John P.Davies, Donald P.Weeks1 and Arthur R.Grossman. Carnegie Institution of Washington, Department of Plant Biology, 290 Panama Street, Stanford, ...... Ben-Ze'ev, A., Farmer, S.R., and Penman, S. (1979) Cell, 17, 319-325. 33.
Nucleic Acids Research, Vol. 20, No. 12 2959-2965
Expression of the arylsulfatase gene from the f32-tubulin promoter in Chlamydomonas reinhardtii John P.Davies, Donald P. Weeks1 and Arthur R.Grossman Carnegie Institution of Washington, Department of Plant Biology, 290 Panama Street, Stanford, CA 94305 and 'Department of Biochemistry, University of Nebraska, Lincoln, NE 68583, USA Received April 14, 1992; Accepted April 27, 1992
ABSTRACT Arylsulfatase, produced by Chiamydomonas reinhardtii during sulfur-limited growth, is secreted into the periplasmic space and is readily assayed using a chromogenic substrate. To assess the usefullness of the gene encoding arylsulfatase (ars) as a reporter gene in C. reinhardtii, we have fused the promoter region of the 32-tubulin gene (tubB2) to the coding region of an ars genomic clone to form a tubl2/ars chimeric sequence. This construct was introduced into C. reinhardtii, strain CC425 (cw-15, arg-2), via cotransformation with the argininosuccinate lyase gene (which complements the arg-2 lesion) (1). Transformants expressing arylsulfatase (Ars) in sulfursufficient medium were isolated and subsequently shown to contain the tubB2/ars gene. RNA analysis determined that tubB2/ars transcripts accumulated in these cells. Abundance of the chimeric transcript increased immediately following deflagellation in a manner similar to that of the endogenous tubB2 transcript. Thus, chimeric genes incorporating ars coding sequences and heterologous promoters can be used to examine regulated gene expression in C. reinhardtii. INTRODUCTION The unicellular, green alga Chlamydomonas reinhardtii has been extensively used as a model system for examining physiological, biochemical, and genetic processes in a eukaryotic, photosynthetic microbe. Recently developed techniques for introducing DNA into both the chloroplast (2) and nuclear genomes (1,3) have greatly enhanced the ease with which physiological and biochemical processes can be dissected at a molecular level in this organism. Introduction of DNA into the chloroplast genome has been used to study recombination (4), transcription (5) and mRNA stability (6). Nuclear genes encoding argininosuccinate lyase (arg-2/arg-7) (1), nitrate reductase (nit-i) (3,7), a radial spike protein (rsp-3) (8), and a member of the oxygen evolving enhancing complex (oee-J) (9) have been used to complement C. reinhardtii strains with lesions at these loci. Several factors have been shown to regulate expression of nuclear genes in C. reinhardtii. Light increases accumulation of transcripts from genes encoding the small subunit of ribulose
bisphosphate carboxylase (10) and the chlorophyll a/b binding proteins (11). Deflagellation causes a transient increase in tubulin synthesis (12,13), copper deprivation induces the synthesis of cytochrome c6 (cyt-c6) (14,15), ammonium deprivation stimulates the synthesis of nitrate reductase (16) and sulfur-limited cultures of C. reinhardtii produce a periplasmic arylsulfatase (Ars, gene designation ars) (17,18,19). In some of these cases, transcriptional control has been proposed to be important (20, 21, 22). However, progress in understanding the molecular mechanisms that govern these processes has been slow because the techniques necessary to elucidate them have been unavailable. For example, commonly used reporter genes such as (3glucuronidase and chloramphenicol acetyltransferase, that are useful in identifying modes of regulation and regulatory elements of promoters are not expressed in C. reinhardtii. We are developing a reporter gene system using the endogenous ars sequence. Several features of the Ars protein suggested the potential of an ars reporter gene system. Ars is a periplasmic enzyme that cleaves sulfate from aromatic compounds. Its activity is easily assayed in whole cells with the chromogenic substrate 5-bromo-4-chloro-3-indolyl sulfate (XS04), the product being a blue compound. The mature polypeptide, which is 68 kDa and contains three N-linked oligosaccharides, is synthesized only when cells are grown in sulfur-deficient medium (19). No Ars activity or ars mRNA is detectable in untransformed cells grown in sulfur-sufficient medium (22). We have used ars to explore the regulation of the (32-tubulin gene (tubB2). The promoter region of tubB2, one of four tubulin encoding genes in C. reinhardtii, was fused to the coding region of an ars genomic sequence. The tubB2 promoter is particularly useful because the tubB2 gene is transcribed in vegetatively growing cells. Cells were screened readily for expression of the tubB2/ars chimeric gene by assaying for Ars activity with XS04. Additionally, transcription from the tubB2 promoter increases after deflagellation. This promoter contains several repeats of a consensus sequence immediately upstream of the TATA box common to all 4 tubulin genes. These sequences have been suggested to function in increasing transcription of tubulin genes following deflagellation. Chimeric genes incorporating the tubB2 promoter and ars coding sequences can be used to investigate the role of the consensus sequence in the regulated expression of the tubB2 gene.
