C 20" 95°C 20" 95°C
61°C 30" 60.1°C 30" 64.1°C
72°C 23" 72°C 17" 72°C
72°C 10' 72°C 10' 72°C
287bp
5’ CATCCAGGGAGTGGAAAGG 3’
2'30"
20"
30"
19"
10'
Anneal.
Ciclic Final N°. extent. extent. Cycles 35 35 35 35 35
PCR reactions were carried out in 25 µl volume containing 100 ng of genomic DNA, 2.5 µl of 10x PCR Buffer (20mM Tris-HCl pH 8.0, 40mM NaCl, 2mM Sodium Phosphate, 0.1mM EDTA, 1mM DTT, stabilizers, 50% (v/v) glycerol), 0.8 or 1 µl of each 10µM primer, 4.0 µl of 1.25mM each dNTP, 0.75 µl of 50mM MgCl2, 0.2 µl of 5U of Taq DNA polymerase (Platinum Taq DNA Polymerase, Invitrogen, Carlsbad, CA, USA). PCRs were performed on Mastercycler epgradient S (Eppendorf AG, Hamburg, Germany) and amplification conditions are illustrated in table 1. Electrophoresis of PCR products were performed in 1-1.5 % (w/v) in agarose gel (GellyPhor, Euroclone, UK), for 30 min at 8 V/cm in 1X TAE buffer. The gels were stained with ethidium bromide and PCR products were visualized on ultraviolet transilluminator (UVItec, Cambridge, UK). All PCR products were subjected to single-strand conformation polymorphism (SSCP) analysis to scan mutations (Tahira et al., 2003). An aliquot of the PCR product (2.5 µl was denatured at 95°C for 10 min in 7.5 µl of denaturing solution containing 1 mg/ml xylene-cyanol (Sigma–Aldrich Corporation, St. Louis, Missouri, USA), 1 mg/ml bromophenol blue (Pharmacia Biotech, Uppsala, Sweden), 10mM EDTA (pH 8), 8 ml deionised formamide (Sigma– Aldrich Corporation, St. Louis, Missouri, USA), and chilled on ice before loading. SSCP analysis was performed using the vertical electrophoresis DCode TM Universal mutation detection system (Bio-Rad Laboratories, Segrate, MI, Italy. SSCP gel compositions, different for percentages of 40% (w/v) acrylamide solution (acrylamide:bis-acrylamide 37.5:1), glycerol, 5X TBE (Tris–borate-EDTA), (TEMED, tetramethylethylenediamine), 10 % APS (ammonium persulfate) and running conditions for the five fragments analysed are indicated in table 2. Table 2: Gel SSCP mixture composition and running condition Fragments H20 ml 21.76 F3 26.76 F5 25.76 F11 24.76 F15
TBE 5X ml 4 4 4 4
Acryl ml 12 8 8 10
Glycerol ml 2 1 2 1
Temed ml 0.04 0.04 0.04 0.04
APS ml 0.2 0.2 0.2 0.2
Gel % 12 8 8 10
T °C 12 12 12 12
Time h 16 16 16 6
Program p2 p1 p2 p1
26.76 4 8 1 0.04 0.2 8 12 16 p2 F16 Program : P1(25 W, 1200 V, 67 mA) or P2 (15 W, 1000 V, 67 mA) The gels were stained with SYBR®gold (Invitrogen, Carlsbad, CA, USA) for 30 min and were visualized by ultraviolet transilluminator (UVItec, Cambridge, UK).
