Prostaglandin E2 induces interleukin-6 expression in human ...

Am J Physiol Cell Physiol 298: C1445–C1456, 2010. First published March 24, 2010; doi:10.1152/ajpcell.00508.2009.

Prostaglandin E2 induces interleukin-6 expression in human chondrocytes via cAMP/protein kinase A- and phosphatidylinositol 3-kinase-dependent NF-␬B activation Pu Wang,1 Fei Zhu,1 and Konstantinos Konstantopoulos1,2,3 1

Department of Chemical and Biomolecular Engineering, 2Johns Hopkins Physical Science Oncology Center and 3Institute for NanoBioTechnology, The Johns Hopkins University, Baltimore, Maryland

Submitted 16 November 2009; accepted in final form 18 March 2010

Wang P, Zhu F, Konstantopoulos K. Prostaglandin E2 induces interleukin-6 expression in human chondrocytes via cAMP/protein kinase A- and phosphatidylinositol 3-kinase-dependent NF-␬B activation. Am J Physiol Cell Physiol 298: C1445–C1456, 2010. First published March 24, 2010; doi:10.1152/ajpcell.00508.2009.—Elevated levels of prostaglandin (PG)E2 and interleukin (IL)-6 have been reported in the cartilage and synovial fluid from patients with arthritic disorders. PGE2 regulates IL-6 production in numerous different cells including macrophages and synovial fibroblasts. Although PGE2 stimulates IL-6 expression in human chondrocytes, the underlying signaling pathway of this process has yet to be delineated. Here, we investigate the mechanism of IL-6 induction in human T/C-28a2 chondrocytes treated with exogenously added PGE2. PGE2 induces IL-6 mRNA and protein expression via a cAMP-dependent pathway, reaching maximal levels after 60 min of stimulation before declining to baseline levels at 6 h. Forskolin, an adenylyl cyclase activator, also stimulates IL-6 expression in human chondrocytes in a dose- and time-dependent fashion. Inhibition of downstream effectors of cAMP activity such as protein kinase A (PKA) or phosphatidylinositol 3 kinase (PI3K) blocks PGE2- and forskolin-induced IL-6 upregulation. Simultaneous inhibition of PKA and PI3K reduces IL-6 expression in stimulated chondrocytes well below the basal levels of untreated cells. Gel shift, supershift, and chromatin immunoprecipitation assays reveal the activation and binding of the nuclear factor (NF)-␬B p65 subunit to the IL-6 promoter, which is markedly suppressed by selective PI3K or PKA pharmacological inhibitors. p65 knockdown completely abrogates IL-6 mRNA synthesis in PGE2- and forskolinprimed chondrocytes. Cumulatively, our data show that PGE2 and forskolin induce IL-6 expression in human chondrocytes via cAMP/ PKA and PI3K-dependent pathways, which in turn regulate the activation and binding of p65 to the IL-6 promoter. arthritic disorders; protein expression; chondrocytes; signal transduction; arthritis

suggests that prostaglandin (PG)E2 contributes to the pathogenesis of arthritic disorders including rheumatoid arthritis (RA) (25). Elevated levels of PGE2 have been detected in the cartilage and synovial fluid from patients with RA (37) and osteoarthritis (OA) (2, 21). It is believed that PGE2 plays a critical role in the generation and maintenance of edema and erosion of cartilage and juxtaarticular bone (25, 31). In an animal model of adjuvant-induced arthritis, the administration of a neutralizing antibody against PGE2 to arthritic rats markedly suppressed the edema, hyperalgesia, and cytokine interleukin (IL)-6 production at sites of inflamation (31). ACCUMULATING EVIDENCE

Address for reprint requests and other correspondence: K. Konstantopoulos, Dept. of Chemical and Biomolecular Engineering, The Johns Hopkins Univ., 3400 N. Charles St., Baltimore, MD 21218 (e-mail: [email protected]). http://www.ajpcell.org

