Proceedings edited by

Proceedings edited by

Jean-Charles Côté Imre S. Otvos Jean-Louis Schwartz Charles Vincent

Participants to 6th Pacific Rim Conference 2005

Proceedings of the 6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact Victoria, BC, Canada Oct 30 - Nov 3, 2005

Edited by Jean-Charles CÔTÉ Horticulture Research and Development Centre, Agriculture and Agri-Food Canada, Saint-Jean-sur-Richelieu, QC, Canada [email protected] Imre S. OTVOS Pacific Forestry Centre, Canadian Forest Service, Natural Resources Canada, Victoria, BC, Canada [email protected] Jean-Louis SCHWARTZ Departement of Physiology, Université de Montréal, Montreal, QC, Canada [email protected] Charles VINCENT Horticulture Research and Development Centre, Agriculture and Agri-Food Canada, Saint-Jean-sur-Richelieu, QC, Canada [email protected] ©2007

Érudit

The correct citation of this document is: Côté, J.-C., Otvos, I.S., Schwartz, J.-L. and Vincent, C. (eds). 2007. Proceedings of the 6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact. Érudit, Montréal, 141 pages. This document with full colour illustrations is also available on the enclosed CD. It is also downloadable free of charge at : www.erudit.org/livre/pacrim/2005/index.htm Partial reproduction of these articles is permitted with mention of the authors and source. Graphic design and page layout : Natacha Sangalli, Graphic designer Science Publishing and Creative Services Agriculture and Agri-Food Canada Saint-Jean-sur-Richelieu, Quebec

ISBN 978-2-9810223-0-1 Biocontrol Network of Canada - Réseau Biocontrôle du Canada Dépôt légal - Bibliothèque et Archives nationales du Québec, 2007 Dépôt légal - Bibliothèque et Archives Canada, 2007

ii

About the editors Jean-Charles Côté is a Research Scientist with Agriculture and Agri-Food Canada at the Horticulture Research and Development Centre in Saint-Jean-sur-Richelieu, Quebec, Canada. He received a B.Sc. in Biology from Université du Québec à Rimouski, Canada, a M.Sc. in Microbiology from Sherbrooke University Medical School,Canada and a Ph.D. in Molecular Biology from Cornell University,Ithaca, NY. JeanCharles joined the Horticulture Research and Development Centre in 1989. He was appointed Adjunct Professor at the Université du Québec à Montréal in 1993. His research focuses on Bacillus thuringiensis. His main invention is a series of seven Bacillus thuringiensis-based bio-insecticides called BioprotecTM, developed through a series of Matching Investment Initiatives with the private sector for use in horticulture, forestry and households. More recently, he was the co-inventor of a novel B. thuringiensis strain which exhibits specific cytocidal activity against selected human cancer cells. He also works on Bacillaceae phylogeny and ecology, including not only B. thuringiensis but also B. cereus, a contaminant of dairy products and B. anthracis, the anthrax-causing agent. He is also pursuing activities on the true role of B. thuringiensis in the environment. He has led two international projects, co-organized three international Conferences, and has co-supervised five Ph.D. and 10 M.Sc. students. In 2006, he received a Gold Harvest Ministerial Award for his outstanding work.

Jean-Louis Schwartz is a full professor at the Department of Physiology, Faculty of Medicine of the Université de Montréal.  He is also the Leader of the Biocontrol Network, a Canadian consortium of 57 scientists from Academia, Government and Industry.  The Biocontrol Network is supported by the Natural Sciences and Engineering Research Council of Canada (NSERC), several federal and provincial organisations, and a number of private partners. The Network conducts research and development in the area of plant protection against noxious organisms in agriculture and forestry.  Jean-Louis was formerly a research scientist at the National Research Council of Canada in Ottawa (Biological Sciences) and Montreal (Biotechnology Research Institute), where he pioneered electrophysiological and biophysical approaches in endocrine physiology.  For the last fifteen years, he has focused on the mechanism of action, at the molecular and cellular levels, of proteins that form pores in cell membranes, including several bacterial toxins that affect mammals and invertebrates. He and his collaborators (“Team Canada”) are recognized world leaders in Bacillus thuringiensis based insecticide research. Within the framework of the Biocontrol Network, Jean-Louis is interested in the biology, the socio-economics and the regulatory aspects of non-chemical management of crop and forestry pests and of disease vector insects.  He is the author of over 200 scientific articles, communications and book chapters.  Jean-Louis’ goal for the next decade is to contribute to the establishment of an all-inclusive Canadian consortium which will make Canada the international leader in the development of traditional and new crop protection within the context health and environment protection and that of global issues like climate change, invasive species, emerging diseases and sustainable resources.

Imre S. Otvos is a Senior Research Scientist with Natural Resources Canada, Canadian Forest Service, Pacific Forestry Centre, Victoria, British Columbia. He obtained his Ph.D. at the University of California, Berkeley, in 1969, specializing in forest entomology and biological control. On graduation, Dr. Otvos returned to Canada and joined the Canadian Forest Service as a Research Scientist, and has been involved with the management of forest defoliators, first in eastern, and since 1980 in western Canada. He has made significant contributions in developing integrated management techniques, using ecologically sound and economically feasible methods for controlling forest defoliators using parasitoids, naturally occurring viruses and Bacillus thuringiensis subsp. kurstaki (Btk). He also investigated the potential non-target effects of Btk applications in the forest environment. Dr. Otvos was a co-developer of the integrated management system developed and now used operationally in BC for controlling the Douglas-fir tussock moth. Dr. Otvos is a Board Certified Entomologist (Entomological Society of America). He served as Associate Editor for The Canadian Entomologist for many years, and has authored over 150 research papers and reports, including several invited book chapters, and has co-edited two Proceedings. In recognition of his significant contributions to entomology he received a lifetime membership in the Entomological Society of British Columbia and was elected a Fellow of the Entomological Society of Canada, Fellow of the Royal Entomological Society (UK), and elected into the General Assembly of the Hungarian Academy of Sciences. For his cooperative work with entomologists in China he was named Research Professor of the Key Laboratory of Forest Protection by the National Forestry Administration. He was also an adjunct Professor in the Faculty of Forestry, University of British Columbia, Department of Biology, University of Victoria, and Department of Forest Protection, Northeastern Forestry University (Harbin, P.R. China).

Charles Vincent received a B.Sc. in Agriculture from Université Laval (Quebec City, Canada), a M.Sc and a Ph.D. (1983) in Entomology from McGill University (Montreal, Canada). Since 1983, he worked as an entomologist for the Horticultural Research and Development Center (Agriculture and Agri-food Canada) at Saint-Jean-sur-Richelieu, Quebec, Canada. In 1984, he has been appointed adjunct professor at the Macdonald Campus of McGill University. He has been appointed as adjunct at Université du Québec à Montréal in 1992, and, since 2000, is invited professor at l’Université de Picardie Jules Verne (Amiens, France). He co-supervised the work of 35 graduate students. His research focuses on the management of insect populations of horticultural importance with biological (including biopesticides) and physical control methods. To date he published 135 scientific and 200 technical papers. He edited 14 technical bulletins or books. He served as President of the Entomological Society of Canada in 20032004. He received the Prix Léon Provancher (professionnal) from the Entomological Society of Quebec (1991) and the Prix Jean-Charles Magnan from the Quebec Order of Agronomists in 1989 and 1994, a research scholarship from the Ministry of Agriculture (the Netherlands) in 1994, a fellowship from OECD (Paris) in 1996. In 1999, he has been awarded the “Médaille de distinction agronomique” by the Quebec Order of Agronomists for his research and extension work in plant protection. He received an “Exceptional Service Award” in 2000 and 2007 from the Entomological Society of America.

iii

Foreword from the editors The 6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact was held in Victoria, British Columbia, Canada, from October 30 to November 3, 2005, for the first time on the east side of the Pacific. Previous conferences were held in Taipei (Taiwan) in 1994, in Chiang Mai (Thailand) in 1996, in Wuhan (China) in 1999, in Canberra (Australia) in 2001 and in Hanoi (Vietnam) in 2003. All these past international meetings proved to be great successes. They brought together scientists from various countries with diverse, and often specific problems, priorities and approaches to the use of Bt, but sharing same interests and complementary expertises. They provided a unique platform to review and present new research results of both fundamental and practical nature, to discuss new trends and issues related to Bt science, Bt products and Bt uses worldwide. The Victoria Conference continued this tradition and offered updated, significant contributions to sound science, transparent communication and critical appraisal of the continuing progress experienced by the Bt field.

which may be less dangerous to human and animal health, and to the environment. The 6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact, as will be documented in the following pages, addressed several of the above issues. Forty oral communications and twenty posters were presented to close to one hundred delegates. The contributions were grouped into eight sessions: toxin mode of action, novel toxins and activities, public safety, environmental impact, Bt crops and resistance, application in agriculture, forestry and vector control. The organizers wish to express their sincere thanks to all contributors, scientists and trainees, for the excellent presentations they gave at the meeting and for their contributions to this book of proceedings. They are also indebted to Kees van Frankenhuyzen from the Great Lakes Research Centre and Nicholas Conder from the Pacific Research Centre of the Canadian Forest Service (CFS), Natural Resources Canada and to Lucie Lévesque and Stéphane Dupont from the Biocontrol Network, for their outstanding organizational and technical support.

More than six decades after its commercial introduction as a biological control agent against agricultural and forestry pests, after three decades following the discovery of Bt strains active against major dipteran insects, with a major impact on human health, and after twelve years of commercialization of the first Bt transgenic crops, Bt remains the most widely used biopesticide, far ahead of other microbial agents. Bt is specific. Bt is safe to humans and it does not damage the environment. Furthermore, pest resistance to sprayable Bt products remains limited, and efficient strategies are being implemented to prevent its development in Bt transgenic planted areas. This continuing success story does not translate, unfortunately, into more than 1.5 to 2% share of the global pesticide market, for several reasons: (1) Bt products are narrow spectrum agents, compared to synthetic pesticides; (2) while many Bt strains have been isolated, their toxicity spectrum is not known and only a few are produced and commercialized; (3) the industry has been in constant restructurating; (4) a large part of the industrial efforts in the last decade has been devoted to transgenic crop development; (5) demand by growers and foresters, and acceptance by users and the public have not always been properly promoted, and easier, more economical access to Bt products and better information on their use have not been optimal; (6) ethical, legal and environmental issues have been raised, but have often been poorly addressed by all parties involved; and finally (7) the synthetic pesticide industry is evolving and is coming up with new products

We also thank the generous sponsors of the conference: Valent Biosciences Corporation, the Société de protection des forêts contre les insectes et maladies (SOPFIM), the Spray Efficacy Research Group (SERG), the Bacteria Division of the Society for Invertebrate Pathology (SIP) and the Biocontrol Network of Canada. The production of these proceedings would not have been possible without the strong financial and technical support provided by CFS-Natural Resources Canada and Agriculture and Agri-Food Canada. And finally, the continuing support of the International Standing Committee of the Pacific Rim Conferences on the Biotechnology of Bacillus thuringiensis and its Environmental Impact is highly appreciated. The Editors express their sincere thanks to Natacha Sangalli, Graphic designer, Thérèse Otis, Production Manager and to Suzanne Fréchette, Pierre Lemoyne and Nicholas Conder for technical assistance.

iv

Table of contents About the editors Foreword of the editors To x i n m o d e o f a c t i o n Important Interactions with Membrane Receptors in the Mode of Action of





Bacillus thuringiensis Cry Toxins Mario Soberón, Isabel Gómez, Liliana Pardo, Carlos Muñoz, Luisa E. Fernandez, Claudia Pérez, Sarjeet S. Gill, and Alejandra Bravo. Oligomer Formation of Different Cry Toxins Indicates that a Pre-Pore is an Essential Intermediate in the Mode of Action of the Three-Domain Cry Family Alexandra Bravo, Liliana Pardo, Isabel Gómez, Carlos Muñoz-Garay, Nuria Jimenez-Juaréz, Jorge Sánchez, Claudia Pérez, and Mario Soberón. Cyt1Aa from Bacillus thuringiensis subsp. israelensis Synergizes Cry11Aa Toxin Activity by Functioning as a Membrane-Bound Receptor Claudia Pérez, Luisa E. Fernandez, Jianguang Sun, Jorge Luis Folch, Mario Soberón, Alejandra Bravo, and Sarjeet S. Gill. Identification of scFv Molecules that Recognize Loop 3 of Domain II and Domain III of Cry1Ab Toxin from Bacillus thuringiensis Isabel Gómez, Juan Miranda-Ríos, Iván Arenas, Ricardo Grande, Baltazar Becerril, Alejandra Bravo, and Mario Soberón



iii iv

1

7

9

12



Mechanism of Detoxification of Cry1Ac in Bombyx mori, Hybrid Shunrei x Shogetsu Yasuyuki Shitomi, Delwar M. Hossain, Kohsuke Haginoya, Masahiro Higuchi, Tohru Hayakawa, Kazuhisa Miyamoto, Ryoichi Sato, and Hidetaka Hori

15



Determination of a Region of Cry1Aa Inserted into Bombyx mori BBMV Kazuya Tomimoto, Tohru Hayakawa, and Hidetaka Hori

17



Production and Characterization of a Subtractive cDNA Library and Quantitative PCR Analysis of Choristoneura fumiferana Genes Differentially Expressed in Response to Bacillus thuringiensis Cry1Ab Toxin Exposure Liliane Meunier, Gabrielle Préfontaine, Manuela Van Munster, Roland Brousseau, and Luke Masson



19

Gene Expression Response of the Spruce Budworm, Choristoneura fumiferana, after Exposure to Various Doses of Bacillus thuringiensis Cry1Ab Toxin Using Microarray Technology Manuela van Munster, Gabrielle Préfontaine, Alberto Mazza, Liliane Meunier, Miria Elias, Roland Brousseau, and Luke Masson

21

23



Molecular Identification and Cytocidal Action of Parasporin, a Protein Group of Novel Crystal Toxins Targeting Human Cancer Cells Sakae Kitada, Yuichi Abe, Akio Ito, Osamu Kuge, Testuyuki Akao, Eiichi Mizuki, and Michio Ohba



Using DNA Microarrays for Assessing Crystal Protein Genes in Bacillus thuringiensis Luke Masson, Jarek Letowski, Alejandra Bravo, and Roland Brousseau



28



Cloning and Expression of cry1Aa, cry1Ab, cry1C, and cry1Da Genes from Bacillus thuringiensis var. aizawai Jen-Chieh Cheng, Feng-Chia Hsieh, Bing-Lan Liu, and Suey-Sheng Kao



Redesigning Bacillus thuringiensis Cry1Aa Toxin into a Mosquito Toxin Xinyan Sylvia Liu, and Donald H. Dean

31 33

Public safety

Development and Application of Molecular Tools for Exposure, Toxicity and Pathogenicity Characterization of Bacillus cereus Group Organisms in Context of Biotechnology Use Vern Seligy, Gordon Coleman, Jennifer Crosthwait, Kathy Nguyen, Phil Shwed Azam Tayabali, George Arvanitakis, Della Johnston, Louis Bryden, Michael Mulvey, Brian Belliveau, and Esther Seto

37

Safety of Bacillus thuringiensis var. kurstaki Applications for Insect Control to Humans and Large Mammals Imre S. Otvos, Holly Armstrong, and Nicholas Conder



45

Human Health Impact Assessment after Exposures to Bacillus thuringiensis subspecies kurstaki David B. Levin



61



64



67





72



74



Monitoring of Bacillus thuringiensis Cry1Ac Resistance in Helicoverpa armigera (Hübner) (Noctuidae: Lepidoptera) Saad Mousa, Trilochan Mohapatra, and Govind T. Gujar



Host Plant Effects Associated with Cry1A Resistance in Helicoverpa armigera Lisa Bird, and Ray Akhurst



78



Transformation of Maize Elite Lines with cry1Ca of Bacillus thuringiensis to Control Spodoptera frugiperda Fernando H. Valicente, Newton P. Carneiro, Ruth H. Utida, Cláudia T. Guimarães, Jurandir V. Magalhães, Edilson Paiva, and Andréa A. Carneiro.



81



84



A Comparative Study of Histamine Release from Rat Mast Cells by Cry1Aa, Cry1Ab and Cry1Ac Fragmented with Simulated Gastric Fluid (SGF). Mayumi Ohno, Miho Suganuma, Youko Egawa, Kazuya Tomimoto, Takashi Hara, Tohru Hayakawa, and Hidetaka Hori

Bt crops and resistance

Bt Resistance Management: Have We Been Lucky or Smart? Anthony M. Shelton, Jian-Zhou Zhao, and Ping Wang



A Deterministic Model to Evaluate and Improve the Strategy of Insect Resistance Management (IRM) to Genetically Modified Plants Synthesizing a Cry Toxin Aiko Gryspeirt, and Jean-Claude Grégoire





Application in agriculture, forestry and vector control

Bt Crop Straw is an Effective Source of Active and Stable Cry1Ac Toxin for Spray Bio-Formulations Mohsin Abbas Zaidi, Xiongying Cheng, and Illimar Altosaar

vi



Utilization of Bacillus thuringiensis var. israelensis (bti)-Based Formulations for the Biological Control of Mosquitoes in Canada Mario Boisvert







Insecticidal Effect of New Strains of Bacillus thuringiensis on the Diamondback Moth, Plutella xylostella Hyun G. Goh, Dale B. Gelman, Phyllis A. W. Martin, Ashaki D. S. Shropshire, Daniel L. Rowley, Michael B. Blackburn, Ik Y. Choi, and Robert R. Farrar



Bacillus thuringiensis in Brazil: Geographical Distribution and Fermentation Media for Production Fernando H. Valicente, Rodrigo F. Zanasi , Kátia g. Boregas, and marliton r. barretto



87

94



97

Valent BioSciences Corporation: an Overview Dirk Avé



99

Positioning of Biopesticides in Thailand Paisan Ratanasatien, Uthai Ketunuti, and Achara Tantichodok



100

To x i n s m o d e o f a c t i o n





Activation Process of the Mosquitocidal Delta-Endotoxin Cry39Aa Produced by Bacillus thuringiensis subsp. aizawai BUN1-14 and Binding Property to Anopheles stephensi BBMV Takeshi Ito, Hisanori Bando, and Shin-ichiro Asano

108

Improved Technique for Refining the Crystal of Bacillus thuringiensis by NaBr Gradient Centrifugation So Takebe, Shinji Morinaga, Akira Mizuhashi, and Tohru Komano

111

Oligomerization of Parasporin-2, a New Crystal Protein from Non-Insecticidal Bacillus thuringiensis, in Lipid Rafts Yuichi Abe ,Sakae Kitada, Osamu Kuge, Michio Ohba, and Akio Ito

113

Kinetics of Interaction between Insecticidal Cry1A Toxins from Bacillus thuringiensis and Artificial Lipid Membrane Vesicles (Liposomes) Kohsuke Haginoya, Taisuke Kato, Yasuyuki Shitomi, Masahiro Higuchi, Ryoichi Sato, Tohru Hayakawa, and Hidetaka Hori Mutagenic Analysis of Putative Domain II and Surface Residues in Mosquitocidal Bacillus thuringiensis Cry19Aa Toxin Jong Yul Roh and Donald H. Dean

116

118

Novel toxins and activities



Characterization of Cancer Cell-Killing Activity Associated with Parasporal Proteins of Novel Bacillus thuringiensis Isolates Akiko Uemori, Minoru Maeda, Koichi Yasutake, Akira Ohgushi, Kumiko Kagoshima, Eiichi Mizuki, and Michio Ohba Occurrence of Bacillus thuringiensis Producing Parasporin, Cancer Cell-Killing Cry Proteins, in Vietnam Koichi Yasutake, Ngo Dinh Binh, Kumiko Kagoshima, Akiko Uemori, Akira Ohgushi, Minoru Maeda, Eiichi Mizuki, Yong Man Yu, and Michio Ohba

vii

122

124



Characterization of Bacillus thuringiensis Strains in the Vietnam Bacillus thuringiensis Collection Ngo Dinh Binh, Nguyen Xuan Canh, Nguyen Thi Anh Nguyet, Nguyen Dinh Tuan, Pham Kieu Thuy, Nguyen Thi Thanh Hanh, Shin-ichiro Asano, and Michio Ohba

126

Tr a n s g e n i c p l a n t s a n d r e s i s t a n c e

Engineering Turf Grass for Resistance against Certain Coleopteran Pests Using Bacillus thuringiensis cry8Da Gene Shin-ichiro Asano, Takuji Okamoto, Hisanori Bando, Mitsugu Horita, Hiroshi Sekiguchi, and Toshihiko Iizuka

131

Environmental impacts

Analysis of Non-Target Impacts of Foray 48B on Soil Micro-Organisms Maureen O’Callaghan, E. Gerard, and U. Sarathchandra

133



Ecosystem Effects of Novel Living Organisms (EENLO): A Federal Research Initiative Valar Anoop, Wendy Shearer , and Stuart Lee

135



Environmental Risk Assessment of Bacillus thuringiensis strain ATCC 13367 under the Canadian Environmental Protection Act 1999 (CEPA 1999) Souad El Ouakfaoui, Lee-Ann Tsan, Théophile Paré, and Kiera Delgaty



Environmental Evaluation of GM Hot Pepper in Newly Synthesized Material Differences Si-myung Lee, Jeoung-han Kim, Byung-soo Park, Hyun-suk Cho, Donghern Kim, and Yong-moon Jin



Evaluation of Border Cell Number and Cry Protein Expression from Root Tips of Gossypium hirsutum Oliver G.G. Knox, and Gupta V.S.R. Vadakattu

139

Acknowledgements

141



viii

136 137

6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact, Victoria BC, 2005 Côté, J.-C., Otvos, I.S., Schwartz, J.-L. and Vincent, C. (eds)

Important Interactions with Membrane Receptors in the Mode of Action of Bacillus thuringiensis Cry Toxins Mario Soberón1*, Isabel Gómez1, Liliana Pardo1, Carlos Muñoz1, Luisa E. Fernandez1, Claudia Pérez1, Sarjeet S. Gill2, and Alejandra Bravo1. 1 2

Instituto de Biotecnología, Universidad Nacional Autónoma de México, Cuernavaca, Morelos, Mexico, 62250. Department of Cell Biology and Neuroscience, University of California, Riverside, CA, U.S.A, 92506.

In this review we summarize recent findings on the Cry toxin-receptor interaction and its role in the mode of action of these toxins. Cry toxins interact with multiple receptor molecules leading to the formation of membrane pores in membranes of susceptible insects. In lepidopteran insects, Cry toxins interact with a cadherin receptor and with glycosyl-phosphatidyl-inositol (GPI)- anchored proteins (aminopeptidase N and alkaline phosphatase) leading to insertion of oligomeric toxin in membrane microdomains (or lipid rafts) and inducing cell swelling. Furthermore, recent data shows that in addition to protein receptors involved in Cry toxin interaction with the membrane of susceptible organisms, certain glycolipids also play a role in toxin action. These glycolipids are specific to invertebrate organisms like insects and nematodes. Recent progress in the characterization of mosquitocidal Cry toxin GPI-anchored protein receptors will also be reviewed. The conserved structure of Cry toxins and the characterized receptor molecules tend to suggest that similar receptor molecules may be involved in Cry toxin action on different insects. Introduction Bacillus thuringiensis (Bt) is an aerobic, spore-forming bacterium that produces, during the sporulation phase, crystalline inclusions composed of proteins known as δ-endotoxins (3). The δ-endotoxins form two multigenic families, Cry and Cyt toxins. Cry proteins are specifically toxic to several orders of insects: Lepidoptera, Coleoptera, Hymenoptera, Diptera, and to nematodes. In contrast, Cyt toxins are mostly found in Bt strains active against Diptera (3).

A

Cry and Cyt proteins are produced as protoxins that are activated by midgut proteases to release their toxin fragment (3). Cry and Cyt toxins exert their pathological effect by forming lytic pores in the membrane of midgut epithelial cells (3). Cry toxins are composed of three functional domains, an α-helical domain involved in membrane insertion (domain I) and two β-sheet domains (domains II and III) involved in receptor interaction (3). Cyt proteins, on the other hand, have a single α−β domain comprising of two outer layers of αhelix hairpins wrapped around a β-sheet (3) (Fig. 1).

B

FIG. 1. Three-dimensional structures of insecticidal toxins produced by Bacillus thuringiensis. A. Structure of Cry1Aa toxin showing three domains: domain I in blue and domains II and III in magenta. The loop regions involved in receptor interaction are on the apex of the structure. B. Structure of Cyt2A toxin.

Cry toxins are being used worldwide in transgenic plants for insect pest control. They are also used to control mosquitoes, the vectors of important human diseases (2, 3). The major threat to the use of Cry toxins is the appearance of insect resistance. The most frequent mechanism of resistance to Cry toxins is receptor-binding impairment (12). For Cry1A lepidopteran toxins, at least four different protein receptors have been characterized: a cadherin-like protein (CADP), a glycosylphosphatidyl-

Cry toxins bind to specific protein receptors in the microvilli of midgut epithelial cells (3), in contrast to Cyt toxins that do not bind to protein receptors but interact directly with membrane lipids, resulting in insertion into the membrane and pore formation (32), or in membrane destruction by detergent-like interaction (6).

* Corresponding author. Mailing address: Instituto de Biotecnología, Universidad Nacional Autónoma de México, 2001 Av. Universidad, Col. Chamilpa, Apdo. postal 510-3, Cuernavaca, Morelos, Mexico, 62250. Tel: 52 73 11-4900. Fax: 52 73 17-2388. Email: [email protected].



inositol (GPI)-anchored aminopeptidase N (APN), a GPIanchored alkaline phosphatase (ALP) and a 270-kDa glycoconjugate (23, 24, 29, 35, 36). In this review, we summarize the recent findings on receptor recognition and characterization, and discuss a possible general mechanism of Cry toxin interaction with the target cells of different susceptible organisms.

SFRGSAQGIEGS loop a 8

Receptor molecules associated with resistance to Cry toxins

RRPFNIGI

1. Cadherin receptor. A laboratory selected H. virescens Cry1Ac-resistant line YHD2 was shown to have a retrotransposon insertion mutation in the cadherinlike gene (13). The characterization of CADP alleles in field-derived and laboratory selected strains of the cotton pest Pectinophora gossypiella (pink bollworm) revealed three mutated CADP alleles associated with resistance in this lepidopteran insect (26). Cadherins represent a large family of glycoproteins that are responsible for intercellular contacts. These proteins are transmembrane proteins with a cytoplasmic domain and an extracellular ectodomain with several cadherin repeats (CR,12 in the case of the M. sexta CADP BtR1). In the case of Bt-R1, it was shown that the protein is located in the microvilli of midgut cells (8).

loop3

GFNSNSSVSI

loop2

HITDTNNK IPLPASILTV

TGVLTLNIQ

FIG. 2. Interaction of Cry1A toxins with cadherin receptors. The binding epitopes in the toxin and in the receptor are shown. Epitopes of loops α8 and 2 correspond to those mapped in M. sexta Bt-R1, while the loop 3 binding region is that found in the H. virescens cadherin. L1421 (depicted in red in one of the green binding epitopes) is the residue where single nucleotide changes led to the abolishment of Cry1Ac binding (36).

and mesodermal tissues of transgenic Drosophila melanogaster caused sensitivity to Cry1Ac toxin (14). Recently, it was reported that a laboratory-selected Spodoptera exigua resistant colony did not express APN1, suggesting that the lack of APN production correlated with resistance to Cry1C toxin (20).

The interaction of Cry1A toxins with the CADP receptor is a complex process. Three cadherin regions have been shown to interact with three domain II loop regions. The Cry1Ab loop 2 interacts with the CR 7 residues 865NITIHITDTNN875, while loops α-8 and loop 2 interact with the CR 11 residues 1331IPLPASILTVTV1342 (16, 17). A third Cry1A binding epitope was mapped to CR 12 of Bt-R1 (21). In the case of the Heliothis virescens cadherin, the CR 12 epitope was narrowed to residues 1423GVLTLNFQ1431 (37). It was shown that this epitope binds loop 3 of Cry1Ac domain II and that a single nucleotide change in this region results in loss of binding (38). Figure 2 shows the location of the binding epitopes of Cry1A toxins and CADP proteins.

With regard to the APN binding epitopes involved in Cry toxin interaction, a region of 63 residues (I135-P198) involved in Cry1Aa binding was identified in B. mori APN (28). Domain III residues of Cry1Aa 508STRLVN513 and 582 VFTLSAHV589 were shown to be involved in binding the I135-P198 APN fragment (1). Furthermore, the swapping of domain III between Cry1Ac and Cry1Ab toxins showed that Cry1Ac domain III was involved in APN recognition (9). The interaction of Cry1Ac domain III and APN is dependent on N-acetylgalactosamine (Gal-Nac) residues (5). Mutagenesis studies of Cry1Ac domain III identified residues 509QNR511, N506 and Y513 as the epitopes for sugar recognition (5). In the case of Lymantria dispar APN, the interaction of domain III to an N-acetyl galactosamine moiety of the receptor precedes the binding of loop regions of domain II (22).

2. Aminopeptidase N. APN are GPI-anchored exopeptidases. Sequence analysis of various APN from lepidopteran insects suggests that APN enzymes group into at least four classes (30). Inhibition of APN1 production on S. litura larvae by double-stranded RNA interference showed that insects with low APN levels became resistant to Cry1C toxin (33). Moreover, heterologous expression of M. sexta APN in midguts



3. Alkaline phosphatase. ALP is also a GPI-anchored enzyme. In M. sexta, it was shown that Cry1Ac binds to a 65-kDa ALP protein (25). Furthermore, resistance of H. virescens YHD2 larvae to Cry1Ac toxin correlated with reduced levels of 65-kDa ALP (23). As mentioned previously, the YHD2 colony has a mutation in the cadherin gene that is responsible for 40 to 80% of Cry1Ac resistance levels, while the absence of ALP accounts for the rest of the resistance phenotype of the colony (23).

membrane proteins (27). APN receptors in M. sexta and H. virescens, in contrast to CADP receptors, were shown to be located in lipid rafts (39). The interaction of pore-forming toxins with lipid rafts could result in additional cellular events, including toxin internalization, signal transduction and cellular response.

Multiple receptors involved in Cry toxins pore-formation Previously, we provided evidence that, in M. sexta, binding of monomeric Cry1A toxin to the CADP receptor promotes complete proteolytic activation of the toxin, facilitating the formation of a pre-pore oligomeric structure that can insert into membranes and is active in bioassays against M. sexta (15). The pre-pore oligomer inserts more efficiently into membrane vesicles than monomeric Cry1Ab, forming stable channels with high open probability (34), which suggests that the oligomer is required for proper toxin insertion into membranes (34). The pre-pore oligomer then binds to a second receptor, a GPI-anchored APN, leading to toxin insertion into membrane lipid rafts (4). Based on this scheme, we proposed a model that involves the sequential interaction of Cry1A toxin with CADP and APN in M. sexta (4).

4. Glycolipids. Using the nematode Caenorhabditis elegans as a model, genetic screening of resistance to Cry5B led to the identification of four genes, BRE2, BRE-3, BRE-4 and BRE-5 (18). BRE genes were shown to code for specific glycosyltransferases involved in the carbohydrate synthesis of a galactoserich 11-saccharide-linked lipid (19) (Fig. 3). This lipid is also found in insects and it was shown that M. sexta glycolipid bound to Cry1A toxins (19). Thus, it has been proposed that glycolipids are important Cry-receptor molecules in insects (19). Glc Man GlcNac

2

4 5 3

In this model the role of neither glycolipids nor ALP was considered. For other pore-forming toxins, low affinity interactions with abundant surface molecules precedes interaction a high affinity receptor. It was reported that Cry5B binding affinity to pure glycolipids displays a Kd around 750 nM, in contrast to 1 nM for Cry1A toxins binding to Bt-R1 (19, 35). Therefore, it is possible that binding of Cry toxins to glycolipids is the first step in the interaction of the toxins with their target membrane, followed by interaction with CADP receptors (Fig. 4). However, it cannot be excluded that Cry-glycolipid interaction may be important in the late stages of prepore membrane insertion (19).

GalNac Gal Fuc 2-O-MeFuc

FIG. 3. Structure of C. elegans glycolipid Cry-receptor. The arrows indicate the proposed steps catalyzed by the BRE glycosyltranferases gene products, 2 = BRE-2, 3 = BRE-3, 4 = BRE-4 and 5 = BRE-5.

It has been proposed that, in H. virescens, the ALP may play the role of the APN in M. sexta, and that it binds the pre-pore oligomeric structure and drives it into lipid rafts where pore-formation takes place (Jurat-Fuentes and Adang, personal communication). Alternatively, it may be possible that several GPI-receptors may be involved in the interaction of Cry toxins with lipid rafts. This would explain that the toxicity to M. sexta of Cry1Ac domain-III mutants that abolish binding to APN is barely affected (5) (Fig. 5).

Lipid rafts and membrane interaction of Cry toxins GPI-anchored proteins are proposed to be selectively located in lipid rafts that are spatially differentiated liquidordered microdomains in cell membranes (27). Lipid rafts are enriched in glycosphingolipids, cholesterol and GPI-anchored proteins and are thought to be involved in signal transduction, sorting and trafficking of plasma



Kd = 1 nM

APN = 120 kDa

Kd = 100 nM

?

Kd = 0.75 nM

?

Kd = 730 nM Bt-R1 = 210 kDa

FIG. 4. Proposed mode of action of Cry1A toxins in M. sexta. Cry1A toxins are solubilized and proteolitically activated to yield monomeric toxins. Monomers interact either with glycolipids first or with cadherin receptors. The interaction with cadherins (Kd = 1 nM in contrast to Kd = 100 nM of Cry monomer interaction with APN) promotes further cleavage of helix α-1 of the monomer and formation of a pre-pore structure. The pre-pore binds then to APN with enhanced affinity (Kd= 0.75 nM) and inserts afterwards in lipid rafts.

A

B

Cadherin

APN

Manduca sexta

ALP

Cadherin

Heliothis virescens

C

Multiple co-receptors ?

A 200 kDa, Aedes aegypti GPI-ALP Cadherin? FIG. 5. Comparison of the proposed mode of action of Cry toxins in M. sexta (A) and in H. virescens (B). Alternatively, several GPI-anchored co-receptors may be involved in the late stages of pre-pore oligomer insertion (C).

A

B 200 kDa, Cadherin?

GPI-ALP

Aedes aegypti

B

?

?

FIG. 6. Proposed mode of action of Cry11Aa in Aedes aegypti. A. Binding of Cry11Aa to a 200-kDa unidentified protein and subsequent interaction with a GPI-anchored alkaline phosphatase. B. Cyt1Aa is a membrane receptor of Cry11Aa. Cyt1Aa may be involved in the first interaction of Cry11Aa or in the late stages of membrane insertion of the pre-pore oligomer.

?

?