273
After SSCP analysis 4 samples of each distinct migration pattern were purified and sequenced. Nucleotide sequence alignments, translations and comparisons were carried out using the Bioedit software (www.mbio.ncsu.edu/bioedit/bioedit.html). The NCBI (National Center for Biotechnology Information) Blast algorithm was used to search the NCBI GenBank (http://www.ncbi.nlm.nih.gov/) database for homologous SNP discovery and genotyping and protein sequence alignment. Results and discussion The Fragment 3 showed different SSCP migration patterns and by sequencing it was possible to identify two G>T transversions at position 980 and 981. The SNP at position 981 is a missense mutation that determines an amino acid change from Glycine to Valine. Moreover, SSCP migration pattern allowed to identify C>T transition at position 1686 of fragment 5, as well as, C>T transition in position 4294 of the intron 11. Another C>T transition resulted in the fragment 15 after SSCP and sequencing. The fragment 16 showed differences in SSCP patterns caused by G>A transition at positions 5657 and 5688. This latter SNP resulting in an amino acid change from Glycine to Serine. Six nucleotide polymorphisms were discovered within the coding region and only one in the intron region. The missense mutation at position 981, Fragment 3, C>T transition at position 5448, fragment 15, were detected only in Sarda sheep. SNPs at position 4294 of the intron 11 and at position 1686 of the fragment 5 were shared among the three studied breeds. SNPs at fragment 16 were shared between Sarda and Jezersko Solčavska X Romanov sheep but not to Bovec X East Friesian sheep. Previous studies showed SREBP-1 gene polymorphisms in different species and their association with milk production and fatty acids composition (Hoashi et al., 2007). This study revealed for the first time SREBP-1 gene polymorphisms in sheep. Four of the detected SNPs appeared within species. However, further efforts are needed to evaluate the role of identified SNPs in sheep breeds. Conclusions These results improved information about genetic polymorphisms in SREBP-1 gene and could be useful to scan genetic markers for animals producing milk and meat. The detection of SNPs requires further investigation in a higher number of sheep breeds in order to detect other SNPs and to check their possible association with production traits.
References BioEdit http://www.mbio.ncsu.edu/BioEdit/BioEdit.html BLAST http://www.ncbi.nlm.nih.gov/blast/ Eberle D., Hegarty B., Bossard P., Ferre P., Foufelle F. (2004) SREBP transcription factors, master regulators of lipid homeostasis. Biochimie 86 (11), 839–848 Han C., Vinsky M., Aldai N., Dugan M.E., McAllister T.A., Li C. (2013) Association analyses of DNA polymorphisms in bovine SREBP-1, LXRα, FADS1 genes with fatty acid composition in Canadian commercial crossbred beef steers. Meat Sci; 93: 429–436. Hoashi S., Ashida N., Ohsaki H., Utsugi T., Sasazaki S., Taniguchi M., Oyama K., Mukai F., Mannen H. (2007) Genotype of bovine sterol regulatory element binding protein-1 (SREBP-1) is associated with fatty acid composition in Japanese Black cattle. Mamm Genome; 18: 880–886. Hussein M., Harvatine K., H,. Weerasinghe W. M. P. B L., Sinclair A., Bauman and D. E. (2013) Conjugated linoleic acid-induced milk fat depression in lactating ewes is accompanied by reduced expression of mammary genes involved in lipid synthesis J. Dairy Sci. 96:3825–3834. NCBI http://www.ncbi.nlm.nih.gov Primer3Plus http://www.bioinformatics.nl/primer3plus Proskura W.S. (2013) Insertion/deletion polymorphism of the sterol regulatory element-binding protein 1 gene in different cattle breeds Turk J Vet Anim Sci( 37).
274
Rincon G.,-Trejo A I., Castillo Alejandro R., Bauman DE., German B.J., Medrano J. F.(2012) Polymorphisms in genes in the SREBP1 signalling pathway and SCD are associated with milk fatty acid composition in Holstein cattle. Journal of Dairy Research 79 66–75. Shimano H. (2001) Sterol regulatory element-binding proteins (SREBPs): transcriptional regulators of lipid synthetic genes. Prog. in Lipid Res. 40, 439–452. Tahira T., Suzuki A., Kukita Y., and Hayashi K. (2003) SNP Detection and Allele Frequency Determination by SSCP Methods in Molecular Biology, vol. 212.
