proof of your article attached, please read carefully ...

JOHN WILEY & SONS, LTD., THE ATRIUM, SOUTHERN GATE, CHICHESTER P019 8SQ, UK

*** PROOF OF YOUR ARTICLE ATTACHED, PLEASE READ CAREFULLY *** After receipt of your corrections your article will be published initially within the online version of the journal.

PLEASE NOTE THAT THE PROMPT RETURN OF YOUR PROOF CORRECTIONS WILL ENSURE THAT THERE ARE NO UNNECESSARY DELAYS IN THE PUBLICATION OF YOUR ARTICLE READ PROOFS CAREFULLY ONCE PUBLISHED ONLINE OR IN PRINT IT IS NOT POSSIBLE TO MAKE ANY FURTHER CORRECTIONS TO YOUR ARTICLE •

This will be your only chance to correct your proof

•

Please note that the volume and page numbers shown on the proofs are for position only

ANSWER ALL QUERIES ON PROOFS (Queries are attached as the last page of your proof.) •

Please annotate this file electronically and return by email to the production contact as detailed in the covering email. Guidelines on using the electronic annotation tools can be found at the end of the proof. If you are unable to correct your proof using electronic annotation, please list all corrections and send back via email to the address in the covering email, or mark all corrections directly on the proofs and send the scanned copy via email. Please do not send corrections by fax or post. Acrobat Reader & Acrobat Professional

•

You will only be able to annotate the file using Acrobat Reader 8.0 or above and Acrobat Professional. Acrobat Reader can be downloaded free of charge at the following address: http://www.adobe.com/products/acrobat/readstep2.html

CHECK FIGURES AND TABLES CAREFULLY •

Check sizes, numbering, and orientation of figures

•

All images in the PDF are downsampled (reduced to lower resolution and file size) to facilitate Internet delivery. These images will appear at higher resolution and sharpness in the printed article

•

Review figure legends to ensure that they are complete

•

Check all tables. Review layout, titles, and footnotes

COMPLETE COPYRIGHT TRANSFER AGREEMENT (CTA) if you have not already signed one •

Please send a scanned signed copy with your proofs by e-mail. Your article cannot be published unless we have received the signed CTA

OFFPRINTS •

Free access to the final PDF offprint of your article will be available via Author Services only. Please therefore sign up for Author Services if you would like to access your article PDF offprint and enjoy the many other benefits the service offers.

Additional reprint and journal issue purchases •

Should you wish to purchase additional copies of your article, please click on the link and follow the instructions provided: http://offprint.cosprinters.com/cos/bw/

•

Corresponding authors are invited to inform their co-authors of the reprint options available.

•

Please note that regardless of the form in which they are acquired, reprints should not be resold, nor further disseminated in electronic or print form, nor deployed in part or in whole in any marketing, promotional or educational contexts without authorization from Wiley. Permissions requests should be directed to mailto: [email protected]

Research Article Received: 15 May 2010,

Revised: 24 September 2010,

Accepted: 4 October 2010,

Published online in Wiley Online Library: 00 Month 2010

(wileyonlinelibrary.com) DOI:10.1002/jmr.1106

Label-free sensing and atomic force spectroscopy for the characterization of protein–DNA and protein–protein interactions: application to estrogen receptors

O

FS

A. Berthier a,b *, C. Elie-Cailleb, E. Lesniewskac, R. Delage-Mourrouxa and W. Boireaub

D

PR

O

In this paper we describe a new surface plasmon resonance (SPR) biosensor dedicated to potential estrogenic compounds prescreening, by developing an estrogen receptor (ER) specific DNA chip. Through the covalent binding of a DNA strain wearing the estrogen response element (ERE) to an activated 6-mercapto-1-hexadecanoic acid and 11-mercapto-1-undecanol self-assembled monolayer on gold surface, the SPR biosensor allows to detect specifically, quickly, and without any labeling the binding of ER in the presence of estrogen. In parallel, we investigated the ER interaction with itself, in order to study the formation of ER dimer apparently needed to activate the gene expression through ERE interaction. For that, we engaged force spectroscopy experiments that allowed us to prove that ER needs estrogen for its dimerization. Moreover, these ER/ER intermolecular measurements enabled to propose an innovative screening tool for anti-estrogenic compounds, molecules of interest for hormono-dependant cancer therapy. Copyright ß 2010 John Wiley & Sons, Ltd.

TE

Keywords: estrogen receptor; force spectroscopy; DNA sensor

EC

INTRODUCTION

UN

CO RR

Estrogens, and particularly estradiol-17-b (E2), are female hormones involved in development, growth, and maintenance of reproductive tissues (Diel, 2002). These hormones interact with estrogen receptors (ER) which are transcription factors activated by ligand binding (O’Malley, 2005). These activated nuclear receptors modulate expression of estrogen-responsive genes after the interaction with palindromic DNA sequences called estrogen response element (ERE; Klinge, 2001). Many molecules could interact with these ER, as well as plant derived compounds called phytoestrogens (genistein, glucopyranosylchrysin, etc.; Maggiolini et al., 2001; Berthier et al., 2007), synthetic drugs (ICI 182,780, Tamoxifen, etc.; Wakeling et al., 1991; Ahn and Sheen, 1997), or endocrine disturbers (polychlorobiphenyls, parabens, etc.; Okubo et al., 2001; Ho et al., 2008). Interactions of these compounds have an impact on the conformational state of the receptors. Thus, the agonist or antagonist nature of the bonded compounds allows or blocks receptor dimerization, DNA interaction, and coregulators recruitment (Arbuckle et al., 1992; Brzozowski et al., 1997; Shiau et al., 1998; Klinge, 2000; Gruber et al., 2002). All estrogenic or anti-estrogenic compounds could act on the animal and human health and treatments: (i) phytoestogens as lignans could be used to prevent the hormonally dependent cancer arrival or to limit climacteric complaints (Thompson, 1998; Power and Thompson, 2003; Bergman Jungestrom et al., 2007; Feng et al., 2008); (ii) drugs like Tamoxifen or fulverstran1 (ICI 182,780) were applied to cancers and menopause treatments (Love et al., 1994; Landgren et al., 2002; Martino et al., 2004a,b; Jacobsen et al., 2008; McCormack and Sapunar, 2008; Saji and Kuroi, 2008). At present, public and