Receptor molecules and binding epitopes in mosquitoes

Concluding remarks The mode of action of Cry toxins is a multi-step process that involves the interaction of several receptor molecules leading to membrane insertion and cell lysis. The characterization of receptor molecules in other susceptible organisms will be important to fully understand the mode of action of Cry toxins. Moreover, the identification of receptor molecules and binding epitopes in the toxins and the receptors will help in the development of strategies to deal with insect resistance. This knowledge will be also critical for the development of novel toxins with novel specificities and for a better public perception of these safe toxins.

Bacillus thuringiensis subsp. israelensis (Bti) is a Bt strain used to control these disease vectors since it shows toxicity to dipteran insects (2). Bti produces crystal inclusions during sporulation that are composed principally of six toxins: Cry4Aa, Cry4Ba, Cry10Aa, Cry11Aa, Cyt1Aa and Cyt2Ba. In the case of Cry11Aa and Cry4Ba toxins, a bindingprotein of 65 kDa was identified in brush border membrane vesicles (BBMVs) from Aedes aegypti larvae (7). Data from our laboratory showed that this 65-kDa protein is a GPI-anchored ALP that binds Cry11Aa and is important for toxicity (11). Besides the GPI-ALP, a membrane-anchored 200-kDa protein was also found to bind Cry11Aa in ligand blot experiments (Fig. 6).

Acknowledgements Research of our groups was supported in part by DGAPA/UNAM IN207503-3, IN206503-3 and IX217404, CONACyT 36505-N, USDA 2002-35302-12539 and NIH 1R01 AI066014-01.

We identified specific regions in Cry11Aa toxin that are involved in the interaction with midgut microvilli membranes from A. aegypti (10). We isolated a peptidedisplaying phage (P5.tox ) that recognized the domain II loop α-8 region of Cry11Aa and inhibited the interaction of the toxin with its receptor. Finally, mutants in loop α-8 that impaired toxicity and receptor interaction were isolated (10).

References 1. Atsumi, S., E. Mizuno, H. Hara, K. Nakanishi, M. Kitami, N. Miura, H. Tabunoki, A. Watanabe, and R. Sato. 2005. Location of the Bombyx mori aminopeptidase N type I binding site on Bacillus thuringiensis Cry1Aa toxin. Appl. Environ. Microbiol. 71: 3966-3977. 2. Becker N. 2000. Bacterial control of vector-mosquitoes and black flies, p. 383-396. In J. F. Charles, A. Delécluse and C. NielsenLeRoux (ed.), Entomopathogenic Bacteria: from Laboratory to Field Application, Kluwer Academic Publishers, Dordrecht, The Netherlands. 3. Bravo, A., M. Soberón and S.S. Gill. 2005. Bacillus thuringiensis mechanisms and use, p. 175-206. In L. I. Gilbert, K. Iatrou, and S. S. Gill (ed.), Comprehensive Molecular Insect Science, Vol. 6, Elsevier, New York, NY, USA. 4. Bravo, A., I. Gómez, J. Conde, C. Muñoz-Garay, J. Sánchez, M. Zhuang, S. S. Gill, and M. Soberón. 2004. Oligomerization triggers differential binding of a pore-forming toxin to a different receptor leading to efficient interaction with membrane microdomains. Biochim. Biophys. Acta 1667: 38-46 5. Burton, S. L., D. J. Ellar, J. Li, and D. J. Derbyshire. 1999. Nacetylgalactosamine on the putative insect receptor aminopeptidase N is recognized by a site on the domain III lectin-like fold of a Bacillus thuringiensis insecticidal toxin. J. Mol. Biol. 287: 1011-22. 6. Butko, P., F. Huang, M. Pusztai-Carey, and W. K. Surewicz. 1997. Interaction of the delta-endotoxin CytA from Bacillus thuringiensis var. israelensis with lipid membranes. Biochem. 36: 12862-68. 7. Buzdin, A. A., L. P. Revina, L. I. Kostina, I. A. Zalunin, and G. G. Chestukhina. 2002. Interaction of 65- and 62-kD proteins from the apical membranes of the Aedes aegypti larvae midgut epithelium with Cry4B and Cry11A endotoxins of Bacillus thuringiensis. Biochem. (Moscow). 67: 540-546. 8. Chen, J., M. R. Brown, G. Hua, and M. J. Adang. 2005. Comparison of the localization of Bacillus thuringiensis Cr1A δ-endotoxins and their binding proteins in larval midgut of tobacco hornworm Manduca sexta. Cell Tissue Res. 321:123-129 9. de Maagd, R. A., P. Bakker, L. Masson, M. JAdang, S. Sangadala, W. Stiekema, and D. Bosch. 1999. Domain III of the Bacillus thuringiensis delta-endotoxin Cry1Ac is involved in binding to Manduca sexta brush border membranes and to its purified aminopeptidase N. Mol. Microbiol. 31: 463-471. 10. Fernández, L E., C. Pérez, L. Segovia, M. H. Rodríguez, S S. Gill, A. Bravo,, and M. Soberón. 2005. Cry11Aa toxin from Bacillus

Cyt1A is a membrane receptor of cry11Aa. Interestingly, no resistance in the field is observed for mosquito species controlled by Bti. The lack of resistance to Bti is due to the presence of the Cyt1Aa protein (37). Therefore, we explored the possibility that Cyt1Aa may function as a membrane-bound receptor of Cry11Aa. Our data shows that Cry11Aa binds membrane-bound Cyt1A and that this interaction enhances Cry11Aa insertion into the membrane. Furthermore, mapping the binding epitopes in both molecules revealed that Cry11Aa interacts with Cyt1A by means of the domain II loop regions involved in receptor interaction (31). Overall, this data points out that the interaction with Cyt1Aa may facilitate Cry11Aa toxin membrane insertion, suppressing resistance related to Cry receptor mutations. It is not known however whether Cyt1Aa interaction with Cry11Aa promotes the formation of oligomers or the insertion of the pre-pore oligomer in membrane lipid rafts. It is also possible that Cyt1Aa plays both roles. This is currently studied in our laboratory (Fig. 6).



thuringiensis binds its receptor in Aedes aegypti mosquito larvae trough loop α-8 of domain II. FEBS Lett. 579: 3508-3514. 11. Fernandez, L. E., K. G. Aimanova, S. S. Gill, A. Bravo, and M. Soberón. 2005. A GPI-anchored alkaline phosphatase is a functional midgut receptor of Cry11Aa toxin in Aedes aegypti larvae. Biochem. J. 394:77-84 12. Ferré, J., and J. van Rie. 2002. Biochemistry and genetics of insect resistance to Bacillus thuringiensis. Annu. Rev. Entomol. 47: 501-533. 13. Gahan, L. J., F. Gould, and D. G. Heckel. 2001. Identification of a gene associated with Bt resistance in Heliothis virescens. Science 293: 857-860. 14. Gill, M., and D. Ellar. 2002. Transgenic Drosophila reveals a functional in vivo receptor for the Bacillus thuringiensis toxin Cry1Ac1. Insect Mol. Biol. 11: 619-625. 15. Gómez, I., J. Sánchez, R. Miranda, A. Bravo, and M. Soberón. 2002. Cadherin-like receptor binding facilitates proteolytic cleavage of helix α-1 in domain I and oligomer pre-pore formation of Bacillus thuringiensis Cry1Ab toxin. FEBS Lett. 513: 242-246. 16. Gómez, I., J. Miranda-Rios, E. Rudiño-Piñera, D. I. Oltean, S. S. Gill, A. Bravo, and M. Soberón. 2002. Hydropathic complementarity determines interaction of epitope 869HITDTNNK876 in Manduca sexta Bt-R1 receptor with loop 2 of domain II of Bacillus thuringiensis Cry1A toxins. J. Biol. Chem. 277: 30137-30143. 17. Gómez, I., D. H. Dean, A. Bravo, and M. Soberón. 2003. Molecular basis for Bacillus thuringiensis Cry1Ab toxin specificity: Two structural determinants in the Manduca sexta Bt-R1 receptor interact with loops α-8 and 2 in domain II of Cy1Ab toxin. Biochem. 42: 10482-10489. 18. Griffitts, J. S., J. L. Whitacre, D. E. Stevens, and R. V. Aroian. 2001. Bacillus thuringiensis toxin resistance from loss of a putative carbohydrate-modifying enzyme. Science 293: 860-864. 19. Griffits, J. S., S. M. Haslam, T. Yang, S. F. Garczynski, B. Mulloy, H. Morris, P. S. Cremer, A. Dell, M. J. Adang, and R. V. Aroian. 2005. Glycolipids as receptors for Bacillus thuringiensis crystal toxin. Science 307: 922-925. 20. Herrero, S., T. Gechev, P. L. Bakker, W. J. Moar, and R. A. de Maagd. 2005. Bacillus thuringiensis Cry1Ca-resistant Spodoptera exigua lacks expression of one of four aminopeptidase N genes. BMC Genomics 6, 96. 21. Hua, G., J. L. Jurat-Fuentes, and M. J. Adang. 2004. Bt-R1a extracellular cadherin repeat 12 mediates Bacillus thuringiensis binding and cytotoxicity. J. Biol. Chem. 279: 28051-28056. 22. Jenkins, J. L., M. K. Lee, A. P. Valaitis, A. Curtiss, and D. H. Dean. 2000. Bivalent sequential binding model of a Bacillus thuringiensis toxin to gypsy moth aminopeptidase N receptor. J. Biol. Chem. 275: 14423-14431. 23. Jurat-Fuentes, J. L., and M. J. Adang. 2004. Characterization of a Cry1Ac-receptor alkaline phosphatase in susceptible and resistant Heliothis virescens larvae. Eur. J. Biochem. 271: 3127-3135. 24. Knight, P., N. Crickmore, and D. J. Ellar. 1994. The receptor for Bacillus thuringiensis CryIA(c) delta-endotoxin in the brush border membrane of the lepidopteran Manduca sexta is aminopeptidase N. Mol. Microbiol. 11: 429-436. 25. McNall, R. J., and M. J. Adang. 2003. Identification of novel Bacillus thuringiensis Cry1Ac binding proteins in Manduca sexta midgut through proteomic analysis. Insect Biochem. Mol. Biol. 33: 999-1010. 26. Morin, S., R. W. Biggs, M. S. Sisterson, L. Shriver, C. Ellers Kirk, D. Higginson, D. Holley, L. J. Gahan, D. G. Heckel, Y. Carrière, T. J. Dennehy, J. K. Brown, and B. E. Tabashnik. 2003. Three cadherin alleles associated with resistance to Bacillus thuringiensis in pink bollworm. Proc. Natl Acad. Sci. USA 100: 5004-5009. 27. Munro, S. 2003. Lipid rafts: elusive or illusive? Cell 115: 377388 28. Nakanishi K., K. Yaoi, Y. Nagino, H. Hara, M. Kitami, S. Atsumi, N. Miura, and R. Sato. 2002. Aminopeptidase N isoforms from the midgut of Bombyx mori and Plutella xylostella- their classification and the factors that determine their binding specificity to Bacillus thuringiensis Cry1A toxin. FEBS Lett. 519: 215-220. 29. Nagamatsu, Y., T. Koike, K. Sasaki, A. Yoshimoto, and Y. Furukawa. 1999. The cadherin-like protein is essential to specificity

determination and cytotoxic action of the Bacillus thuringiensis insecticidal. FEBS Lett. 460: 385-390. 30. Oltean, D. I., A. K. Pullikuth, H.-K. Lee, and S. S. Gill. 1999. Partial purification and characterization of Bacillus thuringiensis Cry1A toxin receptor A from Heliothis virescens and cloning of the corresponding cDNA. Appl. Environ. Microbiol. 65: 4760-4766. 31. Pérez, C., L. E. Fernandez, J. Sun, J. L. Folch, S. S. Gill, M. Soberón, and A. Bravo. 2006. Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as membrane-bound receptor. Proc. Natl Acad. Sc. USA 102:1830318308 32. Promdonkoy, B., and D. J. Ellar. 2003. Investigation of the pore forming mechanism of a Cytolitic δ-endotoxin from Bacillus thuringiensis. Biochem. J. 374: 255-259. 33. Rajagopal, R., S. Sivakumar, N. Agrawal, P. Malhotra, and R. K. Bhatnagar. 2002. Silencing of midgut aminopeptidase N of Spodoptera litura by double-stranded RNA establishes its role as Bacillus thuringiensis toxin receptor. J. Biol. Chem. 277: 4684946851. 34. Rausell, C., C. Muñoz-Garay, R. Miranda-CassoLuengo, I. Gómez, E. Rudiño-Piñera, M. Soberón, and A. Bravo. 2004. Tryptophan spectroscopy studies and black lipid bilayer analysis indicate that the oligomeric structure of Cry1Ab toxin from Bacillus thuringiensis is the membrane-insertion intermediate. Biochem. 43:166-174. 35. Vadlamudi, R. K., E. Weber, I. H. Ji, T. H. Ji, and L. A. Jr Bulla. 1995. Cloning and expression of a receptor for an insecticidal toxin of Bacillus thuringiensis. J. Biol. Chem. 270: 5490-5494. 36. Valaitis, A. P., J. L. Jenkins, M. K. Lee, D. H. Dean, and K. J. Garner. 2001. Isolation and partial characterization of Gypsy moth BTR-270 an anionic brush border membrane glycoconjugate that binds Bacillus thuringiensis Cry1A toxins with high affinity. Arch. Insect Biochem. Physiol. 46: 186-200. 37. Wirth M. C., G. P. Georghiou, and B. A. Federeci. 1997. CytA enables CryIV endotoxins of Bacillus thuringiensis to overcome high levels of CryIV resistance in the mosquito, Culex quinquefasciatus. Proc. Natl Acad. Sci. USA 94: 10536-10540 38. Xie, R., M. Zhuang, L. S. Ross, I. Gómez, D. I. Oltean, A. Bravo, M. Soberón, and S. S. Gill. 2005. Single amino acid mutations in the cadherin receptor from Heliothis virescens affect its toxin binding ability to Cry1A toxins. J. Biol. Chem. 280: 8416-8425. 39. Zhuang, M., D.I. Oltean, I. Gómez, A.K. Pullikuth, M. Soberón, A. Bravo, and S. S. Gill. 2002. Heliothis virescens and Manduca sexta lipid rafts are involved in Cry1A toxin binding to the midgut epithelium and subsequent pore formation. J. Biol. Chem. 277: 13863-13872.



6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact, Victoria BC, 2005 Côté, J.-C., Otvos, I.S, Schwartz, J.-L. and Vincent, C. (eds)

Oligomer Formation of Different Cry Toxins Indicates that a Pre-Pore is an Essential Intermediate in the Mode of Action of the Three-Domain Cry Family Liliana Pardo, Isabel Gómez, Carlos Muñoz-Garay, Nuria Jimenez-Juaréz, Jorge Sánchez, Claudia Pérez, Mario Soberón, and Alexandra Bravo* Instituto de Biotecnología, Universidad Nacional Autónoma de México, Cuernavaca, Morelos, Mexico, 62250

We analyzed in vitro formation of Cry1Ab pre-pore oligomers. Our data suggests that a metalloprotease is involved in the cleavage of helix α-1 leading to oligomerization. Optimal oligomer formation was achieved by incubation of Cry1Ab crystals with a monoclonal antibody that mimics a cadherin epitope in a 1:4 ratio at pH 10.5 and in the presence of 5% M. sexta midgut juice. Oligomer formation with a high level of pore formation activity was obtained with different Cry1 and Cry3 toxins and with Cry11A toxins. Our data shows that pre-pore formation is a general step required for efficient membrane insertion of three-domain Bt toxins.

B. thuringiensis (Bt) produces parasporal crystalline inclusions that contain proteins (δ-endotoxins) toxic to a broad range of insect species and other invertebrates (1). The molecular mechanism that mediates the insecticidal activity of these toxins is still being elucidated. Basically, it has been described as a multi-step process, which begins upon ingestion of the parasporal inclusions by the susceptible larvae. Specific pH and proteases in the insect gut favor solubilization and proteolytic cleavage of the inclusions. The activated toxins bind to specific receptors on the insect midgut brush border membrane (1). Following binding, at least part of the toxin inserts into the membrane, resulting in pore formation (1). It has been proposed that oligomer formation is a necessary step for pore formation. The oligomeric structure is responsible for the formation of lytic pores (1) followed by cell lysis and insect death. Bt Cry1A toxins bind to two receptors, an aminopeptidase N (APN) protein and a cadherin-like protein (1). We showed that toxin binding depends on the toxin oligomeric sate. The monomeric toxin binds to the cadherin which induces proteolytic processing and oligomerization of the toxin (Fig. 1), while the oligomeric structure binds to the APN which drives the toxin into detergent-resistant membrane microdomains, resulting in pore formation (2, 3). The conformational changes from monomeric to a pre-pore oligomeric form lead to a structure that permits membrane insertion. Our data show that the oligomer, in contrast to the monomer, is able to interact efficiently with phospholipid membranes and to form stable pores (5).

Cadherin receptor interaction catalyses two structural events :

1.- Cleavage of helix a -1 then hydrophobic residues are exposed

2.-Oligomerization of four monomers

Oligomer is insertion competent

FIG. 1. Cry1A binding to cadherin receptor.

Oligomer formation in vitro We have previously characterized a scFv antibody (scFv73) that inhibits binding of Cry1A toxins to the cadherin receptor, but not to the APN, and that reduces Cry1Ab toxicity to M. sexta larvae (3). Using scFv73 as a surrogate of the cadherin receptor, we demonstrated that binding of Cry1Ab to scFv73 facilitated proteolytic cleavage of helix α-1 of domain I and formation of a 250-kDa tetrameric pre-pore (3). Such oligomer was also formed when the Cry1Ab protoxin was incubated with midgut juice in the presence of M. sexta brush border membrane vesicles (BBMVs) containing native receptor molecules (3). To determine the optimal conditions leading to oligomer formation in vitro, we analyzed this process using a Cry1Ab protoxin and scFv73 mixture (1:4 ratio) incubated in the presence of 5% M. sexta midgut juice and revealed by SDS-PAGE electrophoresis and Western blot using an anti-Cry1Ab polyclonal antibody. Figure 2 shows that increasing amounts of 250-kDa oligomers were found when the

* Corresponding author. Mailing address : Instituto de Biotecnología, Universidad Nacional Autónoma de México, 2001 Av. Universidad, Col. Chamilpa, Apdo. postal 510-3, Cuernavaca, Morelos, Mexico, 62250. Tel: 52 73 11-4900. Fax: 52 73 17-2388. Email : [email protected] mx.



FIG. 2. Activation of Cry1Ab protoxin with M. sexta midgut juice in the presence of scFv73 antibody that mimics that of a cadherin receptor.

amount of Cry1Ab protein was increased. Additionally, we determined the effect of pH, of different Cry1Ab: scFv73 ratios and of different concentrations of midgut juice on oligomer formation. The optimal conditions for in vitro production of oligomer were found to be pH 10.5, 5% midgut juice and a Cry1Ab protoxin/scFv73 ratio of 1:4 at 37oC.

Previous work demonstrated that activated Cry3 toxins (Cry3A, Cry3B and Cry3C) produced oligomers in vitro in the presence of coleopteran BBMVs (5). The oligomeric form of Cry3 toxins showed high pore formation activity in contrast to monomeric toxins (5). Furthermore, we investigated the possibility for the mosquitocidal Cry11Aa toxin to form oligomers in the presence of Aedes aegypti BBMVs or in the presence of Cyt1Aa, which was recently shown to be a functional Cry11Aa receptor (4). Cry11Aa oligomers were produced when the protoxin was activated with either trypsin or M. sexta midgut juice and in the presence of either A. aegypti BBMVs or Cyt1Aa toxin.

A metalloprotease is involved in oligomer formation To characterize the protease involved in the cleavage of helix α-1 and the formation of the oligomer, in vitro oligomer formation was performed in the presence of protease inhibitors: cysteine proteases (E64), serine proteases (PMSF), aspartic proteases (pepstatin), elastase-like serine proteases (elastinal) and metalloproteases (EDTA). The only protease inhibitor that inhibited oligomer formation was EDTA, suggesting that a metalloprotease is involved in helix α-1 cleavage and in oligomer formation.

These results suggest that pre-pore oligomer formation is a general step of three-domain Bt toxins and that it is necessary for efficient membrane insertion.

Acknowledgments This research was supported in part by DGAPA/UNAM IN207503-3, IN206503-3 and IX217404, CONACyT 36505-N, USDA 2002-35302-12539 and NIH 1R01 AI066014-01.

Different members of the 3D Cry family form pre-pore oligomers To determine if the pre-pore structure is a general step taking place in the mode of action of three-domain Bt toxins, we analyzed the oligomer formation of different Cry toxins. In the case of Cry1 toxins, Cry1Aa, Cry1Ca, Cry1Da, Cry1Ea, Cry1Fa and Cry1Ga protoxins were proteolytically activated by midgut juice in the presence of M. sexta BBMVs. Except for Cry1Ga toxin, all these toxins are toxic to M. sexta larvae. Analysis of oligomer formation revealed that Cry1Ga did not form oligomers, in contrast to the other Cry1 toxins that produced oligomers in the presence of M. sexta BBMVs. Pore formation assays revealed that high level of pore formation activity correlated with oligomer formation.

References 1. Bravo, A., M. Soberón and S.S. Gill. 2005. Bacillus thuringiensis mechanisms and use, p. 175-206. In L. I. Gilbert, K. Iatrou, and S. S. Gill (ed.), Comprehensive Molecular Insect Science, Vol. 6, Elsevier, New York, NY, USA. 2. Bravo, A., I. Gómez, J. Conde, C. Muñoz-Garay, J. Sánchez, M. Zhuang, S. S. Gill, and M. Soberón. 2004. Oligomerization triggers differential binding of a pore-forming toxin to a different receptor leading to efficient interaction with membrane microdomains. Biochem. Biophys. Acta 1667:38-46 3. Gómez, I., J. Sánchez, R. Miranda, A. Bravo, and M. Soberón. 2002. Cadherin-like receptor binding facilitates proteolytic cleavage of helix α-1 in domain I and oligomer prepore formation of Bacillus thuringiensis Cry1Ab toxin. FEBS Lett. 513:242-246. 4. Pérez, C., L. E. Fernandez, J. Sun, J. L. Folch, S. S. Gill, M. Soberón, and A. Bravo. 2006. Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as membrane-bound receptor. Proc. Natl Acad. Sc. USA 102:18303-18308 5. Raussel, C., I. Garcia-Robles, J. Sánchez, C. Muñoz-Garay, A. C. Martinez-Ramirez, M. D. Real, and A. Bravo. 2004. Role of toxin activation on binding and pore formation activity of the Bacillus thuringiensis Cry3 toxins in membranes of Leptinotarsa decemlineata (Say) Biochim. Biophys. Acta 1660:99-105.



6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact, Victoria BC, 2005 Côté, J.-C., Otvos, I.S, Schwartz, J.-L. and Vincent, C. (eds)

Cyt1Aa from Bacillus thuringiensis subsp. israelensis Synergizes Cry11Aa Toxin Activity by Functioning as a Membrane-Bound Receptor Claudia Pérez1, Luisa E. Fernandez1, Jianguang Sun1, Jorge Luis Folch2, Sarjeet S. Gill3, Mario Soberón1, and Alejandra Bravo1* Instituto de Biotecnología. UNAM. Ap. 510-3, Cuernavaca 62250, Mor. Mexico, 2CEIB, UAEM., Av. Universidad 1001, Cuernavaca 62210, Mor., Mexico, 3Dept. of Cell Biology and Neuroscience, UC, Riverside, CA 92506, U.S.A. 1

Keywords: Bacillus thuringiensis israelensis (Bti), synergism, Cry toxin, Cyt toxin, Aedes aegypti, protein-protein interaction, bioassays, binding affinity.

The synergism between Cry11Aa and Cyt1Aa, two Bacillus thuringiensis subsp. israelensis (Bti) toxins, is an interesting molecular event with regard to the mode of action of Bti proteins. In this work, we demonstrate the in vitro interaction between these toxins and provide evidence that Cyt1Aa enhances the binding of Cry11Aa to brush border membrane vesicles of Aedes aegypti larvae. We mapped the Cyt1Aa and Cry11Aa binding epitopes involved in their interaction and identified, using site-directed mutagenesis, key residues that affect binding interaction and synergism in vivo. This data strongly indicates that the Cyt1Aa-Cry11Aa interaction is the determinant of synergism between the two toxins and that Cyt1Aa may function as a Cry11Aa receptor in the mosquito midgut. Bacillus thuringiensis (Bt) is an ubiquitous Grampositive, spore-forming bacterium that produces parasporal crystals with insecticidal activity against different insect orders such as Lepidoptera, Diptera and Coleoptera (1). Bioinsecticides manufactured with Bt spores and crystals are a useful alternative to synthetic chemical pesticide in agriculture and for mosquito control. Moreover, Bt is also a source of genes for transgenic expression in plants to protect them against pests (7). One of the most important species of Bt is Bt subsp. israelensis (Bti) that produces a parasporal crystal containing Cry4Aa, Cry4Ba, Cry10Aa, Cry11Aa, Cyt1Aa and Cyt2Ba proteins (6). Since 1980, it was demonstrated that Cry and Cyt toxins from Bti are not only individually toxic, but act also synergically when used in combination (2, 3, 10). Moreover, in Culex quinquefasciatus larvae, Cyt toxins are able to overcome resistance to Cry toxins. It was proposed that the lack of resistance to Bti in the field was actually due to the presence of Cyt proteins in the crystal (5, 9).

To probe this hypothesis, we decided to work with two of the most abundant protein produced by Bti, i.e., Cry11Aa and Cyt1Aa, which show synergic activity against Aedes aegypti larvae. To evaluate the pattern of binding of these two toxins, we performed a sequential binding assay. In this assay, the binding of biotinylated Cry11Aa to BBMVs pre-incubated or not with unlabelled Cyt1Aa was analyzed. We found that the presence of Cyt1Aa increased the binding of Cry11Aa to A. aegypti BBMVs, contrary to BBMVs of M. sexta, for which no binding of biotinylated Cry11Aa was observed, even in the presence of Cyt1Aa. Homologous competition of biotinylated Cry11Aa in the presence of increased concentrations of unlabelled Cry11Aa showed that the interaction was specific. In fact, we found that higher concentrations of unlabelled Cry11Aa were needed to displace labeled Cry11Aa with Cyt1Aa, suggesting a higher number of binding sites. We concluded that the binding of biotinylated Cry11Aa in BBMVs containing Cyt1Aa was saturable and specific.

The molecular mechanism responsible for the interaction between Cyt and Cry toxins is not known. We propose that after solubilization and activation of these proteins in mosquito midguts, Cyt toxins insert into the membrane and expose specific regions that interact with some Cry toxins. Our hypothesis is that Cyt toxins function as membrane bound receptors of these particular Cry proteins

To demonstrate further the interaction between Cry11Aa and Cyt1Aa, we performed three assays: ELISA, ligand blot and co-immunoprecipitation. We showed that Cry11Aa bound to Cyt1Aa in solution and to membraneinserted Cyt1Aa. This interaction was specific, since Cry1Ab and Cry3A toxins did not interact with Cyt1Aa.

* Corresponding author. Mailing address : Instituto de Biotecnología, Universidad Nacional Autónoma de México, 2001 Av. Universidad, Col. Chamilpa, Apdo. postal 510-3, Cuernavaca, Morelos, Mexico, 62250. Tel: 52 73 11-4900. Fax: 52 73 17-2388. Email : [email protected] mx.



TABLE 1. Synergism and binding affinities of mixtures of Cry11Aa and Cyt1Aa proteins at 1:0.2 ratio.

Toxin combination

LC50 (ng/ml) predicted

LC50 (ng/ml) experimental

SFa

Kdb

Cry11Aawt :Cyt1Aawt

227.3

12.1 (0.4-30.8)c

18.7

0.4

Cry11Aawt:Cyt1Aa-K198A

227.7

5.7 (0.3-14.2)

40.0

0.3

Cry11Aawt:Cyt1Aa-E204A

202.6

25.8 (11.4- 42.0)

7.9

1.5

Cry11Aawt:Cyt1Aa-K225A

222.5

66.4 (42.3-111.4)

3.4

4.0

Cry11Aa-E266A :Cyt1Aawt

650.3

286.0 (164.9-521.7)

2.3

1.2

Cry11Aa-S259A :Cyt1Aawt

179.4

70.9 (35.6-119.6)

6.6

4.0

Cry11Aa-S259A :Cyt1Aa-K225A

176.5

445.9 (375.9- 515.9)

0.4

30.0

Synergism factor (Predicted LC50/Experimental LC50) Apparent dissociation constant obtained from ELISA competition assays c 95% fiducial limits a b

In order to identify the specific region of Cry11Aa that interacts with Cyt1Aa, we performed competitive binding assays (by ELISA and ligand blot) using synthetic peptides corresponding to different exposed regions of domain II of Cry11Aa (4). These experiments demonstrated that loop-α8, loop-2 and β4 synthetic peptides inhibited the interaction between fixed Cyt1Aa and soluble Cry11Aa toxins.

Finally we introduced mutations in the identified regions of Cry11Aa and Cyt1Aa by site-directed mutagenesis. The mutants were tested in bioassays against 4th instar A. aegypti larvae. Cyt1Aa mutants in the β6-αE and β7 regions were toxic and bound normally to BBMVs. For Cry11Aa, we used the loop-α8 mutants previously reported (4), since it was shown that this loop is important for the interaction between Cry11Aa and its natural receptor in A. aegypti BBMVs, and that a loopα8 synthetic peptide inhibited the interaction between Cry11Aa and Cyt1Aa. While the Cry11Aa-S259A mutant displayed wild-type activity, toxicity and binding of the Cry11Aa-E266A protein was altered (4).

To identify the region of Cyt1Aa that interacts with Cry11Aa, we used the yeast two-hybrid system. A domain II and III region of Cry11Aa was cloned in a bait plasmid pHybLex/Zeo and different fragments of Cyt1Aa were cloned in a prey plasmid pYESTrp2. Both plasmids were co-transformed in a yeast strain auxotroph for histidine and tryptophan. Cry-Cyt proteinprotein interaction was monitored by the reporter genes his3 and lacZ. It was shown that the domain II and III region of Cry11Aa interacted with the F2 and F6 fragments of Cyt1Aa, which correspond to the region from αC to β7.

In vivo synergism was evaluated using the Tabashnik equation (8). The synergy factors (SF) of the different combinations of wild-type and mutant proteins are shown in Table 1. All mutant toxins showed a decrease in SF compared with the wild-type proteins, except for the mutant Cyt1Aa-K198A that showed an SF increase. The decrease in synergism correlated with decreased binding (Table 1). In fact, the Kd of the mutants with reduced synergism were larger than that of the wildtype proteins.

To narrow down the identification of the interaction sites, we analyzed the binding of biotinylated Cry11Aa to 30 overlapping peptides of the Cyt1Aa αC-β7 region immobilized in nitrocellulose membranes. Two regions were identified: P1 and P2. Competitive binding assays (by ELISA and ligand blot) using synthetic peptides that corresponded to P1 and P2 established that the β6-αE region (P1) and β7 region (P2) of Cyt1Aa inhibited the interaction between Cry11Aa and Cyt1Aa toxins.

Therefore, our data support the fact that Cry11Aa uses similar regions for the interaction with its natural receptor on A. aegypti BBMVs and with Cyt1Aa, which implies that Cyt1Aa toxin acts as a receptor of Cry11Aa toxin.

10

References 1. Beegle, C. C., and T. Yamamoto. 1992. History of Bacillus thuringiensis berliner research and development. Can. Entomol. 124:587-616. 2. Chang, C., Y. M. Yu, S. M. Dai, S. K. Law, and S. S. Gill. 1993. High-level cryIVD and cytA gene expression in Bacillus thuringiensis does not require the 20-kDa protein, and the coexpressed gene products are synergistic in their toxicity to mosquitoes. Appl. Environ. Microbiol. 59:815-821. 3. Chilcott, C. N., and D. J. Ellar. 1988. Comparative toxicity of Bacillus thuringiensis var. israelensis crystal proteins in vivo and in vitro. J. Gen. Microbiol. 134:2551-2558. 4. Fernández, L. E., C. Pérez, L. Segovia, M. H. Rodríguez, S. S. Gill, A. Bravo, and M. Soberón. 2005. Cry11Aa toxin from Bacillus thuringiensis binds its receptor in Aedes aegypti mosquito larvae through loop alpha-8 of domain II. FEBS Lett. 579:3508–3514. 5. Georghiou G. P., and M. C. Wirth. 1997. Influence of exposure to single versus multiple toxins of Bacillus thuringiensis subsp. israelensis on development of resistance in the mosquito Culex quinquefasciatus (Diptera: Culicidae). Appl. Environ. Microbiol. 63:1095-1101. 6. Guillet, P., D. C. Kurstack, B. Philippon, and R. Meyer. 1991. Use of Bacillus thuringiensis israelensis for onchocerciasis control in West Africa, p. 187-190. In H. de Barjac, and D. J. Sutherland (ed.), Bacterial control of mosquitoes and blackflies: Biochemistry, Genetics & Applications of Bacillus thuringiensis israelensis and Bacillus sphaericus, Rutgers University Press, Piscataway, NJ, USA 7. Schnepf E., N. Crickmore, J. Van Rie, D. Lereclus, J. Baum, J. Feitelson, D. R. Zeigler, and D. H. Dean. 1998. Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol. Mol. Biol. Rev. 62: 775–806. 8. Tabashnik, B. E. Evaluation of synergism among Bacillus thuringiensis toxins. 1992. Appl. Environ. Microbiol. 58:3343-3346. 9. Wirth, M. C., H. W. Park, W. E. Walton, and B. A. Federici. 2005. Cyt1A of Bacillus thuringiensis delays evolution of resistance to Cry11A in the mosquito Culex quinquefasciatus. Appl. Environ. Microbiol. 71:185-189. 10. Wu, D., J. J. Johnson, and B. A. Federici. 1994. Synergism of mosquitocidal toxicity between CytA and CryIVD proteins using inclusions produced from cloned genes of Bacillus thuringiensis. Mol. Microbiol. 13: 965-972.

11

6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact, Victoria BC, 2005 Côté, J.-C., Otvos, I.S., Schwartz, J.-L. and Vincent, C. (eds)

Identification of scFv Molecules that Recognize Loop 3 of Domain II and Domain III of Cry1Ab Toxin from Bacillus thuringiensis Isabel Gómez1, Juan Miranda-Ríos1, Iván Arenas1, Ricardo Grande2, Baltazar Becerril3, Alejandra Bravo1, and Mario Soberón1* Instituto de Biotecnología, 1Depto. de Microbiología Molecular, Universidad ����������������������������������������� Nacional Autónoma de México, Cuernavaca, Morelos, Mexico, 62250.� 2Depto. de Ing. Celular y Biocatálisis, ������������������������������ Universidad Nacional Autónoma de México, Cuernavaca, Morelos, Mexico, 62250.� 3Depto. de Medicina Molecular y Bioprocesos. ������������ Universidad Nacional Autónoma de México, Cuernavaca, Morelos, Mexico, 62250.