2960 Nucleic Acids Research, Vol. 20, No. 12 Our results demonstrate that chimeric genes including ars coding sequences are useful in studying regulated transcription in C. reinhardtii. Transformants expressing these genes can be rapidly identified by assaying for Ars activity, and regulated gene expression can be followed by Northern blot analysis.
MATERIALS AND METHODS Cell culture C. reinhardtii strains were grown in TAP medium (23) and supplemented with 50 Ag/ml arginine when required. Gametes were made from cultures containing 5-7 x 106 cells/ml. The cells were washed twice in Medium V (24) and resuspended in Medium V for 24 h prior to deflagellation by pH shock (25). Gametic cultures of transformed strains were supplemented with 100 ItM MgSO4 to prevent the induction of the endogenous ars gene.
Cloning A library of C. reinhardtii DNA was constructed from genomic DNA of strain CC 125 according to Maniatis et al. (26). A clone containing a complete copy of the ars gene, X2ars, was identified by hybridization of plaques to an ars cDNA (22). To generate the tubB2/ars chimeric gene, a 1 kbp fragment containing the tubB2 5' region (from an EcoRI site upstream, to a XhoI site 65 bp downstream of the transcription initiation site) was fused to an 7 kbp fragment of X2ars containing the coding region of the ars genomic sequence (from a SfiI site in the 5' transcribed but untranslated region 72 bases upstream of the translation start site and 32 bases downstream of the transcription start site, to a Sall site downstream of the 3' end of the gene) in Bluescript SK+. This plasmid was designated pJD55. Transformation C. reinhardtii strain CC425 (cw-15, arg-2) was transformed by the glass bead method (3) with the supercoiled plasmids pArg7.8 (1), containing the argininoscccinate lyase gene (from J.-D. Rochaix), and pJD55, containing the tubB2/ars chimeric gene. After vortexing, 5 ml of TAP + arginine (50 ytg/ml) was added to the culture and the tubes were placed on a rotating platform and illuminated (90 AEm-2s-') for 16-20 h. The cells were separated from the glass beads, pelleted by centrifugation for 3 min at 3000xg, washed twice (with 5 ml of TAP medium), resuspended in 100 yd of TAP medium, spread on solid TAP medium and grown in the light. Approximately 300 colonies were visible after 7 days. No colonies were observed when the transformation procedure was performed without DNA or with a plasmid lacking the argininosuccinate lyase gene. Ars assay Ars activity in transformants was assayed in 2 ways: individual transformants were grown in 200-400 yd of TAP medium in microtiter wells until cultures were 5-10 x 106 cells/ml, at which time 4 Al of 30 mM XS04 was added. Alternatively, transformants grown on solid TAP medium were sprayed with 250 1l of 10 mM XS04 in 0.1 M Tris-HCl pH 7.5. After 16 h transformants expressing Ars were identified by the blue color of the liquid medium or a blue ring around the colony on agar plates. To compare Ars activity of untransformed cells incubated in sulfur-deficient medium and transformants grown in sulfursufficient medium, 0.3 mM XS04 was added to the medium and the cultures incubated at room temperature for the time indicated.
Cells were pelleted by centrifugation for 3 min in a microfuge, and Ars activity was measured in the supernatant as a change in absorbance at 650 nm.
Southern Blot Analysis Genomic DNA from exponentially growing cultures of CC425 and transformed strains was isolated by lysing cells in 1 % SDS, 200 mM NaCl, 40 mM Tris-HCl pH 8.0, 20 mM EDTA, extracting the lysate with phenol, and purifying the DNA by CsCl gradient centrifugation. Digested genomic DNA was electrophoresed in an 0.8% agarose gel in TAE buffer (40 mM Tris-acetate, 1 mM EDTA pH 8.0), transferred to nitrocellulose paper, and hybridized (27) to either a BanII-BamHI fragment of the ars cDNA (22) or the EcoRI-XoI fragment containing the tubB2 promoter and the first 65 bp of transcribed DNA (28).
Northern Blot Analysis RNA was isolated from cells according to the method of Thompson and Mosig (29). RNA concentrations were determined by measuring the A260 and Northern blot anlaysis was performed as described in Sambrook et al. (27). Filters were hybridized with either a radiolabeled 2.2 kbp BanII-SspI fragment of the ars cDNA (22) or the 1 kbp EcoRl-XhoI fragment containing the tubB2 promoter and the first 65 bp of transcribed DNA (28). Hybridization signals were quantitated with a Molecular Dynamics Phosphorlmager (400A). cDNA synthesis and PCR amplification cDNA was synthesized using AMV reverse transcriptase (Life Sciences) and primer ars7 (GGTAGATGTTGGGGTCG), which hybridizes to the ars transcript 520 nucleotides downstream of the translation initiation site. The 25 yd reactions contained 1 /Ag RNA, 1 mM each of dATP, dGTP, dCTP, dTTP, 50 mM KCl, 100 mM Tris-HCl, pH 8.3, 10 mM MgCl2, 10 mM dithiothretol, 1 /M primer ars7, and 5 U AMV reverse transcriptase. Products of the cDNA reaction were amplified by the polymerase chain reaction (PCR) with 1.25 U of Amplitaq (Cetus) in a Perkin-Elmer Cetus Thermocycler using the reaction buffer recommended by the manufacturer. Primers used for amplification were ars7 and either 5'ars (ATAGAGGGTTAAACTGG), which hybridizes to the 5' untranslated region of the ars transcript or 5'tubB2 (GGAATTCAAAGCCATATTCAAACACC), which hybridizes to the 5' untranslated sequences of tubB2. Prior to amplification the template DNA was denatured at 94°C for 5 min. The reaction consisted of 35 cycles of 15 sec at 95°C, 30 sec at 55°C and 90 sec at 72°C, followed by a final extension period of 5 min at 72°C. PCR products were electrophoresed in a 0.8% agarose gel in TAE, transferred to nitrocellulose paper, and hybridized with a radiolabeled BanIfSmaI fragment of the ars cDNA (22).