politic attentions are focussed on a new class of molecules called endocrine disturbers. These compounds, resulting from an environmental pollution (drugs, pesticides, and industrial waste) or from our lifestyle (plastics, cosmetics, etc.), affect fertility and enhance risk of cancer (Inadera, 2006; Vanparys et al., 2006; Ho et al., 2008; Soto et al., 2008; Tiemann, 2008). All these data incite to identify some new potential estrogenic or anti-estrogenic compounds essential to protect human health (therapy, prevention) and environment. Classically, the identification of new potential estrogenic compounds was based on cellular or animal models. However, the ER dimerization and its interaction with DNA being the initial steps of the estrogenic genomic mechanism, a prescreening of molecules of interest could be processed upstream, in order to reduce time and money consumptions. Surface plasmon resonance (SPR) biosensors and/or on-chip force spectroscopy analysis, which allow real time biomolecular

* Correspondence to: A. Berthier, Estrogeńes, Expression Geńique et Pathologies du Syste´me Nerveux Central, EA3922, IFR 133, Universite´ de Franche-Comte´, Besançon cedex, France. a A. Berthier, R. Delage-Mourroux Estroge`nesQ2, Expression Geńique et Pathologies du Syste´me Nerveux Central, EA3922, IFR 133, Universite´ de Franche-Comte´, Besançon cedex, France b A. Berthier, C. Elie-Caille, W. Boireau Institut FEMTO-ST, UMR 6174 CNRS, Clinical and Innovation Proteomic Platform (CLIPP), Universite´ de Franche-Comte´, Besançon cedex, France c E. Lesniewska Laboratoire Interdisciplinaire Carnot Bourgogne UMR CNRS 5209, Nanosciences Department, University of Bourgogne, Dijon Cedex, France

61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 Q2 111 112 113 114 115 116 117 118 119 120

1

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

J. Mol. Recognit. 2010; 9999: 1–7

Copyright ß 2010 John Wiley & Sons, Ltd.

A. BERTHIER ET AL.

Table 1. 50 amine modified oligonucleotides (D1 and D4) and complementary single strand (C3 and C6) sequences

Names D1 C3 D4 C6

Double strand sequences

Sequences 50 -H2N-(CH2)12-ATATATAGTTCTTTGATCAGGTCACTGTGACCTGAACTTGCT-30 AGCAAGTTCAGGTCACAGTGACCTGATCAAAGAACT 50 -H2N-(CH2)12-ATATATGTCCAAAGTCAATCGCCAGCACGATGATCAAAGTCC-30 GGACTTTGATCATCGTGCTGGCGATTGACTTTGGAC

ERE Control

The ERE (bold and underlined) and control sequences were created by hybridization of D1/C3 and D4/C6 oligonucleotides, respectively.

D

PR

O

O

FS

spectroscopy is able to monitor intermolecular interactions in different medium conditions. Recording the applied force over the stretching distance revealed a characteristic sawtooth-like pattern of force peaks. The appearance of a ‘‘repetitive’’ pattern of force peaks while retracting ER tip to the ER surface confirmed (1) that ER interacts with itself and (2) that this interaction, estrogen specific and repetitive, described a specific pathway. These observations fit with a dimerization of ER in the presence of estrogen. In this paper we have described a new SPR biosensor dedicated to potential estrogenic compounds prescreening, by developing an ER specific DNA chip, the ERE chip. In parallel, force spectroscopy experiments allowed us to (1) prove that ER needs estrogen for its dimerization and (2) propose an innovative screening tool for anti-estrogenic compounds.

MATERIALS AND METHODS Materials

DNA immobilization was allowed by a primary amine grafted via a 12 carbons alkyl chain on 50 extremities of D1 and D4 single strand oligonucleotides. Modified oligonucleotides (D1 and D4) were able to create ERE or double strand control sequence by hybridization with complementary sequence C3 and C4. All DNA sequences were presented in Table 1 (Eurogentec, Liege, Belgium). Human recombinant estrogen receptor-a (ERa; PanVera, Invitrogen Corporation, Carlsbad, USA) was conserved at

UN

CO RR

EC

TE

interaction detections and quantification, can be applied to these prescreening steps. These biosensors are based on the immobilization of biomolecules on a gold chip directly or indirectly by physical or chemical adsorption (Boireau et al., 2002; Aoyagi et al., 2008). In order to get free of non-specific protein adsorption, a passivation step of the metallic film is essential (Rella et al., 2004). This process implies the development of indirect grafting strategies. Actually, many kinds of surfaces were provided to SPR biosensor’s users, for instance 3D hydrogels like commercial carboxymethyl dextran (CMD) or 2D self-assembled monolayers (SAMs). For the ER/ERE interaction studies, several authors have oriented their DNA grafting strategies on the CMD based chips (Cheskis et al., 1997; Kostelac et al., 2003; Asano et al., 2004; Habauzit et al., 2008). However, the CMD based surfaces were known to create some kinetic disturbing as mass transport and rebinding (Schuck, 1996; Yarmush et al., 1996; Fong et al., 2002). Thus, to get free of these artifacts, one of the grafting alternative was based on a mixture of 16- mercapto-1-hexadecanoic acid (MHA) and 11- mercapto-1-undecanol (MUO). Previous works have shown that carboxylic functions of the MHA allowed molecular grafting and that the hydroxyl groups of the MUO reduced the non-specific adsorption phenomenon (Frederix et al., 2003; Huang et al., 2005). The grafting of molecules like modified DNA and proteins on such SAMs presenting a primary amine group was enabled by this latest surface choice after carboxylic function activation. To address the question of ER dimerization, we analyzed interactions between an ER functionalized gold surface and an ER modified AFM tip by force spectroscopy. Indeed, AFM force

Figure 1. (A) Detection of ER/DNA specific interaction. The ERa was incubated with 10 nM E2 (30 min at room temperature) and injected (90 ml at 30 ml/ min) on ERE (black) or control DNA sequences (gray). (B) Ligand impact. The ERa was incubated with ligand solvent (ethanol), with equimolar proportion of E2, or with an excess of ICI 182 780 supplemented or not by E2 (10 nM). The specific interaction signals were the control interaction signal subtracted to the ERE signal. Data presented as histograms were the means of three independent experiments.