PGE2 production is regulated by the two isoforms of cyclooxygenase (COX): COX-1 and COX-2. COX-1 is constitutively expressed in many cell types, including chondrocytes, and is presumed to be responsible for the synthesis of housekeeping prostanoids that are critical for normal physiological functions. COX-2 is inducible and is primarily responsible for the elevated production of prostanoids at sites of disease and inflammation (2, 3, 24). Compelling evidence suggests that the effects of PGE2 on chondrocyte function and cartilage tissue vary according to concentration levels. At the nano- to micromolar concentrations produced by arthritic tissues (2, 3), PGE2 has been associated with catabolic effects because it suppresses the production of proteoglycans and stimulates the degradation of extracellular matrix (5, 13, 24, 30). In contrast, low (picomolar) concentrations of PGE2 exert anabolic effects (24), as evidenced by stimulation of proteoglycan (aggrecan) synthesis (22). PGE2 is capable of controlling the production of diverse chemical mediators, including IL-6, in various cells. IL-6 is a multifunctional cytokine with a wide array of biological activities on different target cells. Under physiological conditions, IL-6 expression is tightly regulated. In response to an inflammatory insult, IL-6 levels increase in vivo and then decline to baseline levels on resolution of the insult. Even though PGE2 has been reported to inhibit IL-6 synthesis in resident liver macrophages (11), most previous studies have shown a positive association between PGE2 and IL-6 production in many different cells, including astrocytes (6), macrophages (25), synovial (18) and gingival (29) fibroblasts, osteoblasts (34), and chondrocytes (35). Elevated levels of IL-6 have been detected in synovial fluid from patients with RA (17). Moreover, intraperitoneal injection of an anti-PGE2 monoclonal antibody to arthritic rats attenuated paw levels of IL-6 RNA and serum IL-6 protein (31). It is believed that dysregulated overproduction of IL-6 is responsible for the systemic inflammatory manifestions and abnormal laboratory findings in RA patients. Although PGE2 has been reported to directly stimulate IL-6 production in human articular chondrocytes (21, 35), the mechanism of PGE2-induced IL-6 expression in chondrocytes has yet to be elucidated. Using the T/C-28a2 chondrocyte cell line as a model system, we here delineate the signaling pathway of IL-6 induction in human chondrocytes primed with exogenous PGE2. Specifically, we demonstrate that PGE2, an activator of the cAMP signaling pathway, and forskolin, an activator of adenylyl cyclase, induce IL-6 expression in human chondrocytes via cAMP/protein kinase A (PKA)- and phosphatidylinositol 3 kinase (PI3K)-dependent pathways. cAMP/PKA and PI3K in turn regulate the activation and binding of the nuclear factor (NF)-␬B p65 subunit to the IL-6 promoter and mediate PGE2-induced IL-6 expression.

0363-6143/10 Copyright © 2010 the American Physiological Society

C1445

C1446

PGE2-INDUCED IL-6 EXPRESSION IN CHONDROCYTES

EXPERIMENTAL PROCEDURES

Reagents. PGE2, forskolin, the adenylate cyclase inhibitor SQ22536, the PKA inhibitor H89, the specific activator of the exchange protein activated by cAMP (Epac) 8-(4-Chlorophenylthio)-2=-Omethyladenosine-3=,5=-cyclic monophosphate (8-pCPT-2=-O-MecAMP·Na or CPT), and the NF-␬B inhibitor 6-amino-4-(4phenoxyphenylethylamino)quinazoline (QNZ) were obtained from Enzo Life Sciences. The PI3K inhibitors LY-294002 and wortmannin were from Sigma-Aldrich. p65 small interfering RNA (siRNA), PKA C-␣ siRNA, and antibodies specific for ␤-actin, Akt, p-Akt (Ser473), cAMP responsive element (CRE) binding protein (CREB), and pCREB (Ser133) were purchased from Cell Signaling Technology (Danvers, MA). The anti-p65 monoclonal antibody (mAb), the antiIL-6 mAb, CREB1 siRNA, and ATF4 siRNA were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). The cAMP enzyme immunoassay (EIA) kit was from Cayman Chemical. All reagents for qRT-PCR and SDS-PAGE experiments were purchased from BioRad. Reagents for electrophoretic mobility shift assays (EMSA) were obtained from Pierce Chemical. The chromatin immunoprecipitation (ChIP) EZ-ChIP kit was purchased from Upstate Biotechnology. All other reagents were from Invitrogen, unless otherwise specified. Cell culture. Human primary articular chondrocytes (Cell Applications) or T/C-28a2 chondrocytic cells were seeded on 6-cm tissue culture dishes (106 cells per dish) in human chondrocyte growth medium (Cell Applications) or in DMEM/F12 medium supplemented with 10% FBS, respectively (1, 14, 15, 39). Twenty four hours later, T/C-28a2 cells were grown in serum-free medium for another 24 h before being incubated with PGE2 (1–20 ␮M), forskolin (1–20 ␮M), or vehicle (control) for prescribed periods of time in the presence or absence of pharmacological inhibitors. Transient transfection. In RNA interference assays, T/C-28a2 cells were transfected with 100 nM of an siRNA oligonucleotide sequence specific for CREB1, ATF4, PKA C-␣, or p65. In control experiments, cells were transfected with 100 nM of control siRNA. Transfected cells were allowed to recover for at least 12 h in growth medium and then incubated for 24 h in serum-free medium before their exposure to different treatments.