RESULTS Constructs and Transformation We have used genomic DNA of C. reinhardtii to construct a chimeric gene consisting of the promoter of ,32-tubulin (tubB2) and the coding region of arylsulfatase (ars). This 8 kbp construct, shown in Figure IA, is harbored in the plasmid pJD55. The 1 kbp fragment contains approximately 900 bp of sequence upstream of the transcription initiation site. This region contains several copies of a consensus sequence common to all 4 coordinately regulated tubulin genes. The ars genomic fragment
Nucleic Acids Research, Vol. 20, No. 12 2961 contains the entire coding region, all of the introns, and the transcription termination site. Transcription of the chimeric gene should yield a 2.5 kb mRNA species similar to the endogenous ars transcript, except that the first 32 bases of the 5' untranslated region of the ars transcript are replaced by the first 65 bases of the tubB2 5' untranslated region. The sequence of the DNA containing the junction of the tubB2/ars fusion is shown in Fig. lB. Using the glass bead method for transformation (3), pJD55 was introduced into C. reinhardtii strain CC425 (cw-15 arg-2)
A kbp
0
1
2
3
5
4
6
7
8
Hindlll ATG
B GAGCGCTGTT
TkAATAGCCA
GCCCCCGATT GCAGACAT
TATAGCGAGC TACCAAAGCC ATATTCAAAC
ACCTAGATCA
CTACCACTTC TACACAGGCC ACTGAGGCCA ACGCTGTCAA GGGATCGTTT GGGATCGGGG CAATCAGCAC
CGGCTCAGGA
CGAAACCATC AAGATGGGTG
C
U, UL
N4 et
(C U
LCl Lu)
v
U)
L) N
q
u)
In
I)
LO
via cotransformation with pArg7.8 (1). The latter plasmid contains the argininosuccinate lyase gene which complements the arg-2 lesion and enables transformants of CC425 to grow on arginine-deficient medium. After transformation, cells were selected for growth on solid TAP medium (lacking arginine). Cells harboring an intact copy of the tubB2/ars gene are able to express Ars in sulfur-sufficient medium. These cells were identified by adding XS04 to the medium of growing cells and observing the development of blue color. Screening 135 transformants identified 17 that express Ars in sulfur-sufficient medium. Southern Analysis Using Southern blot analysis we determined the frequency of cotransformation to be about 25 % by identifying the tubB2/ars gene in 7 of 26 randomly chosen transformants. Of these 7 transformants, 3 expressed the tubB2/ars gene. Furthermore, in every Ars expressing transformant that we examined, the tubB2/ars gene was observed. Southern blot analysis of 2 such transformants is shown in Fig. IC. Genomic DNA from CC425 and 2 transformants expressing the tubB2/ars gene, 554 and 55-5, was digested with EcoRl plus HindIII and hybridized with the 5' portion of tubB2 (the 1 kbp fragment used to make the chimeric gene) and a portion of the ars cDNA. The tubB2/ars chimeric gene is cut once by HindlIl and not at all by EcoRI (Fig. IA). The fragments detected in this analysis have one end within the chimeric gene and the other in C. reinhardtii genomic DNA near the site of integration. Thus, different size fragments will be generated from each copy of the chimeric gene present in the genome. The tubB2 5' sequence hybridizes to two fragments > 12 kbp and 0.8 and 0.6 kbp fragments present in both untransformed (Fig. IC, lanel) and transformed strains (Fig. IC, lanes 2 and 3). These fragments contain the endogenous
4o 9.5
A
B
.g.411. 44.0
U)
+
+
a
a
+
I
+i -
U) +
u}n
in
.l +
+
N
gTw g
.