275
Investigation of polymorphisms in KiSS-1 and GPR54 genes in dairy and meat sheep. Di Stefano M.V.1, Farci F.1, Zidda F.1, Daga C.1, Fatur B.2, Mura M.C.1, Luridiana S.1, Bini P.P.1, Carcangiu V.1 1Department of Veterinary Medicine, Sezione di Endocrinologia, Zootecnica e Benessere animale, University, Via Vienna 2, 07100 Sassari 2 freelance veterinarian
Abstract KiSS-1 gene encodes for a family of peptides, named kisspeptins, which stimulate the hypothalamic-pituitarygonadal axis by raising luteinising hormone (LH) and follicle-stimulating hormone (FSH). Kissepeptins are endogenous ligands for the GPR54, a G-protein-coupled receptor, encoded by GPR54 gene. KiSS-1 and GPR54 system is very important for the puberty onset and sexual maturation in mammals. It regulates the release of gonadotropin-releasing hormone (GnRH) from hypothalamic neurons. Polymorphisms at exon 1 of KiSS-1 and at exon 1 and exon 2 of GPR54 genes were detected in prolific sheep breeds while no polymorphisms were found in low litter size sheep breeds. Our objective was to investigate exon 1 of KiSS-1 gene and exon 1 and 2 of GPR54 gene by PCR-SSCP analysis and sequencing to find polymorphisms and their relationships with meat and dairy sheep breeds. Three pairs of primers were used to amplify the DNA sequence target of KiSS1 and GPR54 gene in 80 Sarda sheep (a dairy purebred), 33 Jezersko Solčavska X Romanov (a meat crossbred) and 14 Bovec X East Friesian (a dairy crossbred). The length of the PCR products were respectively 106, 250 and 130 bp. By the SSCP analysis of the GPR54 gene exons 1 and 2 no different patterns were found. Only exon 1 of KiSS-1 gene exhibited three different migration patterns. Sequencing of the obtained fragments evidenced one polymorphic site, 1035 G > A. The genotype G/G resulted the most frequent compared to A/G whereas genotype A/A was found only in Jezersko Solčavska X Romanov sheep. Introduction KiSS-1 gene encodes for a family of peptides, named kisspeptins, endogenous ligands for the GPR54, a G-proteincoupled receptor, encoded by the GPR54 gene (Smith JT., 2009). Kisspeptins and GPR54 are major regulatory elements of gonadotropin axis (Caraty A. et.al., 2012). The discovery of kisspeptins and their effects on reproduction is a landmark in understanding gonadotropic axis regulation in mammals. Evidence of their importance came indirectly from humans and mice with impaired sexual development and showing hypogonadotropic hypogonadism (Chalivoix et al., 2010). Kisspeptin system is a prime candidate to participate in the seasonal regulation of reproduction. Kisspeptin cells show changes in peptide and mRNA levels with season, consistent with a role in determining activity or quiescence of GnRH cells. Some selective effects of estrogen are seen in kisspeptin cells in the breeding and non-breeding seasons. Kisspeptin input to GnRH cells changes with season in a manner consistent with involvement in the determination of cyclicity. Reproductive function can be restored during the nonbreeding season by kisspeptin treatment (Clarke I.J. et al., 2009). Various studies have been conducted in many species, including rats, mice, sheep and primates to understand the association between KiSS-1 and GPR54 genes, and the reproductive activity (Redmond J.S. et al., 2011). KiSS-1 and GPR54 system is very important for the puberty onset and sexual maturation in mammals (Navarro VM. et al., 2007). Activated mutation of both genes can cause central precocious or delayed puberty. Mutations in GPR54, cause autosomal recessive idiopathic hypogonadotropic hypogonadism in humans and mice, suggesting that this receptor is essential for normal GnRH physiology and for puberty (Seminara S.B. et al., 2003). Polymorphisms at KiSS-1 gene have been associated with litter size in sheep (Chu M. et al., 2011) and in goat breed (Cao G.L. et al., 2010). Our aim was to investigate exon 1 of KiSS-1 gene, exon 1 and 2 of GPR54 gene by PCR-SSCP analysis and sequencing in Sarda and Slovenian sheep breeds, to find polymorphisms and their relationships with meat and dairy sheep breeds.