A phage repertoire was constructed using antibody genes from the bone marrow and the spleen of a rabbit immunized with Cry1Ab toxin. Biopanning against either the Cry1Ab toxin or a domain II loop 3 synthetic peptide resulted in the identification of monoclonal antibodies in scFv format. They inhibited binding and toxicity of Cry1Ab toxin against Manduca sexta. Toxin overlay assays, using the scFv antibodies as competitors, revealed that the anti-loop 3 molecule competed with Cry1Ab toxin binding to the cadherin receptor (Bt-R1) of M. sexta, while anti-domain III antibodies interfered with the binding of Cry1Ab toxin to the aminopeptidase N (APN) receptor of this insect. on large TYE AMP GLU agar plates. For panning, phage preparations were purified and concentrated by polyethylene glycol precipitation.

Introduction Insecticidal Cry1 proteins from Bacillus thuringiensis (Bt) are used in biopesticides and transgenic crops (2). In susceptible insects, proteinases in the alkaline midgut activate the Cry protein to a toxin that binds with high affinity to receptors of the brush border epithelium membrane. In the case of the cadherin receptor Bt-R1, toxin binding initiates a conformational change that results in the assembly of a pre-pore toxin oligomer (5). Aminopeptidases also bind Cry1 toxins and facilitate toxin-induced pore formation (8). An emerging model suggests that after binding cadherins, toxins bind aminopeptidases and insert into membrane microdomains called lipid rafts (3). Domain II determines specificity, because it represents the most divergent part of the toxin sequence, and exchanging domain II, or domains II and III, between closely related toxins resulted in active hybrids showing altered specificity (4,6).

Selection and characterization of phage-displayed antibodies. Panning was carried out essentially as described previously (7) using 50 µg of Cry1Ab. 1011 phage were used in each round of selection. Binders were eluted with 1 ml of triethylamine (100 mM) and the eluant was neutralized and mixed with 8.5 ml of exponentially growing TG-1 cells. An aliquot was removed for titration, measured as colony forming units on agar plates. Infected bacteria were plated on TYE AMP GLU agar plates and bacteria were harvested after ON growth at 37°C. Phages were rescued for the next selection cycle. Insect bioassay. Bioassays were performed on M. sexta neonate larvae by the surface contamination method. The toxin solution was preincubated with selected phages for 1 h then poured on the diet surface and allowed to dry. Neonate M. sexta larvae were placed on the dried surface and mortality was monitored after 7 days.

Materials and methods Phage display libraries construction. Total RNA from spleen tissue and bone marrow of an immunized rabbit was used for first strand cDNA synthesis. Heavyand light-chain genes were amplified separately and recombined by three subsequent PCR, essentially as described (7). In order to construct the scFv libraries, scFv DNA and phagemid vector were digested with SfiI and NotI (New England BioLabs, Beverly, MA, USA), and ligated. The purified DNA was electroporated into TG1 electrocompetent cells. Each library was grown

Results Phage antibody library construction and characterization. After cDNA synthesis by reverse transcription from spleen and bone marrow RNA samples, the VH and VL region gene repertoires were amplified separately by PCR. In the second PCR reaction, a DNA linker coding a (Gly4Ser)3 peptide linker sequence was added using

* Corresponding auhtor. Mailing address: Instituto de Biotecnología, Universidad Nacional Autónoma de México, 2001 Av. Universidad, Col. Chamilpa, Apdo. postal 510-3, Cuernavaca, Morelos, Mexico, 62250. Tel: 52 73 11-4900. Fax: 52 73 17-2388. Email: [email protected].

12

modified 3´-heavy and 5´-light chains primers. Finally, a third PCR reaction was performed to fuse heavy and light chain genes by overlapping extension. PCR products from the third PCR reaction were digested with SfiI and NotI, and cloned into phagemid vectors pSyn2 or pCANTAB that allow the display of the cloned fragment on M13 phage. After transformation, libraries sizes of 2.0 x 106 members were obtained.

None of the phages were toxic to M. sexta larvae. All of the anti-loop 3 phages reduced the toxicity of Cry1Ab to 30-60% while the two anti-domain III phages reduced it to 10-20%.

Discussion The striking dissimilarity between domain II and domain III amino acid sequences of different Cry toxins motivated us to investigate the role of these regions in insect specificity, toxicity and binding using phage display antibodies against these regions. We generated immune libraries in the scFv format that could be used for efficient selection of high-affinity and specific scFv antibodies against Cry1Ab toxin. We identified scFv phages that recognized domain II loop 3 or domain III, since these regions are likely to be involved in receptor interaction (1, 6).

To examine the integrity of the libraries, 20 clones of each library were picked at random and 95% of the clones were found by PCR to contain scFv genes having the expected size. To determine the diversity of the gene content of the libraries, cloned scFv genes were amplified from the same colonies and digested with the AluI restriction enzyme. PCR fingerprinting analysis of bone marrow and spleen libraries showed that the libraries were diverse since all restriction patterns analyzed were different.

Rabbit immune repertoires from spleen or bone marrow yielded a great diversity. Using phage display technology, after three or four rounds of panning using Cry1Ab toxin, we isolated specific scFv antibodies from the pool of the two libraries, that inhibited toxicity. Among these, antibody M22 was particularly interesting. M22, in contrast to the other anti-Cry1Ab scFv molecules analyzed, recognized Cry1Ab but did not bind to Cry1Ac. Therefore, scFv M22 most likely recognized a certain domain III region involved in toxicity, since this antibody reduced the toxicity of Cry1Ab toxin. In the case of Cry1Ac toxin, domain III is important on APN binding (4). We were able also to obtain five specific scFv antibodies against loop 3 of domain II. All anti-loop 3 scFv molecules analyzed recognized Cry1Ab but did not bind to Cry1Aa, consistent with the fact that these toxins do not share sequence similarity in the loop 3 region. Our results show the efficacy of our libraries for the generation of highly specific reagents against specific regions of Cry toxins to study toxin-receptor interaction. Our set of recombinant scFv antibodies against Cry1Ab toxin represents the first demonstration of the recombinant-antibody approach to the study of toxin-receptor and structure-function relations. With these tools it should be possible now to characterize more thoroughly the toxin-receptor interactions of Cry proteins and to ascertain the role of these interactions in the mode of action of these important toxins.

Identification of anti-loop 3 and anti-domain III phage antibodies. For the identification of anti-loop 3 scFv antibodies, the libraries were panned against a synthetic biotinylated peptide with a sequence corresponding to the Cry1Ab loop 3. The panning procedure consisted in two selection rounds against the whole Cry1Ab toxin and a third panning round against the biotinylated loop 3 synthetic peptide. Fingerprinting analysis revealed five different restriction patterns. In ELISA, all clones bound to Cry1Ab and Cry1Ac, but did not bind to Cry1Aa which has a different loop 3 amino acid sequence, suggesting that these scFv bind loop 3 of Cry1Ab. After two rounds of panning against Cry1Ab, a final panning round was conducted against Cry1Ab in the presence of soluble Cry1Ac to ensure binding to Cry1Ab toxin of phages that do not recognize Cry1Ac. Fifty colonies from the fourth round were amplified by PCR and characterized by fingerprinting analysis. Five different restriction patterns were identified. Analysis of binding to the three Cry1A proteins revealed that three scFv phages bound to Cry1Ab, but not to Cry1Ac which has a different domain III sequence, suggesting that these scFv antibodies bind Cry1Ab toxin through domain III. Effect of phage antibodies on toxicity of Cry1Ab toxin to M. sexta larvae. First instar larvae were fed Cry1Ab toxin either alone or Cry1Ab pre-incubated with 108 phage preparation of the different monoclonal scFv antibodies selected after four rounds of selection. 13

Acknowledgments The authors are indebted to Dr. H. Hawlisch for valuable advice. We thank Jorge Sánchez, Oswaldo López and Lizbeth Cabrera for technical assistance, and Elizabeth Mata and Sergio González for veterinary services. This work was supported by CONACyT contract no. G36505-N, DGAPA-UNAM IN206200 and IN216300, UC MEXUSCONACYT, and the United States Department of Agriculture, USDA 2002-3502-1239. References 1. Atsumi, S., E. Mizuno, H. Hara, K. Nakanishi, M. Kitami, N. Miura, H. Tabunoki, A. Watanabe, and R. Sato. 2005. Location of the Bombyx mori aminopeptidase N type I binding site on Bacillus thuringiensis Cry1Aa toxin. Appl. Environ. Microbiol. 71:3966-3977. 2. Bravo, A., M. Soberón and S.S. Gill. 2005. Bacillus thuringiensis mechanisms and use, p. 175-206. In L. I. Gilbert, K. Iatrou, and S. S. Gill (ed.), Comprehensive Molecular Insect Science, Vol. 6, Elsevier, New York, NY, USA. 3. Bravo, A., I. Gómez, J. Conde, C. Muñoz-Garay, J. Sánchez, M. Zhuang, S. S Gill, and M. Soberón. 2004. Oligomerization triggers differential binding of a pore-forming toxin to a different receptor leading to efficient interaction with membrane microdomains. Biochim. Biophys. Acta 1667:38-46. 4. de Maagd, R. A., P. Bakker, L. Masson, M. J. Adang, S. Sangadala, W. Stiekema, and D. Bosch. 1999. Domain III of the Bacillus thuringiensis delta-endotoxin Cry1Ac is involved in binding to Manduca sexta brush border membranes and to its purified aminopeptidase N. Mol. Microbiol. 31:463-471. 5. Gómez, I., J. Sánchez, R. Miranda, A. Bravo, and M. Soberón. 2002. Cadherin-like receptor binding facilitates proteolytic cleavage of helix α-1 in domain I and oligomer pre-pore formation of Bacillus thuringiensis Cry1Ab toxin. FEBS Lett. 513:242-246. 6. Gómez, I., J. Miranda-Rios, E. Rudiño-Piñera, D. I. Oltean, S. S. Gill, A. Bravo, and M. Soberón. 2002. Hydropathic complementarity determines interaction of epitope 869HITDTNNK876 in Manduca sexta Bt-R1 receptor with loop 2 of domain II of Bacillus thuringiensis Cry1A toxins. J. Biol. Chem. 277:30137-30143. 7. Hawlisch, H., A. Meyer zu Vilsendorf, W. Bautsch, A. Klos, and J. Kohl. 2000. Guinea pig C3 specific rabbit single chain Fv antibodies from bone marrow, spleen and blood derived phage libraries. J. Immunol. Methods 236:117-31. 8. Zhuang, M., D.I. Oltean, I. Gómez, A.K. Pullikuth, M. Soberón, A. Bravo, and S. S. Gill. 2002. Heliothis virescens and Manduca sexta lipid rafts are involved in Cry1A toxin binding to the midgut epithelium and subsequent pore formation. J. Biol. Chem. 277:13863-13872.

14

6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact, Victoria BC, 2005 Côté, J.-C., Otvos, I.S, Schwartz, J.-L. and Vincent, C. (eds)

Mechanism of Detoxification of Cry1Ac in Bombyx mori, Hybrid Shunrei x Shogetsu Yasuyuki Shitomi, Delwar M. Hossain, Kohsuke Haginoya, Masahiro Higuchi, Tohru Hayakawa, Kazuhisa Miyamoto1, Ryoichi Sato2, and Hidetaka Hori* Graduate School of Science and Technology, Niigata University, Niigata, Japan, 950-2181. 1Department of Insect Genetics and Evolution, National Institute of Agrobiological Science, Tsukuba, Ibaraki, Japan, 305-8634. 2 Graduate School of Bio-Applied and Systems Engineering, Tokyo University of Agriculture and Technology, Tokyo, Japan, 184-8588. Keywords: aminopeptidase N, Bacillus thuringiensis, Bombyx mori, brush border membrane, Cry1Ac resistance, peritrophic membrane, pseudo receptor

Toxicity of Cry1Ac to Bombyx mori, Shunrei x Shogetsu, was 3,200 times lower than that of Cry1Aa. However, non toxic Cry1Ac binds to midgut BBM proteins as well as that of highly toxic Cry1Aa. We found that Cry1Ac was trapped by some peritrophic membrane (PM) proteins via N-acetylgalactosamine of a sugar side chain. P252 was purified from B. mori BBM as Cry1Ac binding proteins. Furthermore, we also found Cry1Ac binding proteins, such as 105-, 100-, 96- and 75-kDa BBM proteins. We thought that a majority of these Cry1Ac binding proteins may act as pseudo-receptors to quench the toxicity against B. mori as well as PM proteins. B. mori, hybrid Shunrei x Shogetsu, is susceptible to Cry1Aa and insensitive to Cry1Ac (1). It has been believed that the toxicity is correlated with the presence of a specific receptor in midgut epithelial cell membrane of insects. In ELISA and ligand blot analysis, however, many kinds of BBM proteins were shown to bind to Cry1Ac with almost equal intensity in both resistant and susceptible insects. These suggest that a majority of the bindings between Cry1Ac and BBM proteins of B. mori may be pseudo-binding. Therefore, we hypothesized that those pseudo-bindings to Cry1Ac should not lead to insect death. As Cry1A must pass through the PM before reaching the BBM, PM is an important step for the activation of Cry1A toxin as well as BBM. To elucidate the Cry1Ac non-susceptibility of B. mori, we searched Cry1Ac binding proteins which are involved in the pseudo-binding in PM and BBM of this insect. Here, we present evidences showing some PM and BBM proteins may act as a pseudo-receptor for Cry1Ac in B. mori.

molecular sizes were different. In contrast, Cry1Ac did not pass through the PM for the first 2 h. However, during the third hour, Cry1Ac passed through the PM at 0.34 μg/mm2 PM/h, because of a destruction of the PM or a saturation of Cry1Ac binding site on the PM. The Cry1Ac trapped during the first two hours correlated closely to an interaction of the toxin with some PM proteins. We performed ligand blot analysis of Cry1A toxins with PM proteins. As expected, Cry1Ac binding proteins were detected in detergent soluble fractions (Fig. 1).

First of all, we evaluated the permeability of Cry1Aa or Cry1Ac through the PM. An apparatus to estimate the passage through PM was constructed as described in (2). BSA (66-kDa), Carbonic anhydrase (29-kDa) and Cry1Aa passed through the PM at 0.37 μg/mm2 PM/ h. These passages seemed to be a diffusion process because their rates were similar, even though their

FIG. 1. Ligand blot analysis of PM proteins from B. mori treated with Cry1Aa and Cry1Ac. Class 2 and class 3 PM proteins were seperated by SDS-7.5% PAGE and strained with CBB (PAG). PM proteins were then transferred to a PVDF membrane and analysed by ligand blot using Cry1Aa and Cry1Ac. The migration of molecular weight markers is indicated by open arrow heads. Major PM proteins bound to Cry1Aa and/or Cry1Ac are indicated by filled arrow heads.

* Corresponding author. Mailing address : Laboratory of Molecular Life Sciences, School of Science and Technology, Niigata University, 8050 Ikarasi 2-no-cho, Niigata, Japan, 950-2181. Tel : 81 25 262 7637. Fax : 81 25 262 7637. Email: [email protected]

15

In particular, 125- (P125), 100- (P100), 95- (P95) and 55- (P55) kDa proteins from class 2 which were obtained with 1% Triton X-100 and 165 (P165) kDa proteins of class 3 which was extracted with 2% SDS and 2% mercaptoethanol were shown to bind to Cry1Ac only but not Cry1Aa (2). Our results suggest that the prevention of Cry1Ac from passing through the PM occurs by trapping of PM proteins.

Although Cry1Ac has no toxicity to B. mori, many kinds of Cry1Ac binding proteins, such as 252-, 115-, 105-, 100-, 96- and 75-kDa, were detected. We purified 96kDa APN (APN96) and 252-kDa (P252) proteins (1, 4) as Cry1Ac binding proteins in Triton X-100 soluble fraction of B. mori BBM. We determined the KD constant of APN96 and P252 for Cry1Ac binding using SPR analysis. The KD value of APN96−Cry1Ac interaction was 1.83 μM (1) and the KD value for Cry1Aa, Cry1Ab and Cry1Ac of P252 were 28.9, 178.5 and 20 nM, respectively (4).

Cry1Ac recognizes N-acetylgalactosamine (GalNAc) occurring as sugar side-chain of proteins localized in BBM (3). Cry1Ac trapping by whole PM proteins was inhibited by 70% in the presence of GalNAc, but Cry1Aa trapping was not. In ligand blot, the bindings between Cry1Ac and P125, P95, P55 and P165 were almost completely inhibited by GalNAc. We estimated the GalNAc effect on the Cry1Ac passage through the PM and co-inoculation of Cry1Ac and GalNAc facilitate was shown to Cry1Ac passage through the PM with rate of 0.45 µg/mm2 PM/h. GalNAc residue of PM protein seemed to be involved in Cry1Ac trapping.

We believe that a majority of these Cry1Ac binding proteins from both PM and BBM may act as pseudoreceptors to quench the toxicity of Cry1Ac. We propose here a model of mechanism for detoxification of Cry1Ac in B. mori. Activated Cry1Ac is initially trapped by PM proteins. In case, some Cry1Ac molecules pass through the PM and bind to BBM proteins, such as APN96, P252, 100-, 105- and 75-kDa proteins. The bindings with these proteins further reduce the toxicity of Cry1Ac. It was reported that both the cadherin like protein and APN have been shown to relate with Cry1Ab toxicity in Manduca sexta (3, 5, 6). We hypothesize, however, that there is no such involvement of these proteins in Cry1Ac binding in B. mori. As Cry1Ac must bind to PM and/or BBM proteins and stay there unchange for some time, Cry1Ac cannot form pores on BBM.

We focused on the Cry1Ac binding proteins in class 2 PM and tried to purify them using DEAE ion-exchange chromatography. Whole proteins of this class were fractionated into 8 peaks and those were subjected to ligand blot analysis after SDS-PAGE. Four proteins, i. e., P125, P100, P95 and P55, were detected as Cry1Ac binding protein and the bindings between those proteins and Cry1Ac were inhibited by GalNAc with respective degree. Further characterizations of those proteins are under way in our laboratory.

References 1. Shitomi, Y., T. Hayakawa, D. M. Hossain, M. Higuchi, K. Miyamoto, T. Mitsui, K. Nakanishi, R. Sato, and H. Hori. 2006. A novel 96-kDa aminopeptidase localizing on epithelial cell membrane of Bombyx mori midgut, which binds to Cry1Ac toxin of Bacillus thuringiensis. J. Biochem. 139: 223-233. 2. Hayakawa, T., Y. Shitomi, K. Miyamoto, and H. Hori. 2004. GalNAc pretreatment inhibits trapping of Bacillus thuringiensis Cry1Ac on the peritrophic membrane of Bombyx mori. FEBS Letters 576: 331-335. 3. Knight, P. J., N. Crickmore, and D. J. Ellar. 1994. The receptor for Bacillus thuringiensis CryIA(c) δ-endotoxin in the brush border membrane of the lepidopteran Manduca sexta is aminopeptidase N. Molec. Microbiol. 11:429-436. 4. Hossain, D. M., Y. Shitomi, K. Moriyama, M. Higuchi, T. Hayakawa, T. Mitsui, R. Sato, and H. Hori. 2004. Characterization of a novel plasma membrane protein, expressed in the midgut epithelia of Bombyx mori, that binds to Cry1A toxins. Appl. Environ. Microbiol. 70: 4604-4612. 5. Knowles, B. H., P. J. Knight, and D. J. Ellar. 1991. N-acetyl galactosamine is part of the receptor in insect gut epithelia that recognizes an insecticidal protein from Bacillus thuringiensis. Proc. Roy. Soc. Lond. B 245: 31-35. 6. Bravo, A., I. Gómez, J. Conde, C. Muñoz-Garay, J. Sánchez, R. Miranda, M. Zhuang, S. S. Gill, and M. Soberón. 2004. Oligomerization triggers binding of a Bacillus thuringiensis Cry1Ab pore-forming toxin to aminopeptidase N receptor leading to insertion into membrane microdomains. Biochim. Biophys. Acta 1667:38-46.

We also detected several kinds of Cry1Ac binding proteins in B. mori whole BBM protein, Triton X-100 soluble and insoluble BBM proteins (Fig. 2).

FIG. 2 Ligand blot analysis of BBMV proteins with Cry1Aa and Cry1Ac. Whole BBMV or Triton X-100-soluble proteins from BBMV were applied to SDS-PAGE and proteins were blotted onto PVDF membrane. Ligand blot was performed with Cry1Aa and Cry1Ac. Lane 1: whole BmBBMV proteins, Lane 2: Triton X-100-soluble BmBBMV proteins. The migration of molecular weight markers is indicated by open arrow heads.

16

6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact, Victoria BC, 2005 Côté, J.-C., Otvos, I.S, Schwartz, J.-L. and Vincent, C. (eds)

Determination of a Region of Cry1Aa Inserted into Bombyx mori BBMV Kazuya Tomimoto1, Tohru Hayakawa2, and Hidetaka Hori1* Graduate School of Science and Technology, Niigata University, Niigata Japan, 950-2181. 2Graduate School of Natural Science and Technology, Okayama University, Japan, 700-8530. 1

Keywords: Bacillus thuringiensis; Cry toxin; Cry1Aa; Bombyx mori; BBMV; umbrella model; pore formation; membrane insertion; pronase.

Cry1Aa penetrates into the brush border membrane (BBM) of insect midgut, and causes cell lysis by pore formation. We detected various digests of Cry1Aa inserted into BBMV using various part-specific antisera of Cry1Aa and advocated the plausible insertion region of oligomeric and monomeric Cry1Aa. In oligomeric Cry1Aa, a 15 kDa fragment presumed to be dimeric α-4,5 helices was detected. On the other hand, the digests of monomeric Cry1Aa was quite different from that of oligomer. α-2-7 helices as well as domain III were inserted into BBM whereas α-1-5 sheets were on the membrane surface. Cry1Aa is an insecticidal protein that specifically kills lepidopteran insects by forming pores on BBM of insect midgut. The umbrella model has been recognized as an insertion and pore forming model of Cry1A (1). Several Cry1A toxin molecules gather as oligomerized form on BBM; α-4,5 helices may be subsequently inserted into the membrane to form a pore (2). However, this hypothesis has several disadvantages. One of the most important question is that not only tetrameric Cry1Ab but also monomeric Cry1Ab has pore forming activity and the umbrella model can not explain the latter (3). Furthermore, in the umbrella model, the bulky uninserted region might cause steric hindrance and thereby membrane insertion with assembled molecules might be inhibited. Then, pore forming monomeric Cry1Aa model may differ from that of oligomeric Cry1Aa.

in BBMV bound Cry1Aa. Dominant fragments of 30-35 kDa were detected by anti α-4,5 and anti α-6,7 antisera (Fig. 1 B and C, lane 2-5), but not by anti α-2,3 antiserum (Fig. 1 A). These fragments recognized by those two antisera seemed to be identical to each other based on the SDS-PAGE pattern. Along with these peptides of higher molecular size, a 7.5 kDa fragment was detected by anti α-2,3 antiserum and was not digested further in even 2 mg/ml treatment (Fig. 1 A, lane 6). The molecular weight of the fragment closely accorded with that of α2,3 helices. This result indicates that intact α-2,3 helices are removed from BBMV bound Cry1Aa, thereafter it is still in the lipid bilayer as stable form. On the other hand, a 30 kDa fragments were detected with anti β-6-11 and anti domain III antisera and these patterns in SDS-PAGE

We performed pronase digestion of Bombyx mori BBMV bound Cry1Aa to identify the region. Membrane inserted region may not be digested by pronase, whereas the uninserted region must be vigorously done. Antisera specific to various Cry1Aa region, such as anti α-2,3, anti α-4,5, anti α-6,7, anti β-1-5, anti β-6-11 and anti domain III antisera were prepared to detect fragments of Cry1Aa remaining even after the digestion. All antisera recognized each specific site of Cry1Aa individually, and did not show non-specific binding to B. mori BBMV proteins (data not shown). Digestion was done at 37°C for 24 hours on various pronase concentrations. Many digests were detected even in 1 mg/ml treatment (Fig. 1 all panels, lane 1). It is clear that ultra-high proteinase resistant peptides reside

FIG. 1. Pronase digestion assay of BBMV bound CryAa. Lane 1 : non-treated BBMV bound Cry1Aa; lane 2: 1 mg/mL pronase digestion; lane 3: 1.25 mg/mL pronase; lane 4: 1.75 mg/mL pronase; lane 5: 1.75 mg/mL pronase; lane 6: 2 mg/mL pronase.

* Corresponding author. Mailing address : Laboratory of Molecular Life Sciences, School of Science and Technology, Niigata University, 8050 Ikarasi 2-no-cho, Niigata, Japan, 950-2181. Tel : 81 25 262 7637. Fax : 81 25 262 7637. Email: [email protected]

17

were mutually similar (Fig. 1 E and F, lane 2-5). Thus, they appeared to be the same fragments composed of β-6-11 sheets and domain III. In contrast, almost no fragments were detected using anti β-1-5 antiserum (Fig. 1 D). As expected, total molecular weight summed up the three fragments size, i.e., 30-35, 7.5 and 30 kDa, were nearly equal to that of activated Cry1Aa. This clearly suggests that these fragments are generated from the “same” Cry1Aa molecule. On the other hand, a significant 15 kDa fragment was recognized only by anti α-4,5 antiserum was also observed (Fig. 1 B, lane 2-6). We confirmed the specificity of anti α-2,3 and anti α-6,7 antisera, in which α-3 helix and α-6 helix were respectively recognized (data not shown). Therefore, this result together with the specificity suggests that 15 kDa fragment does not include both α-3 and α-6 helices. In a previous report, α-4,5 helices were shown to have oligomerization as well as pore formation activities (2). We therefore analogize that the 15 kDa fragment must be dimeric α-4,5 helices. Interestingly, 15 kDa fragment of dimeric α-4,5 helices appeared together with 30-35 kDa fragments at the same time and the same intensity (Fig. 1 B). This suggested that the dimer of α-4,5 helices may not derive from the Cry1Aa molecule that produced 7.5, 30-35 and 30 kDa fragments. All results described above suggest that a single molecule of Cry1Aa inserts into BBM and forms pore, and that oligomerized α-4,5 helices also penetrates simultaneously.

between α-1 and α-2, α-3 and α-4, and β-1 and β-5 were digested. These digested portions may expose themselves to the membrane surface. In addition, a 30 kDa fragment including β-6 and domain III region was also was conserved in BBMV. Domains II and III have been speculated to be on the membrane surface with binding to receptor. But our results do not clearly support the above speculation; rather they suggest that these regions are also buried in the membrane by interaction with lipids. Based on our results, we proposed a “Buried dragon model”. The main characteristic of this model feature is whole parts of Cry1Aa are inserted or buried into the membrane. Moreover, not only the membrane inserted region but also buried regions must be important for pore forming in some way. Alternatively, pore forming region of tetrameric Cry1Aa should be α4,5 helices (Fig. 2 B). In a pronase digestion assay, a detected fragment was actually dimeric α-4,5 helices although it may be too small to form pore. Cry1A toxin has been known to normally oligomerize to tetramer. Therefore, it is reasonable to analogize that pore forming unit must be dimer of dimeric α-4,5 helices or tetramer of the helices. However, as indicated above, Cry1Aa tetramer must cause steric hindrance as it is, and thus bulky extra portions should be removed during oligomerization. Our observation that only α-4,5 helices dimer was detected matched to our hypothesis.

Our new pore forming model is shown on Fig. 2. The pore forming region of monomeric Cry1Aa is thought to be from α-2 to α-7 helix because this region was not digested and kept in the BBMV even after vigorous Pronase digestion (Fig. 2 A). Conversely, the region

1. Gazit, E., P. L. Rocca, M. S. P. Sansom, and Y. Shai. 1998. The structure and organization within the membrane of the helices composing the pore-forming domain of Bacillus thuringiensis δendotoxin are consistent with an “umbrella-like” structure of the pore. Proc. Natl. Acad. Sci. USA. 95:12289-12294. 2. Gerber, D., and Y. Shai. 2000. Insertion and Organization within Membranes of the δ-Endotoxin Pore-forming Domain, Helix 4-LoopHelix 5, and Inhibition of Its Activity by a Mutant Helix 4 Peptide. J. Biol. Chem. 275: 23602 – 23607. 3. Gómez, I., J. Sánchez, R. Miranda, A. Bravo and M. Soberón. 2002. Cadherin-like receptor binding facilitates proteolytic cleavage of helix α-1 in domain I and oligomer pre-pore formation of Bacillus thuringiensis Cry1Ab toxin. FEBS Lett. 513: 242-246.

References

FIG. 2. Hypothesis of membrane insertion region and pore forming model of Cry1Aa.

18

6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact, Victoria BC, 2005 Côté, J.-C., Otvos, I.S, Schwartz, J.-L. and Vincent, C. (eds)

Production and Characterization of a Subtractive cDNA Library and Quantitative PCR Analysis of Choristoneura fumiferana Genes Differentially Expressed in Response to Bacillus thuringiensis Cry1Ab Toxin Exposure Liliane Meunier1,2, Gabrielle Préfontaine2, Manuela Van Munster2, Roland Brousseau1,2�*, and Luke Masson1,2 1 2

Department of Microbiology and Immunology, Université of Montréal, Montreal, Quebec, Canada, H2X 3Y7 National Research Council of Canada, Biotechnology Research Institute, Montreal, Quebec, Canada, H4P 2R2

Keywords: Bacillus thuringiensis, Choristoneura fumiferana, suppression subtractive hybridization, quantitative PCR, gene expression

Bacillus thuringiensis is a biological control agent for Choristoneura fumiferana, exerting its lethal effect primarily through the production of crystal proteins. There is concern about the impact of Cry toxins on non-target species, especially in terms of sublethal effects. By understanding the transcriptional response of C. fumiferana larvae to a sublethal dose of Cry1Ab toxin, we can proceed to assess whether genes showing altered transcriptional profiles can be used as universal Cry toxin stress markers for non-target insects. To this end, a suppression subtraction hybridization library was created and differential mRNA expression of selected clones was measured using a quantitative polymerase chain reaction (Q-PCR) technique. Spruce budworm (Choristoneura fumiferana) larvae are destructive defoliators of North American forests where epidemic episodes result in major damage to spruce and balsam fir trees (1, 2). These episodes have been controlled using formulations containing the entomopathogenic bacterium Bacillus thuringiensis (Bt) that contains crystal proteins (Cry) as the active toxic agent. Bt has been developed commercially for the control of various agronomical insect pests (3, 4) and represents an important alternative to chemical insecticides (5).

protoxin) and a control population. Midguts from diet fed instar 4 (L4) larvae were removed by dissection 24 h after the end of the feeding period and immediately stored at -80oC. Treatment was followed by mRNA extraction in order to create a subtracted library using both larval populations (control and toxin Cry1Ab treated). Gene expression was evaluated by Q-PCR analysis of 17 selected unique genes. All Q-PCRs were done in triplicate for two different biological replicates. The transformed library was initially characterized by sequencing 1091 clones. Among these clones, 623 possessed unique sequences with the remainder representing duplicate or contiguous sequences. BLASTX analyses were performed and 171 clones were found to match to a specific function (e-value less than e-15). Those sequences ascribed a putative molecular function using the Gene Ontology Consortium software (7) and were classified in different categories. The majority of the unique sequences (54%) had a molecular function related to catalytic activity. The two other major functions represented were proteins involved in binding (15%) and structural (15%) functions. A small amount (3%) had a role in the stress response of the insects.

Although Cry toxins have a relatively narrow host range, their effect on non-target organisms remains a controversial environmental issue (6). Sublethal effects on non-target insects are not readily apparent but can be assessed at a molecular level. By understanding the molecular response of the larvae to sublethal doses of a Cry toxin, we can then proceed to assess whether genes showing altered transcriptional profiles can be used as universal Cry toxin stress markers for non-target insects. The present study describes the construction and partial characterization (sequencing and mRNA quantification) of a suppression subtraction hybridization library between a Cry1Ab toxin exposed larval population of C. fumiferana and a control population not exposed to the toxin.

All gene expression experiments (Q-PCR) were normalized to a housekeeping gene, the acidic calciumindependent phospholipase A2 (PLPA2). After Q-PCR analysis, 17 clones were classified in three different groups according to the type of expression observed

C. fumiferana larvae were divided into two populations: a Cry1Ab protoxin fed population (35 ng of Cry1Ab

* Corresponding author. Mailing address : National Research Council of Canada, Biotechnology Research Institute, 6100 avenue Royalmount, Montreal, Quebec, Canada, H4P 2R2. Tel: 514-496-6152. Fax: 514-496-6312. Email: [email protected].

19

10.00 9.00 8.00 7.00

Ratio

6.00 BR1 BR2

5.00 4.00 3.00 2.00 1.00

ct or Es te ra se D N A In re iti pa at ir io n fa ct Ch or iti U n nk bi no nd w in n g Am pr in H ot op yd ei ep n ro xy tid de as hy e N dr og en as e AT AB Pa C se tr an sp or t er H ea t M sh et oc al lo k pr ot ea se Li pa se

P4 50 G

ro

w th

fa

ot ei n to ch ro

m e

pi n2

pr

ze

Cy

An tif r

ee

Se r

Se r

pi n1

0.00

FIG. 1. Levels of mRNA expression by Q-PCR. BR1 and BR2 represent two independent biological replicates of the feeding experiments. Error bars represent standard error. All data were normalized to PLPA2 and expressed as a ratio (toxin fed/control).

after toxin exposure. Nine clones were considered overexpressed (ratio > 1.5), five clones showed stable levels of mRNA and three clones were transcriptionally repressed compared to the control when exposed to the toxin (Fig. 1). Two serine protease inhibitors (serpins) showed an overexpression profile in both biological replicates. Four other clones showed an overexpression profile after toxin exposure: an antifreeze protein, a cytochrome P450, an esterase and a protein involved in DNA repair. Three clones having homology with a growth factor, an initiation factor and a gene of unknown function also showed an enhanced expression profile in one replicate, but their expression levels remained unchanged in the other. This result was presumably due to the fact that only a single time point was examined in both replicates. In other words, the second replicate may have been sampled when the genes were either at the start or at the finish of their altered transcriptional profile. Five clones related to binding activity showed a stable expression profile (ratio between 0.5 and 1.5): an aminopeptidase, a chitin receptor, a hydroxydehydrogenase, an ATPase and an ATP binding cassette (ABC). Clones having homology with a lipase, a metalloprotease precursor and a heat shock protein were all repressed by the toxin treatment (ratio < 0.5).

insect. A large number of enzyme-related genes were either enhanced or repressed while specific Cry toxin receptor genes such as aminopeptidase genes did not seem to have an altered transcriptional profile. Extending the analysis of these expression profiles among other toxin-exposed insects is needed to assess whether this stress response to Cry toxin intoxication is universal.