+
Deflagellated
41.7 -
41.4
*0.8 ars or tubll2/ars >. 40.6
1
23
tubB2
4
5
tubB2/ars
-~< tubR2
6
ars
Figure 1. Structure of the tubB2/ars chimeric gene in plasmid pJD55 and Southern analysis of genomic DNA from transformants. A. In the schematic of the tubB2/ars chimeric gene, the dark box represents the tubB2 5' sequence, and the open box the ars genomic sequence. The arrow indicates the position of the transcription initiation site. The ATG defines the start codon and the position of the Hindl!! site used in Southern analysis is also noted. B. DNA sequences of the 5' fusion region of the tubB2/ars gene. The arrow designates the transcription initiation site of tubB2 (20). The (0) is the last base contributed by the tubB2 sequence and the (-) is the first base of ars sequence. The TATA box and translation initiation site are underlined. C. Southern blots of chromosomal DNA from CC425 (lanes 1 and 4), 55-4 (lanes 2 and 5), and 55-5 (lanes 3 and 6) cut with EcoR! plus Hind!II were hybridized with the tubB2 5' fragment (lanes I-3) and a portion of the ars cDNA (lanes 4-6). The arrows indicate the positions and sizes of
hybridizing fragments.
12, 9.5, 4.0, 0.8, and 0.5 kbp in DNA from CC425 (lane 4) and 55-4 and 55-5 (lanes 5 and 6, respectively). Two additional hybridizing fragments are present in the genomic DNA of each of the transformed strains. For 55-4 they are 1.7 and >12 kbp (Fig. IC, lane 5) and for 55-5 they are 1.4 and 6.5 kbp (Fig. IC, lane 6). Thus, the 1.7 kbp fragment of 55-4 and the 1.4 kbp fragment of 55-5 contain the tubB2 5' end plus the 5' region of the ars fragment used to construct the chimeric gene. These results demonstrate that the transformed strains contain a single unique restriction fragment that hybridizes both to the ars cDNA and to the tubB2 promoter, and a second unique fragment that hybridizes to the ars cDNA. Therefore, a single copy of the chimeric gene has integrated into the genomic DNA of the transformants 554 and 55-5. The analyses of the chromosomal DNA of 55-4 and 55-5, indicates that part of the tubB2 sequence of the chimeric gene was lost during integration of pJD55 into the chromosome. Within pJD55 there is no EcoRJ site, only one HindIII site and about 1.8 kbp between the HindII site and the 5' end of the chimeric gene. Therefore, the 1.7 kbp fragment of 55-4 and the 1.4 kbp fragment of 55-5 probably arose because the tubB2 sequence of the chimeric gene integrated into the chromosome near an EcoRI or HindIII site. Hence, a portion of the tubB2 sequence distal to the transcription initiation site must have been lost during the integration event. Further analysis has demonstrated that the tubB2/ars gene in 554 has greater than 800 bp of promoter sequences upstream of the transcription start site, whereas the promoter of the chimeric gene in 55-5 contains less than 300 bp (data not shown). The 3' end of the tubB2/ars chimeric gene in 55-5 also has recombined near a HindIII or EcoRI site. The 6.5 kbp restriction fragment (Fig. IC, lane 6) contains DNA sequences from the internal HindIllI site through the 3' end of
tubB2/ars (6.2 kbp). Because pJD55 does not contain any other HindIII or EcoRI site, some plasmid sequences (i.e. vector sequences) must have been lost in the integration process. Hence, integration of the chimeric gene was either by a double nonhomologous recombination event or by a single non-homologous recombination event accompanied by elimination of part of pJD55. We do not know if a loss of plasmid DNA at the 3' end of tubB2/ars also occurred in 554.
Northem Analysis Northern analysis shown in Fig. 2 demonstrates that the tubB2/ars gene is expressed in cells growing in complete medium, but the ars gene is expressed only when cells are deprived of sulfur. To establish the presence of the tubB2/ars chimeric RNA in the transformed strains, we hybridized ars cDNA to RNA from 55-4, 55-5, and CC425 grown in sulfur-sufficient medium. A 2.5 kb transcript, similar in size to the endogenous ars transcript is detected in RNA from 554 and 55-5 but not CC425 (Fig. 2A, lanes 2-4). The endogenous ars transcript is detected in CC425 when it is deprived of sulfur (Fig. 2A, lane 1). These results suggest that the 2.5 kb mRNA found in 554 and 55-5 grown in sulfur-replete medium is a product of the tubB2/ars chimeric gene. To confirm the identity of the 2.5 kb transcript, we isolated RNA from vegetative cells of 554, 55-5, and CC425 both before and after deflagellation. The transformants were maintained on sulfur-replete medium while CC425 was grown in both sulfurdeficient and sulfur-sufficient medium. In C reinhardtii, deflagellation results in increased accumulation of tubulin mRNA (30,31). The 5' tubB2 specific DNA hybridized to a 2.5 kb transcript from non-deflagellated 554 and 55-5 (Fig. 2B, lanes 3 and 5, upper arrow). This transcript is more abundant in deflagellated cells (Fig. 2B lanes 4 and 6, upper arrow). The 2.5 kb transcript is not present in CC425 grown on sulfur-deficient (Fig. 2B, lanes 1 and 2) or sulfur-replete medium (Fig. 2B, lanes 7 and 8). The 5' tubB2 specific DNA hybridized strongly to the 2.0 kb tubB2 transcript (lower arrow) in all strains. As expected, this transcript is more abundant in RNA from deflagellated cells (Fig. 2B, compare lanes 3, 5, and 7 with 4, 6, and 8). The abundance of the tubB2 transcript does not increase when sulfurstressed cells are deflagellated (Fig. 2B, compare lanes 1 and
0.4
0.3
r. No
3 0.2
AU
L.