Quantitative real-time PCR. Quantitative real-time PCR (qRTPCR) assays were performed on the iCycler iQ detection system (Bio-Rad) using total RNA, the iScript one-step RT-PCR kit with SYBR green (Bio-Rad) and primers. The GenBank accession numbers and forward (F-) and reverse (R-) primers are as follows. IL-6 (NM_000600): F-ATGAACTCCTTCTCCACAAGCGC, R-GAAGAGCCCTCAGGCTGGACT; CREB1 (NM_134442): F-CCAGGTATCTATGCCAGCAG, R-TCTGTGTTCCGGAGAAAAGTC; ATF4 (NM_182810): F-CATTCCTCGATTCCAGCAAAGCAC, R-TTCTCCAACATCCAATCTGTCCCG; p65 (NM_001145138): F-CTGCAGTTTGATGATGAAGA, R-TAGGCGAGTTATAGCCTCAG; PKA C-␣ (NM_002730): F-GCGTGAAAGAATTCTTAGCCA, RCCACCTTCTGTTTGTCGAGGA; Akt1 (NM_001014432): F-ACCAGATGCAACCTCACTAT, R-TTAAACCTTGCTCCTCTGTC; Akt2 (NM_001626): F-AAACACAAGGAAAGGGAAC, R-CTTTGATGACAGACACCTCA; Akt3 (NM_005465): F-GCAAGTGGACGAGAATAAGT, R-CAATTTCATGCAAAAACAAA; GAPDH (NM_002046): FCCACCCATGGCAAATTCCATGGCA, R-TCTAGACGGCAGGTCAGGTCCACC. GAPDH was used as internal control. Reaction mixtures were incubated at 50°C for 15 min followed by 95°C for 5 min, and then 35 PCR cycles were performed with the following temperature profile: 95°C, 15 s; 58°C, 30 s; 68°C, 1 min; 77°C, 20 s. Data were collected at the (77°C, 20 s) step to remove possible fluorescent contribution from dimer-primers (38). Western blot analysis. T/C-28a2 cells, from vehicle control, PGE2-, or forskolin-treated samples, were washed twice with ice-cold D-PBS (lacking Ca2⫹/Mg2⫹) and lysed in 500 ␮l extraction buffer containing 0.125 M Tris·HCl (pH 6.8), 4% SDS, 20% glycerin, 2.5% mercaptoethanol, and 0.1% bromophenol blue (BPB) as a tracking dye. The protein samples were boiled for 5 min at 100°C. Aliquots of total cell lysates were subjected to SDSPAGE, transferred onto a nitrocellulose membrane, and probed with a panel of specific antibodies. Each membrane was only probed using one antibody. ␤-Actin was used as loading control. All Western hybridizations were performed at least in triplicate by using a different cell preparation each time.

Fig. 1. Dose-dependent induction of interleukin (IL)-6 mRNA synthesis by prostaglandin (PG)E2 or forskolin in human chondrocytes. T/C-28a2 chondrocytes (A, B) or human primary articular chondrocytes (C, D) were treated with the indicated concentrations of either PGE2 (A, C) or forskolin (B, D) for 1 h. IL-6 mRNA expression was determined by quantitative RT-PCR. GAPDH served as internal control. Data are means ⫾ SE of three independent experiments, except for the experiments performed using human primary chondrocytes (n ⫽ 1). *P ⬍ 0.05 with respect to no treatment (vehicle) control.