References 1. Rose, A. H. and O. H. Linquist.1994. Insects of eastern spruces, firs and hemlocks. Natural Resources Canada, Canadian Forest Service, Science and Sustainable Development Directorate and Canada Communication Group, Ottawa. Revised edition, Ottawa, Canada. 2. Dale, V., L. Joce, S. MCcNulty, R. P. Neilson, M. P. Ayres, M. D. Flannigan, P. J. Hanson, L. C. Irland, A. E. Lugo, C. J. Peterson, D. Simberloff, F. J. Swanson, B. J. Stocks, and B. M. Wotton. 2001. Climate change and forest disturbance. BioScience 51:723-34. 3. Moar, W. J., L. Masson, R. Brousseau, and J. T. Trumble. 1990. Toxicity to Spodoptera exigua and Trichoplusia ni of individual P1 protoxins and sporulated cultures of Bacillus thuringiensis subsp. kurstaki HD-1 and NRD-12. Appl. Environ. Microbiol. 56:2480-3. 4. Saade, F. E., G. B. Dunphy, and R. L. Bernier. 1996. Response of the carrot weevil, Listronotus oregonensis (Coleoptera: Curculionidae), to strains of Bacillus thuringiensis. Biological Control 7:293-298. 5. Feitelson, J. S., J. Payne, and L. Kim. 1992. Bacillus thuringiensis: Insects and Beyond. Bio/Technology 10:271-275. 6. Hilbeck, A. 2001. Implications of transgenic, insecticidal plants for insect and plant biodiversity. Perspect. Plant Ecol. Evol. Syst. 4:43-61. 7. Ashburner, M., C. A. Ball, J. A. Blake, H. Butler, J. M. Cherry, J. Corradi, K. Dolinski, J. T. Eppig, M. Harris, D. P. Hill, S. Lewis, B. Marshall, C. Mungall, L. Reiser, S. Rhee, J. E. Richardson, J. Richter, M. Ringwald, G. M. Rubin, G. Sherlock, and J. Yoon. 2001. Creating the gene ontology resource: Design and implementation. Genome Res. 11:1425-1433.

In this study, it was shown that the response elicited by sublethal Cry1Ab toxin ingestion seems to be related primarily to alterations in metabolic activities in the

20

6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact, Victoria BC, 2005 Côté, J.-C., Otvos, I.S, Schwartz, J.-L. and Vincent, C. (eds)

Gene Expression Response of the Spruce Budworm, Choristoneura fumiferana, after Exposure to Various Doses of Bacillus thuringiensis Cry1Ab Toxin Using Microarray Technology Manuela van Munster1, Gabrielle Préfontaine2, Alberto Mazza2, Liliane Meunier1, Miria Elias1, Roland Brousseau1,2*, and Luke Masson1,2 1 2

Université de Montréal, Montreal, Quebec, Canada, H2X 3Y7 National Research Council of Canada, Biotechnology Research Institute, Montreal, Quebec, Canada, H4P 2R2

Keywords: Choristoneura fumiferana, Bacillus thuringiensis, microarray, Cry1Ab toxin

In order to gain more insight into the response of the North American lepidopteran forest pest Choristoneura fumiferana to the Cry1Ab toxin of Bacillus thuringiensis, linearly amplified mRNA was synthesized from midguts of healthy and infected insects exposed to various sublethal doses of this toxin. Fluorescently labeled cDNAs obtained from the mRNA were hybridized onto a custom DNA microarray chip containing 1091 clones isolated from a subtractive library between toxin-fed and control insects. Our results show that genes implicated in various metabolic functions were specifically enhanced or repressed when susceptible larvae were exposed to sublethal doses of toxin. Spruce budworm larvae (Choristoneura fumiferana) are major defoliators of many spruce species and are responsible for important economic losses in North America forests (5). Chemical control of C. fumiferana is problematic for many reasons (pollution, toxicity to non-target insects, etc.) and, as an alternative, commercial formulations containing Cry toxins of the entomopathogenic bacterium Bacillus thuringiensis (Bt) have been developed and used for many years as a biocontrol agent in Canadian forests (6). Although it is known that Bt toxins have a narrow and specific host range (2), potential subtle effects on non-target insects, such as altered oviposition, reduction in insect size or slower maturation, may not be readily apparent and these effects could influence insect population dynamics over the long term. In order to evaluate the risk for non-target insects potentially exposed to Bt toxins, we determined the transcriptional response of C. fumiferana larvae exposed to various sublethal doses of Cry1Ab toxin using microarray technology.

chlorophyll synthetase of Arabidopsis thaliana) was also included on each slide to allow normalization of the data. For microarray analyses, messenger RNA was isolated from midguts of either healthy or exposed (5, 10, 20 and 40 ng Cry1Ab toxin /larva) instar 4 (L4) larvae, one day after removal of diet, linearly amplified and labeled using fluorescent cyanine dyes. The labeled amplified DNA was then hybridized onto the microarray chip and subsequent data normalization, statistical analysis and visualization were performed using GeneSpring software (Agilent Technologies Inc., Palo Alto, CA, USA). Negative control experiments using a coleopteran-specific toxin (20 ng Cry3A toxin/ larva) were conducted simultaneously to determine gene response specificity to the lepidopteran-specific Cry1Ab. Independent validation of microarray results was done using quantitative PCR (Q-PCR). Specific primers for three selected clones having significant BLASTX homology with an aminopeptidase, a serine protease inhibitor and a lipase were designed and synthesized in order to amplify a 100-150 base-pair PCR product. SYBR Green I dye (Applied Biosystems, Foster City, CA, USA) was used to quantify each of the relative mRNA levels for each gene, as analyzed by the Rotor-Gene quantification software (Corbett Research, Cambridge, UK). A mathematical model was then used to calculate the relative expression ratio between the toxin-fed and control populations (4).

To this end, a cDNA subtractive library enriched in clones differentially expressed in C. fumiferana intoxicated larvae (20 ng Cry1Ab toxin/larva) was created from which 1091 clones were selected and analyzed. Individual PCR-amplified fragments (amplicons) from each of the clones were immobilized onto glass slides in triplicate. A set of positive control genes (phospholipase A2, tubulin of C. fumiferana and a spike-in gene,

* Corresponding author. Mailing address : National Research Council of Canada, Biotechnology Research Institute, 6100 avenue Royalmount, Montreal, Quebec, Canada, H4P 2R2. Tel: 514-496-6152. Fax: 514-496-6312. Email: [email protected].

21

TABLE 1: Clones with known functions overexpressed (i.e., intensity ratio toxin/control >1.8) and repressed (i.e., intensity ratio toxin/control 2.5

Hydrolase activity - Glucosidase - Lipase - Carboxypeptidase - Serine protease

++ + -

++ + + -

++ + ++ +

-: 1-0.5 +: 0.5-0.4 ++:< 0.4

Microarray results showed that 24 clones were specifically enhanced after a 20 ng toxin/larva treatment. In particular, several clones having sequence homology with the genes of serine protease inhibitors (serpins) as well as that of a cytochrome P450 protein were enhanced after a 10 ng toxin/larva treatment (Table 1). Serpins are involved in the defense immune system of insects as they inhibit serine protease activity (1) and the cytochrome P450 superfamily proteins is known to be involved in a variety of metabolic processes including insecticide metabolism and, consequently, insecticide resistance (3). We were able to detect 124 clones specifically repressed after a 20 ng toxin/larva treatment (Table 1). Moreover, 103 clones were already specifically repressed after a 5 ng toxin/larva treatment. For the most part, repressed clones shared sequence homology with the genes of proteins implicated in hydrolase activity (lipase, glucosidase, carboxypeptidase, midgut serine proteases) (Table 1). Q-PCR analysis on the selected

lipase, serpin and aminopeptidase genes, showed that indeed the lipase gene was repressed while the gene coding for the serpin was overexpressed after the toxin treatments. In the case of aminopeptidase, a known receptor for Cry1Ab toxin in Lepidoptera, its expression was unchanged after the various toxin treatments (Fig. 1). In conclusion, we show that the parallel processing power of DNA microarray technology is a powerful and useful tool for screening large numbers of genes for altered gene expression. Using a susceptible insect, we show that many genes involved in several metabolic functions have their expression ratio altered by toxin treatment, even at low dose. References 1. Bode, W., and R. Huber. 1992. Natural protein proteinase inhibitors and their interaction with proteinases. Eur. J. Biochem. 204:433-51. 2. de Maagd, R. A., A. Bravo, C. Berry, N. Crickmore, and H. E. Schnepf. 2003. Structure, diversity, and evolution of protein toxins from spore-forming entomopathogenic bacteria. Annu. Rev. Genet. 37:409-33. 3. Feyereisen, R. 1999. Insect P450 enzymes. Annu. Rev. Entomol. 44:507-33. 4. Pfaffl, M. W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29:45. 5. Rose, A. H., and O. H. Linquist, 1994. Insects of eastern spruces, firs and hemlocks. Natural Resources Canada, Canadian Forest Service, Science and Sustainable Development Directorate and Canada Communication Group, Ottawa. Revised edition, Ottawa, Canada. 6. van Frankenhuyzen, K., J. L. Gringorten, R. E. Milne, D. Gauthier, M. Pusztai, R. Brousseau, and L. Masson. 1991. Specificity of activated CryIA proteins from Bacillus thuringiensis subsp. kurstaki HD-1 for defoliating forest Lepidoptera. Appl. Environ. Microbiol. 57:1650-1655.

5

Intensity ratio toxin/control

MA 4

Q-PCR

3

2

1

0

5 10 20 Aminopeptidase

5

10 20 Serpin

5

10 20 Lipase 00

FIG. 1: Comparison of microarray and Q-PCR results. Analysis was done in triplicate for each toxin treatment (5, 10, 20 ng/larva).

22

6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact, Victoria BC, 2005 Côté, J.-C., Otvos, I.S, Schwartz, J.-L. and Vincent, C. (eds)

M������������������������������������������������������������ olecular Identification������������������������������������� ��������������������������������������������������� and C����������������������������������������������� ������������������������������������������������ ytocidal �������������������������������������� Action�������������������������������� of P��������������������������� ���������������������������� arasporin, ���������� a Protein �������������� ������ G����� roup of Novel ������������������������������������������������� C������������������������������������������ rystal ����������������������������������� T���������������������������������� oxins Targeting ���������������������������� H����������������� uman C����������� ������������ ancer C���� ����� ells Sakae Kitada1�*, Yuichi Abe1, Akio Ito1, Osamu Kuge1, Tetsuyuki Akao2, Eiichi Mizuki2, and Mi��������� ch������� io Ohba3 Department of Chemistry, Faculty of Science, Kyushu University, Fukuoka, Japan, 812-8581. Biotechnology and Food Research Institute, Fukuoka Industrial Technology Center, Fukuoka, Japan, 839-0861. 3 Department of Applied Genetics and Pest Management, Faculty of Agriculture, Kyushu University, Fukuoka, Japan, 812-8581. 1 2

Keywords: Bacillus thuringiensis, cancer cell,���������������������������������������������������������������������� ��������������������������������������������������������������������� c�������������������������������������������������������������������� rystal protein������������������������������������������������������ , GPI-anchored proteins, lipid raft, parasporin, poreforming toxin, receptor

While there are a number of Bacillus thuringiensis (Bt) strains producing insecticidal toxins, many Bt strains with non-insecticidal inclusion proteins are ubiquitously found in natural environments. P���������������������������������������������������������������������������������������������������������� araspo���������������������������������������������������������������������������������������������������� r��������������������������������������������������������������������������������������������������� in, a new type of crystal protein������������������������������������������������������������������ s����������������������������������������������������������������� derived from the ��������������������������������������������������� non-insecticidal ����������������������������������������������� and non-hemolytic ������������ Bt strains,� recognizes and kills some ������������������������������������������������������������������������������������������������������������������������������������������� human �������������������������������������������������������������������������������������������������������������������������������������� cells �������������������������������������������������������������������������������������������������������������������������������� including ���������������������������������������������������������������������������������������������������������������� cancer cells. ������������������������������������������������������������������������������������������������� At present, four parasporins (parasporin-1, parasporin-2, parasporin-3, and parasporin-4), which differ in molecular������������������������������������������������������������������������������������������������������������������������������������� ���������������������������������������������������������������������������������������������������������������������������������������������� weight, structure, and target cell specificity, have been purified from independent Bt strains and genes for the proteins have been cloned. In this minireview, we describe structures and functions of parasporins, and focus on parasporin-2, which has a unique cytocidal activity against various human cells with marked target specificity. In slices of liver and colon cancer tissues, the parasporin-2���������������������������������������� preferentially ��������������������������������������� kills the cancer cells, leaving the normal cells unaffected. The cytocidal effect of parasporin-2 is non-apoptotic and it seems rather to be a pore-forming toxin oligomerized in lipid raft on the plasma membrane via GPI-anchored proteins. Cytotoxic actions and the������������������������������������������������������������ ��������������������������������������������������������������� receptors of parasporins will be revealed in the molecular levels, and the toxins and the receptors, moreover, may provide new applications in the medical field. The genes for the proteins were cloned, and then the parasporins were numbered in order of their molecular identifications.

Non-insecticidal Bt strains and the parasporal inclusion proteins While there are a number of Bt strains with Cry proteins, which are toxic to insects within the species’ specificity, it is reported that many Bt strains with non-insecticidal inclusion proteins are ubiquitously found in natural environments (1, 2). Interestingly, these strains are even more widely distributed than insecticidal strains. Through a wide screening for the cytotoxicity of such strains in some organisms and cultured human cell lines, Mizuki and his coworkers reported a new Bt toxin that exerted cytotoxic activity to some cultured human cancer cells from non-insecticidal and nonhemolytic Bt strain A1190 (3). After their report, different types of Bt strains with toxins killing human cells were identified one after another. In order to distinguish the parasporal toxins from the insecticidal Cry proteins, we now propose a new protein group; parasporin which is defined as “the B. thuringiensis and related bacterial parasporal proteins that are non-hemolytic but capable of preferentially killing cancer cells”.

TABLE 1. Non-insecticidal and non-hemolytic Bt strains and parasporins.

a

Inclusion morphology

Strains

Locality (source)

Parasporins

A1190

Hiroshima (soil) a

Spherical

Parasporin-1

A1547

Fukuoka (soil) a

Irregular shaped

Parasporin-2

A1462

Tokyo (soil)

a

Bipyramidal

Parasporin-3

A1470

Tokyo (soil)

a

Irregular shaped

Parasporin-4

Isolated by Ohba et al.

Molecular structures Figure 1 shows the schematic structures of parasporins, based on the primary structures. Parasporin-1 consists of 723 amino acid residues. As the protein contains five conserved blocks among Cry proteins (3), parasporin-1 could be a three-domain type toxin like most Cry proteins. The active parasporin-1 is purified from Bt strain A1190 as the protoxin, which is cleaved by trypsin in vitro at two sites in the N-terminal domain. The resultant polypeptides of 15 kDa and 56 kDa seem to be tightly

At present four parasporins have been purified from independent Bt strains (A1190, A1547, A1462, and A1470), all of which were isolated in Japan (Table 1).

* Corresponding author. Mailing address: Department of Chemistry, Faculty of Science, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka, Japan, 812-8581.Tel:81-92-642-2521. Fax: 81-92-642-2507. E-mail: [email protected]

23

Minireview Kitada et al.

FIG. 1. Molecular structures and characteristics of parasporin proteins. Arrows indicate the cleavage sites by proteinase K or trypsin. Diagonal regions are mature toxic polypeptides and white blocks indicate propeptide regions cleaved off by the proteases. Gray blocks mean a low degree of homology to the consensus sequence for each block, and black blocks are highly conserved ones. Numbers show amino acid residues in the proparasporins.

associated with each other and form a toxin complex (4). On the other hand, parasporin-2 has no homology to existing Cry proteins. Pro-parasporin-2 is processed at N- and C-terminal regions by proteinase K, and a central region of 30 kDa polypeptide acts as a potent toxin to selected human cancer cell lines (5). Parasporin-3, like parasporin-1, also has the five conserved blocks. Because the sequence in each block shows a high degree of homology to that in the insecticidal Cry toxin, this protein is a typical three-domain type toxin. The protoxin is converted into an active one by proteinase K-digestion at N-terminal region, and possibly also somewhere in the C-terminal region. Recently, two analogous genes to parasporin-3 were isolated from Bt strain A1462 (6). The last one, parasporin-4 shows no strong homologies to Cry and Cyt proteins and contains none of the blocks conserved in Cry proteins (Saitoh et al., unpublished data). The protoxin turns into cytotoxic 27-kDa protein only by the C-terminal digestion.

lethal cell dose (LD50) by parasporins are summarized. Parasporin-1 shows toxicity against cancer cell lines; for example, highly toxic to HeLa cells originating from human uterus cancer, as well as other cancer cells (4). Parasporin-2 is highly cytotoxic to such cell lines as MOLT-4, Jurkat, and HepG2 cells, while some cell lines, such as HC and HeLa celle, are relatively resistant to the toxin. Parasporin-3 also shows toxicity against a few cancer cell lines, such as HepG2 and HL-60 cells (6). Parasporin-4 seems to target some of cancer cell lines such as CACO-2 and Sawano cells (7). Although no generalities for cell-specificity of the toxins are found, it is interesting that some cancer cells seem more toxin-sensitive than normal cells. For example, we realize the preferential specificity of the parasporins to cancer cells when the LD50 values for HepG2 cells derived from hepatoma with for normal hepatocyte HC cell are compared. The cytotoxic effects of parasporins have been examined not only with the biochemical assay but also with the morphological changes of cells under microscopic observations (4-7). Although the morphological changes depends on the

The parasporin-1, -2, -3, and -4 were designated as Cry31Aa, Cry46Aa, Cry45Aa, and Cry41Aa, respectively, by the Bt delta-endotoxin nomenclature committee (http://www.lifesci.sussex.ac.uk/home/Neil_ Crickmore/Bt/index.html).

TABLE 2. Summary for the members of parasporins.

Cytocidal actions and cell specificities In Table 2, the currently known members of parasporin are summarized. These four parasporins differ in molecular weight and composition. Yet, a more important point is that they have no identical rule in target cell specificity. In table 3, the values of 50% of the

24

Parasporins

Protoxin (kDa)

Toxin (kDa)

Receptors

Cell death

Parasporin-1

81

15 and 56

Unknown

Ca2+ influx

Parasporin-2

37

30

GPI-proteins

Cytolysis

Parasporin-3

88

64

Unknown

Unknown

Parasporin-4

31

27

Unknown

Unknown

cytotoxic effects, it will be needed to investigate toxin modes of the actions in the molecular levels. Another point of view, each toxin-specific receptor could be on the target cells because each parasporin can recognize a different class of cancer cell lines (Table 3). However, none of the receptors are known for certain (Table 2). Identification of the receptors will greatly enhance not only scientific knowledge but also encourage their application, especially in the medical field.

Parasporin-2: the cancer cell recognition and the oligomerization in lipid raft Parasporin-2 is reported as a potent toxin targeting human cancer cells. It is most interesting that the toxin preferentially kills some cancer cells with little affect on the normal cells in tissue sections of human cancers from patients. How does parasporin-2 induce cell death? From the biochemical analyses, it seemed to be an efflux of cytoplasm through the plasma membrane, because lactate dehydrogenase in cytoplasm rapidly leaked from the cells (8). Moreover, propidium iodide, which is an indicator of plasma membrane damage, also rushed into the cells. Therefore, parasporin-2 increases the plasma membrane permeability of the target cells. Prasporin-2 binds to a detergent-resistant membrane, the so-called “lipid raft” in a plasma membrane, and then forms the SDS-resistant oligomer embedded in the membrane (8).

Minireview Kitada et al.

FIG. 2. Morphological changes of cells caused by parasporins. Cytopathic effect of parasporin-1 on HeLa cells (panel A), parasporin-2 on HepG2 cells (panel B), parasporin-3 on HepG2 cells (panel C), and parasporin-3 on MOLT-4 cells (panel D) are shown. Right and left panels indicate mock-treated and intoxicated cells, respectively.

doses of the toxins and on times of the intoxications, it is observed that parasporins swell susceptible cells, induce balloon-like shapes suddenly emerged on the cell surface, fragmentate the cells, or often detach the cells from culture dishes (Fig. 2). The effects seem to be different in each cell intoxicated by each parasporin. Though the molecular mechanisms of the cytotoxic actions are mostly unknown yet, parasporin-1 could rapidly induces influx of extracellular calcium ions into HeLa cells (Katayama et al., unpublished data). The cell death induced by parasporin-2 is non-apoptotic, although the apoptotic process occurs when the cell damage proceeded slowly (5). To reveal the precise

Finally, the toxin permeabilizes the membrane and damages the target cells. Where does parasporin2 associate in the cells during the cytotoxic action? Figure 3A shows immunofluorescence images of cells after parasporin-2 treatment. Just after the toxin treatment, the toxin bound itself to the surface of the cells. After chase incubation for 60 minutes, most of the

TABLE 3. Cytocidal activities of parasporins to various human cells. Cells MOLT-4 Jurkat HL-60 T cell HepG2 HC HeLa Sawano TCS UtSMC CACO-2 a

Characteristics Leukemic T cell Leukemic T cell Leukemic T cell Normal T cell Hepatocyte cancer Normal hepatocyte Uterus(cervix) cancer Uterus cancer Uterus(cervix) cancer Normal uterus Colon cancer

LD50 (µg/ml) Parasporin-1 2.2 >10 0.32 >10 3.0 >10 0.12 >10 N.D. a >10 >10

Parasporin-2 0.022 0.018 0.019 N.D. a 0.019 1.1 2.5 0.0017 7.8 2.5 0.013

N.D. Not done

25

Parasporin-3 >10 >10 1.32 >10 2.8 >10 >10 >10 >10 >10 >10

Parasporin-4 0.472 >2 0.725 >2 1.90 >2 >2 0.245 0.719 >2 0.124

and increased (8). How does the toxin recognize specific cells? To answer this question, we focused on the molecules in lipid raft because parasporin-2 monomer associates with lipid raft. Then, we did specific degradations of the molecules in lipid raft or inhibitions of the biosynthesis of molecules rafted there, and the toxin actions were investigated. Through such investigations, we hit upon some types of molecules that are GPI-anchored proteins (GPI-proteins), which are abundant in lipid raft. Phosphatidylinositol-specific phospholipase C (PI-PLC) cleaves the bond with the GPI anchor and releases the polypeptide and glycan from the membrane. The PIPLC treatment greatly inhibits the parasporin-2 binding to HepG2 cells and the toxin association to cells cut off from GPI-proteins is nealy null (8). The PI-PLC treatment to cells decreases parasporin-2 oligomerization and delays the cytotoxicity (8). Thus, the GPI-proteins is essential for parasporin-2 action to HepG2 cells. A possible model for cell recognition and action of parasporin-2 is shown in Figure 3C. This toxin binds GPI-proteins in lipid raft, and then seems to form the oligomer that can permeabilize the plasma membrane. Because of the membrane permeability, the cells suffer lethal damage. This model raises yet more questions on parasporin-2 actions. Which GPI-anchored protein is a true receptor? Are any other molecules interacting with the toxin? How does the toxin assemble with the SDS-resistant oligomer, and what is the exact size of the toxin-oligomer in the intact membrane? And, finally, how is the toxin inserted into the membrane?

Minireview Kitada et al.

FIG. 3. Association and oligomerization of parasporin-2 on the cells and a possible model for cell recognition and action by parasporin-2. (A) Toxin localization to the plasma membrane during the cytotoxic action. The left panels show immunofluorescence images of HepG2 cells after parasporin-2 treatment, using the specific toxin antibody. Just after the toxin treatment (upper panels) and after the chase incubation for 60 minutes (lower panels) are shown. (B) SDSresistant oligomerization of parasporin-2. Parasporin-2 incubated with HepG2 cells was detected using the specific antibody followed by SDS-PAGE and western blotting. Arrows indicate monomeric (M) and the SDS-resistant oligomeric (O) toxins.

toxins stayed there, and after this time, most cells were dead. Therefore, parasporin-2 seems to be localized in the plasma membrane during the action. When we detected parasporin-2 using the specific antibody followed by SDS-PAGE and western blotting, as shown in Figure 3B, the monomeric toxin decreased, but the immunoreactive and SDS-resistant toxin oligomer, the size of which was about 200 kDa on the PAGE, formed

Oligomerizing and pore-forming toxins and GPI-proteins Recently, there are many reports about oligomeric poreforming toxins, most of which target lipid raft. In Table 4, some of them with their oligomer size and GPI-proteins as the receptors are listed. Cry1A is an oligomeric toxin

TABLE 4. Pore-forming oligomeric toxins and GPI-anchored proteins as the receptors. Toxins

Bacteria

Monomer [Oligomer]

Receptors [GPI-protiens]

Cry1A

Bacillus thuringiensis

60 kDa [4-5 mer]

[Aminopeptidase N] Cadherin-like protein

Parasporin-2

Bacillus thuringiensis

30 kDa [6-7 mer]

[GPI-proteins] Unknown proteins?

Aerolysin

Aeromonas hydrophila

56 kDa [7 mer]

[GPI-proteins]

54 kDa [>50mer]

[Human CD59] Chlesterol

Intermedilysin

Streptococcus intermedius

Others…

26

R���������� eferences 1. Ohba, �������������������������� M., and K.J. Aizawa. 1986. ������������������� Insect toxicity of Bacillus thuringiensis isolated from soils of Japan. J. ���������������������� Invertebr. Pathol. 47�:12-20� 2. Meadows, M.P., D.J. Ellis, J. Butt, P. Jarrett, and������������� ���������������� H.D. Burges. 1992. Distribution, Frequency, and Diversity of Bacillus thuringiensis in an Animal Feed Mill���������������������������� . �������������������������� Appl. Environ. Microbiol.� 58:1344-1350 3. Mizuki, E., M. Ohba, T. Akao, S. Yamashita, H. Saitoh, and Y. S. Park. 1999. ��������������������������������������������������������� Parasporin, a human leukemic cell-recognizing parasporal protein of Bacillus thuringiensis. J. Appl. Microbiol. 86�:477-486. 4. Katayama, H., H.������������������������������������������� ������������������������������������������ Yokota, T.�������������������������������� ������������������������������� Akao, O.����������������������� ���������������������� Nakamura, M.���������� ��������� Ohba, E. Mekada,��������������� and����������� E. Mizuki�. ���������������������������������������������� 2005. Parasporin-1, a novel cytotoxic protein to human cells from non-insecticidal parasporal inclusions of Bacillus thuringiensis. J Biochem. 137:17-25. 5. Ito, A., Y.����������������������������������������������� Sasaguri, ���������������������������������������������� S. Kitada, Y. Kusaka, K. Kuwano, K.� Masutomi, E.������������������������������� ������������������������������ Mizuki, T. Akao, and M. Ohba��. 2004. A Bacillus thuringiensis crystal protein with selective cytocidal action to human cells. J. Biol. Chem. 279:21282-21286. 6. Yamashita, S., H.��������������������������������������������� �������������������������������������������� Katayama,����������������������������������� ���������������������������������� H.�������������������������������� ������������������������������� Saitoh,������������������������ ����������������������� T. Akao, Y.S. Park, E. Mizuki, M�������������������� . O����������������� hba, and A������� . ����� Ito��.� 2005. Typical three-domain Cry proteins of Bacillus thuringiensis strain A1462 exhibit cytocidal activity on limited human cancer cells. J Biochem. 138:663-672. 7. Okumura, S., H.����������������������������������������������� Saitoh, ���������������������������������������������� T. Ishikawa, N. Wasano, S. Yamashita, K. Kusumoto, T., Akao, E.��������������������������������� Mizuki, �������������������������������� M. Ohba, and K.��������� Inouye�� ��������. 2005. Identification of a novel cytotoxic protein, Cry45Aa, from Bacillus thuringiensis A1470 and its selective cytotoxic activity against various mammalian cell lines. J Agric Food Chem. 53:6313-6318. 8. Abe�������������������������������������������� , Y.���������������������������������������� , S.������������������������������������ �������������������������������������� Kitada����������������������������� ,���������������������������� O.������������������������� ��������������������������� Kuge��������������������� ,�������������������� M.����������������� ������������������� Ohba������������ , and������� ���������� A.���� Ito. 2005��. Oligomerization of parasporin-2, a new crystal protein from noninsecticidal Bacillus thuringiensis, in lipid rafts. Proceedings of the ���� 6th� Pacific Rim Conference on the������������������ ����������������� Biotechnology of Bacillus thuringiensis and Its����������������������������������������������� Environmental ���������������������������������������������� Impact�������������������������� Victoria ������������������������� , B.C., Canada��. In press. 9. Abrami, L., M. Fivaz, ��������������������� and F.G ����������������� van der Goot�. 2000. ����������������� Adventures of a pore-forming toxin at the target cell surface. Trends Microbiol. 8:168-172. 10. Bravo, A., I. Gomez, J. Conde, C. Munoz-Garay, J. Sanchez, R. Miranda, M. Zhuang, S.S. Gill, and M. Soberon. ������ 2004. Oligomerization triggers binding of a Bacillus thuringiensis Cry1Ab pore-forming toxin to aminopeptidase N receptor leading to insertion into membrane microdomains. Biochim Biophys Acta. 1667:38-46. 11. Giddings, K.S., J.���������������������������������� Zhao, ��������������������������������� P.J.����������������������� Sims,����������������� ���������������������� and R.K. ������������ Tweten�. 2004. Human CD59 is a receptor for the cholesterol-dependent cytolysin intermedilysin. Nat. Struct. Mol. Biol. 11: 1163-1164. 12. Kondo, S., E������������������������������ . Mizuki���������������������� ���������������������������� , T. �������������������� Akao,������������ and�������� M.����� Ohba. ���� 2002. ���������������������� Antitrichomonal strains of Bacillus thuringiensis. Parasitol Res. 88:1090-1092. 13. Wei, J.Z., K������������������������������������������������������ .����������������������������������������������������� Hale,����������������������������������������������� L��������������������������������������������� ���������������������������������������������� . Carta, ������������������������������������������� E. Platzer, C.���������������������� Wong, ��������������������� S.C.����������� Fang, ���������� ���� and R.V. Aroian��. 2003. Bacillus thuringiensis crystal proteins that target nematodes. Proc. Natl. Acad. Sci. U. S. A. 100:2760-2765.

Minireview Kitada et al.

FIG. 4. An image of the world of Bt toxins and their application in the future. See the comment in the text.

and requires a GPI-protein, aminopeptidase N (9), and parasporin-2 requires GPI-proteins as described above. Another bacterial toxin, aerolysin from Aeromonas hydrophila, is also reported to need GPI-proteins to form the heptameric oligomer (10). Intermedilysin, which is a cholesterol-dependent cytolysin, selectively interacts with cholesterol and human GPI-protein, CD59 (11).

Prospects Since the discovery of a Bt bacterium in 1901, the world of Bt toxins has been greatly expanded in scientific and applied fields, such as commercial agriculture and forestry management (Fig. 4). Cry proteins have been also used in vector control for epidemic prevention of insect-mediated diseases such as African river blindness. Recently, Bt strains against parasitic protozoa Trichnomonas vaginalis are reported (12) and Cry proteins have now been shown to target nematode worms including the intestinal parasite Nippostrongylus brasiliensis (13), suggesting that Bt toxins may be used as parasiticides in the future. Yet just, in the last couple of years, human cancer cell-killing Bt toxins, parasporins, were discovered and they are characterizing at the molecular level. Although research on parasporins are still conducted in several laboratories now, in the near future, it is expected that the parasporin will attract a number of scientists and that their application along with Cry and other Bt toxins will continue to contribute to the field of medicine (Fig. 4).

27

6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact, Victoria BC, 2005 Côté, J.-C., Otvos, I.S., Schwartz, J.-L. and Vincent, C. (eds)

Using DNA Microarrays for Assessing Crystal Protein Genes in Bacillus thuringiensis Luke Masson1*, Jarek Letowski1, Alejandra Bravo2, and Roland Brousseau1 1 2

National Research Council of Canada, Biotechnology Research Institute, Montreal, Quebec, Canada, H4P 2R2 Instituto de Biotecnología, Universidad Nacional Autónoma de México, Cuernavaca, Morelos, Mexico, 62250.

Keywords: cry Array, microarray, cry genes, hybridization

A DNA microarray (cryArray) was designed to identify cry gene contents of Bacillus thuringiensis (Bt) strains. A consentaneous approach was used in which multiple DNA cry-specific probes must all produce a positive hybridization signal to confirm a cry gene’s presence. The immobilized cry-specific oligonucleotide probes agreed with the cry contents of known or PCR-validated Bt strains. In one strain, the cryArray was able to detect the presence of a novel cry1I gene. Since the cryArray can replace hundreds of individual PCR reactions, it should become a valuable tool for fast screening of new Bt isolates presenting interesting insecticidal activities. Although many Cry proteins are structurally and functionally similar, the diversity of Cry toxins and their insecticidal spectra is immense. More than 280 different Cry toxins are organized into 46 primary ranks based on amino acid similarities (1). Cry1 toxins are the largest and best known family having over 130 entries in the Cry databank. Since many Bt strains typically harbor one to nine cry genes, some of which are known to be cryptic (2), it is clear that to assess the complete cry gene content of unknown Bt strains, a technology possessing good parallel processing capabilities is required. Since DNA microarrays possess this ability to simultaneously hybridize with thousands of different genes, a cry gene microarray (cryArray) was designed which contained cry1 gene-specific oligonucleotides, each spotted and immobilized in triplicate. Various other cry gene primary ranked classes were also included (Fig. 1).

well-characterized laboratory or commercial Bt single gene strains (HD-73 or Bt subsp. kenyae; cry1Ac or cry1E). Known multi-gene strains (HD-1 or HD-133) were subsequently used to validate this approach (data not shown). By creating a series of family primers, the cryArray also possessed the ability to detect unknown gene variants within a particular family. An illustration of this is provided in Fig. 2. In this case, the cry1I family primers (secondary ranked) produced a positive hybridization signal from genomic DNA of an unknown Bt strain (IB360) obtained from a Mexican culture collection (3), yet all of the tertiary oligonucleotide probes were negative. The family primers were used to amplify the gene which was sequenced and confirmed to be a novel cry1I gene. As shown in Fig. 3, sufficient homology existed to the family primers to result in positive hybridization signals, whereas, apart from one of two cry1Ia probes, insufficient similarity at the tertiary level resulted in negative signals.

All oligonucleotides were spotted in triplicate (horizontally). The dotted box on the left represents primary ranked cry genes. The dashed box on the right represents the different secondary ranked cry1 gene families. Hybridizations performed with 750 nags (5 ng/mm2) of Cy5-labeled amplified genomic DNA gave sufficiently clear results by producing strong fluorescent signals. The array was constructed using a consentaneous approach so that the presence of any given gene is confirmed only if all the secondary rank probes and all higher rank probes targeting different regions within the gene produced positive hybridization signals. Initial hybridizations were carried out using

By adding oligonucleotide probes to those present on the existing cryArray, probing the array with fluorescently labeled DNA-free RNA allowed the determination of cry gene expression (Fig. 4). Figure 4 shows all three cry1A genes producing positive signals with Cy-5 labeled mRNA, whereas the DNA cry gene detection probes remained negative. In conclusion, we found that DNA microarrays can generally provide single oligo cry gene discrimination

* Corresponding author. Mailing address : National Research Council of Canada, Biotechnology Research Institute, 6100 avenue Royalmount, Montreal, Quebec, Canada, H4P 2R2. Tel: 514-496-6150. Fax: 514-496-6312. Email: [email protected]

28

down to the secondary rank but that a consentaneous or ‘multiple oligo’ approach is needed to achieve discrimination down to the tertiary rank level. Finally, by incorporating complementary oligonucleotide probes, cry gene activity (expression) could be monitored by direct RNA labeling which allows discrimination between active versus cryptic or disrupted genes.