2

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

wileyonlinelibrary.com/journal/jmr


J. Mol. Recognit. 2010; 9999: 1–7

61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120

Q1

808C into 10 ml aliquots to limit the number of freeze-thaw cycles. Estradiol-17-b (E2; Sigma–Aldrich, St. Louis, USA) and ICI 182 780 provided by AstraZeneca (Reims, France) was prepared in ethanol at 1 nM and 1 mM, respectively. The MUO and MHA (Sigma–Aldrich, St. Louis, USA) were prepared in ethanol. MHA carboxylic functions were activated with amine coupling kit consisted of l-ethyl-3(3-dimethylaminopropyl) carbodiimide (EDC) and N -hydroxy succinimide (NHS) 1:1 mix (GE Healthcare Life Sciences, Pittsburgh, USA).

61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120

either used for DNA or ER immobilization, in order to study DNA/ ER sensing by SPR or ER/ER dimerization by force spectroscopy, respectively. SPR experiments All SPR experiments were run on BIAcore 2000 apparatus at 258C using BIACORE 2000 Control Software version 3.2 (GE Healthcare Life Sciences). DNA immobilization

O

FS

Modified DNA immobilizations were processed with HBS-N running buffer (10 mM Hepes pH 7.4, NaCl 150 mM). First, the surface was washed with 15 ml of 40 mM OctylGlucopyranoside (OG, Sigma–Aldrich, St. Louis, USA) at 30 ml/ min. Then, the MHA carboxylic functions were activated with two injections (70 ml at 10 ml/min) of EDC/NHS v/v mix. In order to reduce the surface charge repulsion, 10 mM of amine-modified oligonucleotides were diluted in a 10 mM Hepes buffer pH 8.4 supplemented by 0.4 mM hexadecyltrimethylammonium bromide (CTAB). Oligonucleotides were then injected on the

UN

CO RR

EC

TE

D

PR

Gold chips were processed as previously described (Mangeat et al., 2009). Briefly a 2 nm thick chromium layer is deposited on a glass wafer (diameter: 13 mm and thickness: 0.17 mm) with plasma sputtering technology to improve the adherence of gold to the substrate. Then a 40 nm thick gold layer is sputtered on the top of the Cr layer. After cleaning of the surface (ethanol/water), the chip was functionalized with a mixed SAM. This SAM was processed by an overnight chip immersion in a 1 mM MUO/MHA (90:10 by mol) bath. Such functionalized gold surfaces were

O

Sensor chips

Figure 2. Characterization of ER bio-functionalized surfaces. Thiols functionalized gold chip before (A and C) and after (B and D) ER graftings. AFM images and their corresponding section analysis. Pieces of APTES/glutaraldehyde functionalized silicon nitride, before (E) and after (F and G) ER graftings. The image presented in G is the zoom of one red delimited area in image F. Z range is 10 (E and F) or 5 (G) nm.

3

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

LABELQ1-FREE SENSING AND AFS FOR THE CHARACTERIZATION OF PROTEIN–DNA AND PROTEIN–PROTEIN INTERACTIONS

J. Mol. Recognit. 2010; 9999: 1–7



A. BERTHIER ET AL.

4

ER dimerization characterization by force spectroscopy

FS

(a) Characterization of ER biofunctionalized surfaces

O

O

The quality of the working surfaces, the ER modified silicon nitride AFM tip and the ER modified gold chip, was assessed using AFM to prove the presence of ER on both surfaces (Figure 2). The surface of the MHA/MUO functionalized gold chip was compared before and after ER graftings. The surface presented

EC

TE

ER was immobilized on MUO/MHA (90:10 by mol) functionalized gold surface. For that, the surface was washed with 40 mM Octyl-Glucopyranoside. Then, the MHA carboxylic functions were activated with two injections of EDC/NHS v/v, and the gold surface was incubated during 30 min in the presence of ER solution (20 nM). The surface was then washed with ER buffer. The AFM used was a Nanoscope III (Veeco, Santa Barbara, CA). Imaging was performed in contact mode using NPS-oxide sharpened silicon nitride probes (Veeco) exhibiting spring constants of 0.3 N/m. For the force spectroscopy measurements, the AFM tip, made of silicon nitride, was functionalized by 1% APTES in toluene during 2 h, washed extensively with toluene then with ethanol. The second step consisted in an incubation in 0.2% glutaraldehyde solution during 10 min, followed by extensive washing with water. The modified tips were then incubated in 20 nM ER solution during 30 min, then washed with ER buffer. DNP-S AFM probes (from Veeco) were employed, presenting a spring constant around 0.3 N/m. For all the curves, a 200 nm ramp size and an interaction time of 1 msQ3 were used. The loading rate was varied, from 30 000 to 520 000 pN/s, in order to study the dependency of the forces necessary to rupture specific bonds on the loading rate.

PR

Force spectroscopy

(10 nM) interaction signal, in presence of 10 nM E2, was 3.63 0.8 fold higher on ERE than on control sequence (for example see Figure 1A). Thus, we can conclude that our ERE chip constitutes a valid tool for specific ER/DNA interaction detection. In order to determine the ligand impacts on ER/DNA interactions, the receptor has been injected with or without ligand. In presence of E2, the specific interaction signal was 1.7 fold higher than in absence of ligand (157 RU vs. 91 RU, respectively). When ER has been incubated with 1 mM ICI 182 780, supplemented or not by 10 nM E2, the specific interaction was 1.8 fold reduced compared to ligand free condition (Figure 1B).