AJP-Cell Physiol • VOL

298 • JUNE 2010 •

www.ajpcell.org


Preparation of nuclear extract. Nuclear extracts were isolated using the NE-PER nuclear extraction kit (Pierce) following the manufacturer’s instructions as previously described (15). Electrophoretic mobility shift assay and supershift assay. A 5=biotinylated oligonucleotide probe (5=-GGGATTTTCC-3=) was synthesized containing the NF-␬B cis-element present on the IL-6 promoter. Electrophoretic mobility shift assay (EMSAs) were carried out with a commercially available nonradioisotopic EMSA kit (LightShift Chemiluminescence EMSA kit; Pierce). Briefly, nuclear extracts (1–2 ␮g) were incubated in 10⫻ binding buffer [supplemented with 50 ng poly(dI-dC), 2.5% glycerol, 0.05% Nonidet P-40, 5 mM MgCl2, and 0.25 ␮g BSA], containing 20 fmol biotinylated, double-stranded probe for NF-␬B for 30 min on ice. For competition binding, a 200-fold excess of unlabeled (cold) probe was incubated with nuclear extracts before the inclusion of the biotinylated one. For supershift assays, the nuclear extracts were preincubated for 30 min on ice with an anti-p65 antibody. The biotinylated oligonucleotide probe specific

C1447

for NF-␬B was then added to the reaction mixture and incubated for another 30 min on ice. The protein-DNA complexes were resolved on a native 6% polyacrylamide retardation gel in 0.5⫻ Tris-borateEDTA running buffer at 10 mA for 1 h, transferred to a nylon membrane (Pierce), visualized using the LightShift Chemiluminescence kit (Pierce), and exposed to Kodak X-ray film (Pierce). ChIP assay. This assay was performed by using the EZ ChIP kit following the manufacturer’s instructions (Upstate Biotechnology). Cross-linked chromatin was immunoprecipitated using an anti-p65 antibody (Santa Cruz, CA). In immunoprecipitation assays, the antiRNA polymerase II (clone CTD4H8; Upstate Biotechnology) antibody was used as positive control, whereas the normal mouse IgG (Upstate Biotechnology) and anti-TLR4 (Santa Cruz) antibodies were used as negative controls. DNA purified from both the immunoprecipitated and primmune (pre) specimens was subjected to PCR amplification using the following primers for the p65 and GAPDH (control) promoter genes: p65, F-CTAGTTGTGTCTTGCCATGC,

Fig. 2. Time-dependent increases of IL-6 mRNA and protein synthesis and cAMP production induced by PGE2 or forskolin in human chondrocytes. T/C-28a2 chondrocytes or human primary articular chondrocytes (D, H) were treated with either PGE2 (10 ␮M) (A–D) or forskolin (20 ␮M) (E–H) for the indicated time intervals. IL-6 mRNA expression was determined by qRT-PCR (A, D, E, H). GAPDH served as internal control. IL-6 protein expression levels were determined by Western blotting using an anti-IL-6 mAb (B, F). ␤-Actin was used as loading control. cAMP formation was monitored by a cAMP enzyme immunoassay kit (C, G). Data are means ⫾ SE of three independent experiments, except for the experiments performed using human primary chondrocytes (n ⫽ 1). *P ⬍ 0.05 with respect to no treatment (vehicle) control.


298 • JUNE 2010 •

www.ajpcell.org

C1448


R-CAGAATGAGCCTCAGACATC; and GAPDH (Upstate Biotechnology), F-TACTAGCGGTTTTACGGGCG, R-TCGAACAGGAGGAGCAGAGAGCGA. Measurement of intracellular cAMP concentration. cAMP levels were determined by cAMP enzyme immunoassay kit following the manufacturer’s instructions (Cayman Chemical). The protein concentration of total cell lysate was used as loading control, and the results were expressed as picomoles of cAMP per microgram of total protein. Statistics. Data are means ⫾ SE of at least three independent experiments. Statistical significance of differences between means was determined by Student’s t-test or one-way ANOVA, wherever appropriate. If means were shown to be significantly different, multiple comparisons by pairs were performed by the Tukey test (19). RESULTS