References 1. Crickmore, N. 2006 Full list of delta-endotoxin. URL: http://www. biols.susx.ac.uk/Home/Neil_Crickmore/Bt/index.html. Accessed Feb. 2006. 2. Masson, L., M. Erlandson, M. Puzstai-Carey, R. Brousseau, V. Juárez-Pérez, and R. Frutos. 1998. A holistic approach for determining the entomopathogenic potential of Bacillus thuringiensis strains. Appl. Environ. Microbiol. 64:4782-4788. 3. Bravo, A., S. Sarabia, L. Lopez, H. Ontiveros, C. Abarca, A. Ortiz, M. Ortiz, L. Lina, F. J. Villalobos, G. Peña, M.-E. NuñezValdez, M. Soberón, and R. Quintero. 1998. Characterization of cry genes in a Mexican Bacillus thuringiensis strain collection. Appl. Env. Microbiol. 64:4965-4972.

FIG. 1. cryArray key of the tertiary cry1 genes.

29

FIG. 2. Scanned image of microarrays hybridized with Cy5-labeled genomic DNAs from B. thuringiensis strain IB360. Probes belonging to the same cry gene target are grouped inside the individual squares.

IB360 cry1Ia

tattgcgggtaaaatacttggCaccctaggcgttccttttgcaggacaag tattgcgggtaaaatacttggTaccctaggcgttccttttgcaggacaag

IB360 cry1Ia

tattCccaagctatgatacacTTGtAtatccaattaaaactacTTcTca tattTccaagctatgatacacAAAtGtatccaattaaaactacAGcCca

IB360 cry1Ib

gGgttgatttTcattggaaattCGTcacAcATccGatCgcatctgataat gAgttgatttCcattggaaattTCCcacGcTAccAatAgcatctgataat

IB360 cry1Ib/c

aacacAAgGgcTaggagtgtTgtcaagaGccaatatatcgcattagaaT aacacTCgAgcGaggagtgtAgtcaagaAccaatatatcgcattagaaC

IB360 cgtacaaatacaattgagccaaatagcattacacaaataccattagtaaa cry1I general cgtacaaatacaattgagccaaatagcattacacaaataccattagtaaa IB360 agatAtaccaattccatacgtcaattaacggtaaagctattaatcaaggta cry1I general agatTtaccaattccatacgtcaattaacggtaaagctattaatcaaggta FIG. 3. Sequence comparison of the cry1I amplicon from Bt strain IB360 to cry1I-specific immobilized cryArray probes. Differences between the cry1I gene amplified from strain IB360 and the immobilized specific secondary or tertiary cry1I-derived gene sequence are shown in large, boldfaced capital letters.

cry1Aa cry1Ab cry1Ac

cry1Aa cry1Aa cry1Ab

cry1Ab cry1Ac buffer

FIG. 4. Partial image of a cryArray hybridized with total RNA from Bt strain HD-1. The white box on the left contains negative strand-specific oligonucleotides normally used to detect cry1Aa, b and c genes. The probes on the right represent complementary probes to the cry1A genes on the left.

30

6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact, Victoria BC, 2005 Côté, J.-C., Otvos, I.S, Schwartz, J.-L. and Vincent, C. (eds)

Cloning and Expression of cry1Aa, cry1Ab, cry1C, and cry1Da Genes from Bacillus thuringiensis var. aizawai Jen-Chieh Cheng1, Feng-Chia Hsieh2, Bing-Lan Liu1, and Suey-Sheng Kao2*. Graduate Institute of Applied Chemistry, Chaoyang University of Technology, Taichung 413, Taiwan, ROC; Biopesticides Division, Taiwan Agricultural Chemicals and Toxic Substances Research Institute, Council of Agriculture, Taichung 413, Taiwan, ROC. 1 2

Keywords: Bacillus thuringiensis subsp. aizawai; insecticidal crystal protein (ICP); response surface methodology (RSM).

Four cry genes (cry1Aa, cry1Ab, cry1C and cry1Da) were cloned separately from a commercial product Xentari (based on Bacillus thuringiensis var. aizawai) and expressed in an acrystalliferous B. thuringiensis (Cry-B) respectively. Total protein produced by recombinant strains of cry1Aa, cry1Ab, cry1C and cry1Da were 640, 1700, 1400 and 1500 μg/mL respectively which caused more than 93% mortality against 3rd-instar larvae of Plutella xylostella (Lepidoptera) and 96% mortality against 2nd-instar larvae of Trichoplusia ni (Lepidoptera). The LC50, expressed in ppm of the total protein against 2nd-instar larvae of T. ni from recombinant strains of cry1Aa, cry1Ab, cry1C and cry1Da after 72 h incubation, were 24.9, 13.4, 7.3 and 13.2 μg/mL respectively. Response surface methodology (RSM) was applied to find the optimal ratio of protein combination from recombinant strains of cry1Ab and cry1C against 2nd-instar larvae of T. ni. Results showed that the optimal ratio of protein mixture from cry1Ab and cry1C was 27.8 and 24.6 μg/mL respectively, which gave a mortality of 97.8% against 2nd-instar larvae of T. ni. The conventional method for multifactor experimental designs is time-consuming and cannot detect the true optimum, notably because of interactions among factors. Response surface methodology (RSM) is one of the worthwhile techniques to identify the explanatory variable in the system (3, 4, 6). Generally, RSM can be used to evaluate the relative significance of several factors, optimization of microbiological media culture conditions, and synthesis of metabolites, etc. Insecticides derived from the soil bacterium Bacillus thuringiensis are becoming an increasingly important component of ecologically sound pest management. Insecticidal crystal proteins from B. thuringiensis are extremely toxic to many pests and have been a primary focus of much recent research (5, 7). In this report we tentatively explore the synergism between recombinants by RSM. RSM was applied to find optimal ratio of protein combination from recombinant strains containing cry1Ab and cry1C genes ������������������� (1����������������� , 2�������������� )������������� against 2ndinstar larvae of Trichoplusia ni. Multiple regression analysis was carried out with Statistical 7.0 (Statsoft Inc., Tulsa, Ok, USA).

expressed in an acrystalliferous B. thuringiensis (cry-B) respectively. 2) Total protein produced by recombinant strains of cry1Aa, cry1Ab, cry1C and cry1Da were 640, 1700, 1400 and 1500 μg/mL respectively, which caused more than 94% mortality to 3rd-instar larvae of Plutella xylostella ������������������������������������������ and 96% mortality to 2nd-instar larvae of Trichoplusia ni.���������� 3) ��������� The LC50 expressed in ppm of the total protein against 2nd-instar larvae of T. ni from recombinant strains of cry1Aa, cry1Ab, cry1C and cry1Da after 72h incubation were 24.50, 13.39, 8.57 and 12.47 μg/mL respectively. 4) RSM can be applied to find the optimal ratio of protein combination from different recombinant strains against insect-larvae tested (Fig. 2). In the present study, the RSM is developed to improve the potency of B. thuringiensis toxin that may contribute to the success of resistance management. It is expected that RSM can also be employed to broaden the host spectrum of B. thuringiensis toxin as long as with optimal combination.

References 1. Chak, K. F., M. Y. Tseng,����������������� and ���������������� T. Yamamoto�. 1994.��������������� �������������������� Expression �������������� of the crystal protein gene under the control of the α-amylase promoter in Bacillus thuringiensis strains. Appl. Environ. Microbiol. 60�:2304-2310. 2. Crickmore, N., ���������������������������������������������������� D��������������������������������������������������� . R������������������������������������������������ ������������������������������������������������� . Zeigler, E. Schnepf, J. Van Rie, D. Lereclus, J. Baum, A. Bravo, and D. H. Dean. 2005.� Bacillus thuringiensis toxin nomenclature. www.boils.susx.ac.uk/Home/Neil_Crickmore/Bt/index.html (Dec 10, 2005).

We have four conclusions as follows: 1) Four cry genes (cry1Aa, cry1Ab, cry1C and cry1Da) were cloned separately (Fig. 1) from a commercial product Xentari (based on Bacillus thuringiensis subp. aizawai) and

* Corresponding author. Mailing address : Biopesticides Division, Taiwan Agricultural Chemicals and Toxic Substances Research Institute, Council of Agriculture, Taichung 413, Taiwan, ROC. Tel: 886 4 330 2101. Fax: 886 4 332 3073. Email: [email protected]

31

Path of steepest ascent Orthogonal 1st order regression

3. Giovanni, M. I. 1983. Response surface methodology on product optimization. Food technol. 11:41-45. 4. Khuri, A. I., and J. A. Cornell. 1987. Determining optimum conditions. p.149-205. In A. I. Khuri, and J. A. Cornell (ed.), Response surface methodology. Marcel Dekker, New York. 5. Kao, S. S., F. C. Hsieh, C. C. Tzeng, and T. S. Tsai. 2003. Cloning and expression of the insecticidal crystal protein gene cry1Ca9 of Bacillus thuringiensis G10-01A from Taiwan granaries. Curr. Microbiol. 47: 295-299. 6. Thomson, D.1982. Response surface experimentation. J. Food Proce. Preser. 6:155-188. 7. Yang, C. Y., J. C. Pang, S. S. Kao, and H. Y. Tsen. 2003. Enterotoxigenicity and cytotoxicity of Bacillus thuringiensis strains and development of a process for Cry1Ac production. J. Agric. Food Chem. 51:100-105.

Factors or VariablF esactors or Variables (2k Fractional fact(o2rkiaFl rdaecstiognna)l factorial design)

k (2 Fractional factorial design)

Factors or Variables Orthogonal 1st ordOerrthreoggroensaslio1nst order regression

Path of steepest asPcaetnht of steepest ascent

k 2k Factorial experi2m eFnatcstoprliuasl setxapr eproim inetsntasnpdlus star points and central points (Fivcee-nletrvaellpfoacintotsri(aFl ivde-sliegvne)l factorial design)

Multiple regressioM n ultiple regression

Checking the adeqCuhaeccykoinf gthtehemaadtehqeumaactyicoafl m thoe dmelathematical model

FIG. 2. The systematic diagram of response surface methodology.

FIG. 1. Construction of cry1Aa, cry1Ab, cry1C, and cry1Da genes with shuttle vector pαHY300.

32

6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact, Victoria BC, 2005 Côté, J.-C., Otvos, I.S, Schwartz, J.-L. and Vincent, C. (eds)

Redesigning Bacillus thuringiensis Cry1Aa Toxin into a Mosquito Toxin Xinyan Sylvia Liu, and Donald H. Dean* Department of Biochemistry, The Ohio State University,Columbus, OH, U.S.A., 43210-1292 Keywords: mosquito, protein engineering

The Bacillus thuringiensis crystal protein Cry1Aa is normally selectively active against caterpillar larvae. Through rational design, toxicity (LC50 45 µg/ml) to the mosquito Culex pipiens was introduced by selected deletions and substitutions of loop residues of domain II. Toxicity to its natural target Manduca sexta was concomitantly abolished. The successful grafting of the alternate mosquito toxicity onto the original lepidopteran Cry1Aa toxin demonstrates the possibility of designing and engineering a desired toxicity into any toxin of a common scaffold by reshaping the receptor binding region with desired specificities. Bacillus thuringensis (Bt), an aerobic, gram-positive spore-forming bacterium commonly found in soil, produces parasporal crystal (Cry) proteins with insecticidal activity against a wide range of pests. The structure and function of these toxins is well reviewed (4, 11, 17, 27). The N-terminal domain I is a bundle of eight α-helices with the central, relatively hydrophobic helix surrounded by amphipathic helices. Domain I reportedly functions in the formation and operation of ion channels (27). Domain II, consisting of three anti-parallel β-sheets connected by loops, has been linked to specific receptor binding (27). The C-terminal domain III adopts a lectin-like β-sandwich topology. A number of functional roles have been suggested for this domain, including receptor binding (7, 18, 20) and ion channel formation (8, 28, 32).

activity against the gypsy moth, Lymantria dispar (25). More extensive deletions and substitutions of domain II loop regions of a mosquitocidal toxin, Cry4Ba, gained toxicity to Culex, while its toxicity to the natural target species, Anopheles and Aedes, was not negatively affected (1). However, to date no manipulation of Cry proteins has completely changed the specificity of a toxin to a different order of insect. This project was a test of the ability of rational design, based on current knowledge of receptor binding epitopes, to synthesize a completely new activity into a Cry protein. Cry1Aa and Cry4Ba are presumed to share a similar mode of action, but target distinct insect species. With its known tertiary structure and relatively well characterized receptor binding regions, Cry1Aa is an ideal candidate for the design of alternate specificity. Cry1Aa is a lepidopteran toxin with no natural activity toward mosquitoes. In this study, we have altered domain II loops of Cry1Aa to introduce mosquito toxicity.

Due to the enormous selective pressure imposed by widespread use of Bt Cry proteins in agriculture worldwide, the development of better Cry toxins is of ever increasing importance. The ultimate goal of protein engineering of the insecticidal Cry proteins is to be able to design any Cry toxin to possess toxic activity against any insect. A more immediate goal is to introduce a specific activity into a toxin that does not possess it.

Loop regions are excellent targets for genetic redesigning of novel toxins with diverse specificity by exchanging residues or chain lengths of the active sites without major disruption of the overall integrity of the toxin. Previously, we predicted the loop sequences of Cry4Ba (1). This prediction was recently verified with the elucidation of the toxin’s 3-D structure (6).

Several examples of protein engineering of Cry toxins have demonstrated enhancements of activity in toxins that already expressed some level of activity. In vivo domain substitutions of Cry1Ab resulted in a 4-fold enhancement of activity against Spodoptera (12). Sitedirected mutations of individual residues in domain II loop regions of Cry3Aa led to a 10-fold increase of activity against Tenebrio molitor (33) and mutations in domain II loop regions of Cry1Ab resulted in a 34-fold increase in

Based on secondary sequence alignment (done by Clustal W) and structural analysis (done by Swissmodel) of lepidopteran-specific Cry1Aa and dipteranspecific Cry4Ba, significant differences in length and composition were found in the first two of three

* Corresponding author: Department of Biochemistry, The Ohio State University, 484 W. 12th Ave., Columbus, Ohio, USA, 43210. Tel: (614) 292-8829. Fax: (614) 292-3206. E-mail: [email protected]

33

loops in domain II of Cry1Aa and Cry4Ba (4BL3PAT). Interestingly, it was reported by Abdullah et al. (1) that when loop 3 (PAT) of 4BL3PAT was replaced by GAV, a Cry1Aa homologous loop sequence, its toxicity toward mosquito Culex was further enhanced. For this reason the third loop of Cry1Aa was left unchanged in the subsequent protein engineering work.

Expression and purification of the crystal toxins was essentially as described elsewhere (14). The near UV spectral region of wild-type and mutant Cry1Aa showed no significant variation, indicating that the defined tertiary structure was not disturbed (data not shown). The gradual differences in far UV region agree with the changing ratio of loop components. The results of bioassays on C. pipiens larvae (shown in Table 1) indicate that Cry1Aa wild-type and intermediate mutants (L1, D3, L1D3) have no apparent toxicity, while 1AaMosq with triple mutations in both loops 1 and 2 has enhanced activity against C. pipiens at µg/ml levels. Concomitant with the gain in mosquito toxicity, toxicity toward Manduca sexta determined by surface contamination bioassay was abolished during several rounds of changes in loop residues, confirming the importance of domain II loops in specificity and activity.

The first two loop regions of Cry1Aa were changed by site-directed mutagenesis, using 4BL3PAT as a template. Loop 1 (residues 311RG312) in Cry1Aa was replaced by YQDL, the loop 1 sequence in Cry4Ba, to extend its length. This mutant was named L1. Cry1Aa loop 2, LY367RRIILGSGPNNQ378, was altered in two separate steps. LYRRIIL was first deleted to produce an intermediate mutant called D3. The loop 1 mutation in L1 was then introduced to D3 creating a reference mutant called L1D3. When changed individually or in combination, none of L1, D3 and L1D3 gave rise to a mosquitocidal toxin. Under the guidance of molecular modeling, a third mutant named 1AaMosq with an additional substitution of NNQ by G was built into L1D3 to mimic the shorter second loop in Cry4Ba but maintain the turn between two β-sheets.

The idea of using a protein of known three-dimensional structure to present motifs of various functions or specificity has been a primary goal of protein engineering (16). The use of so-called protein scaffolds for generation of novel binding proteins via combinatorial engineering has emerged as a powerful alternative to natural or recombinant antibodies (22).

Shown in Fig. 1 are the solved structure of Cry1Aa wildtype toxin and the modeled structure of 1AaMosq mutant. The loops at the bottom of the molecules are loops 1, 2, and 3 from the right to left. Loop 1 is elongated when RG was mutated to YQDL, the relatively long loop 2 is shortened to merely a turn by two rounds of deletion, while loop 3 was left unchanged in 1AaMosq.

The results of this study are an example of enhancing Cry toxicity through an approach that integrates sequence comparison, computational prediction and rational design by mutagenesis. Table 2 shows the toxicity of known mosquitocidal toxins from Bt and B. sphaericus. Toxicity of engineered Cry1AaMosq is greater than that

FIG. 1. Structures of Cry1Aa wild type toxin and 1Aa Mosq mutant toxin. On the left is the structure of Cry1Aa wild type toxin. On the right is the modelled structure of 1AaMosq mutant toxin. The loops at the bottom of the molecules are loops 1, 2 and 3 from the right to left. Loop 1 is elongated, loop 2 is shortened and loop 3 is left unchanged in 1AaMosq.

34

TABLE 1. Bioassay results of Cry4Ba and Cry1Aa toxins to Manduca sexta and Culex pipiens.

LC50 Toxins

Manduca sexta a (ng/cm2)

Culex pipiens b

4BL3PAT

NDd

95 ng/ml (69-130) e

4BL3GAV

ND

70 ng/ml (34-129) e

1Aa

3.37(1.92-7.67)

no mortality c

1Aa L1

6.29(4.48-7.98)

no mortality c

1Aa D3

10.67(6.39-43.30)

no mortality c

1Aa L1D3

1664(1302.15-2175.93)

no mortality c

1AaMosq

no mortality

45.73 µg/ml (32.18-59.76)

d

a. Two-day old larvae of M. sexta were used for bioassays. Mortality was recorded after 5 days exposure to a serial dilution of the toxins. The 95% confidence limit is indicated in parentheses.b. Two-day old larvae of C. pipiens were used for bioassays. Mortality was recorded after 24 hours exposure to a serial dilution of the toxins. c. No mortality at 100µg/ml. d. ND: not determined. e. Cited from Abdullah et al. (1) TABLE 2. Toxicity of mosquitocidal proteins ranges of reported toxicity (ng/ml).

A.

A.



aegypti

quadrimaculatus stephansi

Cry1Aa

not active

A.

A.

C.

gambiae

quinquefasciatus pipiens

not active

Cry1AaMosq

C. Ref.

not active

this work

42,000

this work

Cry1C

141,000

283,000

126,000

Cry2Aa

500-1000

38

--

--

1630

>200,000

(5, 10, 21, 31)

563-1600



7400

1117

251-980

400

(3, 13)

61

25





>80,000

>20,000

(2, 13)

3



65

95

(1)



114

37

(2)

not active

(14, 30)

268-37

(9, 14)

Cry4Aa Cry4Ba



4BRAL3PAT

53

44

4BRAL3GAV

44

52

Cry10Aa

low toxicity

not active

Cry11Aa

20-287

455



39.7-64

(29)

Cry11Ba

18-30

42.7



6.5

Cry11Bb

17.9

166.3 (A. albimanus)



34.1

Cry19Aa

1,400,000

3



35

Cry19Ba

nd

Cry20Aa

648,000

1039

not active

(15, 23, 24) 10

(14, 23)

6-187

(2)

7520

(26)

(23)

700,000

(19)

Non-Cry Proteins BinA-B

not active

not active

of several natural toxins (Cry1Ca, Cry2Aa, Cry4Ba and Cry20Aa). The successful grafting of the alternate mosquito toxicity onto the original lepidopteran Cry1Aa toxin demonstrates the possibility to design and engineer desired toxicity into any toxin of a common scaffold by reshaping the receptor binding region with desired specificities. By varying the specificity elements in loop regions on a general scaffold, a customized toxin can be selectively tuned to target different insect species.

15.4-487

(21a)

Acknowledgements We thank Dr. Mohd A. F. Abdullah for valuable discussion at the outset of the project and Bin Ni for technical assistance. This work was supported by NIH grant to D.H. Dean and M.J. Adang (Grant # R01 AI 29092).

35

References

and Bacillus thuringiensis and in a leaf-colonizing strain of Bacillus cereus. Appl. Environ. Microbiol. 60:896-902. 21a.Nicolas, L., C. Nielsen-Leroux, J.-F. Charles, and A. Delecluse. 1993. Respective role of the 42- and 51-kDa components of the Bacillus sphaericus toxin overexpressed in Bacillus thuringiensis. FEMS Microbiol. Lett. 106:275-280. 22. Nygren, P. A., and A. Skerra. 2004. Binding proteins from alternative scaffolds. J Immunol Methods. 290:3-28. 23. Orduz, S. 1998. Sequence of the cry11Bb1 gene from Bacillus thuringiensis subsp. medellin and toxicity analysis of its encoded protein. Biochim. Biophys. Acta 1388:267-272. 24. Poncet, S., A. Delécluse, A. Klier, and G. Rapoport. 1995. Evaluation of synergistic interactions between the CryIVA, CryIVB and CryIVD toxic components of B. thuringiensis subsp. israelensis crystals. J. Invert. Pathol. 66:131-135. 25. Rajamohan, F., O. Alzate, J. A. Cotrill, A. Curtiss, and D. H. Dean. 1996. Protein engineering of Bacillus thuringiensis dendotoxin: mutations at domain II of Cry1Ab enhance receptor affinity and toxicity towards gypsy moth larvae. Proc. Natl Acad. Sci. USA 93:14338-14343. 26. Rosso, M. L., and A. Delecluse. 1997. Contribution of the 65-kilodalton protein encoded by the cloned gene cry19A to the mosquitocidal activity of Bacillus thuringiensis subsp. jegathesan. Appl. Environ. Microbiol. 63:4449-4455. 27. Schnepf, E., N. Crickmore, J. VanRie, D. Lereclus, J. Baum, J. Feitelson, D. R. Zeigler, and D. H. Dean. 1998. Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol. Mol. Biol. Rev. 62:775806. 28. Schwartz, J. L., L. Potvin, X. J. Chen, R. Brousseau, R. Laprade, and D. H. Dean. 1997. Single site mutations in the conserved alternating arginine region affect ionic channels formed by CryIAa, a Bacillus thuringiensis toxin. Appl. Environ. Microbiol. 63:3978-3984. 29. Smith, G. P., J. D. Merrick, E. J. Bone, and D. J. Ellar. 1996. Mosquitocidal activity of the CryIC d-endotoxin from Bacillus thuringiensis subsp. aizawai. Appl. Environ. Microbiol. 62:680-684. 30. Thorne, L., F. Garduno, T. Thompson, D. Decker, M. A. Zounes, M. Wild, A. M. Walfield, and T. J. Pollock. 1986. Structural similarity between the lepidoptera- and diptera-specific insecticidal endotoxin genes of Bacillus thuringiensis subsp. “kurstaki” and “israelensis”. J. Bacteriol. 166:801-811. 31. Widner, W. R., and H. R. Whiteley. 1989. Two highly related insecticidal crystal proteins of Bacillus thuringiensis subsp. kurstaki possess different host range specificities. J. Bacteriol. 171:965-974. 32. Wolfersberger., M. G., X. J. Chen, and D. H. Dean. 1996. Site-directed mutations in the third domain of Bacillus thuringiensis d-endotoxin CryIAa affects its ability to increase the permeability of Bombyx mori midgut brush border membrane vesicles. Appl. Environ. Microbiol. 62:279-282. 33. Wu, S. J., C. N. Koller, D. L. Miller, L. S. Bauer, and D. H. Dean. 2000. Enhanced toxicity of Bacillus thuringiensis Cry3A deltaendotoxin in coleopterans by mutagenesis in a receptor binding loop. FEBS Lett. 473:227-32.

1. Abdullah, M. A., O. Alzate, M. Mohammad, R. J. McNall, M. J. Adang, and D. H. Dean. 2003. Introduction of Culex toxicity into Bacillus thuringiensis Cry4Ba by protein engineering. Appl. Environ. Microbiol. 69:5343-53. 2. Abdullah, M. A., and D. H. Dean. 2004. Enhancement of Cry19Aa mosquitocidal activity against Aedes aegypti by mutations in the putative loop regions of domain II. Appl. Environ. Microbiol. 70:3769-71. 3. Angsuthanasombat, C., N. Crickmore, and D. J. Ellar. 1992. Comparison of Bacillus thuringiensis subsp. israelensis CryIVA and CryIVB cloned toxins reveals synergism in vivo. FEMS Microbiol. Lett. 94:63-68. 4. Aronson, A. I., and Y. Shai. 2001. Why Bacillus thuringiensis insecticidal toxins are so effective: unique features of their mode of action. FEMS Microbiol. Lett. 195:1-8. 5. Audtho, M. 2001. Mode of Action of Bacillus thuringiensis Cry2Aa. Ph.D. thesis. The Ohio State University, Columbus, Ohio, USA. 6. Boonserm, P., P. Davis, D. J. Ellar, and J. Li. 2005. Crystal structure of the mosquito-larvicidal toxin Cry4Ba and its biological implications. J. Mol. Biol. 348:363-382. 7. Burton, S. L., D. J. Ellar, J. Li, and D. J. Derbyshire. 1999. Nacetylgalactosamine on the putative insect receptor aminopeptidase N is recognised by a site on the domain III lectin-like fold of a Bacillus thuringiensis insecticidal toxin. J. Mol. Biol. 287:1011-1022. 8. Chen, X. J., M. K. Lee, and D. H. Dean. 1993. Site-directed mutations in a highly conserved region of Bacillus thuringiensis deltaendotoxin affect inhibition of short circuit current across Bombyx mori midguts. Proc. Natl Acad. Sci. USA 90:9041-5. 9. Crickmore, N., E. J. Bone, J. A. Williams, and D. J. Ellar. 1995. Contribution of the individual components of the d-endotoxin crystal to the mosquitocidal activity of Bacillus thuringiensis subsp. israelensis. FEMS Microbiol. Lett. 131:249-254. 10. Dankocsik, C., W. P. Donovan, and C. S. Jany. 1990. Activation of a cryptic crystal protein gene of Bacillus thuringiensis subspecies kurstaki by gene fusion and determination of the crystal protein insecticidal specificity. Mol. Microbiol. 4:2087-2094. 11. de Maagd, R. A., A. Bravo, and N. Crickmore. 2001. How Bacillus thuringiensis has evolved specific toxins to colonize the insect world. Trends Genet. 17:193-9. 12. de Maagd, R. A., M. S. G. Kwa, H. van der Klei, T. Yamamoto, B. Schipper, J. M. Vlak, W. J. Stiekema, and D. Bosch. 1996. Domain III substitution in Bacillus thuringiensis CryIA(b) results in superior toxicity for Spodoptera exigua and altered membrane protein recognition. Appl. Environ. Microbiol. 62:1537-1543. 13. Delécluse, A., S. Poncet, A. Klier, and G. Rapoport. 1993. Expression of cryIVA and cryIVB genes, independently or in combination, in a crystal-negative strain of Bacillus thuringiensis subsp. israelensis. Appl. Environ. Microbiol. 59:3922-3927. 14. Delécluse, A., M.-L. Rosso, and A. Ragni. 1995. Cloning and expression of a novel toxin gene from Bacillus thuringiensis subsp. jegathesan encoding a highly mosquitocidal protein. Appl. Environ. Microbiol. 61:4230-4235. 15. Donovan, W. P., C. Dankocsik, and M. P. Gilbert. 1988. Molecular characterization of a gene encoding a 72-kilodalton mosquito-toxic crystal protein from Bacillus thuringiensis subsp. israelensis. J. Bacteriol. 170:4732-4738. 16. Dunn, B. D., and J. Bungert. 2003. Two hands (or four) are better than one: A bacterial protease inhibitor provides a scaffold for the in vitro evolution of specific inhibitors of human serine proteases. Nature Biotechnology 21:1019 - 1021. 17. Jenkins, J. L., and D. H. Dean. 2000. Exploring the mechanism of action of insecticidal proteins by genetic engineering methods, p. 33-54. In J. K. Setlow (ed.), Genetic Engineering: Principles and Methods, vol. 22. Springer, New York, USA  18. Jenkins, J. L., M. K. Lee, A. Curtiss, and D. H. Dean. 2000. Bivalent sequential binding by two domains of a Bacillus thuringiensis toxin to gypsy moth aminopeptidase-n receptor. J. Biol. Chem. 275:14423-14431. 19. Lee, H. K., and S. S. Gill. 1997. Molecular cloning and characterization of a novel mosquitocidal protein gene from Bacillus thuringiensis subsp. fukuokaensis. Appl. Environ. Microbiol. 63:46644670. 20. Lee, M. K., T. H. You, F. L. Gould, and D. H. Dean. 1999. Identification of residues in domain III of Bacillus thuringiensis Cry1Ac toxin that affect binding and toxicity. Appl. Environ. Microbiol. 65. 21. Moar, W. J., J. T. Trumble, R. H. Hice, and P. A. Backman. 1994. Insecticidal activity of the CryIIA protein from the NRD-12 isolate of Bacillus thuringiensis subsp. kurstaki expressed in Escherichia coli

36

6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact, Victoria BC, 2005 Côté, J.-C., Otvos, I.S, Schwartz, J.-L. and Vincent, C. (eds)

Development and Application of Molecular Tools for Exposure,Toxicity and Pathogenicity Characterization of Bacillus cereus Group Organisms in Context of Biotechnology Use Vern Seligy,1* Gordon Coleman,1 Jennifer Crosthwait,1 Kathy Nguyen,1 Phil Shwed1, Azam Tayabali,1 George Arvanitakis, 2 Della Johnston, 2 Louis Bryden,3 Michael Mulvey, 3 Brian Belliveau,4 and Esther Seto4 Environmental & Occupational Toxicology, Safe Environments Programme, Health Canada, Ottawa, Ontario, Canada, K1A 0K9 2 Biotechnology, Product Safety Programme (PSP) of the Healthy Environments and Consumer Safety Branch (HECSB), Health Canada, Ottawa, Ontario, Canada, K1A 0k9. 3 Antimicrobial Resistance & Nosocomial Infections, National Microbiology Laboratory, Public Health Agency, Health Canada, Winnipeg, Manitoba, Canada, R3E 3R2. 4 Microbial & Pheromone Evaluation, Pest Management Regulatory Agency (PMRA), Health Canada, Ottawa, Ontario, Canada,K1A 0k9. 1

Keywords: antibiotics, cytokines, enterotoxins, fatty acids, genomics/microarrays, hemolysin, PCR

Both industry and regulators are interested in standardized methods, which can rapidly assess any MO or their subcomponents (or product formulation) for in vivo-relevant toxicological effects. In previous research, we focussed on developing in vitro approaches, which parallel assessment of dose effects of chemical contaminants (9,14,16), and allow quantification of cell/tissue specific multi-gene/protein indicators to inform on mode of toxification or immunologic effects. Here, we covered research approaches that make use of the latest advances in genomics of Bc group organisms and comparative murine and human immuno- and toxico- genomics/proteomics knowledge, and tools, which allows us to harmonize again with chemical testing, and earlier Bc group clinical tests and infection studies involving mouse models (6,7). The genotyping by microarray analysis validates the relatedness of Bt strains to Bc14579 (type strain), and also sharing of a number of factors that could be possibly engineered out of future biotech strains, if needed. This approach may be very important in addressing quorum-sensing factors (e.g., germination, chemotaxic signal factors, and pleiotropic regulators such as plcR and papR) which can coordinate expression/repression of genes (e.g., antibiotic resistance, and various hydrolytic enzymes and toxin-like activities) in mixed bacterial populations (3,4,7,9). Introduction toxicity, and pathogenic / immunogenic potentials, using in vitro and in vivo strategies.

The Bacillus genus contains taxa of interest to biotechnology (e.g., use in bioremediation and pest control), and also some of clinical concern. A key example is within the B. cereus (Bc) group, which includes Bc sensu stricto, B. anthracis (Ba) and B. thuringiensis (Bt). Interspecies comparisons indicate sharing of chromosomal features (e.g. cell cycle/ differentiation and adaptive functions including several virulence factors). Because of this sharing, there is need to qualify the intrinsic identity and safety status of the several dozen putative Bt subspecies which have commercial potential for scale-up applications and environmental release. Here, we survey some key criteria, tools and data relevant for use in assessment of Bc and Bt organisms covered by regulations under the Canadian Environmental Protection Act (1999) and the Pest Control Product Act. The tools featured here address species/strain identification, and scanning

Background Bacterial diversity and knowledge gaps. The Bacillus genus comprises 181 officially recognised species, and over two dozen taxa of biotech interest, including strains of B. sphaericus, B. cereus (Bc) (sensu stricto) and B. thuringiensis (Bt) which are relevant to this conference (1). The latter two species, along with B. anthracis (Ba) as well as three others comprise the B. cereus (Bc) group (2-4). This grouping is based on a number of shared biochemical, morphologic and physiologic (polyphasic) characteristics, and recent data indicating a high degree of relatedness at both gene and chromosome (synteny) levels (3-5). Currently, there are several hundred strains of each species in various collections. As well, there are several dozen candidate

* Corresponding author. Mailing address: Environmental & Occupational Toxicology, Safe Environments Programme, Health Canada, 0803A Tunney’s Pasture, Ottawa, Ontario, Canada, K1A 0K9.. Tel: 613 952 5852. Fax: 613 941 4546. Email: [email protected]

37

Bt subspecies, but none are officially recognised (1). Designation of strains to the Ba and Bt taxa, rather than Bc, relies on a few phenotypic features, which are mostly extra-chromosomally encoded (2-4). Less is known about the overall genomic organization of most Bc strains and Bt strains/subspecies compared to Ba strains, and how they might function in mammalian physiologic environments. Isolates are assigned to the Bt taxon based on presence of cry genes, and/or their encoded Cry endotoxins, and/or their associated parasporal inclusion body (PIB) structures, and/or flagellar serotype (H antigen) (5). However, these traits may be variably shared, transmitted and/or expressed. H-antigen serotyping is not always reliable because frequency of common flagellar antigens is very high between Bt and Bc strains (5). In addition to the many biotech-related strain collections under study within many countries, there are clinical collections of Bt strains exhibiting pathogenic effects (4,6-10). Genomic mapping will enable approaches to distinguish benign from pathogenic members of the Bc group.