D

chip at 10 ml/min for 15 min. The excess of NHS-ester function was inactivated with 1 M ethanolamine (140 ml at 10 ml/min). For the hybridization process, the running buffer was replaced by HBS-EP buffer (GE healthcare Life Sciences). Complementary oligonucleotides (2.5 mM) were injected at 20 ml/min for 2 min. At the end of injection, the surface was cleaned by a 15 ml pulse of OG at 30 ml/min.

ER/DNA interactions

CO RR

For the protein/DNA interaction studies the running buffer was replaced by the interaction buffer (40 mM Hepes pH 7.4, 100 mM NaCl, 10 mM MgCl2, 1 mM DTT, and 0.2% Triton X-100). First, 10 nM ERa was incubated with 1 nM E2 or 1 mM ICI 182 780 for 30 min at room temperature in interaction buffer. Then 90 ml of activated receptor were injected at 30 ml/min on ERE or control channels. Finally, the DNA surface was regenerated by 10 min injection of 0.1% SDS, 100 mM EDTA denaturizing solution (at 5 ml/min).

RESULTS AND DISCUSSION

UN

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ERE chip processing

The 50 amine modified single strand oligonucleotides D1 and D4 (10 mM) were immobilized on activated mixed SAM. Then complementary oligonucleotides (C1 and C4) were injected to create double strand ERE specific sequence or control sequence, respectively. After 2 min of injection the D1/C3 (ERE) and D4/C6 (control) hybridization degrees were 69.3 6.9 and 78.8 6.5%, respectively (data not shown). Double strand SPR signals were 150 30 RU (Response Unit) for ERE and 244 55 RU for control sequence (data not shown). ER/ERE interaction validation The specificity of the ER/DNA interaction was determined by an injection of E2 activated ER on control and ERE sequences. The ER


Figure 3. Force curves measured between ER tip and ER gold chip. (A) Scattered spectra represent superimposition of force curves, that highlight common features. A typical force curve is highlighted in red. Blue circles and arrows indicate the average peak position and the rupture distance. Loading rate: 150 000 pN/s, in the presence of 1 nM E2. (B) Histogram presenting the repartition of rupture forces measured in the absence (ER/ER; in gray) or presence (in black) of 1 nM E2 (ER/ER þ E2) in the medium.


J. Mol. Recognit. 2010; 9999: 1–7

61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 Q3 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120

LABELQ1-FREE SENSING AND AFS FOR THE CHARACTERIZATION OF PROTEIN–DNA AND PROTEIN–PROTEIN INTERACTIONS (b) Force spectroscopy measurements

O

FS

Here we used single molecule force spectroscopy to investigate the molecular forces driving ER/ER interactions. If an ER dimer is formed, under conditions favorable for interaction between the two molecules, single molecule force spectroscopy should detect it while retracting the tip from the surface. In the case of dimerization, when an ER modified AFM tip interacts with an ER modified surface, the dimer is ruptured at the retraction step upon removal of the tip from the surface. Such an event produces a specific rupture signature on the force curve. We observed that when the ER modified AFM tip is used on the ER biofunctionalized gold chip surface after a preliminary 10 min

UN

CO RR

EC

TE

D

PR

O

an increase in rms value (on 400 nm 400 nm surface area), from 0.2 nm (rmax ¼ 0.9 nm) to 0.9 nm (rmax ¼ 3.4 nm) before and after protein grafting, respectively, that reveals the presence of protein material on the gold surface (Figure 2A–D). We also wanted to prove the presence of ER on AFM tip, made in silicon nitride. For that, we prepared pieces of silicon nitride and functionalized them with APTES and glutaraldehyde and controlled the surface by AFM before and after ER grafting. After incubation of the functionalized surface in ER and a washing step, we distinguished motifs on the surface and also some bigger aggregates. While zooming on such aggregates, it appeared that these bigger complexes were composed of motifs of 12–15 nm in diameter (Figure 2E–G). Then, the majority of the surface is covered by proteins, with a good homogeneity and only few aggregates of the protein are present. Thus, we can evaluate that the APTES þ glutaraldehyde surface enables the grafting of ER protein on the silicon nitride surface, meaning that the ER is effectively bound to the silicon nitride tip when ER tip is employed in force curves experiments.

Figure 4. Dynamics of ER/ER interaction. (A) Typical force curves registered in the presence of 1 nM E2, at three different loading rates (30 000, 150 000, and 520 000 pN/s in black, dark gray, and light gray, respectively).

Figure 5. Inhibition and reversibility of ER/ER interaction. (A) In buffer and in the presence of 1 nM E2, forces curves were registered before inhibitor addition (in black), in the presence of 1 mM ICI 182 780 (in red and gray) and after an extensive rinsing and again in buffer containing 1 nM E2 (in blue). (B) Histogram presenting the proportion of curves presenting peaks or not in the different tested conditions.

61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120

5

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

J. Mol. Recognit. 2010; 9999: 1–7



A. BERTHIER ET AL. affinity of ICI 182 780 to the ER is 89% that of oestradiol (Howell, 2006). Then, such a large excess of inhibitor, having an affinity binding comparable to the ligand E2, could induce adsorbed molecules left on ER. This could explain that the interaction between the tip and the surface was reduced after ICI incubation. Moreover, this result indicates that the absence of peaks on curves obtained in the presence of 1 mM ICI 182 780 was effectively due to an inhibition of the tip/surface interaction, and not to an artifact of experiments. Then these unbinding events between ER tip and ER gold chip seem to be specific since:

FS

(1) No interaction is detected between a naked tip and the ER surface (data not shown). (2) Only few and weak interactions appeared between the ER modified tip and ER modified gold surface in the absence of E2.