A
0.10
A
0.0
0
-. 2 4 6 Hours
Figure 3. PCR analysis of the chimeric transcripts. cDNA from RNA of CC425 grown in sulfur-deficient medium (lanes 1 and 2), CC425 (lanes 3 and 4), 55-4 (lanes S and 6), and 55-5 (lanes 7 and 8) grown in sulfur-sufficient medium was synthesized using primer ars7. The cDNAs were PCR amplified using primers ars7 and either 5'ars (lanes 1, 3, 5, and 7) or 5'tubB2 (lanes 2, 4, 6, and 8). The PCR products are approximately 600 bp.
8
Figure 4. Assay of Ars activity in transformed and sulfur-starved C. reinhardtii. A6S values were normalized by dividing the cell density of the culture used at each of the time points by 5 x 106- and then dividing the A65O by this number. (0) sulfur-starved CC425; (U) 55-4; (0) 55-5; and (A) CC425 grown in sulfursufficient medium.
Nucleic Acids Research, Vol. 20, No. 12 2963
2). A detailed analysis of tubB2 and tubB2/ars transcript accumulation following deflagellation of gametic cells is presented in Fig. 5. PCR amplification of the chimeric transcript To definitively demonstrate that strains 55-4 and 55-5 grown under sulfur-sufficient conditions accumulate tubB2/ars mRNA and not the endogenous ars transcript, we used PCR to amplify cDNA copies of specific transcripts. Single stranded cDNAs of Ars encoding mRNAs in 55-4 and 55-5 grown in sulfur-sufficient medium, and CC425 grown in sulfur-deficient medium, were synthesized from an oligonucleotide primer (ars7) that hybridizes to the ars transcript at a position 520 bp from the translation initiation site. As a control, a cDNA reaction was done with RNA from CC425 grown in sulfur-sufficient medium. The cDNA from each strain was used in the amplification reaction with two different sets of primers. Included in both reactions was primer ars7. The second primer was an oligonucleotide that hybridizes
B
A
ILi)112/ars
tul)hB2
425 -S 425>-5
55-5 609(0 120
6lin after
Deflagellation
015.3(
1534)
0
c
6090
120
0
I.
30
60
90 120
>-
"VW -ml
>.
1
2
3
4
5
6
2
lubB2
3
4
5
6
ars
ars
l)
r-
.-6 -0---
55-5 15 55-5
ARS.
c1
*O45AR
0
3
'din
6
A
fter
9(
(
1)tvli'agvllatinl
Figure 5. Quantitation of the tubB2, tubB2/ars and ars transcripts in gametes following deflagellation. Gametes of 55-5 grown in sulfur-sufficient medium and CC425 grown in sulfur-deficient medium were deflagellated by pH shock, and at various times following deflagellation RNA was isolated. A. RNA from 55-5 hybridized with DNA containing the first 65 bases of the tubB2 transcript. B. RNA from 55-5 hybridized to the ars cDNA. C. RNA from sulfur-starved CC425 hybridized to the ars cDNA. In A, B, and C, RNA was isolated immediately (lane 1), 15 min (lane 2), 30 min (lane 3), 60 min (lane 4), 90 min (lane 5) and 120 min (lane 6) after deflagellation. D. The graph compares the kinetics of tanscript accumulation of (0) tubB2 transcript from 55-5, (-) tubB2/ars tanscript of 55-5 and (A) the endogenous ars tmnscript from sulfur starved CC425 following deflagellation. The maximum level of accumulation of each transcript was set at 100%. Therefore, quantitative comparisons of the different transcripts cannot be made.
to cDNA sequences corresponding to the 5' untranslated region of either the tubB2 (5'tubB2), or the ars (5'ars) transcript. The sequence to which 5'ars hybridizes is not present in the tubB2/ars chimeric gene. Figure 3 shows a Southern blot of the PCR products that were hybridized with a portion of the the ars cDNA
located between the sites of primer annealing. PCR products generated from RNA of 55-4 and 55-5 grown in sulfur-replete medium are only detected when primers ars7 and 5'tubB2 are used (Fig.3, lanes 6 and 8), and not detected when ars7 and 5'ars are used (Fig. 3, lanes 5 and 7). The size of the PCR product (about 600 bp) is that predicted if the chimeric transcript were serving as the template to make the cDNA. The ars transcript from sulfur-starved CC425 cells can be amplified with the ars7 and 5'ars primers (Fig. 3, lane 1). However, no PCR product is detected when ars7 and 5'tubB2 are used (Fig. 3, lane 2). Furthermore, no PCR product is detected when RNA from CC425 grown in sulfur-sufficient medium is amplified with ars7 and either 5'ars or 5'tubB2 (Fig. 3, lanes 3 and 4).