Public safety and regulatory oversight. The session “Public Safety” as organized for this conference, includes this paper and two others, which address performance of past and recently used commercial formulations derived from Bt kurstaki (Btk) or israelensis (Bti). As a reference point, “Public Safety” (the prevention and protection of the general public from all manners of harm) is usually considered the domain of Emergency Services organisations. However, for biotechnology products such as those to be gleaned from use of Bc and Bt strains, there are overarching national and international authorities that prescribe extensive measures for authorization/registration and safe use. In the Canadian context (see Fig.1), only select strains of Bti, Btk and Bt tenebrionis (not addressed here) have been assessed for their relative safety and approved for use as biopesticides. Similar regulatory scrutiny is in place to assess strains of Bc and Bt members intended for other environmental applications (Fig.1; ref. 14). Hence, there is need to avoid lumping little known strains of Bc or Bt (as done in some literature) with the subset

FIG.1. Environmental applications of microorganism (MO)-based products. (A) A successful path to market includes developing a safe product which requires working closely with regulatory authorities (B) to fulfil requirements (C) for import, manufacture and production of MOs. Canadian requirements for registration of MO use as pest control agents is governed by the Pest Control Products Act while other applications (e.g., bioenergy/fuels, bioremediation, biowaste recycling/composting) are stipulated by the Canadian Environmental Protection Act (CEPA (1999)). The latter overarching authority requires joint assessments by Environment Canada and Health Canada (Biotechnology Section, Product Safety Programme). A relevant example of this cooperation concerns MOs of the Domestic Substance List (DSL) such as Bc14579 and Bt13367, which are addressed in this paper and elsewhere (13).

38

FIG.2. Characterization of micro-organism based biotech products and subcomponents. (A) Schematic of fractionation strategy and tools for principle component analysis of Bacillus-based products, modelled on commercial biopesticides (Btk, CP-1; Bti, CP-2). Screening potential for infectivity based on growth in mammalian physiologic conditions (B) and expression of virulence factors (C,D): Bc and all Bt strains exhibit peak growth at 34 to 39oC compared to other species. (C) Hemolytic activity assay using 5% sheep or human blood agar at 37oC: spores (5,000 per spot) after 24h, and culture filtrates (7uL) from (B) after 2h (right column). (D) Relative activity estimated from indicator plates (blood or egg yolk) for lipases (PIPLC and PLC) and assays of culture filtrates at 8h growth. Activity associated with Btk (CP1) and Bti (CP2) in presence of gentamicin to prevent spore outgrowth is < 1/20th of that from their outgrowths. Bc14579, Bt10792 and Bt13367 produce ~ 30% more haemolytic activity per cell than either Bti or Btk strains.

of strains that have been favourably evaluated. Given this context, our paper will briefly address the regulatory oversight for micro-organism (MO)-based products, and the ongoing need for data requirements, and the tools/ methods, which may be used to characterize strains of the Bc group (other than Ba) showing promise for application.

technological advances. However, the more extensive the detail and quality of information given in the characterization and analysis steps the better, as this information influences the nature, and possibly extent of data required to asses safety to human health (i.e., Tier 1 animal tests). Subsequent sections of this paper present some methods and results from select Bc and Bt strains, and a few other species which are relevant to both pest control and other environmental applications.

Approaches used in characterization of MO and related biotech products

Bt-product formulations as models. Based on quantities released into the environment, Bti and Btk based biopesticides are the most used of all bacteriabased biotech products (11). Essentially, they are concentrates of scale-up cultures (fermentations) harvested at sporulation phase (Fig. 2A). Given the global extent of application, and their quality (consistency of ingredients), we have used these products as models for developing semi-quantitative methods to assess quality of liquid and powder (hydrated) formulations, and monitor product release and persistence (e.g., efficacy (12), and worker/bystander exposures (11)). Some key tools for product analysis are listed in Fig. 2A. Simple fractionation by centrifugation (> 5000 x g

Criteria for MO risk screens. Requirements to assess MO risks to human health and safety, and to the environment, are fairly consistent between developed countries. The requirements outlined in Fig.1 to address microbial pest control agents (see PMRA Regulatory Directive DIR2001-03; www.hc-sc.gc.ca/pmra-arla) are similar to those prescribed for environmental applications (Fig.1; CEPA 1999, www.ec.gc.ca/substances/nsb/ bioguide/eng/ bi_s2_e.htm), and draw on comprehensive test guidelines of the U.S. Environmental Protection Agency (Series 885, www.epa.gov/opptsfrs/home/ guidelin.htm) and the European Union. The generic format of these requirements provides flexibility for data presentation and accommodation of latest scientific and 39

10 min) or filtration (0.45 micron pore size) enabled us to assess formulation subcomponents (e.g., liquid or powder (hydrated). Analyses of several dozen Bti and Btk–based formulations showed that they contain ~30-35% particulate matter (v/v), comprising > 109 spores per mL of liquid, and about an equal mass of other culture products, mostly PIB structures and amorphous aggregates, characteristic of each strain type, and their Cry products (10-13). Fieldwork with various organizations (11,12) indicated that quantitative detection of Bt formulations (delivered as sprays) was most accurate using the spore rather than the PIB or Cry components. In terms of active ingredient, an international unit would contain ~ 2400 spores, and as much as several million may be deposited as spray droplets per cm2 of surface (10-13).

as indicated in Fig.3. Bc14579, Bt13367 and B.subtilis (Bs) 6051a are of interest for non-pesticide applications (14). The numerical designations for strains are mostly ATCC but also NRRL. A key part of our screening strategy was to make use of parameters that give an indication of potential for infectivity (growth in mammalian cell environment), and quorum sensing (triggering coordinated outgrowth and expression of virulence potentials) (9,10,15). Bc and Bt strains are separated from other Bacillus species by their growth optimum (37oC, Fig. 2B) exhibited in bacterial and mammalian cell medium, growth in the presence of mammalian cells (10,13,15; Figs. 2C, 5 and 6), and expression of animal cell damaging effects (Fig. 2C, D and Figs. 5 and 6). Also, Bc and Bt strains are separated from other bacterial species, but not themselves, in profiles of their growth with different classes of antibiotics (Fig. 3A) and cell-associated fatty acids (derived as methyl esters (FAME)) (Fig. 3B). To separate the Bt strains from Bc14579 a test for presence of PIB structures, cry genes and Cry products (by PCR and immunologic staining methods) would be required (10,12,13). Use of recently developed multivariate analytical software

Identification by biochemical and microbiological methods. Additional assays for characterizing the bacterial cell component of products are described in Fig. 2B to D and Figs. 3-6. For this purpose we used type strains, Bc14579, and Bt Berliner 10792, commercial Bt-products, CP-1 (Btk) and CP-2 (Bti) (12), and others

FIG. 3. Characterization of micro-organisms based on vegetative cell (spore outgrowth) properties. Step 3 - minimum inhibitory concentrations (MIC) ~20,000 cfu / mL, 37ºC incubated for 24h using half-fold dilutions of antibiotics (from 0.37 to 24 ug/mL), columns left to right: Amoxycillin; Amphotericin B; Aztreonam; Cephotaxime; Doxcycline; Erythromycin; Gentamicin; Nalidix acid; Trimethoprim; and Vancomycin. Bc and Bt strains as expected are resistant to penicillin and derivatives, but can be managed by others antibiotics. Steps 4,5 a method to obtain fatty acid (methyl esters/FAME) principle components using Agilent MIDI System and software and databases (Clinical and Environmental), also used by many labs. This methodology only partly discriminates species-level differences within the Bc group (e.g., some B.mycoides strains). The proprietary clinical database classes all Bt strains as Bc, but the bioterrorism database recognizes the possibility of misidentification of Bt.

40

FIG. 4. Potential genome similarities and dissimilarities of Bc and Bt strains revealed by comparative genomic hybridisation arrays. (A) Example of hybridisation to glass slide microarray (manufactured by Qiagen and printed by DNA Core Facility NML/PHAC) composed of oligonucleotide features representing the BaA2012 (5.1 Mbp unfinished chromosome; 5444 features printed, 2486 functions unknown); pX01 (116 of 204 printed and denoted BXA…;156 unknown functions) and pX02 (56 of 104 denoted BXB..;78 unknown functions). (B) Summary of total features detected (triplicate hybridisations) using genomic DNA from Bc and Bt. (C) Common potential virulence functions by various categories. (D) Status of key functions indicating capacity of Bc and Bt strains to express and respond to quorum sensing signals (plcR/papR) but lacking pathogenic factors encoded by plasmids pXO1 and pXO2 of extreme virulent strains of Ba.

can incorporate all of the data collected for any given strain and give both a taxonomic assignment (against reference strains or published criteria (1)), and also a ranking of potential for infectivity and pathogenicity. We have used the latter hierarchy to prioritise in vivo testing. It is notable that 24h tests with commercial products (in presence of antibiotic) showed little or no damage to mammalian or insect cells (10,15; Fig.2C,D), albeit antigenic components (e.g., PI-P Lipase C) (15) are present, and consistent with their degradation by autolytic activity during sporulation phase.

a custom microarray probe based on the BaA2012 chromosome and plasmids pXO1 and pXO2 (3,4). The Bt10792 x A2012 array hybridisation (Fig. 4A) illustrates the significant detection of features also seen using DNA from other genomes. Analysis (Imagene 6.0.0 Beta, BioDiscovery Inc., and Genespring 7.0, Silicon Genetics) indicate a high degree of commonality in features (~2800) compared to Bs168 or Bs6051a (data not shown, 90% sharing (Fig.4 C), which are consistent with earlier analysis of genes and proteins (2-4). Given the small target size of the probe features, similarities between genomes may be underestimated. As genomic/proteomic detail increases, and major similarities between species and strains are understood, the novel aspects (new genes and allelic variations) can be used as strain level discriminators. A further layer of understanding is expected to come from multi-locus, expression analysis using probes from both bacterial and mammalian genomes to map cell-

Identification by genome/proteome mapping. Over the past decade there has been extensive use of PCR and DNA hybridisation methods to identify Bc group organisms, particularly in terms of commonality of their virulence factors (2-5,8,9). We have made use of medium to high-resolution sequence maps of several strains of Ba and Bc, and three Bt strains (3,4), to compare general genomic features of Bc14579 and Bt strains. Figure 4 summarizes intergenomic data using 41

FIG. 5. In vitro toxicity screening protocol for quantifying exposure effects of microorganisms, their byproducts and possible formulation applications. (A) Steps 1 to 6 with end results (multiwell plates, step 6) after 6h exposure using of a number of Bacillus species/strains. Test cell toxicity is indicated by loss of bioreduction (MTT formazan) (clear versus dark wells) and structure (C) (scanning electron microscope image) versus control (B). Only strains of Bc, Bt and B.mycoides strains caused severe cytotoxic/lytic effects. The assay enables collection of Bc/Bt dose/time kinetic data (D and E). Also, both mucosal epithelial (HT29) and macrophage-like (J774A.1) can be assessed for cytokine production and release, prior to cell damage, which indicates potential for inflammatory reactions. With antibiotic (gentamicin 50ug/mL) effects of CP-1, CP2 and purified Bc group spores were nil compared to their vegetative cells (VC) or debris from them (signifying autolytic activity), which induced high levels of cytokines.

cell and molecular interactions, and effects on immune defences (15) (see also next section).

to increase to concentrations similar to that observed in in vivo infections (~ 105 per mL) (6,7,9,10). In early exposures (5 min to 1h), the macrophage model allows the assessment of innate immune defences, which include phagocytosis and cell signalling responses. The pathways outlined in Fig. 6 indicate potential exposure outcomes. Spores of Bc and Bt strains are engulfed at rates and amounts comparable to other Bacillus species spores, but after 3h, depending on spore dose, the macrophage exhibit internal infection and death. These effects have been seen in studies (9). Because both model systems have capacity to release cytokines, known to act in vivo as signals in innate immune responses (e.g., inflammatory reactions), these immune-mediating responses can be assessed as well. Results so far indicate that some cytokines (e.g., GMCSF and IL-8 for mucosal cells and TNF-α, IL-1β, IL-6 for macrophage) are early markers for exposure to Bc and Bt vegetative cells and/or their cellular debris. A further layer of assays can be performed using multi-indicator arrays for specific proteins and genes (e.g., antibody and gene chip arrays) to reveal extent of effects in these exposures such as shown in one array hybridisation example Fig. 6B,C. (see ref. 16 application for Ba analysis).

In vitro animal cell models to test toxicity/ pathogenicity potentials. Summarized here are test systems using model cells of intestinal mucosa (HT29) (Fig. 5), and macrophage (J774A.1) (Fig. 6). J774A.1 along with RAW 264.7 are two of four cell lines that we have tested so far (15), and both have been used to study effects of Acinetobacter strains and Ba (16,17). In the presence of appropriate antibiotics, exposure effects from all types of bacterium are similar to untreated control cells. This includes treatments with PIB structures enriched from Bti and Btk commercial products (10,15). The latter exhibited low effects on immune systems of exposed migrant workers compared to spores (i.e., their vegetative cells) (11). However, in the absence of antibiotic, spores from all strains of Bc and Bt, germinate and grow in the presence of test cells, and produce exoproducts (as indicated in Fig. 2) which cause loss of metabolic activity and protein synthesis, and cell lysis (10). Dose-dependent effects begin with one spore or vegetative cell (Fig. 5B and C), and correlate with the time required for vegetative cells 42

FIG. 6. Macrophage functional test to assess exposure effects of various types of micro-organisms and possible formulations. (A) in vitro assay based on Fig.5. uses J774A.1cells and known amounts of bacteria or subcomponents (step 2) equivalent to the bacteria from which they came. Uptake (phagocytosis) is completed by 45 to 60 min. Pathway 3A,4,5A,6 occurs with spores or vegetative (growing) cells (VC) of Bs6051 as well as either spores or VC derived from Bc14579 or Bt (either 13367, 10982 or CP1 (Btk) or CP2 (Bti) spores) + antibiotic (gentamicin 50ug/mL). Pathway 3A,4,5B,7 occurs with spores of Bc or Bt (all sources), beginning at 3h, and ending at > 6h, and their VCs (with/without prewash to remove exoproteins). (B) Preliminary transcriptional assay using Mouse Autoimmune/Inflammatory Response GEArray: MM-602.3.

FIG.7. In vivo murine test model. (A) Health Canada Animal Care Committee approved protocol using behaviour (shock/stress symptoms) as endpoint followed with assays to address immunologic responses mostly. (B,C) Clearance times for purified (B) spores of Bc, Bt and Bs and equivalent amounts of spores as found in commercial products, CP-1 and Cp-2 (C). The latter contain PIB/CRY proteins (Fig.2). Migrant workers exposed to similar products exhibited relatively low immune reactivity to these components (10). Confocal images (D,E) of lung (thick sections) exhibiting accumulation of granulocytes which occur only in exposures to either Bc or Bt vegetative cell /spore preparations and not others (F).

43

In vivo exposure model. Tier-1 tests to assess human health and safety include regimes involving animals of different species, and test substances (e.g., technical grade active ingredient, microbial pest control agent, and/or end-use product), employing different routes of exposure/administration (e.g., oral, pulmonary, dermal). The test protocol shown in Fig.7A arose partly from joint work on in vivo testing of Bc and Bt strains assigned to the CEPA (1999) Domestic Substance List (see Fig1 and ref.13). This generic protocol is aimed at improving dose delivery and quantification and monitoring immune responses, as a follow up to studies of migrant workers exposed to Bt applications in the U.S.A. (10). The protocol makes use of early indicators for changes in behaviour signifying onset of stress/shock-like symptoms, and lower dose regimes (103 to 106 per animal), and accommodates a large number of assays involving multi-cellular/molecular markers for sub-lethal, largely immunologic effects. A brief scan of data from several tests demonstrates differences in clearance patterns of purified spores from sources indicated in Fig.7A, and commercial Bt-formulations (Fig.7B). However, effects from spores or Bt-formulations are relatively minor compared to immune responses in equivalent exposures with preparations involving mixtures of spores and vegetative cell (>60%) which triggered shock-like symptoms at ~ 2h and build up of various leukocyte populations such as shown here (see Fig.7D-E). These observations are consistent with earlier findings (6,7), and expected based on innate immune reactivity to presence of growing bacteria or their cellular debris.

can lead to death of immunocompetent mice after pulmonary infection FEMS-Immunol-Med-Microbiol.24: 43-47 7. Salamitou, S., F. Ramisse, M. Brehelin, D. Bourguet, N. Gilois, M. Gominet, E. Hernandez, and D. Lereclus. 2000. ���������� The PlcR regulon is involved in the opportunistic properties of Bacillus thuringiensis, and Bacillus cereus in mice and insects. Microbiology 146:2825-2832. 8. Ehling-Schulz, M., B. Svensson, M.-H. Guinebretiere, T. Lindback, M. Andersson, A. Schulz, M. Fricker, A. Christiansson, P. E. Granum, E. Martlbauer, and C. Nguyen-The. 2005. Emetic toxin formation of Bacillus cereus is restricted to a single evolutionary lineage of closely related strains. Microbiol. 151:183-197. 9. Ramarao, N., and D. Lereclus.2005. The InhA1 metalloprotease allows spores of the B.cereus group to escape macrophage. Cell. Microbiol.7:1357-1364. 10. Tayabali A.F., and V.L. Seligy. 2000. Human cell exposure assays of B.thuringiensis commercial insecticides:production of Bacillus cereus-like cytolytic effects from the outgrowth of spores. Env.Health Perspectives 108: 919-930. 11. Bernstein, I.L., J.A. Bernstein, M.E. Miller, S. Terzieva, D.I .Bernstein, Z. Lumus, M.J. Selgrade, D. Doerfler, and V.L. Seligy. 1999. Health effects research on microbiologic insecticides in farm workers. Environ Health Perspectives 107: 575-582. 12. Seligy, V.L., G.R. Douglas, J.M. Rancourt, A.F. Tayabali, I. Otvos, K. van Frankenhuyzen, J. Dugal, and G. Rousseau, 2000. Comparative performance of conventional and molecular dosimetry methods in environmental biomonitoring: assessment using Bacillusbased commercial biopesticides as models. In Rapid Methods for the Analysis of Biological Materials in the Environment. Eds P.J. Stopa and M.A.Bartoszcze, NATO ASI Series Kluwer Academic Publishers, Netherlands pp. 279-297. 13. Seligy, V.L., and J.M. Rancourt. 1999. Antibiotic MIC/MBC Analysis of Bacillus-based commercial insecticides: use of bioreduction and DNA-based assays. J Industrial Microbiol Biotechnol 21: 1-10. 14. El Ouakfaoui, S., L-A. Tsan, T. Pare, and K. Delgaty. 2005. Environmental risk assessment of Bacillus thuringiensis ATCC 13367 under the Canadian Environmental Protection Act 1999 (CEPA 1999). Proc. 6th Pacific Rim Conference. 15. Seligy, VL., PS. Shwed , and AF .Tayabali. 2004. Comparison of Macrophage Cell Models exposed to spores of Bacillus cereus and B.thuringiensis sspp. Proc.12th Internat’l Immunol. Congress. Medimond S.r.l., Bologna Italy Vol.ISBN 88-7587-0769-1 pp 469472. 16. Bergman, NH., K.D. Passalacqua , R. Gaspard , L.M. ShetronRama, J. Quackenbush, and P.C. Hanna. 2005. Murine Macrophage Transcriptional Responses to Bacillus anthracis Infection and Intoxication . Infection and Immunity 73:1069-1080. 17. Tayabali, AF., KC. Nguyen ,and VL. Seligy. 2004. Immunotoxic Assays for Potential Bioremediation Bacteria: Acinetobacter and Rhizobium radiobacter. Proc.12th Internat’l Immunol.Cong. MedimondS.r.l.,Bologna Italy. Vol.88-7587-0769-1 pp269-273.

References 1. Euzéby, J.P. 2005. List of Prokaryotic Names with Standing in Nomenclature (http://www.bacterio.net). 2. Pirttijarvi,T.S., M. Andersen, A.C. Scocing, and M.S. SalkinujaSalonen. 1989. Evaluation of methods for recognizing strains of the B.cereus group with food poisoning potential among Industrial and environmental contaminants. Syst.Appl Microbiol 22: 133-144. 3. Gohar, M., N. Gilois, R. Graveline, C. Garreau, V.Sanchis, and D. Leclercus. 2005. ����������������������� A comparative study of Bacillus cereus, Bacillus thuringiensis and Bacillus anthracis extracellular proteomes. Proteomics 5:3696-3711. 4. Rasko, D.A., M.R. Alther, C.S. Han, and J. Ravel. 2005. Genomics of the Bacillus cereus group of organisms. FEMS Micriobiol. Reviews 29: 303-329. 5. Shisa, N., N. Wasano, A. Ohgushi, D-H. Lee, and M. Ohba. 2002. Extremely high frequency of common flagellar antigens between Bacillus thuringiensis and Bacillus cereus. FEMS Microbiol. Letters 213:93-96. 6. Hernandez, E., F. Ramisse, T. Cruel, R. le Vagueresse, and JD. Cavallo. 1999. Bacillus thuringiensis serotype H34 (subsp. konkukian) isolated from human and insecticidal strains serotypes 3a3b and H14

44

6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact, Victoria BC, 2005 Côté, J.-C., Otvos, I.S, Schwartz, J.-L. and Vincent, C. (eds)

Safety of Bacillus thuringiensis var. kurstaki Applications for Insect Control to Humans and Large Mammals Imre S. Otvos1*, Holly Armstrong2, and Nicholas Conder1 1 2

Natural Resources Canada, Canadian Forest Service Pacific Forestry Centre, Victoria, BC, CANADA; V8Z 1M5. Canadian Food Inspection Agency, Victoria District Office, Victoria, BC, Canada,V8Z 6L8.

This minireview discusses the risks to humans and large mammals associated with the use of Bacillus thuringiensis var. kurstaki (Btk) in forest, agricultural and urban environments. The first subspecies used for insect control was Bacillus thuringiensis subsp. thuringiensis (Btt), known at the time as Bt Berliner. Much of the early work done with Bt does not identify the subspecies. Btk is registered for use against many species that are pests in agriculture, forestry and horticulture. Btk is currently the most widely used insecticide in forestry in Canada. Review of the literature indicates that Btk is safe for the environment and its various components. Since its introduction in the 1960s, no scientifically documented case of human infection has been reported as a result of its use in forestry or agriculture against various defoliators or in urban environments during gypsy moth eradication programs. No human health problems have been proven to be attributable to the application of any Bt product on crops used for human consumption. Based on all available information, Btk is considered by most people to be the safest bioinsecticide available at present. Introduction

diego) affects Coleoptera.

This chapter discusses the risks to humans and large mammals associated with the use of Bacillus thuringiensis var. kurstaki (Btk) in forest, agricultural and urban environments. The safety of Bt toxins expressed in transgenic agricultural crops or forest trees is a seperate issue from aerial or ground applications for insect control, and will not be discussed in this chapter.

Btk is active against over 200 species of Lepidoptera and registered for use against many of these species that are pests in agriculture, forestry and horticulture. Since the mid-1980s, Btk has been the most widely used insecticide in Canadian forests and has been applied against several species of defoliators (13, 36, 81). In the US, the office of Pesticide Programs of the Environmental Protection Agency (US-EPA) “… has the authority [and obligation] to ensure that pesticide use in commerce will not result in unreasonable adverse effects to humans and environment …” (69). In Canada, the Pest Management Regulatory Agency (PMRA), under the responsibility of Health Canada, is charged with the same responsibilities (35, 36). Although both agencies require considerable data on the safety of any product they register, concerns are still expressed by some groups over the possible side effects of Btk applications, especially to humans, particularly when applied near water, highways or over populated areas.

A brief review of the history of use of this bacterial pathogen in North America will be useful to better understand the risks. The variety or subspecies used in early insect control programs was Bacillus thuringiensis var. thuringiensis (Btt), known at the time as Bt Berliner (24). Btt was first introduced for insect control in North America in 1958, when it received partial registration in the United States (US) for use on food and forage crops (25). Full exemption (i.e., there is no waiting period between the time of application and when the crop is sold on the market) was granted in 1960 (10). Btt was registered in Canada in 1961 (41), and in Germany in 1964 (44). Btk was first used in a commercial product (Dipel®) in 1970 (4). At least 84 subspecies of Bt have been identified by the Institut Pasteur, Paris, France (J.-F. Charles, personal communication), and most of these strains affect specific orders of insects. The most widely used strains are: Btk and Bt var. aizawaii (Bta), that affect Lepidoptera, Bt var. israelensis (Bti) affects Diptera, and Bt biovar. tenebrionis (= Bt subsp. san

This review, which is an update of part of an earlier report (60), brings together both published and unpublished information on the safety and toxicology of Btk and its potential environmental impact on humans and large mammals.

* Corresponding author. Mailing Address: Natural Resources Canada, Canadian Forest Service, Pacific Forestry Centre. 506 West Burnside Road, Victoria, BC, V8Z 1M5 CANADA. Tel: 250 363 0620. Fax: 250 363 0775. Email: [email protected]. 1 To avoid confusion, Bt var. thuringiensis will be abbreviated to Btt, and Bt var. tenebrionis will not be abbreviated.

45

study concluded that the large volume of mammalian toxicology data on Btk and Bti show that both are nontoxic or pathogenic to mammals, including humans (52). No further laboratory experiments were conducted with human volunteers, and the effects of human exposure to Btk were monitored during field applications to control native insects or to eradicate exotic insects.

Exposure of Humans to Bt The potential effects of Bt on humans were investigated from the time that Bt was considered as a tool in insect control in North America. Early investigations on the safety of Bt involved experimental exposure of human volunteers “satisfied government officials and the manufacturer as to the safety of Thuricide [Btt]” (26), and these data were probably used to support registration. Later, when Btk sprays were used operationally (or experimentally to determine the efficacy of the various products becoming available commercially), humanexposure monitoring was conducted in the field (i.e. realistic conditions).

Exposure of humans in field studies. Epidemiological studies have been conducted in association with 11 Btk applications near or over areas of human habitation in North America (Tables 1 and 2). Four of these studies were conducted during Btk treatments of the native spruce budworm (Choristoneura fumiferana) in eastern Canada, and seven studies during gypsy moth (Lymantria dispar) eradication programs in western North America.

Exposure of humans in laboratory studies. The possible effects of Btt on humans were studied during early experimental exposure of human volunteers under controlled laboratory conditions in the late 1950s. Eighteen volunteers consumed 1 g of Thuricide® (active ingredient Btt, 9 x 109 spores/g, supplied by Bioferm Corp.) daily for 5 days, and five of these volunteers also inhaled 100 mg of the powder (containing 3 x 109 spores) daily for 5 days (25). Complete physical examinations measuring weight, height, blood pressure, respiratory rate, and pulse rate, as well as evaluations of genitourinary, gastrointestinal, cardiorespiratory and nervous systems, were conducted before, immediately after the 5-day administration of the insecticide and 4 or 5 weeks after administration. All volunteers remained well throughout the test period (p. 687). Despite the presence of β‑exotoxin in the formulation, the volunteers showed no adverse effects resulting from either ingestion or inhalation of Btt over a 5-day period. In addition, 8 employees of Bioferm Corp. continuously exposed to Btt during the manufacturing process were observed over a 7-month period. No health problems arose in any of the employees, and “comprehensive” medical examinations (type of tests not specified) of these individuals did not reveal any adverse effects resulting from their exposure to Btt (25).

Human exposure during the operational and experimental applications of Btk to control the native spruce budworm will be discussed first for two reasons. First, Btk treatment was only applied once per year to each area (Table 1). Second, because these monitoring studies also show that forest managers (or people responsible for making the control decisions) proactively monitored human exposure early on to detect any possible health complications arising from the Btk treatments. Eradication programs conducted against the gypsy moth, Lymantria dispar, will be discussed later because during these projects Btk was applied at higher doses and multiple times to each area in a single year. Operational and experimental aerial spraying of Btk against spruce budworm. During the operational treatments conducted in Quebec, different Btk products were applied at dosages ranging from 20-30 BIU/ha in 2.3 to 5.9 L/ha (50). The results of part of the Quebec study on immunological responses will be discussed here; the sections dealing with spore density counts monitored in two communities, will be discussed later in the section “Airborne Btk following aerial sprays”.

The only other laboratory study we found is mentioned in a review of human and laboratory animal toxicological data submitted to the US-EPA prior to 1989 to support registration of Bt-based microbial insecticides (52). Their data refer to a study in which five male and five female volunteers each ingested 1g (1x1010) viable spores daily for 3 consecutive days. All blood cultures of the test subjects were negative, even though five of the 10 subjects showed viable spores of Bt 30 days post-ingestion. The

Province of Quebec, Canada – 1984 to 1987. Btk is the most widely used insecticide in the forests in Canada, and was used in the past mainly to suppress spruce budworm populations. Human health was monitored during spruce budworm suppression projects over 4 years using several different formulations containing Btk. Other products were also used experimentally (Table 1).

46

TABLE 1. Summary of Btk applications against Choristoneura fumiferana during which human health studies were conducted. Location

Year

Québec

1984

Québec

Québec Québec

New Brunswickb

Area treated (ha)

Est. human pop. in or near treatment area

Product

Dose and Rate

383,009

Dipel 88 Dipel 132 Futura Thuricide 32LV Thuricide 48LV

20 BIU/ha in 5.85 L/ha 30 BIU/ha in 2.37 L/ha 20 BIU/ha in 2.50 L/ha 20 BIU/ha in 4.68 or 2.34 L/ha 30 BIU/ha in 5.85 L/ha

3,500a

50

1985

479,293

Futura FC Novabac 3 Thuricide 48LV San 415 Thuricide 64B Futura XLV Biobit 64B Dipel 176

20 BIU/ha in 2.50 L/ha 30 BIU/ha in 3.55 L/ha 30 BIU/ha in 2.37 L/ha Not given - experimental Not given - experimental Not given - experimental Not given - experimental Not given - experimental

28,500a

2, 51

1986

18,160

Futura FC Thuricide 48LV

20 BIU/ha in 2.50 L/ha 30 BIU/ha in 2.37 L/ha

35,300a

19

1987

197,992

Dipel 132 Dipel 176 Futura

30 BIU/ha in 2.37 L/ha 30 BIU/ha in 1.77 L/ha 20 BIU/ha in 2.50 L/ha

1983 - 1989

645,088

Not given

Not given

Total

Sources

2,900a

18

Not given

22

Est. 70,200a

Number of individuals in spray area during the operational sprays in Quebec were estimated from population of the communities (2-7 each year) in which the sampling devices were placed during the operational sprays to monitor aerial drift of Bt spores. These communities were located 1-13 km from the actual treatment blocks. b Based on one anecdotal account from a 7-year period. a

Human health monitoring was conducted on workers directly involved with the spray program during operational and experimental sprays of various formulations, dosages and volumes of Btk against spruce budworm in southeastern Quebec (Table 1). No communities were within the treated areas, although over 70,000 people lived within 13 km of the treated stands at the time of the study. These communities, located near the treated stands, were monitored for spray drift (see section on “Airborne Btk Following Aerial Spray Program Activities”). While most of the studies dealt with occupational exposure or aerial distribution of spores, one study (2) examined local residents for the presence of spores or immune response to Btk sprays. During this study, 484 nasal samples were obtained from primary school students (attending schools 315 km from treated stands), of which only 16 (3.3%) cultured positively for Bt. In addition, of 110 blood samples obtained from residents living within 20.5 km of the spray blocks, only one had an immunological response to Bt (2).

cereus-like bacteria grown from various sources (blood, pus, biopsies, eye, etc.) obtained from hospitals throughout Quebec were examined for the presence of Btk or Bti (48). Of the 89 cultures examined, 86 were identified as B. cereus, and three were identified as Btk; two from blood samples and one from abdominal fluid. However, in all three cases it was concluded that the Btk was present as a result of laboratory contamination of the samples (48). None of the reports we obtained from Quebec indicated any medical problems amongst either the workers involved in the spray program or the general populace (2, 18, 19, 20, 46, 48, 50, 51). Province of New Brunswick, Canada (year not given). In a poorly documented incident (which took place sometime between 1983 and 1989) of overspraying of two elderly individuals in New Brunswick, concerns were raised because of reported post-exposure nonspecific health effects (dermal rash, hive-like wheals, increased incidence and respiratory infections and general malaise). The negative symptoms may or may not have been associated with an aerial application of Bt against the spruce budworm (22). Considering that human volunteers were exposed to higher doses of Btt (25), it is likely the negative symptoms experienced by

Quebec – 1995 to 2000. During another monitoring program, initiated in 1996 (but also examining samples obtained in 1995), a total of 89 cultures of Bacillus

47

TABLE 2. Summary of Btk applications to eradicate Lymantria dispar in western North America during which human health studies were conducted. Year

Area treated (ha)

Product

Dose and Rate

Eugene, OR

1985

101,171

Dipel 8L

Not given

80,000

23, 29, 59

Eugene, OR

1986

109,265

Dipel 8L and Dipel 6AF

Not given Not given

40,000

23, 29, 59

Tacoma, WA

1992

47,128

Foray 48B

60 BIU/ha in 4.7 L/haa

500,000b

82, 83

Seattle, WA

2000

Not given

Foray 48B

60 BIU/ha in 4.7 L/haa

6,600

84

Vancouver, BC

1992

18,813

Foray 48B

50 BIU/ha in 4.0 L/ha (x4)

250,000b

56

Victoria, BC

1994

116

Foray 48B

50 BIU/ha in 4.0L/ha (x3)

5,250

5

Victoria, BC

1999

13,398

Foray 48B

50 BIU/ha in 4.0 L/ha (x3-5)

80,000

11, 61

Total a b

Est. human pop. in treatment area

Location

Sources

Est. 961,850

Approximate dose and volume applied, converted to metric. Estimated population in treated areas based on number of residential units or personal communication.

the two elderly people were likely coincidental and not related to Btk treatment.

general public to the Lane County Health Department were tabulated and examined for observable patterns of clinical disease complaints.

Epidemiology studies of humans exposed to aerial spraying of Btk during gypsy moth eradication programs

A total of 56 Bt-positive cultures were obtained from patients, in the two spray years during and after spray: 55 from three hospitals and one from an outpatient clinic. Of the 56 cultures collected, 52 (92.9%) of the Bt isolates were assessed as probable contaminants, either of skin or tissue or of the laboratory plates, and not the result or cause of clinical illness. Among the four cultures of interest, one was collected from a spray project worker (not wearing a face mask) who received an accidental splash of Btk to his face, including his eyes. The worker developed dermatitis, pruritus, burning, swelling and erythema. Treatment, with a steroid cream to his eyelid and skin, resulted in complete recovery.