PGE2 induces IL-6 expression in human chondrocytes. Elevated levels of PGE2 (37) and IL-6 (17) have been detected in synovial fluid from patients with RA. PGE2 stimulates IL-6 expression and secretion in diverse cells such as macrophages (25), synovial fibroblasts (18), osteoblasts (34), and chondrocytes (21, 35). However, the signaling pathway of IL-6 induction in human chondrocytes stimulated with PGE2 remains unknown. In this study, we aimed to delineate the mechanism by which PGE2 induces IL-6 expression in human chondrocytes. The human T/C-28a2 chondrocyte cell line was chosen as a model system, since T/C-28a2 cells have been shown to behave much like primary human chondrocytes when cultured under appropriate conditions (10, 20). As a first step, we evaluated the effect of exogenously added PGE2 on IL-6 mRNA and protein expression. Our data reveal that PGE2

induced IL-6 mRNA synthesis in a dose- and time-dependent manner (Fig. 1A and 2A). Maximal IL-6 mRNA levels were achieved after stimulation of human T/C-28a2 chondrocytes with 10 ␮M of exogenous PGE2 (Fig. 1A). The mRNA and protein levels of IL-6 were upregulated within 10 –30 min of PGE2 (10 ␮M) stimulation and reached a peak at 60 min before returning to basal levels at the 6-h time point (Fig. 2, A and B). It is well established that PGE2 can stimulate cAMP production by binding to Gs-linked receptors coupled to adenylate cyclase. Indeed, treatment of T/C-28a2 chondrocytes with PGE2 (10 ␮M) induced maximal cAMP formation within 10 min of stimulation, which gradually decreased to baseline levels at 3– 6 h (Fig. 2C). It is noteworthy that PGE2-induced cAMP production preceded IL-6 mRNA synthesis. From this observation, we examined whether cAMP mediates the effects of PGE2 on IL-6 induction. Treatment of T/C-28a2 chondrocytes with forskolin (1–20 ␮M), which increases the intracellular levels of cAMP (Fig. 2G) by directly activating adenylyl cyclase, upregulated IL-6 mRNA synthesis in a dose- and time-dependent fashion (Figs. 1B and 2E). Maximal mRNA and protein levels were detected after 60 min of forskolin (20 ␮M) stimulation and returned to background levels at 6 h (Fig. 2, E and F). Collectively, these data suggest the potential involvement of cAMP in PGE2-induced IL-6 mRNA expression in human chondrocytes. To validate previously published observations showing that T/C-28a2 cells represent an appropriate model for the study of chondrocyte function in vitro (10, 20), we examined the responses of human primary articular chondrocytes to exogenously added PGE2 and forskolin. Our data indicate that exogenous PGE2 and forskolin induce IL-6

Fig. 3. PGE2 and forskolin induce phosphorylation of Akt and cAMP responsive element binding protein (CREB) in human T/C-28a2 chondrocytes. T/C2– 8a2 chondrocytes were treated with either PGE2 (10 ␮M) (A) or forskolin (20 ␮M) (B) for the indicated periods of time. Phosphorylated Akt (Ser473), total Akt, phosphorylated CREB (Ser133) and total CREB levels are shown by immunoblotting using specific Abs. Equal loading in each lane is shown by the similar intensities of total Akt, total CREB and ␤-actin. Immunoblots are representative of three independent experiments, all revealing similar results. The intensity of bands was quantified relative to ␤-actin for each treatment using the Bio-Rad gel image system and then normalized with respect to the value obtained for the untreated control. Data are means ⫾ SE of three independent experiments. *P ⬍ 0.05 with respect to no treatment control.


298 • JUNE 2010 •

www.ajpcell.org


mRNA synthesis in a dose-dependent manner (Fig. 1, C and D). Most importantly, the temporal induction of IL-6 is qualitatively similar in both human primary and T/C-28a2 chondrocytes stimulated with either exogenous PGE2 or forskolin

C1449

(Fig. 2, D and H). Taken together, these data suggest that T/C-28a2 chondrocytes are appropriate to be used as a model system to elucidate the mechanism of IL-6 induction in PGE2activated human chondrocytes.