O

In the presence of 1 nM E2:

D

PR

O

(1) A recurrent pattern of 3–5 peaks appeared, attesting that the ER/ER interaction follows a highly controlled and specific multiple-steps mechanism. (2) The forces needed to rupture the ER/ER interaction is loading rate dependent, meaning that these interactions are ER specific. (3) The addition of the ICI 182 780 inhibitor prevents the ER/ER interaction.

UN

CO RR

EC

TE

incubation in the presence of 1 nM E2, interaction events can be recorded. We collected then several force curves (50) in this condition (loading rate 150 000 pN/s), i.e., in the presence of 1 nM E2. We obtained the scattered spectra presented in Figure 3A. Scattered spectra represent superimpositions of force curves obtained in the same conditions. Superimpositions highlight common features (a ‘‘five peaks’’ typical curve) of the unfolding events and reduce deviations, which may occur in individual spectra. More than 90% of force curves presented interaction peaks in the presence of 1 nM E2. The peak intensity was around 10 pN. The results are different in the absence of 1 nM E2, since the majority of force curve present no peak. Moreover, when a peak appeared in these conditions, its intensity was really low, close to zero (Figure 3B, the single gray bar). Moreover, the forces necessary to rupture specific bonds are known to depend on the loading rate (Merkel et al., 1999). Consistent with this study, 100 force curves were registered at four different loading rate, from 30 000 to 520 000 pN/s. Typical force curves obtained for three different loading rates are represented in Figure 4A. We found that the binding force between the ER tip and the ER surface, in the presence of 1 nM E2 in the solution, increased linearly with the logarithm of the loading rate (Figure 4B). In our force spectroscopy experiment, we also tested the effect of ICI 182 780, a molecule known as an inhibitor of ER/ER dimerization. While the buffer contained 1 nM E2 and 1 mM of ICI 182 780, we registered 50 curves and from them, very few curves were presenting peaks, and in this case only a single peak at short rupture distance was observed (Figure 5A, in red). Nevertheless, the majority of curves even presented no more interaction peaks (Figure 5A, in gray). Then, the presence of ICI 182 780 seemed to have inhibited the interaction between the ER tip and the ER surface. After this, we rinsed our surface, tip and AFM fluidic cell extensively with buffer, added again 1 nM E2 and proceeded again in force curves experiments. We observed that force curves presented again several peaks (3–5 peaks), and that the stretching distance fit with the stretching distance registered before addition of the inhibitor (Figure 5A, in blue). Nevertheless, after recording 50 force curves in these conditions (‘‘after ICI incubation and rinsing’’), we noticed that only 50% of curves roughly presented this pattern of peaks (Figure 5B). This observation could mean that the ER/ER interaction is ‘‘quasi-reversible’’ after ICI 182 780 incubation, as if the inhibitor remained partially fixed on ER after washing. This is probably the case. Indeed, to ensure the inhibition of ER/ER interaction, we used a 1 mM inhibitor concentration, compared to 1 nM concentration of E2. But, it is known that the binding

CONCLUSION This SPR biosensor, consisting in ERE presenting DNA sequence, allows the selection of molecules which induce ER/ERE interaction. These preselected compounds could be enough to isolate compounds which are able to induce gene transactivation. The estrogenic activity should then be studied with an animal or cellular model. These xeno-estrogenes could be used for example to menopause treatment. However, hormonodependant cancer therapy needs molecules which reduce target gene expressions by ER dimerization and/or its interaction with DNA inhibition. The differentiation of anti-estrogenic and inefficient compounds will be impossible using the SPR ERE biosensor. The force spectroscopy assays represent then a relevant and complementary tool since this strategy allows to preselect quickly anti-estrogenic compounds which inhibit ER dimerization (initial step of gene transactivation).

REFERENCES Ahn MR, Sheen YY. 1997. Antiestrogen interaction with estrogen receptors and additional antiestrogen binding sites in human breast cancer MCF-7 cells. Arch. Pharm. Res. 20(6): 579–585. Aoyagi S, Rouleau A, Boireau W. 2008. TOF-SIMS structural characterization of self-assembly monolayer of cytochrome b5 onto gold substrate. Appl. Surf. Sci. 255(4): 1071–1074. Arbuckle ND, Dauvois S, Parker MG. 1992. Effects of antioestrogens on the DNA binding activity of oestrogen receptors in vitro. Nucleic Acids Res. 20(15): 3839–3844. Asano K, Ono A, Hashimoto S, Inoue T, Kanno J. 2004. Screening of endocrine disrupting chemicals using a surface plasmon resonance sensor. Anal. Sci. 20(4): 611–616.

Bergman Jungestrom M, Thompson LU, Dabrosin C. 2007. Flaxseed and its lignans inhibit estradiol-induced growth, angiogenesis, and secretion of vascular endothelial growth factor in human breast cancer xenografts in vivo. Clin. Cancer Res. 13(3): 1061–1067. Berthier A, Girard C, Grandvuillemin A, Muyard F, Skaltsounis AL, Jouvenot M, Delage-Mourroux R. 2007. Effect of 7-O-beta -D- glucopyranosylchrysin and its aglycone chrysin isolated from Podocytisus caramanicus on estrogen receptor alpha transcriptional activity. Planta Med. 73(14): 1447–1451. Boireau W, Bombard S, Sari MA, Pompon D. 2002. Bioengineering and characterization of DNA–protein assemblies floating on supported membranes. Biotechnol. Bioeng. 77(2): 225–231.