Seven gypsy moth eradication programs were conducted against the gypsy moth (both European and Asian strains) in western North America between 1984 and 1999. During each of the eradication programs, Btk (in most cases Foray 48®B) was applied at 50-60 BIU in 4.0-4.7 L/ha, and treatments were applied three to five times, ca. 7-10 days apart (Table 2), depending on the location and estimated duration of larval hatch (the length of which can vary considerably and is affected by microclimatic conditions). Eugene, Oregon State, United States – 1985 and 1986. Epidemiological studies were conducted as part of the gypsy moth eradication program in Eugene, Oregon. Bacterial isolates, cultured for routine clinical purposes from hospitals and outpatient clinics, were screened for possible human infections caused by Btk throughout the three sprays per year, and for 1 month after the last spray in both 1985 and 1986. About 80,000 residents lived in the treated areas in 1985, and 40,000 residents in 1986 (29). Samples collected from a non-treated community ca 100km from the treated area served as a control during the second year of the spray. In addition to the culture samples, telephone complaints made by the

In the remaining three Bt-positive cultures (two from a hospital, one from outpatient clinic), it could not be proven conclusively whether or not the cultures were the result of an epidemiological infection by Btk. Indepth case studies revealed that all three patients were immunocompromised (29). The first patient was a 77year-old male, admitted to hospital during the spray, with an underlying lung cancer. He was discharged about 2 weeks after the spray program ended, but was readmitted on July 14, 1985, when he developed a fever and pneumonia, and he died 13 days later. Because only one of the four samples taken from the patient’s

48

lungs contained a Bt-like bacterium, and because the patient did not respond to antibiotics (to which Bt is susceptible), the pneumonia was most likely caused by a different organism. Unfortunately, this could not be confirmed because the family refused autopsy (29).

as absolutely non-pathogenic to humans... These [pest control] microorganisms may have potential for causing disease in immunocompromised persons. Therefore, such individuals should be advised on how to use biopesticides and how to protect themselves from undue exposure in areas where they are used” (29). People with compromised immune systems or preexisting allergies may be particularly susceptible to the effects of Bt (72).

The second patient was a 31-year-old mentally challenged female who suffered from partial paralysis and subdural bleeding as the result of a car accident that occurred 10 years previously (29). She had surgery for gallstones and recovered “uneventfully”. No Bt was cultured from gall bladder tissue, and only one of the eight fluid specimens showed Bt growth after 5 days of incubation. These observations, and the patient’s lack of fever, indicate there was no infection by Bt (29), and the one sample showing Bt growth was probably the result of contamination.

Tacoma, Washington State, United States – 1992. The Washington State Department of Health (DOH) monitored and evaluated the health effects associated with an aerial spray program to eradicate gypsy moth in 1992. A telephone hotline was established to receive health complaints related to the gypsy moth eradication spray program. There were 179 calls to the hotline involving 279 individuals, from an estimated population of about 500,000 (Table 2), with health complaints, but the reported illnesses were almost all relatively mild. Background illnesses in any community include hay fever-type symptoms, viral gastroenteritis (intestinal flu), rash illnesses and streptococcal throat infections, making it difficult to distinguish between such illnesses and health effects reported as a result of the Btk spray program. No reports of Bacillus infections associated with Btk applications were received by the DOH. The report concluded that there were “no demonstrated infectious complications” resulting from the Btk spray program (83).

The third culture was isolated from an abscess on the right forearm of a 25-year-old female who had a history of intravenous drug abuse. Twenty colonies of Bt grew from the abscess sample taken from the injection site in June 1985, some days after the completion of the spray program. Five days later, before she started treatment with antibiotics, the wound did not produce any Bt cultures. Another organism may have caused the infection and the Bt cultured from this area would likely be contaminants (29). Although it could not be proven conclusively that the cultures were the result of infection by Btk, circumstantial evidence indicates they were due to contamination of the culture media.

Vancouver, British Columbia, Canada – 1992. Potential changes in human health during and after the combined ground and aerial spraying of Foray 48B to eradicate Asian gypsy moth in Vancouver (Table 2) were monitored during a multi-faceted study conducted by medical doctors at the University of British Columbia. The study included: food sampling during and after Btk spraying; monitoring health effects of Btk on workers occupationally exposed to the bioinsecticide; monitoring the frequency of visits to physician offices and hospital emergency wards during and after the spray; and examining cultures collected from patients visiting hospitals and physicians during the test period for the presence of Btk (56).

Many of the complaints made by the public during the epidemiological study were related to skin rashes and eye irritation. These symptoms may have been caused by the presence of the gypsy moth itself rather than by the Btk application (29). Both dermatitis and eye irritation have been documented by large numbers of people from the northeastern U.S., and this has been attributed to an allergic sensitivity to the “hairs” of gypsy moth larvae (75). Similar reactions are also caused by other caterpillars in the same family (16). Btk and Bta are considered to be non-pathogenic to humans and other animals, although the increase in the proportion of immunocompromised people in the general population over the last 36 years has raised concerns that some people may become ill because of Bt sprays. Because of this, “the medical community has become more reluctant to label any bacterium

More than 26,000 telephone calls, 1140 family practice patients (visits) and 3500 admissions to hospital emergency departments were examined, and the health of 120 workers with occupational exposure to the

49

Btk spray was monitored during this study. In addition, the study examined more than 400 bacterial cultures submitted from 10 participating laboratories. The study also examined air samples for Bt spore concentrations to which both the general public and workers associated with the Btk spray were exposed, as well as samples of food from a variety of sources and times (56).

Over 10,000 notification letters were sent to residences inside and within 30 m of the spray zone boundary, directing the public to report any symptoms believed to be associated with the spray to the Medical Health Officer (5). A total of 30 self-administered complaint questionnaires were requested by residents by calls to the office of the Medical Health Officer, but only 16 of the 30 questionnaires were completed and returned. Forty symptoms were reported associated with the Btk spray program, the three most frequently reported symptoms being headache (10%), dry sore throat (9%) and dry hacking cough (6%) (p. 43). It is of interest that of the 16 who completed the questionnaires, none were residents with addresses within the spray zone; five lived adjacent (within 1 km) to the spray zone boundary and 11 lived outside the 1km zone (5). Spray droplets could certainly have drifted this far, but the concentration of spray droplets would have been much lower than in the treated area (yet there were no complaints received from inside the treated area where these symptoms should have been more severe). Verification of exposure to spray droplets was not obtained, but the survey results were intended, in part, to serve as a documentation of the level of public concern and response over the Btk application in an urban area to eradicate the gypsy moth (p. 44). The small complaint response (16 or 0.15% of the notified residents) to a highly-publicized spray program, in which information leaflets were sent to 10,495 residents in and near the spray zone, is a noteworthy result and indirect evidence that people were not affected by the spray (5). The results of health monitoring during the 1999 gypsy moth eradication program in Victoria is reported in Levin (47). Reports of airborne concentrations of Btk during the 1999 spray program (74) will be reported in the next section.

Complaints of respiratory and eye symptoms were no more frequent among those living within the spray zone than those living outside of the spray zone in the Vancouver study. Furthermore, complaints of such symptoms were no more frequent among individuals who had objective evidence of having been exposed to the spray than those who did not. “While symptoms may have been attributable to the spray, it is not possible to distinguish these from the identical complaints that regularly occur during spring due to environmental factors such as dust and pollen” (56). Furthermore, “…there was no evidence to suggest that the number of visits, and reasons for visits, to emergency departments were different as a result of the spray program…” (56). Although Bt (no serotyping, DNA analysis or bioassaying were done to confirm subspecies) was recovered from a broad range of body sites (blood, body fluids and tissues) from exposed individuals, the authors did not find a single case of Btk-caused infection. There was no significant difference in the percentage of Btpositive cultures from nose samples of patients living within (57.8%) and outside (39.1%) of the spray zone (128 positive cultures total), the remaining 3.1% had no postal code information available and could not be slotted either in or outside the treated area. Positive Bt cultures did not result in a negative health outcome in any of the patients, even though 85% of the patients did not receive antibiotics. Moreover, examination of all significant cultures collected during the test period showed that there were no cases of infection in immunosuppressed people as a result of exposure to Btk spray. Results of this study clearly indicate that the large-scale Btk spray program for gypsy moth eradication in Vancouver did not cause any “measurable increase in serious community unwellness that could be attributed to the spray” (56).

Non-occupational exposure to airborne Btk following aerial spray program activities Levels of Btk in the air were monitored for the first time in Canada at two municipalities in southeastern Quebec during the peak of the Btk application period. (50). Btk spores were collected by drawing air through a filter using a vacuum pump and the number of spores collected/minute/L (spores-min/L) of air sampled was calculated. Levels of Btk in the air ranged between 0 and 132.6 spores-min/L (94.0 spores/m3), but most measurements were below 2 spores-min/L (1.4 spores/ m3), and were much lower than amounts inhaled and ingested by the human volunteers (25, 52). The highest level of Btk present in air samples following nearby spraying

Victoria, British Columbia, Canada – 1994. A health surveillance program was conducted in the Greater Victoria area when a 116 ha area with an estimated population of 5,250 residents, was treated with Btk during another gypsy moth eradication program (Table 2).

50

was 132.6 spores-min/L. Assuming that this quantity of Btk in the air remained constant for a day [which is unlikely (74)], a person with an average respiration rate of 30 L/min could inhale a total of 4x104 spores over a 24-hour period (50). Over a 25-day period, a person could maximally inhale a total of 105 Btk spores. In contrast, the human volunteers in Fisher and Rosner’s experiment (1959) ingested 33,000 times (3.3x109 spores) this number of spores daily, and inhaled 3,300 times (3.3x108 spores) this number of spores daily for 5 days without experiencing any ill effects (50). In the treated areas in Quebec in 1985 spore concentrations ranged from 4.5x103 to 2.8x105 spores-min/ L, and no human health problems were reported (20). The authors concluded that “Bt concentrations detected in the two municipalities monitored represent only a very minimal hazard for the populations concerned” (50). Several other similar studies (2, 18, 19, 51) conducted in the same area in 1985 and 1986, and in other municipalities in Quebec in 1987 during peak spray periods, confirmed these findings.

were open) were related to indoor concentrations. Drift occurred outside the spray zone by at least the sampled band of 125 to 1000 m (74). For additional information on the 1999 Victoria study (47).

Occupational exposure Occupational exposure to one application of Btk was investigated for the first time in Quebec during spruce budworm control programs between 1984 and 1987. It was also investigated during eradication programs when Btk was applied several times in a ca. 2 month period and, in some cases, applied both from the air and from the ground. Quebec – 1984 to 1987. During the operational and experimental sprays conducted against spruce budworm in southeastern Quebec, the effects of working in close and continual contact with Btk was studied. During 1984 and 1985, blood samples were collected from workers (loaders, mixers, etc.) who were exposed to Btk as part of their work. Samples were obtained from 28 workers three times during 1985: before the aerial spraying began, at the end of the spray program, and 10 weeks after the end of the spray. At the end of the spray program (second sample), six of the 26 workers (21.4%) had positive immunological responses to Bt. By the third sample, only four (14.3%) of these workers still had antibodies for Bt, and in all cases their immune response was 25-50% lower than in the second sample (2). It was also determined that the type of antibody produced was IgM, which is not involved in allergic responses. This is slightly different from the findings of Bernstein et al. (2000) (6), who found antibodies IgE and IgG produced by crop pickers exposed to Btk.

Airborne exposure to Btk during the 1999 aerial spray program to eradicate gypsy moth in the populated Greater Victoria, B.C., area was monitored to determine the rate of reduction of airborne concentrations following spraying, the occurrence of drift outside the spray area and whether staying indoors during spraying reduced exposures to Btk (74). Outdoor air concentrations of Btk were highest from the start of spraying and for up to 3 hours, then diminished exponentially over time. Within 8-13 hours after the spray, airborne concentrations were 20% of the highest mean spore concentrations at the time of the spray (74). Culturable airborne Btk concentrations measured outdoors after spraying ranged from below the detection limit to too numerous to count, with a mean of 739 Btk CFU/m3 of air. Btk exposure inside residences in the spray zone initially averaged concentrations 2-5 times lower than that of outdoor concentrations, but at 2-3 hours after the start of the spray, indoor concentrations (395 CFU/ m3) approached outdoor concentrations (501 CFU/ m3) and then exceeded outdoor concentrations (244 CFU/m3 versus 77 CFU/m3) at 5-6 hrs after the start of spraying. Staying indoors during the spray, therefore, initially lowered exposure to Btk, but this benefit was not sustained within several hours as outside air moved indoors with normal daily activities and did not dissipate or degrade as quickly indoors as it did outdoors (74). None of the measured indoor characteristics (type of residence, type of entry, story of sampling, room sampled or indoor temperature, whether any windows or doors

In a second study, conducted around the same time, blood samples were collected from field technicians and workers at the airports where the spray planes were loaded in 1984, 1985 and 1986. Samples collected in 1984 and 1985 were stored at -70°C until they were examined in 1986 for immunological response to the presence of Btk (46). Of the 136 workers tested, only five (all of whom worked closely with the Btk) reacted positively for the presence of anti-Bt antibodies; of these, four of the five had a positive response to vegetative cells only, spores and crystals elicited little or no response. In 1985, five of nine field technicians had positive antibody responses to spores and crystals, but did not react to vegetative cells (the other four tested negative). Of the airport workers (loaders and mixers) tested in 1985,

51

four of 12 had a positive reaction to vegetative cells, but only one of these workers also reacted positive to spores and crystals . However, these positive reactions were only temporary, lasting between 3 months to 1 year. Indeed, in 1986, no workers tested positive for anti-Bt antibodies. This may have been due to the lower volumes of Btk applied in 1986, or the fact that none of the formulations used required mixing (46).

high as 500 times that of the general public living in the treated area, would have encountered during an aerial spray (56). For individuals who worked most shifts during the spray program, estimated cumulative Btk exposures ranged from a high of 7.2 x108 CFU/m3 among workers applying the spray to a low exposure of 5.4 x106 CFU/m3 among Kromecote card handlers (Kromecote cards are placed in the spray zone near ground level to estimate spray droplet size and density). No significant health problems resulted from Foray 48B exposure, and no differences were found with respect to gender or smoking status (56).

Eugene, Oregon - 1985 and 1986. During the largescale application of Btk in 1985 and 1986, personal exposure sampling was conducted to determine the occupational and general public’s exposure to Btk sprays. In 1985, samples were collected from 22 individuals doing 15 different kinds of jobs, while in 1986, samples were collected from 19 individuals doing nine different jobs. General area air samples were collected at various locations within the spray boundary, as a reflection of public exposure potential (23). Breathing zone samples for a safety officer, helicopter pilot, aerial observer, card checkers and a security guard indicated Btk exposure ranged from 0 to 5,600 CFU/m3, with one sample from a Kromecote card checker who was in brief direct contact with the spray recording 11,000 CFU/m3 (23). General public exposure to Btk during the eradication program ranged from 0 to 1,600 CFU/ m3 (29). In comparison, during the spruce budworm programs in Quebec, where Btk was applied at lower rates (Table 1), the spore densities were ranged from 0 to 94.8 spores/m3.

Miscellaneous studies. A health survey was conducted in farm workers before and after their exposure for about 4 months to Btk through the picking of sprayed vegetables. The investigation grouped workers into high, medium and low exposure groups and compared results of questionnaires, nasal and mouth lavages, ventilatory function assessments, and skin tests (6). As expected, the majority of positive skin-prick tests to Btk occurred in workers who had a higher degree of exposure. Specific IgG and IgE antibodies to vegetative cells were present in all groups of workers. Comparison between exposure groups in terms of the prevalence of IgG and IgE immune responses indicated that “exposure to Btk spray may lead to allergic sensitization, as indexed by both positive skin tests and specific IgE antibodies, induction of IgG antibodies, or both” (6). The authors suggested that allergenic effects of Btk in humans could be due in part to vegetative-derived allergens. They further suggested that the “immediate hypersensitivity developed in some workers indicates that adverse IgE mediated health effects could develop if repetitive exposure continue[s]”. However, there was no evidence of occupationally related respiratory symptoms or clinical diseases in any of the workers (6). The antibodies detected in this study differ from those identified in a Quebec study (2), in which neither IgE nor IgG antibodies were detected, only IgM.

Vancouver, British Columbia – 1992. Occupational exposure to Btk was also investigated as part of an epidemiological study conducted in conjunction with the Asian gypsy moth eradication program (58). Within the study population of 120 occupationally exposed ground spray workers, almost two thirds of the workers reported eye, nose, and throat irritation, dry skin and chapped lips; complaints were most prevalent among workers who had a prior history of allergies (56). Symptoms were noted to occur only briefly at the beginning of each of the three treatments when the spray droplet concentrations of Foray 48 were at their maximum (average 2 x 106 to 5.9 x 106 spores/m3; maximum recorded value 1.6 x 107 spores/m3). Nearly all workers exposed to higher concentrations for 5-20 shifts retained Btk for at least 5-6 days, and most were culture positive for 14-30 days. There were, however, no days of work loss attributable to Btk exposure. The ground spray workers were exposed to Btk at rates as

A B. cereus-like bacterium was reported in some stool samples obtained from Danish greenhouse workers where Dipel® was used (43). The isolate had the same RAPD pattern and gave the same results for PCR against cryI endotoxin and 16-23S rRNA, but analysis of the plasmid DNA showed that the plasmids differed from the Btk in the Dipel® used (43). This bacterium, isolated from the stool samples, was not positively identified (although most DNA testing indicated it probably was

52

Btk), therefore it was not ascertained if the strain was the same one used by the greenhouse workers, or whether they may have acquired the bacterium by some other means, including contaminated diet.

from stool samples of four individuals, of which one sample was also positive for Norwalk virus, a known enteric pathogen (42). In the three other ill individuals, however, no other enteric pathogen was detected. The stool samples were subsequently stained for toxin crystal formation and identified as B. thuringiensis. B. cereus was isolated from spice (onion powder) samples submitted by the institution. However, these food isolates were determined, by phage typing, to be unrelated to the patient isolates (42). Since neither Bt nor B. cereus isolates from the stool samples matched isolates recovered from food samples, Bt cannot be directly attributed as the agent of the gastroenteritis (68). Furthermore, the suspected cases of food poisoning in the four individuals could not be traced to the use of Btk in the treatment of food crops or aerial applications against defoliators in the area (42).

Dietary exposure No human health problems have proven to be directly attributable to the use of Btk during the 35 years since its registration in 1970. Bt has been used extensively on fruit and vegetable crops, including maize, broccoli, cabbage, lettuce, apple and tomato (10). The U.S. Environmental Protection Agency approves the use of Bt products (β-exotoxin free) on food destined for human consumption up to and including the very day that these products are harvested, as well as for use on stored food products (79). The same also applies in Canada (66). The absence of a "waiting period" is an indication of the considered safety of Btk to consumers. Most likely, there have been instances where spores or crystals were present on treated produce sold at grocery stores, and the consumer did not wash, or inadequately washed, the purchased goods before consumption. For instance, Bt (possibly Btk) was repeatedly cultured from commercially available vegetables during and after the gypsy moth eradication program in Vancouver in 1992. As a result, the general public was “readily exposed to sources of Btk other than either the aerial or [local] ground sprays” (56). Despite this, the general health of individuals living in the spray area exposed to such produce was not adversely affected.

Isolates of Bt originating from eight commercial Btbased insecticidal products [Btk (Dipel®, Foray® 48B), Bta (Florbac® FC, Turex®, XenTari®), Bti (Bactimos®, VecTobac®) and Bt subsp. tenebrionis (Novodor® FC)] were all found to produce diarrhoeal enterotoxins when grown in the laboratory on brain heart infusium broth (14). However, it should be noted that it is highly unlikely that this type of substrate would be generally be present where any of these bioinsecticides would be used in the field. The quantity of diarrhoeal enterotoxin production varied by a factor of more than 100 among the different strains tested; B. cereus produced the highest amount of enterotoxin and Btk from Dipel® the lowest (0.86%). Although diarrhoeal enterotoxin production was low to moderate in most of the strains tested, the author warned that the results indicate that Bt is capable of causing food poisoning, and therefore, Bt-based insecticides with viable spores may, under the “right conditions” (these conditions were not specified), pose a potential risk for a gastroenteritis outbreak (14). Subsequent laboratory tests with six strains of Bt (including var. kurstaki, israelensis and morrisoni) also demonstrated enterotoxin production (9). The authors cautioned that “with current trends for increasing popularity of organically grown foods [on which biopesticides are commonly used] and decreasing cooking time for vegetables, a potential [non-lethal] foodpoisoning risk exists if enterotoxin-producing strains of B. thuringiensis become employed as biopesticides” (9), and if the consumers do not properly wash the food before preparation and consumption.

Another documented example was in which Bt was isolated from Red Tokay grapes imported from California, USA, and sold for human consumption in Saskatoon, Saskatchewan, Canada (8). No health problems were reported from eating these grapes. The close taxonomic and molecular relationship between B. thuringiensis and B. cereus warrants close scrutiny of the published literature with respect to food safety. Due to a lack of a universally accepted method for conclusively differentiating Bt from B. cereus in public health laboratories, some researchers feel there may be an under-representation of food poisoning cases attributable to Bt (9), or, conversely, showing the safety of Bt. There is only one published case in the literature that implicates Bt with food poisoning. Investigation during a gastroenteritis outbreak in a chronic care institution in Ottawa, Ontario, recovered bacterial isolates presumptively identified as B. cereus

53

As part of the same study, the isolate with the highest level of enterotoxin was fed to rats at a dosage of 5x1010 spores / day (total of 1012 spores) over 3 weeks, and 106 spores were injected subcutaneously. The rats suffered no ill-effects in terms of their condition or in the pathology of their internal organs despite the fact that the strain tested (Bt 13B) was capable of producing both β-exotoxin and enterotoxin. Dissection of sacrificed rats showed that the Bt spores did not germinate in the rat gut (9), which supports earlier work done on mice (70).

ingesting it, but recovered within 18 hours. The Centre for Disease Control (CDC) in Atlanta determined that Bt, and not B. cereus, was present in the honey. However, the epidemiologist at the CDC in Atlanta stated that there was no evidence that implicates Bt as the cause of the illness and no evidence to stop the use of Btk in the gypsy moth control program being conducted in Pennsylvania (39). Unfortunately, the reference does not specify if the retailer shipped the gift directly to the recipients, or how much honey the family members ingested before they became ill. It is somewhat unusual that only three of the five people from the same family became ill after eating the honey, and nobody else eating honey from the same distributor in Maine became ill.

It has been demonstrated that washing vegetables (spinach leaves) in cold running water resulted in a reduction of only about 50% of the Btk spore load (9). Bactospeine® [Btk (HD-1)], applied in a greenhouse according to the manufacturer’s instructions and sprayed until run-off on both surfaces of spinach (Spinacia oleracea) leaves, was investigated for spore load reduction after normal food preparation practices. Plants were harvested 24 hours following Btk application in attempt to show as high a residual load as possible. Boiling of the leaves effectively removed the spores (99% homologous to the corresponding region in cry31Aa. Our results clearly show that the parasporal inclusion proteins of the four B. thuringiensis isolates from Vietnam belong to the parasporin-1 family (7). This is supported by the following facts: (i) the proteins have in vitro cancer cell-killing activities, (ii) they are immunologically closely related to parasporin-1, and (iii) homology >99% is revealed in partial DNA sequences between parasporin-1 (cry31Aa) and genes encoding the proteins of the four isolates. It should be noted that the reference strains of cancer cell-killing B. thuringiensis were all from natural environments in Japan (2-4, 9). Our findings strongly suggest that the parasporin producers are widely distributed, not only in Japan but also in other regions of Asia.

References 1. Attathom, T., W. Chongrattanameteekul, J. Chanpaisang, and R. Siriyan.1995. Morphological diversity and toxicity of deltaendotoxin produced by various strains of Bacillus thuringiensis. Bull. Entomol. Res. 85:167-173. 2. Ito, A., Y. Sasaguri, S.Kitada, Y. Kusaka, K. Kuwano, K.Masutomi, E.Mizuki, T. Akao, and M. Ohba. 2004. A Bacillus thuringiensis crystal protein with selective cytocidal action to human cells. J. Biol. Chem. 279:21282-21286. 3. Katayama, H., H.Yokota, T. Akao, O.Nakamura, M.Ohba , E. Mekada, and E. Mizuki. 2005. Parasporin-1, a novel cytotoxic protein to human cells from non-insecticidal parasporal inclusions of Bacillus thuringiensis. J. Biochem. 137:17-25. 4. Lee, D.-W., T. Akao, S.Yamashita, H. Katayama, M. Maeda, H.

125

6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact, Victoria BC, 2005 Côté, J.-C., Otvos, I.S., Schwartz, J.-L. and Vincent, C. (eds)

Characterization of Bacillus thuringiensis Strains in the Vietnam Bacillus thuringiensis Collection Ngo Dinh Binh1*, Nguyen Xuan Canh1, Nguyen Thi Anh Nguyet1, Nguyen Dinh Tuan1, Pham Kieu Thuy1, Nguyen Thi Thanh Hanh1, Shin-ichiro Asano2, and Michio Ohba3 Institute of Biotechnology, Vietnamese Academy of Science and Technology, Vietnam. Graduate School of Agriculture, Hokkaido University, Sapporo, Hokkaido, Japan, 060-8589. 3 Graduate School of Agriculture, Kyushu University, Fukuoka, Japan, 812-8581. 1 2

In the Vietnamese Collection of Microorganisms, the Bacillus thuringiensis collection is abundant and diverse. Established since 1993, the Bacillus thuringiensis Collection, currently includes 119 reference strains belonging to 78 different serovars received from Korea, Japan, France, USA and more than 1080 strains isolated from various samples collected in several areas across Vietnam. Among them, 601 strains produce parasporal inclusions of different morphological characteristics such as rhomboidal, cuboidal, spherical, amorphous and heterogeneous crystals. H-serotyping of 442 crystalliferous strains showed that they belong 19 serotypes. Most of them belong to Bacillus thuringiensis subsp. kurstaki (132 strains), aizawai (74 strains), morrisoni (74 strains). Bioassays revealed that 127 strains are active against Plutella xylostella (Lepidotera), 33 strains are active against Aedes aegypti (Diptera) and 5 strains are active against Tribolium castaneum (Coleoptera). PCR was used to detect genes encoding crystal proteins for 185 strains: the genes found are cry1Aa, cry1Ab, cry1Ac, cry1B, cry1C, cry1D, cry1E, cry1F, cry2A, cry3A, cry4B, and cyt2 (Table 6) The Vietnamese Bacillus thuringiensis collection is continuously being developed. Introduction The Institute of Biotechnology (IBT) is the leading research institute in biology and biotechnology in Vietnam. One important mandate of IBT is to collect and curate microorganism strains. The Vietnam Collection of Microorganisms (VCM) was established in 1993 by IBT on the basis of the Collection of the former Department of Microbiology of the Biology Institute (founded in 1975). At first, there were about 1000 strains belonging to various groups of microorganisms such as bacteria, mold, yeast, actinomycetes. Since then, the Vietnam Collection of microorganisms has been continuously developed in cooperation with other Vietnamese and overseas collections. The VCM is considered one of the

largest in Vietnam. Its primary mandate is to maintain and preserve microorganism strains and, recently an attempt has been made to develop a GeneBank. Bacillus thuringiensis is the most abundant microorganisms in this collection, with more than 1000 strains collected from several different sources (Table 1). At present, the Vietnam Bacillus thuringiensis Collection includes 78 subspecies reference-strains and more than 1000 of well-characterized local isolates. This is a valuable biological resource for research, education and various applications (1) .

TABLE 1. Introduction of the Vietnam Bacillus thuringiensis Collection

Source (Country)

Number of Bt strains

Bt strain’s Site in the VCM

Year obtained

Korea

4

Reference strains

2000

Japan

5

Reference strains

2001

France

32

Reference strains

2000

USA

78

Type strains

2002-2003

Vietnam

1080

Isolates

From 1975 to present

* Corresponding author. Mailing address: Instittute of Biotechnology, Vietnamese Academy of Science and Technology, 18 Hoang Quoc Viet road, Hanoi, Vietnam. Tel: 84 4 756 2880, Fax: 84 4 836 3144, Email: [email protected]

126

The characteristics of isolates in the Vietnam collection of Bacillus thuringiensis isolation

TABLE 3. Morphology of Bt crystal in the Collection.

Crystal shapes

Several Bt-based bioinsecticides are available on the Vietnamese market, most of which are imported. Using imported products may bring foreign and recombinant bacteria into the local ecosystem. This may also causes the change of local microorganisms distribution (1). Accordingly, it is necessary to study the distribution and the contribution of the local native Bacillus thuringiensis bacteria. Bt has been isolated from numerous types of samples collected across Vietnam, including 550 soil, 185 leaf and 45 insect-cadaver samples. Isolation procedures were implemented following a method improved from Ohba and Aizawai (1986) (10) (Table 2).

Number of strains Percentage (%)

Rhomboidal

681

63.1

Spherical

121

11.2

Cuboidal

52

4.8

Heterogeneous

163

15.1

Amorphous

63

5.8

TABLE 2. Characteristics of Bacillus thuringiensis isolates in Vietnam.

Number of samples Number of Bt isolated/ Kind with Bt/ Number of Number of spore-forming of samples examined bacteria examined (Bt samples (%) index) Soils

379/550 (68.91)

763/1861 (0.41)

leaves

104/185 (56.22)

258/662 (0.39)

Insect cadavers

16/45 (35.56)

59/190 (0.31)

Total

499/780 (63.97)

1080/2713(0.4)

FIG. 1. Scanning electron micrographs of crystal morphology of Bt isolates. a: Strain DB 21-2 isolated from Dien Bien Phu soil sample with rhomboidal crystals; b: Strain HN5-7 isolated from Ha Noi with spherical crystals; c: Strain SH149-11 isolated from Ha Tay province with cuboidal crystals; d: Strain NC29-3 isolated from Thai Nguyen province with cuboidal and rhomboidal crystals; e: Strain TN 1-1 isolated from Thai Nguyen province with rhomboidal and spherical crystals; g: Strain NC27-1 isolated from the Thai Nguyen province with cuboidal and spherical crystals.

The isolation process obtained 2713 colonies with morphological features of the Bacillus cereus group, of which 1080 colonies were identified as crystalproducing Bt. Bt was present in 499 samples (63.97%), and an average Bt-index of 0.4. Bacillus thuringiensis was found in all three kinds of samples, including soil, leaves and insect cadavers. However, their prevalence differed depending on kind of samples, i.e. highest (68.9%) in the soil and lowest (35.5%) in insect cadavers (Table 2).

kind of crystal, but some (15.1%) are able to produce crystals with various shapes (Figure 1, Table 3).

Classification characteristics of Bt in the collection A number of strains (119) belonging to 78 Bt subspecies were obtained from various countries, including the USA, France, Japan, and Korea. With these reference strains, a set of antisera was produced for use as a standard serological kit to classify Bt. Isolated strains in the VCM were classified according to de Barjac and Bonnefoi (1990) (6) (Table 4).

Morphological characteristics of toxic crystal protein The isolation process resulted in 1080 strains producing crystal proteins with various size and morphological characteristics. Three shapes of crystals were abundant: rhomboidal (63.1%), spherical (11.2%), and cuboidal crystals (4.8%). Some (5.8%) strains produce irregular crystals. Most of isolates produce only one specific

Of 479 strains classified by flagellar (H) antigen analysis, 442 strains (92.3%) showed positive agglutination with 18 antisera, the remaining 37 strains (7.7%) did not agglutinate with any of 60 antisera used. The results revealed that 27.6% of the isolates belong to serotypes 3a,3b,3c (subspecies kurstaki), 15.4% belong to 127

TABLE 4. H-Serotyping of Bacillus thuringiensis isolates in Vietnam Bt Collection.

No

Subspecies

H-serotype

Agglutination strains

Percentage (%)

1

alesti

3a, 3c

35

7.3

2

sumiyoshiensis

3a, 3d

6

1.3

3

kurstaki

3a, 3b, 3c

132

27.6

4

fukuokaensis

3a, 3d, 3e

18

3.8

5

gallariae

5a, 5b

7

1.5

6

aizawai

7

74

15.4

7

morrisoni

8a, 8b

74

15.4

8

nigeriensis

8b, 8d

16

3.3

9

tolwothy

9

13

2.7

10

isralensis

14

7

1.5

11

indiana

16

13

2.5

12

yunnanensis

20a, 20b

4

0.8

13

pondicheriensis

20a, 20c

3

0.6

14

colmeri

21

12

2.5

15

novosibirsk

24a, 24c

3

0.6

16

coreanensis

25

6

1.3

17

leesis

33

8

1.7

18

konkukian

34

11

2.3

37

7.7

19

Not agglutinated

TABLE 5. Toxicity of Bacillus thuringiensis isolates against Plutella xylostella, Aedes aegypti, and Tribolium castaneum, 3 days after treatment.

Percentage of died insects (%) 0-20 20-40 40-60 60-80 80-100

Dosages (spores/ml)

Plutella xylostella No. of Bt Percentage (%) strains

Aedes aegypti

Tribolium castaneum

No of Bt strains

Percentage (%)

No of Bt strains

Percentage (%)

105

49

15.2

33

22.4

39

40.6

10

7

20

6.2

9

6.1

31

32.3

105

81

25.2

48

32.7

25

26

107

39

12.1

38

25.8

23

24

10

5

76

23.6

36

24.5

18

18.8

10

7

127

39.4

43

29.3

22

23

10

5

68

21.1

21

14.3

11

11.5

10

7

77

23.9

36

24.5

17

17.7

10

5

48

14.9

9

6.1

3

3.1

10

7

59

18.3

21

14.3

5

5.2

128

FIG. 2. Agarose gel (1.5%) electrophoresis analysis of multiplex PCR products obtained by using specific primers of Bt isolates. Lane M: Marker, Lane 1: SPJ9-6, Lane 2: DB8-2, Lane 3: HL2-1, Lane 4: DB6-2, Lane 5: SP23-10, Lane 6: BB12-6, Lane 7: SP5-1, Lane 8: NA8-1, Lane 9: QB3-2, Lane 10: SP10-7, Lane 11: DH206-2, Lane 12: TQ3-3, Lane 13: SP14-3, Lane 14: AV132-2, Lane 15: BB85-14, Lane 16: NAK7-4. TABLE 6. PCR analysis of the insecticidal crystal protein genes from Bacillus thuringiensis isolates.

Specific primer

No. of isolates detected

% of isolates detected

cry1Aa

112

60.5

cry1Ab

114

61.6

cry1Ac

124

67

cry1B

28

15.1

cry1C

43

23.2

cry1D

36

19.5

cry1E

26

14.1

cry1F

20

10.8

cry2A

77

41.6

cry3A

3

1.6

cry4B

16

8.7

cyt2

65

35.1

Not detected

13

7

aizawai and 15.4% belong to morrisoni. Subspecies novosibirsk and pondicheriensis were rare subspecies, with 3 strains (0.6%) of each. Our data indicate that Bt isolated in Vietnam is rather diverse in classification. Up to now, there are 82 subspecies of Bt identified all over the world (8), of which 18 subspecies are present in Vietnam. Interestingly, 37 strains of the VCM do not agglutinate with antisera. They may either belong to remaining or new subspecies. The subspecies present in Vietnam, such as kurstaki, aizawai, israelensis and

morrisoni, have been already well-characterized in the world, and have valuable properties for control application.