Fig. 4. Involvement of PI3K and cAMP/PKA signaling pathways in IL-6 mRNA synthesis and cAMP production induced by PGE2 or forskolin in human T/C28a2 chondrocytes. T/C-28a2 cells were incubated with either PGE2 (10 ␮M) (A, C) or forskolin (20 ␮M) (B, D) for 1 or 2 h in presence of the PI3K inhibitors [LY-294002 (30 ␮M) or wortmannin (10 ␮M)] or the PKA inhibitor H89 (10 ␮M) or the adenylyl cyclase inhibitor SQ-22536 (100 ␮M). IL-6 mRNA synthesis was determined by qRT-PCR (A, B). GAPDH served as internal control. cAMP formation was analyzed by a cAMP enzyme immunoassay kit (C, D). Data are means ⫾ SE of three independent experiments. *P ⬍ 0.05 with respect to all pharmacological treatments and no treatment (vehicle) control. E: Western blots showing the effects of the phosphatidylinositol 3 kinase (PI3K) inhibitors (LY-294002; wortmannin), PKA inhibitor H89, or the adenylyl cyclase inhibitor SQ-22536 on PGE2- and forskolinmediated phosphorylation of Akt (Ser473) and CREB (Ser133) using specific antibodies (Abs). Equal loading in each lane is shown by the similar intensities of Akt, CREB, and ␤-actin. The immunoblots shown are representative of three independent experiments with similar results. The intensity of bands was quantified relative to ␤-actin for each treatment using the Bio-Rad gel image system and then normalized with respect to the value obtained for the untreated control. Data are means ⫾ SE of three independent experiments. *P ⬍ 0.05 with respect to no treatment control.


298 • JUNE 2010 •

www.ajpcell.org

C1450


PGE2 induces IL-6 expression in chondrocytes via a cAMP/ PKA- and PI3K-dependent pathway. We next aimed to elucidate the signaling cascade of IL-6 mRNA synthesis in PGE2activated human chondrocytes. From observations showing that PGE2 stimulates cAMP formation (Fig. 2C), we examined the potential contribution of downstream effectors of cAMP to this process, which include PI3K and PKA (8). As a first step, we demonstrated that exogenously added PGE2 (10 ␮M) increased the phosphorylation levels of Akt (at Ser473) and CREB (at Ser133) in a time-dependent manner (Fig. 3A), which was similar to that of the induction of IL-6 mRNA synthesis (Fig. 2A), without affecting total Akt and CREB levels. Similar data were obtained using forskolin-stimulated chondrocytes (Fig. 3B). Treatment of T/C-28a2 cells with the selective PI3K inhibitors LY-294002 (30 ␮M) or wortmannin (10 ␮M), blocked PGE2-induced IL-6 mRNA synthesis (Fig. 4A). These pharmacological inhibitors abolished the phosphorylation of Akt at Ser473 without altering total Akt levels (Fig. 4E). Incubation of T/C-28a2 chondrocytes, with either the specific PKA inhibitor H89 (10 ␮M) or the cell-permeable adenylate cyclase inhibitor SQ-22536 (100 ␮M), also abrogated the induction of IL-6 mRNA expression in response to PGE2 stimulation (Fig. 4A). These pharmacological interventions were also effective in suppressing CREB phosphorylation at Ser133, while they tended to modestly increase Akt phosphorylation at Ser473 (Fig. 4E), which is in concert with a potential cross-talk between PI3K and PKA/cAMP (8). SQ-22536 was also capable of inhibiting cAMP formation in PGE2-stimulated chondrocytes (Fig. 4C). Taken together, these data demonstrate that PGE2 induces IL-6 mRNA synthesis in human chondrocytes via cAMP/PKA- and PI3K/Akt-dependent pathways. Similar observations were made using forskolin-stimulated chondrocytes (Fig. 4, B, D, and E). It is noteworthy that incubation of T/C-28a2 chondrocytes with both the PI3K inhibitor LY-294002 and the PKA inhibitor H89 in the presence of either PGE2 or forskolin reduced the IL-6 mRNA expression well below the basal levels of untreated cells (Table 1), thereby suggesting the critical involvement and synergistic roles of cAMP/PKA and PI3K in this process. Although H89 has widely been used as a potent and selective inhibitor of PKA, non-PKA-based actions of H89 have been reported (16). To demonstrate the key role of PKA in the induction of IL-6 expression in PGE2- and forskolin-stimulated Table 1. Effects of PKA and PI3K inhibitors on IL-6 mRNA synthesis in human T/C-28a2 chondrocytes stimulated with PGE2 or forskolin IL-6 mRNA Synthesis