6

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60



J. Mol. Recognit. 2010; 9999: 1–7

61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120

LABELQ1-FREE SENSING AND AFS FOR THE CHARACTERIZATION OF PROTEIN–DNA AND PROTEIN–PROTEIN INTERACTIONS

D

PR

O

O

FS

Mangeat T, Berthier A, Elie-Caille C, Perrin M, Boireau W, Pieralli C, Wacogne B. 2009. Gold/silica biochips: applications to surface plasmon resonnace and fluorescence quenching. Laser Phys. 19(2): 252–258. Martino S, Costantino J, McNabb M, Mershon J, Bryant K, Powles T, Secrest RJ. 2004a. The role of selective estrogen receptor modulators in the prevention of breast cancer: comparison of the clinical trials. Oncologist 9(2): 116–125. Martino S, Cauley JA, Barrett-Connor E, Powles TJ, Mershon J, Disch D, Secrest RJ, Cummings SR. 2004b. Continuing outcomes relevant to Evista: breast cancer incidence in postmenopausal osteoporotic women in a randomized trial of raloxifene. J. Natl. Cancer Inst. 96(23): 1751–1761. McCormack P, Sapunar F. 2008. Pharmacokinetic profile of the fulvestrant loading dose regimen in postmenopausal women with hormone receptor-positive advanced breast cancer. Clin. Breast Cancer 8(4): 347–351. Merkel R, Nassoy P, Leung A, Ritchie K, Evans E. 1999. Energy landscapes of receptor-ligand bonds explored with dynamic force spectroscopy. Nature 397(6714): 50–53. Okubo T, Yokoyama Y, Kano K, Kano I. 2001. ER-dependent estrogenic activity of parabens assessed by proliferation of human breast cancer MCF-7 cells and expression of ERalpha and PR. Food Chem. Toxicol. 39(12): 1225–1232. O’Malley BW. 2005. A life-long search for the molecular pathways of steroid hormone action. Mol. Endocrinol. 19(6): 1402–1411. Power KA, Thompson LU. 2003. Ligand-induced regulation of ERalpha and ERbeta is indicative of human breast cancer cell proliferation. Breast Cancer Res. Treat. 81(3): 209–221. Rella R, Spadavecchia J, Manera MG, Siciliano P, Santino A, Mita G. 2004. Liquid phase SPR imaging experiments for biosensors applications. Biosens. Bioelectron. 20(6): 1140–1148. Saji S, Kuroi K. 2008. Application of selective estrogen receptor modulators for breast cancer treatment according to their intrinsic nature. Breast Cancer Schuck P. 1996. Kinetics of ligand binding to receptor immobilized in a polymer matrix, as detected with an evanescent wave biosensor. I. A computer simulation of the influence of mass transport. Biophys. J. 70(3): 1230–1249. Shiau AK, Barstad D, Loria PM, Cheng L, Kushner PJ, Agard DA, Greene GL. 1998. The structural basis of estrogen receptor/coactivator recognition and the antagonism of this interaction by tamoxifen. Cell 95(7): 927–937. Soto AM, Vandenberg LN, Maffini MV, Sonnenschein C. 2008. Does breast cancer start in the womb? Basic Clin. Pharmacol. Toxicol. 102(2): 125–133. Thompson LU. 1998. Experimental studies on lignans and cancer. Baillieres Clin. Endocrinol. Metab. 12(4): 691–705. Tiemann U. 2008. In vivo and in vitro effects of the organochlorine pesticides DDT, TCPM, methoxychlor, and lindane on the female reproductive tract of mammals: a review. Reprod. Toxicol. 25(3): 316–326. Vanparys C, Maras M, Lenjou M, Robbens J, Van Bockstaele D, Blust R, De Coen W. 2006. Flow cytometric cell cycle analysis allows for rapid screening of estrogenicity in MCF-7 breast cancer cells. Toxicol. in Vitro 20(7): 1238–1248. Wakeling AE, Dukes M, Bowler J. 1991. A potent specific pure antiestrogen with clinical potential. Cancer Res. 51(15): 3867–3873. Yarmush ML, Patankar DB, Yarmush DM. 1996. An analysis of transport resistances in the operation of BIAcore; implications for kinetic studies of biospecific interactions. Mol. Immunol. 33(15): 1203–1214.

UN

CO RR

EC

TE

Brzozowski AM, Pike AC, Dauter Z, Hubbard RE, Bonn T, Engstrom O, Ohman L, Greene GL, Gustafsson JA, Carlquist M. 1997. Molecular basis of agonism and antagonism in the oestrogen receptor. Nature 389(6652): 753–758. Cheskis BJ, Karathanasis S, Lyttle CR. 1997. Estrogen receptor ligands modulate its interaction with DNA. J. Biol. Chem. 272(17): 11384–11391. Diel P. 2002. Tissue-specific estrogenic response and molecular mechanisms. Toxicol. Lett. 127(1–3): 217–224. Feng J, Shi Z, Ye Z. 2008. Effects of metabolites of the lignans enterolactone and enterodiol on osteoblastic differentiation of MG-63 cells. Biol. Pharm. Bull. 31(6): 1067–1070. Fong CC, Wong MS, Fong WF, Yang M. 2002. Effect of hydrogel matrix on binding kinetics of protein–protein interactions on sensor surface. Anal. Chim. Acta 456(2): 201–208. Frederix F, Bonroy K, Laureyn W, Reekmans G, Campitelli A, Dehaen W, Maes G. 2003. Enhanced performance of an affinity biosensor interface based on mixed self-assembled monolayers of thiols on gold. Langmuir 19(10): 4351–4357. Gruber CJ, Tschugguel W, Schneeberger C, Huber JC. 2002. Production and actions of estrogens. N. Engl. J. Med. 346(5): 340–352. Habauzit D, Armengaud J, Roig B, Chopineau J. 2008. Determination of estrogen presence in water by SPR using estrogen receptor dimerization. Anal. Bioanal. Chem. 390(3): 873–883. Ho PW, Garner CE, Ho JW, Leung KC, Chu AC, Kwok KH, Kung MH, Burka LT, Ramsden DB, Ho SL. 2008. Estrogenic phenol and catechol metabolites of PCBs modulate catechol-O-methyltransferase expression via the estrogen receptor: potential contribution to cancer risk. Curr. Drug Metab. 9(4): 304–309. Howell A. 2006. Pure oestrogen antagonists for the treatment of advanced breast cancer. Endocrinol. Relat. Cancer 13(3): 689–706. Huang L, Reekmans G, Saerens D, Friedt JM, Frederix F, Francis L, Muyldermans S, Campitelli A, Van Hoof C. 2005. Prostate-specific antigen immunosensing based on mixed self-assembled monolayers, camel antibodies and colloidal gold enhanced sandwich assays. Biosens. Bioelectron. 21(3): 483–490. Inadera H. 2006. The immune system as a target for environmental chemicals: xenoestrogens and other compounds. Toxicol. Lett. 164(3): 191–206. Jacobsen DE, Samson MM, Schouw YT, Grobbee DE, Verhaar HJ. 2008. Efficacy of tibolone and raloxifene for the maintenance of skeletal muscle strength, bone mineral density, balance, body composition, cognitive function, mood/depression, anxiety and quality of life/ well-being in late postmenopausal women 70 years: study design of a randomized, double-blind, double-dummy, placebo-controlled, single-center trial. TrialsQ4 9: 32. Klinge CM. 2000. Estrogen receptor interaction with co-activators and co-repressors. Steroids 65(5): 227–251. Klinge CM. 2001. Estrogen receptor interaction with estrogen response elements. Nucleic Acids Res. 29(14): 2905–2919. Kostelac D, Rechkemmer G, Briviba K. 2003. Phytoestrogens modulate binding response of estrogen receptors alpha and beta to the estrogen response element. J. Agric. Food Chem. 51(26): 7632–7635. Landgren MB, Bennink HJ, Helmond FA, Engelen S. 2002. Dose-response analysis of effects of tibolone on climacteric symptoms. BjogQ5 109(10): 1109–1114. Love RR, Wiebe DA, Feyzi JM, Newcomb PA, Chappell RJ. 1994. Effects of tamoxifen on cardiovascular risk factors in postmenopausal women after 5 years of treatment. J. Natl. Cancer Inst. 86(20): 1534–1539. Maggiolini M, Bonofiglio D, Marsico S, Panno ML, Cenni B, Picard D, Ando S. 2001. Estrogen receptor alpha mediates the proliferative but not the cytotoxic dose-dependent effects of two major phytoestrogens on human breast cancer cells. Mol. Pharmacol. 60(3): 595–602.