Ars activity We have compared the amount of Ars activity from the transformed strains (55-4 and 55-5) grown in sulfur-sufficient medium to that from the untransformed strain (CC425) grown in sulfur-sufficient and sulfur-deficient medium. Levels of Ars activity were assayed by adding the chromogenic substrate, XS04, direcfly to the culture and allowing the reaction to proceed for various times. The cells were then removed from the medium by centrifugation and the A650 measured. Figure 4 shows that the A650 of medium from sulfur-starved CC425 rapidly increased to a half-maximal level at the earliest time point, (approximately 5 min was required to remove the cells and measure the absorbance). The absorbance increased to maximal levels within the first hour, at which time either the substrate was depleted or the reaction products inhibited the enzymatic activity. The same rate was observed when 5 mM MgSO4 (the sulfate concentration of TAP medium) was added to sulfurdeficient medium (demonstrating that this sulfate concentration does not inhibit Ars activity, data not shown). Essentially no Ars activity was detected in cultures of CC425 that were grown in sulfur-replete medium. Ars activity was detected in cultures of both 55-4 and 55-5 grown in sulfur-replete medium. Hydrolysis of the chromogenic substrate in culture medium of these strains occurred slowly during the 7 h incubation period (Fig. 4). We have compared Ars activity in deflagellated and control cells. To remove previously synthesized Ars from the cultures, growing cells were washed and resuspended in fresh TAP medium. Cells were deflagellated by pH shock, collected by centrifugation, resuspended in fresh TAP medium (1.25 x 107 cells/ml), and XS04 was added to monitor Ars activity. No change in the A650 was detected until 5 hours after deflagellation, and at this time no difference in A650 in deflagellated and control cultures was observed. Northern blot analysis indicated that tubB2/ars mRNA was 3 fold more abundant in deflagellated than control cells at both 30 and 60 min following deflagellation. However, 2 hours after deflagellation there was no difference in accumulation of the chimeric transcript between samples (data not shown). Thus, although there is a transient increase in tubB2/ars transcript abundance following deflagellation, we are unable to measure an increase in Ars activity. The 5 hour lag in detecting Ars activity after deflagellation may obscure the difference in Ars activity between control and deflagellated cells. Alternatively, more Ars
2964 Nucleic Acids Research, Vol. 20, No. 12 may not be synthesized following deflagellation despite the increase in tubB2/ars transcript abundance.
Kinetics of transcript accumulation in response to deflagellation Levels of transcripts from all of the genes encoding tubulin in C. reinhardtii, transiently increase following deflagellation (28). An increase in both the tubB2 and tubB21ars transcripts upon deflagellation was shown in Figure 2. A comparison of the increase in tubB2 mRNA and tubB2/ars mRNA in 55-5 at various times following deflagellation is shown in Fig. 5 (A, B, and D). To determine the relative abundance of the transcripts, the RNA was resolved on a denaturing gel, transferred to nitrocellulose, hybridized with an ars or tubB2 specific probe and each band quantitated using a Molecular Dynamics PhosphorImager. We observed the characteristic increase and subsequent decline in accumulation of tubB2 mRNA in 55-5 during recovery from deflagellation. The peak of mRNA accumulation occurs at approximately 60 min following deflagellation (Fig. 5, A, and D). Hybridization of the tubB2 DNA to the chimeric transcript is also observed, as shown in panel A (weak signal above the 2.0 kbp tubB2 transcript apparent in lanes 3 and 4). Generally, the absolute level of the chimeric transcript was found to be 10-20 fold lower than that of tubB2. Accumulation of the 2.5 kb chimeric transcript, quantitated with the ars gene specific probe, is slightly more rapid than that of the tubB2 transcript. The decline in abundance of the tubB2/ars chimeric transcript was also more rapid than that of the endogenous tubB2 transcript (Fig. 5, B, and D). The characteristics of transcript accumulation was similar in all transformants expressing tubB2/ars. Accumulation of the endogenous ars transcript responds to deflagellation differently than the tubB2/ars chimeric mRNA. Immediately after deflagellation of sulfur-starved CC425, the level of ars mRNA is significantly diminished. It continues to decline for 15 min and only begins to increase approximately 90 min after deflagellation (Fig. 5, C, and D). At this time accumulation of both the tubB2/ars and the tubB2 transcripts were declining. Thus, deflagellation causes a rapid depletion of ars mRNA in sulfur-starved cells. Accumulation of the ars transcript commences only after the level of the tubB2 transcript begins to drop. These results are consistent with the idea that the transient increase in the level of tubB2 mRNA following deflagellation is, at least partially, due to a change in the transcriptional activity of the tubB2 promoter. Deletion analysis of the tubB2 promoter has identified an element necessary for induced transcription following deflagellation. However, removing this element has no effect on expression during vegetative growth (J.D. unpublished data).