PGE2 Forskolin

Vehicle

LY-294002

H89

LY-294002 ⫹ H89

5.8 ⫾ 1.1* 4.3 ⫾ 0.5*

1.3 ⫾ 0.1 1.7 ⫾ 0.2

1.0 ⫾ 0.1 1.1 ⫾ 0.1

0.3 ⫾ 0.2† 0.3 ⫾ 0.2†

T/C-28a2 cells were incubated with either prostaglandin E2 (PGE2, 10 ␮M) or forskolin (20 ␮M) for 1 h in the presence of the phosphoinositol 3 kinase (PI3K) inhibitor LY-294002 (30 ␮M) or the protein kinase A (PKA) inhibitor H89 (10 ␮M). IL-6 mRNA synthesis was determined by quantitative real-time PCR. GAPDH served as internal control. Data are normalized with respect to untreated (no PGE2 or forskolin) vehicle control and are means ⫾ SE of 3 independent experiments. *P ⬍ 0.05 with respect to vehicle control and all pharmacological treatments. †P ⬍ 0.05 with respect to LY294002 and H89 individual treatments. AJP-Cell Physiol • VOL

Fig. 5. PKA C-␣ knockdown inhibits PGE2- and forskolin- induced IL-6 mRNA synthesis in human chondrocytes. T/C-28a2 chondrocytes were transfected with an small interfering RNA (siRNA) oligonucleotide sequence specific for PKA C-␣ before being treated with either PGE2 (10 ␮M) or forskolin (20 ␮M) for 1 or 2 h. PKA C-␣ (middle) and IL-6 mRNA (bottom) expressions were determined by quantitative RT-PCR. GAPDH was served as internal control. Data are means ⫾ SE of three independent experiments. *P ⬍ 0.05 with respect to no treatment control.

chondrocytes, experiments were carried out by transfecting T/C-28a2 cells with an siRNA oligonucleotide sequence specific for PKA C-␣. This genetic intervention effectively knocked down PKA C-␣ mRNA expression and markedly inhibited IL-6 mRNA synthesis in PGE2- and forskolin-stimulated chondrocytes (Fig. 5), thereby illustrating the critical involvement of PKA in IL-6 induction. It was recently reported that forskolin mediates cellular proliferation in macrophages via cAMP-dependent activation of both PKA and Epac, which in turn activate Akt1 (27). To delineate the potential contribution of Epac to the IL-6 mRNA synthesis in chondrocytes, experiments were performed by treating T/C-28a2 cells with the Epac-selective cAMP analog CPT. As shown in Fig. 6, CPT failed to alter the mRNA levels of all Akt isoforms as well as the phosphorylated and total Akt levels in T/C-28a2 chondrocytes. Morever, this treatment had no effect on IL-6 mRNA expression, thereby suggesting the lack of Epac involvement in this process. p65, but not CREB, is involved in PGE2-induced IL-6 mRNA synthesis. We next aimed to identify the key transcription factor(s) responsible for IL-6 mRNA induction in PGE2-activated chondrocytes. The promoter of the IL-6 gene contains

298 • JUNE 2010 •

www.ajpcell.org


C1451

Fig. 6. The Epac-selective cAMP analog 8-(4chlorophenylthio)-2=-O-methyladenosine-3=,5=-cyclic monophosphate (8-pCPT-2=-O-Me-cAMP·Na) does not induce IL-6 expression in human chondrocytes. T/C-28a2 chondrocytes were treated with 8-pCPT2=-O-Me-cAMP·Na (10 ␮M) for indicated time intervals (A, C). Alternatively, cells were treated with the indicated concentrations of 8-pCPT-2=-O-MecAMP·Na for 1 h (B, D). Akt1, Akt2, Akt3, and IL-6 mRNA levels were determined by qRT-PCR (A, B). GAPDH served as internal control (A, B). Phosphorylated Akt and total Akt protein levels were monitored by immunoblotting using specific Abs. ␤-actin was used as loading control. The immunoblots are representative of three independent experiments, all revealing similar results.