61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 Q4 94 95 96 97 98 99 100 Q5 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120

7

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

J. Mol. Recognit. 2010; 9999: 1–7



Author Query Form (JMR/1106) Special Instruction: Author please include responses to queries with your other corrections and return by e-mail.

CO RR

EC

TE

D

PR

O

O

FS

Q1: Author: Please check the suitability of the suggested short title according to the maximum limit of 45 characters (including space) for this journal Q2: Author: Please check the correspondence author, correspondence address, and please provide E-mail ID for the corresponding author. Q3: Author: Please check the unit. Q4: Author: Please provide the page range full. Q5: Author: Please check the journal title.

UN

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120

USING eANNOTATION TOOLS FOR ELECTRONIC PROOF CORRECTION Required Software to eAnnotate PDFs: Adobe Acrobat Professional or Acrobat Reader (version 8.0 or above). The Latest version of Acrobat Reader is free: http://www.adobe.com/products/acrobat/readstep2.html Once you have Acrobat Reader 8, or higher, open on your PC you should see the Commenting Toolbar:

****(If the above toolbar does not appear automatically go to Tools>Comment & Markup>Show Comment & Markup Toolbar)****

1. Replacement Text Tool — For replacing text. Strikes a line through text and opens up a replacement text box.

How to use it: 1. Highlight a word or sentence 2. Select “Replace Selected Text” from the Text Edits fly down button 3. Type replacement text in blue box

2. Cross-out Text Tool — For deleting text. Strikes a red line through selected text.

How to use it: 1. Highlight a word or sentence 2. Select “Cross Out Text for Deletion” from the Text Edits fly down button

3. Highlight Tool — For highlighting a selection to be changed to bold or italic. Highlights text in yellow and opens up a text box.

How to use it: 1. Highlight desired text 2. Select “Add Note To Selected Text” from the Text Edits fly down button 3. Type a note detailing required change in the yellow box

4. Note Tool — For making notes at specific points in the text Marks a point on the paper where a note or question needs to be addressed.

How to use it: 1. Select the Sticky Note icon from the commenting toolbar 2. Click where the yellow speech bubble symbol needs to appear and a yellow text box will appear 3. Type comment into the yellow text box

USING eANNOTATION TOOLS FOR ELECTRONIC PROOF CORRECTION

5. Drawing Markup Tools — For circling parts of figures or spaces that require changes These tools allow you to draw circles, lines and comment on these marks.

How to use it: 1. Click on one of shape icons in the Commenting Toolbar 2. Draw the selected shape with the cursor 3. Once finished, move the cursor over the shape until an arrowhead appears and double click 4. Type the details of the required change in the red box

6. Attach File Tool — For inserting large amounts of text or replacement figures as a files. Inserts symbol and speech bubble where a file has been inserted. How to use it: 1. Right click on the Commenting Toolbar 2. Select “Attach a File as a Comment” 3. Click on paperclip icon that appears in the Commenting Toolbar 4. Click where you want to insert the attachment 5. Select the saved file from your PC or network 6. Select type of icon to appear (paperclip, graph, attachment or tag) and close

7. Approved Tool (Stamp) — For approving a proof if no corrections are required. How to use it: 1. Click on the Stamp Tool in the toolbar 2. Select the Approved rubber stamp from the „standard business‟ selection 3. Click on the text where you want to rubber stamp to appear (usually first page)

Help For further information on how to annotate proofs click on the Help button to activate a list of instructions:

WILEY AUTHOR DISCOUNT CLUB We would like to show our appreciation to you, a highly valued contributor to Wiley’s publications, by offering a unique 25% discount off the published price of any of our books*. All you need to do is apply for the Wiley Author Discount Card by completing the attached form and returning it to us at the following address: The Database Group (Author Club) John Wiley & Sons Ltd The Atrium Southern Gate Chichester PO19 8SQ UK Alternatively, you can register online at www.wileyeurope.com/go/authordiscount Please pass on details of this offer to any co-authors or fellow contributors. After registering you will receive your Wiley Author Discount Card with a special promotion code, which you will need to quote whenever you order books direct from us. The quickest way to order your books from us is via our European website at:

http://www.wileyeurope.com Key benefits to using the site and ordering online include: • Real-time SECURE on-line ordering • Easy catalogue browsing • Dedicated Author resource centre • Opportunity to sign up for subject-orientated e-mail alerts Alternatively, you can order direct through Customer Services at: [email protected], or call +44 (0)1243 843294, fax +44 (0)1243 843303 So take advantage of this great offer and return your completed form today. Yours sincerely,

Verity Leaver Group Marketing Manager [email protected]

*TERMS AND CONDITIONS

This offer is exclusive to Wiley Authors, Editors, Contributors and Editorial Board Members in acquiring books for their personal use. There must be no resale through any channel. The offer is subject to stock availability and cannot be applied retrospectively. This entitlement cannot be used in conjunction with any other special offer. Wiley reserves the right to amend the terms of the offer at any time.

REGISTRATION FORM

For Wiley Author Club Discount Card To enjoy your 25% discount, tell us your areas of interest and you will receive relevant catalogues or leaflets from which to select your books. Please indicate your specific subject areas below. Accounting • Public • Corporate

[] [] []

Architecture

[]

Business/Management

[]

Chemistry • Analytical • Industrial/Safety • Organic • Inorganic • Polymer • Spectroscopy

[ [ [ [ [ [ [

] ] ] ] ] ] ]

Computer Science • Database/Data Warehouse • Internet Business • Networking • Programming/Software Development • Object Technology

[ [ [ [ [

Encyclopedia/Reference • Business/Finance • Life Sciences • Medical Sciences • Physical Sciences • Technology

[ [ [ [ [ [

] ] ] ] ] ]

Engineering • Civil • Communications Technology • Electronic • Environmental • Industrial • Mechanical

[ [ [ [ [ [ [

] ] ] ] ] ] ]

Earth & Environmental Science

[]

Hospitality

[]

Finance/Investing • Economics • Institutional • Personal Finance

[ [ [ [

] ] ] ]

Genetics • Bioinformatics/ Computational Biology • Proteomics • Genomics • Gene Mapping • Clinical Genetics

[] []

Life Science

[]

Landscape Architecture

[]

Mathematics Statistics

[]

[ [ [ [

] ] ] ]

Manufacturing Materials Science

Medical Science • Cardiovascular • Diabetes • Endocrinology • Imaging • Obstetrics/Gynaecology • Oncology • Pharmacology • Psychiatry

[ [ [ [ [ [ [ [ [

] ] ] ] ] ] ] ] ]

Non-Profit

[]

] ] ] ] ]

[]

[] []

Psychology • Clinical • Forensic • Social & Personality • Health & Sport • Cognitive • Organizational • Developmental & Special Ed • Child Welfare • Self-Help

[ [ [ [ [ [ [ [ [ [ [

] ] ] ] ] ] ] ] ] ] ]

Physics/Physical Science

[]

Please complete the next page /

I confirm that I am (*delete where not applicable): a Wiley Book Author/Editor/Contributor* of the following book(s): ISBN: ISBN: a Wiley Journal Editor/Contributor/Editorial Board Member* of the following journal(s):

SIGNATURE: ……………………………………………………………………………………

Date: ………………………………………

PLEASE COMPLETE THE FOLLOWING DETAILS IN BLOCK CAPITALS: TITLE: (e.g. Mr, Mrs, Dr) …………………… FULL NAME: …………………………………………………………………………….… JOB TITLE (or Occupation):

..…………………………………………………………………………………………………………………

DEPARTMENT: …………………………………………………………………………………………………………………………………………….. COMPANY/INSTITUTION: …………………………………………………………………………………………………………………………… ADDRESS: …………………………………………………………………………………………………………………………………………………… ……………………………………………………………………………………………………………………………………………………………………… TOWN/CITY: ………………………………………………………………………………………………………………………………………………… COUNTY/STATE: …………………………………………………………………………………………………………………………………………. COUNTRY: ……………………………………………………………………………………………………………………………………………………. POSTCODE/ZIP CODE: ………………………………………………………………………………………………………………………………… DAYTIME TEL: ……………………………………………………………………………………………………………………………………………… FAX: ……………………………………………………………………………………………………………………………………………………………… E-MAIL: ………………………………………………………………………………………………………………………………………………………… YOUR PERSONAL DATA We, John Wiley & Sons Ltd, will use the information you have provided to fulfil your request. In addition, we would like to: 1.

Use your information to keep you informed by post of titles and offers of interest to you and available from us or other Wiley Group companies worldwide, and may supply your details to members of the Wiley Group for this purpose. [ ] Please tick the box if you do NOT wish to receive this information

2.

Share your information with other carefully selected companies so that they may contact you by post with details of titles and offers that may be of interest to you. [ ] Please tick the box if you do NOT wish to receive this information.

E-MAIL ALERTING SERVICE We also offer an alerting service to our author base via e-mail, with regular special offers and competitions. If you DO wish to receive these, please opt in by ticking the box [ ]. If, at any time, you wish to stop receiving information, please contact the Database Group ([email protected]) at John Wiley & Sons Ltd, The Atrium, Southern Gate, Chichester, PO19 8SQ, UK.

TERMS & CONDITIONS This offer is exclusive to Wiley Authors, Editors, Contributors and Editorial Board Members in acquiring books for their personal use. There should be no resale through any channel. The offer is subject to stock availability and may not be applied retrospectively. This entitlement cannot be used in conjunction with any other special offer. Wiley reserves the right to vary the terms of the offer at any time.

PLEASE RETURN THIS FORM TO: Database Group (Author Club), John Wiley & Sons Ltd, The Atrium, Southern Gate, Chichester, PO19 8SQ, UK [email protected] Fax: +44 (0)1243 770154