DISCUSSION We have constructed a chimeric gene by fusing the tubB2 promoter to coding sequences of a genomic clone of ars and introduced it into C. reinhardtii. Transformants containing tubB2/ars exhibited Ars activity during growth in sulfur-sufficient medium, a condition where the endogenous ars gene is not expressed. Thus, promoters from other C. reinhardtii genes can be fused to ars coding sequences and transformants expressing these chimeric genes can be easily identified by assaying for Ars activity (we have achieved expression from both tubB2/ars and oee-J/ars chimeric genes). Screening for Ars activity allows for immediate selection of cotransformants that are expressing the
chimeric sequence. Regulated changes in accumulation of the chimeric transcript can be observed by Northern blot analysis. Using various tubB2/ars constructs we have been able to investigate tubB2 sequences necessary for induced expression following deflagellation. Accumulation of the tubB2/ars transcript is low relative to the endogenous tubB2 transcript. There are a number of possible reasons for this: the chimeric transcript may be synthesized at a lower rate, the primary transcript may not be efficiently processed and/or delivered to the cytoplasm of the cell, or the mature transcript may be less stable (or a combination of these factors). Transcription of the chimeric gene may be impeded if it recombines into the chromosome at a position that supresses its expression, or if sequences necessary for high levels of expression are not present. We have examined 7 transformants that express Ars and although there is a 5-fold variation among transformants in the level of chimeric transcript present, they all contain at least 10 fold less tubB2/ars transcript than tubB2 transcript, both in vegetative and deflagellated cells. Because all the transformants accumulate relatively low levels of the chimeric transcript, the position of integration of tubB2/ars, while possibly modulating expression to some extent, is unlikely to have caused the generalized low-level expression. It is possible that sequences necessary for high-level expression were lost during integration of the chimeric gene, or were not present in the origional construct. Of the 7 transformants expressing tubB2/ars that we have examined, 6 have over 800 bp and 1 has less than 300 bp upstream of the tubB2 transcription initiation site. Among these 7 transformants, there is no correlation in the level of tubB2/ars expression and the length of the promoter present. Furthermore, deletion analysis of the tubB2 promoter has demonstrated that accumulation of the chimeric transcript in both vegetative and deflagellated cells is not diminished when the tubB2/ars gene contains only 99 bp of tubB2 promoter sequence upstream of the transcription start site (J.D, unpublished data). Hence, it is unlikely that sequences necessary for high-level expression were lost during integration of tubB2/ars. To examine stability of the tubB2 and the tubB2/ars transcripts we inhibited mRNA synthesis with a-amanitin and determined the half-lives of the two transcripts. The half-life of the tubB2 transcript was 40 minutes while that of the chimeric transcript was 20 minutes. This difference, while significant, is too small to entirely explain the relative levels if the tubB2 and tubB2/ars mRNAs in the transformed strains. While some of the difference in the levels of tubB2 and tubB2/ars transcripts in the transformants is a consequence of altered mRNA stability other factors must also affect the final levels of accumulation. For example, transcription of the chimeric gene may be limited because an enhancer element in or around the tubB2 gene was not included in the origional construct. Alternatively, the primary transcript of the chimeric gene may not be processed effeciently. This could impede transcript accumulation since unspliced mRNA may be rapidly degraded (37). Detecting Ars activity using the colorimetric assay has enabled us to rapidly identify cotransformants. However, we have been unable to measure an increase in Ars activity in deflagellated cells. Thusfar, in our experiments Ars activity has served only as a marker for cotransformation and does not reflect the transient change in tubB2/ars transcript accumulation following deflagellation. However, Ars activity does reflect chimeric transcript levels in cells harboring a construct incorporating the
Nucleic Acids Research, Vol. 20, No. 12 2965 copper regulated cyt-c6 promoter and ars coding sequences. Both cyt-c6 and cyt-c6/ars are transcribed only in cells grown in copper deficient medium. Likewise, cells harboring cyt-c6/ars express Ars in copper deficient medium (J. Quinn and S. Merchant, personal communication). Chimeric ars constructs are useful in analyzing promoter activity. Transformants expressing these genes can be rapidly identified by treating the cells with XSO4, and accumulation of the chimeric transcript can be easily detected by hybridization with ars sequences. We have demonstrated that the accumulation of the tubB2/ars transcript is regulated similarly to the endogenous tubB2 transcript. Furthermore, through a deletion analysis of the the tubB2 promoter, we have generated tubB2/ars constructs that are transcribed normally during vegetative growth but are not induced following deflagelation (manuscript in preparation). Thus, the chimeric constructs incorporating the ars coding region have enabled us to identify functional elements of the tubB2 promoter.
ACKNOWLEDGEMENTS We thank J.-D. Rochaix for pArg7.8. Initial phases of this work were performed at, and with the support of Sandoz Crop Protection. This work was also supported by NSF grant # DCB-8609623 (to DPW), USDA grant # 9103011 (to ARG) and by the Carnegie Institution of Washington. This is CIW publication # 1106. We thank M. Schaefer and C. Davies for reading the manuscript and Jane Edwards for help in preparing it.