276
Materials and Methods For this study, we have used 80 Sarda sheep (a dairy purebred), 33 Jezersko Solčavska X Romanov (a meat crossbred) and 14 Bovec X East Friesian (a dairy crossbred). Blood samples were collected from the jugular vein of each sheep using vacuum tubes with EDTA as an anticoagulant. Genomic DNA was extracted from the whole blood using DNA extraction kit (Genomic DNA from blood, Macherey–Nagel Germany). Three pairs of primers were used to amplify the exon 1 of Kiss-1 gene and the exons 1 and exon 2 of GPR54 gene, respectively, according to Chu et al.(2011). Primer sequences were as follows: Primer 1: F: 5’-GGATGAACGTGCTGCTT-3’; R: 5’-CCTGTGGTTCTAGGATTCTC-3’; Primer 2: F: 5’-GGCAATGCAGCCCTTGTC-3’; R: 5’-ACCGATGTAGAAGTTGGTCAC-3’; Primer 3: F: 5’-CCAACCTGGCGGTCACGGA-3’; R: 5’-CGCACCTGCTGGATGTAGTT. The PCR for the exons above specified were carried out in a 25µl reaction mix final volume, containing 2,5 µl of template DNA (200ng), 2.5µl of 10x PCR Buffer (50 mmol/l KCl, 10 mmol/l Tris-HCl- pH 8.0, 0.1% Triton X-100), 0.6µl of 50 mmol/l MgCl2 (exon1 of KISS1 and GPR54), 0,75 µl (exon 2 of GPR54), 4.0µl of 1.25 mmol/l dNTP, 1µl of 10 µmol/l each primer and 0,2µl of 5U/µl Taq DNA polymerase Euroclone and the rest was ddH2O. PCR protocol included an initial denaturation at 94° C for 2.5 min followed by a 32 cycle program with 30s denaturation at 95° C, 30 s annealing at different temperatures (56° C for exon 1 of KiSS1, 58° C for exon 1 of GPR54 and 61° C for exon 2 of GPR54), extension at 72° C for 30s, 15s and 8s for exon1 of Kiss1, exon1 and exon2 of GPR54 respectively; finally a final extension at 72° C for 10 min. PCR products were visualized on 1.5% (w/v) agarose gel (GellyPhor, Euroclone, UK) stained with ethidium bromide under UV light. Amplicons have been analyzed by single strand conformation polymorphism analysis (SSCP). The PCR product was mixed with denaturation solution containing 1 mg/ml xylene-cyanol (Sigma–Aldrich Corporation, St. Louis, Missouri, USA), 1 mg/ml bromophenol blue (Pharmacia Biotech, Uppsala, Sweden), 25 mM EDTA (pH 8) and 95% formamide (SIGMA-ALDRIC Corporation, St. Louis, Missouri, USA). For the exon 1 of KiSS-1 gene and exon 2 of GPR54 were used 3 µl of PCR product mixed with 7 µl of denaturation solution; for the exon 1 of GPR54 gene were used 5 µl of PCR product mixed with 5 µl of denaturation solution. The mixture was denatured at 95° C for 10 min. chilled on ice until loading. The SSCP analysis, has been conducted using the vertical electrophoresis DCodeTM (Bio-Rad Laboratories, Segrate, MI, Italy) Universal mutation detection system for SSCP at constant voltage (1100 V, 15 W, 67 mA). Denatured amplicons of the KiSS1-exon 1 were subjected to electrophoresis on a 12% neutral polyacrylamide gels (acrylamide/bisacrylamide, 37.5:1) in 0.5X TBE buffer (Tris–borate-EDTA) for 6h at 12° C. Denatured amplicons of the GPR54-exon 1 were subjected to electrophoresis on a 10% neutral polyacrylamide gels (acrylamide/bisacrylamide, 29:1) in 0.5X TBE buffer (Tris–borate-EDTA) for 7h at 12°C. Denatured amplicons of the GPR54-exon 2 were subjected on a 10% neutral polyacrylamide gels (acrylamide/bisacrylamide, 37.5:1) in 0.5X TBE (Tris–borate-EDTA) for 10h at 12° C. The gels were stained with sybr gold (life technologies) for 30 min and then visualized by a ultraviolet transilluminator (UVItec, Cambridge, UK). After SSCP analysis the samples with different migration patterns were purified and sequenced in the forward and reverse directions. Nucleotide sequence alignments, translations and comparisons were carried out using the Bioedit software (www.mbio.ncsu.edu/bioedit/bioedit.html). Allelic frequencies were determined by direct counting of the observed genotypes. Chi-squared test was used to determine Hardy-Weinberg equilibrium of the mutations.
Results and discussion The results of PCR showed that amplification fragment sizes were consistent with the target and had a good specificity. The same migration pattern resulted from the SSCP analysis of the GPR54-exons 1 and 2, while the KiSS-1-exon 1 showed three different migration patterns. By sequencing, was found a G to an A substitution at position 1035. Consequently, three genotypes were recognized: G/G, A/G and A/A. The genotype G/G was the most frequent compared to A/G whereas genotype A/A was found only in two animals of Jezersko Solčavska X Romanov,
277
a meat crossbred . Moreover the genotype A/A was not detected in Sarda breed and in Bovec X East Friesian crossbred, both dairy sheep.