Insecticidal activity of isolates in the Collection The most important property of Bacillus thuringiensis is their specific insecticidal activity that is amenable to the production of bioinsecticides. For this purpose, it is important to select the most active strains. In our study,

129

the isolates were assayed to determine their activity against three orders of insects, i.e. Lepidoptera (Plutella xylostella), Diptera (Aedes aegypti) and Coleoptera (Tribolium castaneum). The assays were carried out by dipping leaf discs in Bt solutions or by rearing larvae on artificial diets treated with Bt (Table 5).

References 1. Binh, N. D. 2005. Reasearch, production and application of Bacillus thuringiensis in Vietnam. Biotechnology of Bacillus thuringiensis. Proceedings of the 5th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact. Edited by Ngo Dinh Binh, Ray. J. Akhurst, Donald H. Dean. Science and Technics Publishing House, Vol. 5, 21-30. 2. Binh, N. D., S. Asano, H. Bando, and T. Iizuka. 2002. Identification of cry1 - type genes of Bacillus thuringiensis isolated from Vietnam. In Biotechnology of Bacillus thuringiensis and Its Environmental Impact. Proceedings of 4th Pacific Rim Conference. Edited by Ray Akhurst, C.E. Beard and P.A. Hughes. 142-146. 3. Binh, N. D., N. Q. Chau, N. V .Thuong, N. H. Chinh, V. T. D. Tram, N. V. Tuat , Y.H. Je, J. H. Chang, and S. K. Kang. 1999. Isolation, screening and characterization of Bacillus thuringiensis isolates from Vietnam. Biotechnology of Bacillus thuringiensis. Rd. Yu Ziniu, Sun Ming and Liu Ziduo. Science Press, Beijing, New York. Vol. 3, 46. 4. Binh, N. D., N. Q Chau, N. V., Thuong, Y. H. Je , J. H. Chang, I. H. Lee, D. W. Lee, J. H. Li, and S. K. Kang. 1998. Screening and characterization of Bacillus thuringiensis isolates from Vietnam. Conference on pesticides of 21st Century. Oct. 30-31, Muju, Korea. 5. Binh, N. D., N. T. A. Nguyet, N. Q. Chau, N. X. Canh, , P. M . Huong, and J. Herrou. 2005. Bacillus thuringiensis Distribution in soil of Vietnam. Biotechnology of Bacillus thuringiensis. Proceedings of the 5th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact. Edited by Ngo Dinh Binh, Ray. J. Akhurst, Donald H. Dean. Science and Technics Publishing House, Vol. 5, 45-56. 6. de Barjac H., and E. Frachon. 1990. Classification of Bacillus thuringiensis Strains. Entomophaga 35: 233-240. 7. Full list of delta-endotoxins. 11 August 2006. http://www.biols. susx.ac.uk/home/Neil_Crickmore/Bt/toxins2.html 8. Lecadet, M. M., E. Frachon , V.Cosmao Dumanoir , H. Ripoutea , S.Hamon, P. Laurent, and I. Thiéry. 1999. Updating of the Hantigen classification of Bacillus thuringiensis. J. Appl. Microbiol. 86: 660-672. 9. Nguyet, N. T. A., J. Herrou , N. Q. Chau , N. X Canh, P. M. Huong , and N. D. Binh. 2005. Screening and characterisation of Bacillus thuringiensis isolated from three provinces in Vietnam. Biotechnology of Bacillus thuringiensis. Proceedings of the 5th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact. Edited by Ngo Dinh Binh, Ray. J. Akhurst, Donald H. Dean. Science and Technics Publishing House, Vol. 5, 141-152 10. Ohba, M., and K. Aizawai. 1986. Distribution of Bacillus thuringiensis in soils of Japan. J. Invertebr. Pathol. 47: 12-20.

Evaluation of toxicity against P. xylostella, A. aegypti and T. castaneum was done respectively for 322, 147 and 96 strains. The results showed that 59 strains (18.3%) and 48 strains (14.9%), respectively killed 80-100% P. xylostella larvae after 3 days at 107 and 105 spores/ml. For the target A. aegypsti, these numbers were: 21 strains-107 spores/ml (14.3%); 9 strains-105 spores/ ml (6.1%) and for T. castaneum larvae: 5 strains-107 spores/ml (5.2%), 3 strains-105 spores/ml (3.1%).

Gene characterization encoding ICPs of Bt isolates In order to get a toxic gene profile for each strain in the collection and to select strains amenable for bioinsecticide production, PCR was used to detect some toxic genes (Figure 2 and Table 6). Genes profile was characterized for 185 strains by using 12 specific primer pairs (cry1Aa, cry1Ab, cry1Ac, cry1B, cry1C, cry1D, cry1E, cry1F, cry2A, cry3A, cry4B, cyt2): 172 strains contained one or more fragment genes, 13 strains did not contain any gene surveyed. The frequencies of genes were different, i.e. cry1Ac accounted for 67%; cry1Ab, 61.6%; cry1Aa, 60.5% and, cry3A, 1.6%.

Conclusion Though characterization of Bt strains in the Vietnam Bacillus thuringiensis Collection was limited (not all of toxin genes were studied for complete gene profiles), its result was significant and beneficial. With these results, strains which habour cry genes can be selected for production of Bt insecticide against Lepidoptera, Coleoptera and tropical Diptera vectors transmitting diseases in Vietnam.

Acknowledgements This work was partially supported by the National Program of Basic Science of Vietnam, code: 82.04.09.

130

6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact, Victoria BC, 2005 Côté, J.-C., Otvos, I.S, Schwartz, J.-L. and Vincent, C. (eds)

Engineering Turf Grass for Resistance against Certain Coleopteran Pests� Using Bacillus thuringiensis cry8Da Gene Shin-ichiro A���� sano1�*,���������������� Takuji Okamoto 1,���������������� Hisanori Bando 1, Mitsugu ��������������� Horita 2,������������������� Hiroshi Sekiguchi 2,and Toshihiko Iizuka 2 1� 2

Graduate School of Agriculture, Hokkaido University, Sapporo, Hokkaido,����������������� Japan, ��������� 060-8589�. Hokkaido Green-Bio Institute, Naganuma, Hokkaido, ��������������� Japan���������� , 069-131�.

Keywords:� SDS-502, cry8Da, transgenic grass, GFP, Coleoptera ����������

A transgenic grass was engineered with the cry8Da gene from a newly discovered B. thuringiensis strain called SDS-502. The cry8Da gene was cloned in a vector, pBI221, by replacing the gusA gene. The plasmid vector containing cry8Da along with another plasmid harboring the GFP gene were introduced to calli derived from mature seed embryos using the particle bombardment method. GFP was used as an indicator of transformed grass cells. Grass cells showing green fluorescence were selected and grown on a plant tissue culture medium. The transgenic grass containing the cry8Da gene showed strong resistance against the feeding attack by the Japanese beetle. The cry8Da gene was cloned from Bt SDS-502 following the method described in Asano et al. (1). A fragment of the cry8Da gene containing the active region was amplified by PCR using two primers having the sequences, 5’- GGATCCCATGAGTCCAAATAATCAAAATG, 5’CCCGGGTCACACATCTAGGTCTTCTTCTGC, and the cloned cry8Da gene as a template. The PCR amplified gene fragment was then cloned in pGEM-TEasy (Promega) following the instructions given by the plasmid manufacturer. The cloned gene was sequenced to confirm the sequence of the cry8Da gene. The PCR amplified cry8Da gene in pGEM-T-Easy was excised out with BamHI and SacI utilizing these sites provided in pGEM-T-Easy and cloned in pBI221 (Clonetech) which had been cut with BamHI and SacI to remove the gusA gene. The resulting plasmid derived from pBI221 in which the cry8Da gene cloned was called p35S-cry8DT and used in plant transformation. The other plasmid (p35S-GFP, Clonetech) used in the plant transformation. The concentration of p35S-cry8DT and p35S-GFP plasmids was adjusted to 2μg/ul before used in the turf grass transformation

were cut in small sizes of about 1 mm3. About 40 callus pieces were placed on the callus-induction medium used in one shot. 10 μg of gold particles (1.5 micron) in 4 μl ethanol were coated with 1 μg of p35S-cry8DT and p35S-GFP and were shot once callus pieces from 12 cm above the sample stage. The transformed callus was then transferred on the fresh medium. Each callus piece was placed on the medium in about 1 cm apart. Within a few days, transformed cells showed GFP fluorescence. After one week, cell masses showing strong GFP fluorescence were excised out from each lump of callus and transplanted on a regeneration medium. The regeneration medium is the same as for the callus induction media except that no hormones were added. The transformed cells were grown on the medium at 24 ○C under 16 hr light per day. After 4 weeks, 3 GFP positive tall fescue callus pieces developed into whole plants with leaves and roots. When transformed callus developed into whole plants, a portion of leaves was taken from each plant and DNA was extracted from the leaf samples using DNeasy Plant Mini Kit (Qiagen) following the manufacturer’s instructions. The cry8Da gene in the samples were analyzed by PCR using two primers having the sequences, 5 ’ - G G AT C C C AT G A G T C C A A ATA AT C A A A AT G , 5’-CCCGGGTCACACATCTAGGTCTTCTTCTGC. If the cry8Da gene existed in a template DNA sample (plant leaf extracts), these primers should produce a 2 kb amplified fragment. All leaf samples derived from

Transformation was performed with particle gun transformation technology. The user manual provided by the particle gun (GIE-III IDER) manufacturer Frontier Science, was essentially followed. Calli grown on the callus induction medium was placed on a high osmotic pressure (HOP) medium consisting of the entire ingredients in the callus induction medium and 0.5 M mannitol overnight. The calli placed on the HOP medium

* Corresponding author : Mailing address : Hokkaido University, Faculty of Agriculture Applied, Molecular Entomology Lab.; Kita 9 Nishi 9, Sapporo, Hokkaido, 0608589, Japan. Tel: 011 706 2423. Fax: 011 706 0879. Email: [email protected]

131

GFP positive callus pieces showed this 2-kb fragment by PCR analysis confirming the cry8Da gene inserted into the plant genome (Fig. 1). Three lines from tall fescue were selected based on this PCR analysis for insect resistance tests. Regenerated whole plants from transformed calli were transferred to 15cm-diameter pots containing potting soil. About six plants were planted in each pot. In each pot, two third-instar Japanese beetle, Popillia japonica Newman (Coleoptera: Scarabeidae), larvae which had been collected from a grass field were released and were allowed to feed on grass roots for one month. The insects consumed the roots of the plants that were not insect-resistant and killed the plants. On the other hand, plants that were positive for cry8Da by PCR analysis showed resistance to the Japanese beetle, which survived (Fig. 2).

F���������������������������������������������������������� IG.������������������������������������������������������� 1����������������������������������������������������� . PCR ��������������������������������������������������� analysis of transformed turf grass showing the cry8Da gene in a form of a 2 kb band (right three lanes). The left lane is a size marker. The second lane from left is a negative control obtained from non-transgenic grass.

Acknowledgments This project was supported by Phyllom LLC, Menlo Park, California, who has the commercial use license on the cry8Da gene. A patent application on the insect resistant transgenic turf grass has been filed on August 31, 2005. � A

Reference 1. Asano, S., C. Yamashita, T. Lizuka, K. Takeuchi, S. Yamanaka, D. Cerf, and T. Yamamoto. 2003. A strain of Bacillus thuringiensis subsp. galleriae containing a novel cry8 gene highly toxic to Anomala cuprea (Coleoptera: Scarabaeidae). �������������������� Biological ������������������� Control 28: 191-196������.�����

B � F������������������������������������������������������������������ IG.��������������������������������������������������������������� 2������������������������������������������������������������� .������������������������������������������������������������ Picture ����������������������������������������������������������� of a pot contains several lines of transgenic turf grass. The pot contains two third-instar Japanese beetle larvae (�� A�) which were allowed to consume the grass roots for one month (�� B�). Some plants (top left four plants, ��������������������������������� white ��������������������������� circled) showed resistance while the others (right and bottom plants, ���������������������������� red������������������������� circled) were killed by the insects.

132

6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact, Victoria BC, 2005 Côté, J.-C., Otvos, I.S, Schwartz, J.-L. and Vincent, C. (eds)

Analysis of Non-Target Impacts of Foray 48B on Soil Micro-Organisms Maureen O’Callaghan1*, E. Gerard1, and U. Sarathchandra2 1 2

AgResearch, PO Box 60, Lincoln, New Zealand,7640. AgResearch, Private Bag 3123, Hamilton, New Zealand, 3240.

The effect of Foray 48B (Bacillus thuringiensis subsp. kurstaki, Btk) on indigenous soil micro-organisms was assessed in a pot trial in which four rates of Foray were applied. Foray had no impact on the genetic diversity of the indigenous soil eubacterial community, as measured by PCR-DGGE. Using Bacillus-specific PCR primers, bands corresponding to Btk were detected within the natural soil populations of bacilli only at 100 and 1000× field rate (where field rate = 5 L/ha of Foray 48B). After 2 weeks, bacterial functional diversity (estimated by BIOLOG ecoplates) was similar in all treatments and total fungal and bacterial populations were greater in the 1000× FR treatment only.

using previously described primers and methodology (3, 5, 6). PCR products were separated by denaturing gradient gel electrophoresis (DGGE). The functional diversity of the soil bacterial community was estimated using BIOLOG ecoplates (10). Bacterial and fungal populations were enumerated by dilution plating on tryptic soy agar (TSA) and potato dextrose agar (PDA) containing 1µg/ml chlortetracycline. DNA fingerprinting patterns showed that Foray 48B application had no impact on the diversity of the indigenous soil bacterial community (Fig. 1). Community analysis of the soil eubacteria revealed highly complex fingerprints in all treatments. The four replicate samples showed almost identical fingerprints, demonstrating low variability between pots and a high reproducibility of DNA extraction, by PCR and DGGE procedures. Using Bacillus-specific PCR primers (2), bands corresponding to Btk were detected within the natural soil populations of bacilli only at 100x and 1000 × FR (data not shown).

Btk products such as Foray 48B are typically applied to foliage for controlling leaf-feeding insect pests. When repeated applications of biopesticide are made, for example to control exotic pests, high numbers of spores and crystals can reach the soil, leading to concerns about potential non-target effects of Btk products on soil microflora. The impact of Bt on other micro-organisms is largely unknown. In vitro antibiotic activity of Bt species other than Btk has been reported (9), but no effect of Dipel (Btk) application was found on soil microbial respiration and biomass when used at the recommended field rate (8). Similarly, more recent studies have not detected any effects of Bt toxins on culturable soil microorganisms (1, 4, 7).

The soil bacterial functional diversity in pots treated with 1000x FR was significantly different from the other treatments at 1 week after treatments, but after 2 weeks functional diversity was similar in all treatments (results not shown). Total culturable bacterial numbers did not differ significantly among treatments, with the exception of 1000x FR, where bacterial numbers were significantly higher than in control soils (results not shown). Similarly the total culturable fungal populations were significantly higher only in the 1000× FR treatment at 1 and 2 weeks post treatments.

In a greenhouse trial, pots containing perennial ryegrass (Lolium perenne) and white clover (Trifolium repens) grown in field collected soil were treated with Foray 48B (Abbott Laboratories) at four rates (0 – water only, 1x, 100x, and 1000x field rate), where field rate was 5 L/ha-1 (equivalent to 83.5 BIU ha-1) and the effects on non-target soil micro-organisms were monitored using a polyphasic approach. Four replicate pots of each treatment were sampled at 1, 2 and 4 weeks after treatment application. Bacterial community DNA extracted from the soil and bacterial 16S rDNA fragments were amplified by PCR

In conclusion, application of very high amounts of Foray 48B (1000x FR) caused only transient effects on bacterial functional diversity and the total numbers of culturable bacteria and fungi. The addition of Foray 48B even at very high rates (1000x FR) had no effect on diversity of predominant eubacterial populations present in soil, as determined by PCR-DGGE. When Bacillus-specific

* Corresponding Author. Mailing Address: AgResearch, PO Box 60, Lincoln, New Zealand, 7640. Tel: 64.03.325.9986, Fax: 64.03.325.9946, Email: [email protected]

133

FIG. 1: DNA banding patterns of soil bacteria obtained by DGGE analysis of eubacterial-primer based amplicons from soil inoculated with Foray 48B at various rates. Bt = Bt kurstaki.

primers were used, bands corresponding to Btk were visible at 100x and 1000x FR 1 week after application; no corresponding bands were detected in the control or in the 1x FR treatment.

References 1. Ferreira, L. H. P. L., J. C. Molina, C. Brasil, and G. Andrade. 2003. Evaluation of Bacillus thuringiensis bioinsecticidal protein effects on soil microorganisms. Plant Soil 256: 161-168. 2. Garbeva, P., J. A. van Veen, and J. D. van Elsas. 2003. ������������ Predominant Bacillus spp. in agricultural soil under different management regimes detected via PCR-DGGE. Microb. Ecol. 45: 302-316. 3. Heuer, H., M. Kresk, B. Baker, K. Smalla, and E. M. H. Wellington. 1997. Analysis of actinomycete communities by specific amplification of genes encoding 16S rRNA and gel-electrophoretic separation in denaturing gradients. Appl. Environ. Microbiol. 63: 3233-3241. 4. Muchaonyera, P., S. Waladde, P. Nyamugafata, S. Mpepereki, and G. G Ristori. 2004. Persistence and impact on microorganisms of Bacillus thuringiensis in some Zimbabwean soils. Plant Soil 266: 41-46. 5. Muyzer, G., E. C. de Waal, and A. G. Uitterinden. 1993. ������������� Profiling of complex microbial populations by denaturing gradient electrophoresis analysis of polymerase chain reaction – amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59: 695-700. 6. Nubel, U., B. Engelen, A. Felske, J. Snaidr, A. Wieshuber, R. I. Amann, W. Ludwig, and H. Backhaus. 1996. J. Bacteriol. 178: 5636-5643. 7. Saxena, D. and G. Stotzky. 2001. Bacillus thuringiensis (Bt) toxin released from root exudates and biomass of Bt corn has no apparent effect on earthworms, nematodes, protozoa, bacteria and fungi in soil. Soil Biol. Biochem. 33: 1225-1230. 8. Visser, S., J. A. Addison, and S. B. Holmes. 1994. Effects of Dipel 176, a Bacillus thuringiensis subsp. kurstaki (B.t.k.) formulation, on soil microflora and the fate of B.t.k. in an acid forest soil: a laboratory study. Can. J. For. Res. 24: 462-471. 9. Yudina, T. G., and L. I. Burtseva, 1997. Activity of delta-endotoxins of four Bacillus thuringiensis subspecies against prokaryotes. Microbiology (NY) 66: 17-22. 10. Zak, J. C., M. R. Willig, D. L. Moorhead, H. G. Wildman. 1994. Functional diversity of microbial communities: a quantitative approach. Soil Biol. Biochem. 26: 1101–1108.

134

6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact, Victoria BC, 2005 Côté, J.-C., Otvos, I.S, Schwartz, J.-L. and Vincent, C. (eds)

Ecosystem Effects of Novel Living Organisms (EENLO): A Federal Research Initiative Valar Anoop1*, Wendy Shearer2, and Stuart Lee1 1 2

Biotechnology Section, New Substances Division, Environment Canada, Gatineau, QC, Canada, K1A 0H3. Plant Biosafety Office, Canadian Food Inspection Agency, Ottawa, ON, Canada, K1A 0Y9.

The purpose of the EENLO initiative is to generate knowledge, through an effective and integrated approach, on long-term ecosystem effects of NLOs, in order to strengthen the sound scientific basis for policies on, decisions about, and management of NLOs. A NLO is a living organism, bearing a trait novel to that species, whose genetic make-up has been influenced by any of a variety of means known as “biotechnology,” as per the Canadian Environmental Protection Act, 1999 (1). With Environment Canada as the lead department; this initiative is centred on the establishment of an interdisciplinary network of researchers from across Canada, both within and outside the federal government, generating and sharing knowledge and ideas about the ecosystem effects of NLOs in collaboration with regulators, policy makers, and the general public. In order to coordinate the networking and facilitate communication and collaboration among academic and government researchers, policy makers and regulators working with EENLO related issues, an online community of practice (CoP) has been established.

References 1. Canadian Environmental Protection Act. 1999. Retrieved October 15, 2005, from http://laws.justice.gc.ca/en/C-15.31/text.html 2. Canadian Food Inspection Agency. Retrieved October 15, 2005, from www.inspection.gc.ca/english/sci/-biotech/enviro/monarce.shtml

Biotechnology derived Bt cotton, potatoes and corn are approved for environmental release, and Bt corn is widely used in Canada (2). Several areas have been identified as being in need of further research to enable decision makers to make more informed choices regarding the responsible deployment of these NLOs. The EENLO initiative seeks to address such knowledge gaps in generating and managing ecosystem information through its proposed seven research themes organized under foundational research, impact research and risk reduction research.

* Corresponding author. Mailing address: Environment Canada, 351 St. Joseph Blvd., PVM-14th Floor, Gatineau, QC, Canada K1A 0H3. Tel: (819) 934-8123. Fax: (819) 953-7155. Email: [email protected]

135

6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact, Victoria BC, 2005 Côté, J.-C., Otvos, I.S., Schwartz, J.-L. and Vincent, C. (eds)

Environmental Risk Assessment of Bacillus thuringiensis strain ATCC 13367 under the Canadian Environmental Protection Act 1999 (CEPA 1999) Souad El Ouakfaoui*, Lee-Ann Tsan2, Théophile Paré1, and Kiera Delgaty1 New Substances Branch, Biotechnology Division, Risk Assessment Directorate Environment Canada, Gatineau, Québec, Canada, K1A 0H3 1

2

College of Physical and Engineering Science, University of Guelph, Guelph, ON Canada N1G 2W1

waste water treatment facilities. The SLRA of the DSL microbial strains consists of integrating the assessment of known or potential exposure from intended and potential uses (taking into account its survival and/or persistence in the environment) with known or potential adverse effects (i.e., toxicity and/or pathogenicity) on the environment and on human health. The poster outlines the SLRA of Bt strain ATCC 13367 from the environmental point of view. The data gathering on Bt strain ATCC 13367 is ongoing as further studies are in progress to help generate knowledge about its potential long term effects in its current and potential uses.

The Canadian Environmental Protection Act (CEPA, 1999) requires that the Government conducts a screening-level risk assessment (SLRA) of the current 43 microbial strains on the Domestic Substances List (DSL). The presence of these stains on the DSL means that they are not ‘new’ but are (or were) in commercial use and, therefore, are exempt from requirements of the New Substances Notification Regulations. Bacillus thuringiensis (Bt) strain ATCC 13367 is among the listed strains. It is used in combination with enzymes and other micro-organisms in non-pesticidal applications such as in drains, sewers, grease traps, septic systems and

* Corresponding author. Mailing address: New Substances Branch, Biotechnology Division, Risk Assessment Directorate Environment Canada, Place Vincent Massey, 351 St-Joseph Boulevard, 14th Floor, Gatineau, Québec, Canada, K1A 0H3. Phone: (613) 994-6656, Fax: (613) 953-7155, E-mail: [email protected]

136

6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact, Victoria BC, 2005 Côté, J.-C., Otvos, I.S, Schwartz, J.-L. and Vincent, C. (eds)

Environmental Evaluation of GM Hot Pepper in Newly Synthesized Material Difference�s Si-myung, Lee1, Jeoung-han, Kim2, Byung-soo, Park2, Hyun-suk, Cho1, Donghern, Kim1, Yong-moon, Jin1 Department of Biosafety , National Institute of Biosafety (NIAB), 250th, Seodun-dong Gwonseon-gu Suwon Gyeonggi-do, Republic of Korea 2 Seoul National University, Korea 1

KeyWords: Environmental evaluation of GMO, GM peppers, New bone materials

We made genetically modified (GM) hot peppers that are herbicide-resistant. To register them for field use, we demonstrated their biosafety by environmental evaluations. We here report substantial equivalence between GM and non-GM hot peppers with respect to extracted and volatilized organic compounds. We compared organic compounds extracted from leaves, stems, roots of herbicide-resistant and wild type (Subicho) peppers.  Herbicide resistant-pepper evolved the same coumpounds and patterns in GC-MS and HPLC analysis. Both types of plants had no detectable differences in organic compounds. Volatile organic compounds from leaves and stems were also similar, although some small variations were detected.  All of detected material had no known toxicity or allergic effects. We conclude that there are no differences between GM and Non-GM peppers. These results will be used for environmental toxicity evaluation, allowing cultivation of herbicide-resistance GM peppers. Concerns about environmental effects force developers of GMOs to demonstrate the safety of GMOs for their cultivation. As a consequence, several environmental evaluation tests have to be conducted. For this evaluation, several issues were considered, including impact,environmental circumstances such as horizontal transfer of genes, morphological changes, cultivation conditions, and toxicity for living organisms. In this report, we evaluated differences in synthesized materials between GM and non-GM, with the aim of demonstrating the biosafety of GM plants.

Volatile and secreted materials from plants were analyzed by HPLC. Evolved materials were identified by GC/MS. Fig 1. shows the analysis of excreted materials from the roots. HPLC detected few differents peaks. Their differences was identified by GC/MS (Table 1). Small differences were detected and were not significant. Analyses of stems, leaves and fruits also yielded similar results. All of evolved materials were similar. Although some differences were detected in the excreted materials, they were similar. Fig 2 shows material patterns of leaves.

We designed herbicide-resistant GM hot peppers for cultivation in field. We proved biosafety of the GM plant aspects by metabolic profiling. Herbicide resistant pepper and control peppers (Subicho) were compared. Each sample was ground and eluted in various solvent conditions. Concentrate extract samples (1μl each) were injected into chromatographs. HPLC and GC/MS analysis conditions are listed below.

We conclude that there are no special differences between GM and Non-GM peppers. Alhough, some of differences were detected, they may be explained by experimental errors. These results will be used for environmental toxicity evaluation of permitting the cultivation of herbicide-resistance GM pepper.

TABLE 1. GC/MS identification of different materials from HPLC.

Peak#

GM

Non-GM

1

Thujyl alcohol

Cyclohexene

2

Thujyl alcohol

Thujyl alcohol

3

Cyclohexene

Cyclohexene

* Corresponding author. Mailing address: Biosafety Division, NIAB, RDA, 225 Seodundong, Gwonseongu, Suwon, Republic of Korea. Tel : 82-31-299-1787. Fax : 82-31-299-1772. Email: [email protected]

137

F����������������������������������������������������������� IG��������������������������������������������������������� 1. ����������������������������������������������������� Analysis of secreted compounds from Hot pepper roots.

FIG 2. Analysis diagrams of HPLC and GC/MS in GM and Non-GM pepper.

138

6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact, Victoria BC, 2005 Côté, J.-C., Otvos, I.S, Schwartz, J.-L. and Vincent, C. (eds)

Evaluation of Border Cell Number and Cry Protein Expression from Root Tips of Gossypium hirsutum Oliver G.G. Knox1,3, and Gupta V.S.R. Vadakattu2,3* CSIRO Land and Water, Locked Bag 59, Narrabri, NSW, Australia, 2390. CSIRO Land and Water, Gate 5, Waite Road, Urrbrae, SA, Australia, 5064. 3 CSIRO Entomology, Gate 5, Waite Road, Urrbrae, SA, Australia, 5064. 1 2

Keywords: cotton, border cells, Cry proteins, radicles, root, soil, transgenic

We investigated border cell numbers and levels of Cry proteins expressed in root tips, border cells and the mucilage of cotton seedlings. Border cell counts averaged 5 x 103 per radicle terminal, for the fourteen cultivars assayed, well below the previously reported 104 border cells for cotton root tips. Border cell counts for transgenic cultivars did not significantly differ from their transgenic donor or elite parents, with the exception of elite parent Sicot 189. Quantifiable ELISA detected expression of both Cry1Ac and Cry2Ab proteins from border cells, mucilage and root tips of all tested transgenic lines indicating that Bt cotton varieties could exude Cry proteins into the soil environment. In transgenic cotton (Gossypium hirsutum), expression of the Bt genes Cry1Ac and Cry2Ab from the soilborne bacterium Bacillus thuringiensis provides effective control against lepidopteran pests. However, the development of transgenic cotton cultivars is not a simple case of just inserting the insecticidal genes. The process involves several back-crossings of a transgenic donor with an elite non-transgenic cultivar, with continuous screening for desirable traits, such as yield, insecticidal protein expression and disease resistance. We investigated border cell production as a property of root architecture that might have been altered during development of transgenics. Border cells are terminally differentiated individual or small groups of cells that detach from the root cap (2). The significance of border cells in the environment is their production of several cell-specific proteins and signal molecules, which influence the direction of root growth, soil chemistry and plant-microbe interactions in the rhizosphere, and may contribute the majority of carbonrich exudates released from roots into the soil (7).

the below-ground implications of the presence of the transgenic proteins are largely unknown due to the complexity of soil ecosystems (8) and limited information on their accumulation and persistence in soil (10). We undertook an examination of Cry protein expression from roots on a morphological basis, using ELISA to detect and quantify Cry1Ac and Cry2Ab in root fractions. Acid delinted cotton seed was surface sterilised with an ethanol (50% v/v) and bleach (0.4 % m/v available chlorine) 3 min wash procedure, the seed was germinated and mucilage, border cells and homogenising root terminals recovered from twenty 72 h old radicles. To establish the number of border cells produced by cotton cultivars we germinated surface sterilised seedlings, placed individual emerging radicles in 1 mL of water, allowed it to imbibe for 5 min before applying gentle agitation with ten repeated draws and returns of a 200 µl pipette, the 1 mL of solution of liberated border cells was transferred to a Sedgewick Rafter (PhycoTech) and counted under the compound microscope (200 times magnification).

By providing the desired insecticidal control (3), transgenic cotton can ��������������������������������� decrease the use of chemical insecticides considerably, thereby helping to develop more sustainable farming systems with reduced nontarget environmental impacts (1). However, the ������������� majority of research on the expression of Cry proteins in cotton crops has concentrated on expression in above-ground plant tissue, and there is limited experimental information available on below-ground expression (4). Additionally,

Results demonstrated that root tips, mucilage and border cells produced detectable levels of Cry1Ac and Cry2Ab (Table1). The release of Cry1Ac protein by roots of two week old seedlings of transgenic cotton cultivars Sicot 289 Ingard® and 289 Ingard® Roundup Ready® was previously observed in solution culture experiments (5), although it has also been reported that the roots of cotton do not exude Cry proteins (9). Our

* Corresponding author. Mailing author : CSIRO Entomology ,PMB 2, Glen Osmond, SA, Australia, 5064. Tel: 61 8 8303 8579. Fax: 61 8 8303 8550. Email : [email protected]

139

results indicate that there is potential for commercial cotton cultivars to release Cry proteins from their roots and, due to differences in expression levels between varieties, they may serve to highlight the need to assess Cry protein exudation on a case by case scenario.

2. Bowers, J. E., B. A. Chapman, J. K. Rong, and A. H. Paterson. 2003. Unravelling angiosperm genome evolution by phylogenetic analysis of chromosomal duplication events. Nature 422: 433-438. 3. Fitt, G. P. 2000. An Australian approach to IPM in cotton: Integrating new technologies to minimise insecticide dependence. Crop Protection 19:793-800. 4. Gupta, V. V. S. R., G. N. Roberts, S. N. Neate, P.Crisp, S. McClure, and S. K. Watson. 2001. Impact of Bt-cotton on biological processes in Australian soils. Proceedings of the 4th Pacific Rim conference on the biotechnology of Bt-environmental impacts. 5. Gupta V.V.S.R., and S. Watson. 2004. Ecological impacts of GM cotton on soil biodiversity. Report to Department of Environment and Heritage, Canberra, Australia. 6. Hawes, M. C., G. Bengough, G. Cassab, and G. Ponce. 2003. Root caps and rhizosphere. J. Plant Growth Regulation 21:352-367. 7. Hawes, M. C., L. A. Brigham, F. Wen, H. H. Woo, and Y. Zhu. 1998. Function of root border cells in plant health: Pioneers in the rhizosphere. Annu. Rev. Phytopathol. 36:311-327. 8. Kowalchuk, G. A., M. Bruinsma, and J. A. Van Veen. 2003. Assessing responses of soil microorganisms to GM plants. Trends Ecol. Evol. 18:403-410. 9. Saxena, D., C. N. Stewart, I. Altosaar, Q. Shu, and G. Stotzky. 2004. Larvicidal Cry proteins from Bacillus thuringiensis are released in root exudates of transgenic B. thuringiensis corn, potato, and rice but not of B. thuringiensis canola, cotton, and tobacco. Plant Physiol. Biochem. 42:383-387. 10. Saxena, D., and G. Stotzky. 2000. Insecticidal Toxin From Bacillus Thuringiensis Is Released From Roots of Transgenic Bt Corn in Vitro and in Situ. Fems Microbiol. Ecol. 33:35-39.

Border cell counts demonstrated differences between cultivars but, with the exception of elite parent Sicot 189, none of the transgenic derived cultivars differed significantly from either parent (Figure 1). This suggested that insertion of the transgenic material did not appear to have a significant impact upon border cell production. However, our results produced an average of 5000 border cells per root tip, considerably lower than the 10000 previously reported for cotton (6). The significance of difference in cotton border cell numbers is currently unknown.

References 1. Azevedo, J. L., and W. L. Araujo. 2003. Genetically modified crops: Environmental and human health concerns. Mutation Research 544:223-233.

TABLE 1. Mean and standard deviation of quantified levels of Cry1Ac and Cry2Ab expression in ppb from five transgenic cultivars as detected by ELISA on root fractions from 20 seedlings.

Cry1Ac

Cry2Ab

289B 289BR DP50BGII 41BR 71BR 289B 289BR DP50BGII 41BR 71BR

Mucilage Mean SD 1 2 9 17 7 11 25 50 55 170 2 7 1 1 2 7 2 3 3 37

Border cell Mean SD 7 20 10 18 6 11 11 15 94 156 8 19 2 11 0 0 13 17 8 65

Root Mean 563 481 1256 1879 2228 453 580 29 857 824

SD 366 325 808 754 852 50 158 9 127 43

10000 8000 6000 4000

DP16

Auburn 623

71 BRR

71

40 BRR

40

289 B RR

289 B

189 Boll

DP50B

189 RR

189

0

DP50

2000

Coker 315

border cells/root tip

12000

FIG. 1. Mean border cells counts from 72 h old cotton radicles for 14 cotton cultivars. Error bars represent the standard error of the mean. Shaded bars indicate transgenic cultivars.

140

Acknowledgements

Thank you to our partners :

Société de protection des forêts contre les insectes et maladies

141

Thanks to our partners :

The

was organized by the