REFERENCES 1. Debuchy, R., Purton, S., and Rochaix, J.-D. (1989) EMBO J. 10, 2803-2809. 2. Boynton, J., Gillham, N.W., Harris, E.H., Hosler, J.P., Johnson, A.M., Jones, AR, Randolph-Anderson, B.C., Robertson, D, Klein, T.M., Shark, K.B., and Sanford, J.C. (1988) Science, 240, 1532-1538. 3. Kindle, K.L. (1990) Proc. Natl. Acad. Sci. USA, 87, 1228-1232. 4. Newman, S.M., Boynton, J.E., Gillham, N.W., Randolph-Anderson, B.L., Johnson, A.M., and Harris, E.H. (1990) Genetics, 126, 875-888. 5. Blowers, A.D., Ellmore, G.S., Klein, U., and Bogorad, L. (1990) 7he Plant Cell, 2, 1059-1070. 6. Stern, D.B., Radwanski, E.R.,and Kindle, K.L. (1991) The Plant Cell, 3, 285-297. 7. Fernandez, E., Schnell, R., Ranum, L.P., Hussey, S.C., Silflow, C.D., and Lefebvre, P.A. (1989) Proc. Natl. Acad. Sci. USA, 86, 6449-6453. 8. Diener, D.R., Curry, A.M., Johnson, K.A., Williams, B.D., Lefebvre, P.A., Kindle, K.L., and Rosebaum, J.L. (1990) Proc. Natl. Acad. Sci. USA, 87,
5739-5743. 9. Mayfield, S.P., and Kindle, K.L. (1990) Proc. Natl. Acad. Sci. USA, 87, 2087-2091. 10. Goldschmidt-Clermont, M., and Rahire, M. (1986) J. Mol. Biol., 191, 421 -432. 11. Kindle, K.L. (1987) Plant Mol. Biol., 9, 547-563. 12. Weeks, D.P., and Collis, P.S. (1976) Cell, 9, 15-27. 13. Silflow, C.D., Lefebvre, P.A., McKeithan, T.W., Schloss, J.A., Keller, L.R., and Rosenbaum J.L. (1982) Cold Spring Harbour Symp. Quant. Biol., 46, 157-169. 14. Merchant, S., and Bogorad, L. (1986) Mol. Cell Biol., 6, 462-469. 15. Merchant, S., Hill, K., and Howe, G. (1991) EMBO J., 10,1383-1389. 16. Fernandez, E., and Cardenas, J. (1989) In Wray, J. and Kinghorn, J.R. (eds.) Molecular and Genetic Aspects of Nitrate Assimilation. Oxford Univ. Press, pp. 101-124. 17. Schreiner, O., Lien, T., and Knutsen, G. (1975) Biochem. Biophys. Acta, 384, 180-193. 18. Lien, T., and Schreiner, 0. (1975) Biochem. Biophys. Acta, 384, 168-179. 19. de Hostos, E.L., Togasaki, R.K., and Grossman, A.R. (1988) J. Cell Biol., 106, 29-37.
20. Brunke, K.J., Anthony, J.G., Stemnberg, E.J., and Weeks, D.P. (1984) Mol. Cell Biol., 4, 1115-1124. 21. Keller, L.R., Schloss, J.A., Silflow, C.D., and Rosenbaum, J.L. (1984) J. Cell Biol., 98, 1138-1143. 22. de Hostos, E.L., Schilling, J., and Grossman, A.R. (1989) Mol. Gen. Genet., 218, 229-239. 23. Gorman, D.S., and Levine, R.P. (1965) Proc. Natl. Acad. Sci. USA, 54, 1665-1669. 24. Weeks, D.P., Collis, P.S., and Gaelt, M.A. (1977) Nature 268,667-668. 25. Witman, G.B., Carlson, K., Berliner, J., and Rosenbaum, J.L. (1972) J. Cell Biol., 54, 507-539. 26. Maniatis, T., Fritsch, E.F., and Sambrook, J. (1982) Molecular cloning: a laboratory manual, Cold Spring Harbor. 27. Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecular cloning: a laboratory manual, Cold Spring Harbor. 28. Brunke, K. J., Young, E.E., Buchbinder, B.U., and Weeks, D.P. (1982) Nucleic Acids Res., 10, 1295-1310. 29. Thompson, R.J., and Mosig, G. (1984) Plant Physiol., 76, 1-6. 30. Minami, S.A., Collis, P.S., Young, E.E., and Weeks, D.P. (1981) Cell, 24, 89-95. 31. Silflow, C.D., and Rosenbaum, J.L. (1981) Cell, 24, 81-88. 32. Ben-Ze'ev, A., Farmer, S.R., and Penman, S. (1979) Cell, 17, 319-325. 33. Cleveland, D.W., Lopata, M.A., Sherline, P., and Kirshner, M.W. (1981) Cell, 25, 537-546. 34. Cleveland, D.W., and Havercroft, J.C. (1983) J. Cell Biol., 97, 919-924. 35. Yen, T.J., Machlin, P.S., and Cleveland, D.W. (1988) Nature, 334, 580-585. 36. Youngblom, J., Schloss, J.A., and Silflow, C.D. (1984) Mol. Cell Biol., 4, 2686-2696. 37. Felber, B.K., Hadzopoulou-Cladaras, M., Cladaras, C., Copeland, T., and Pavlakis, G.N. (1989) Proc. Natl. Acad. Sci. USA., 86, 1495-1499.