Conclusion Our study confirms the existence of three genotypes in the exon 1 of the KiSS-1 gene. It would be interesting to expand the number of dairy and meat sheep breeds analyzed, in order to understand if the A/A genotype is breed specific and could be linked with meat attitude. Acknowledgments Research supported by R.A.S, legge 7, project :"MIGLIOVIGENSAR"
References Cao GL., Chu MX., Fang L., Di R., Feng T., Li N. (2010) Analysis on DNA sequence of KiSS-1 gene and its association with litter size in goats. Mol. Biol. Rep. 37:3921–3929. Caraty A., Decourt C., Briant C., Beltramo M. (2012) Kisspeptins and the reproductive axis: potential applications to manager production in farm animals. Domest. Anim. Endocrinol.43:95-102. Chalivoix S., Bagnolini A., Caraty A., Cognié J., Malpaux B., Dufourny L. (2010) Effects of Photoperiod on Kisspeptin Neuronal Populations of the Ewe Diencephalon in Connection with Reproductive Function. J Neuroendocrinol. 22:110-8. Chu M., Xiao C., Feng T., Fu Y., Cao G., Fang L., Di R., Tang Q., Huang D., Ma Y., Li K., Li N. (2012). Polymorphisms of KiSS-1 and GPR54 genes and their relationships with litter size in sheep. Mol. Biol. Rep. 39, 3291–3297. Clarke I.J., Smith J.T., Caraty A., Goodman R.L., Lehman M.N. (2009) Kisspeptin and seasonality in sheep. Peptides 30:154-63. Navarro V.M., Castellano J.M., García-Galiano D., Tena-Sempere M. (2007) Neuroendocrine factors in the initiation of puberty: the emergent role of kisspeptin. Rev. Endocr. Metab. Disord.8:11-20. Redmond J.S., Macedo G.G., Velez I.C., Caraty A.,Williams G.L., Amstalden M. (2011) Kisspeptin activates the hypothalamic-adenohypophyseal-gonadal axis in prepubertal ewe lambs. Reproduction.141:541-8. Seminara S.B., Messager S., Chatzidaki E.E. et al. (2003) The GPR54 gene as a regulator of puberty. N. Engl. J. Med. 349:1614 –7. Smith J.T. (2009) Sex steroid control of hypothalamic Kiss1 expression in sheep and rodents: comparative aspects. Peptides 30:94-102.
278
Reproductive response to melatonin treatment in different periods in Sarda breed sheep F. Farci, M.V. Di Stefano, F. Zidda, C. Daga, S. Luridiana, M.C. Mura, P.P. Bini, V. Carcangiu Dipartimento di Medicina Veterinaria, Università di Sassari, Via Vienna 2, 07100 Sassari
Abstract The timing of reproductive seasonality in small ruminants is controlled by melatonin secretion from the pineal gland. Melatonin is secreted during the night, consequently, a short day length is associated with a long pattern of melatonin secretion. This condition has a stimulating effect on the reproductive recovery in short-day breeders, like sheep and goat. Exogenously administered melatonin from continuous slow-release implants showed to advance the onset of the breeding season in sheep and goat by mimicking the stimulatory effect of short days. In the Mediterranean area the sheep are treated with melatonin implants around the spring equinox, but the most suitable period for the implants’ insertion to obtain the better reproductive response is still not recognized. The aim of the present work was to define, what is the optimum time to implant melatonin in Sarda ewes, in order to obtain best reproductive efficiency in out-of season mating. From 2 farms, 400 adult ewes, who lambed between November and December were chosen. The selected animals were divided into 8 groups (A, B, C, D, E, F, G, H) each of 50 animals, based on their production level and their age. Animals in Group A were treated on March 1 with one melatonin implant (18 mg) in the left retro-auricular region and group B served as a control. Group C received the implants on March 22 and group D was used as control. Group E was treated on April 10 and group F was used as control. Group G was treated on April 30 and group H was used as a control. Males were introduced in all the groups 35 days after treatment (male/female ratio 1/25). The lambing date and the number of new born lambs were recorded, for each ewes, between day 150 and 190 from males introductions. Statistical analysis showed a higher fertility rate in all the treated groups compared to controls (P