several consensus sequences, including those for CREB, NF␬B, AP-1, and NF-IL-6, which have been implicated in the induction of IL-6 in other cell types (7, 12, 32). From the increased CREB phosphorylation in PGE2- and forskolinstimulated chondrocytes (Fig. 3), we examined the potential roles of CREB1 and CREB2 (also called ATF4) in IL-6 induction using T/C-28a2 chondrocytes transfected with either an siRNA oligonucleotide sequence specific for CREB1 or ATF4, or control siRNA. The efficacy of CREB1 and ATF4 knockdown was demonstrated at the transcriptional level (Fig. 7), whereas the control siRNA did not impair the mRNA expression levels of CREB1 and ATF4 (Fig. 7). Knockdown of both CREB1 and ATF4 failed to alter the induction of IL-6 in PGE2and forskolin-stimulated human chondrocytes, thereby suggesting the lack of their functional involvement in this process. The potential contribution of NF-␬B to IL-6 mRNA synthesis in human chondrocytes stimulated with either PGE2 or forskolin was first evaluated by gel shift and supershift assays. As shown in Fig. 8A, incubation of the biotinylated NF-␬B probe with nuclear extracts from PGE2-stimulated versus untreated T/C-28a2 cells progressively increased the formation of the NF-␬B-specific DNA-protein complex, reaching maximal levels after 60 min of stimulation before declining back to baseline levels at 6 h. Treatment of T/C-28a2 chondrocytes with either the PI3K inhibitors LY-294002 or wortmannin, or the PKA inhibitor H89, or the adenylate cyclase inhibitor SQ-22536 significantly suppressed the formation of the NF␬B-specific DNA-protein complex (Fig. 8C), thereby suggesting the involvement of cAMP/PKA and PI3K in the NF-␬B activation. Similar data were obtained by using forskolinstimulated T/C-28a2 cells (Fig. 8, B and D). Incubating nuclear extracts from PGE2-stimulated T/C-28a2 cells with an anti-p65 antibody before the addition of the biotinylated NF-␬B probe led to a marked supershift of the complex while attenuating the NF-␬B-specific DNA-protein complex formation (Fig. 8E). AJP-Cell Physiol • VOL

Treatment of T/C-28a2 cells with the PI3K inhibitors LY294002 or wortmannin, or the PKA inhibitor H89, or the adenylate cyclase inhibitor SQ-22536 suppressed the PGE2induced NF-␬B activation down to near basal levels (Fig. 8E). Similar observations were made by using forskolin-stimulated T/C-28a2 cells (Fig. 8F). No supershift was detected when nuclear extracts from PGE2- or forskolin-activated chondrocytes were incubated with an anti-CREB antibody (data not shown). ChIP assays also revealed that the binding of p65 to the IL-6 promoter is significantly increased in PGE2- and forskolin-stimulated T/C-28a2 chondrocytes relative to untreated control cells (Fig. 8, G and H). Cumulatively, these data suggest that PGE2 and forskolin regulate IL-6 mRNA synthesis via a cAMP/PKA and PI3K-dependent p65 binding to the IL-6 promoter. To confirm the functional role of NF-␬B in the induction of IL-6 mRNA expression in human chondrocytes stimulated with either PGE2 or forskolin, T/C-28a2 cells were treated with the NF-␬B inhibitor QNZ (10 ␮M), which has been reported to inhibit the NF-kB transcriptional activation (36). This pharmacological intervention markedly suppressed PGE2- and forskolin-induced IL-6 mRNA synthesis (Fig. 9, A and B). Moreover, it inhibited significantly the formation of the NF-␬B-specific DNA-protein complex (Fig. 9C) as well as the supershift of the complex (Fig. 9D). To demonstrate the critical role of the NF-␬B p65 subunit in the regulation of IL-6 expression in PGE2- and forskolin-stimulated chondrocytes, experiments were carried out by using T/C-28a2 cells transfected with either an siRNA oligonucleotide sequence specific for p65 or control siRNA. The efficacy of p65 knockdown was demonstrated at the transcript level for PGE2- and forskolin-stimulated T/C-28a2 chondrocytes (Fig. 10A). This genetic intervention completely blocked the IL-6 mRNA upregulation in activated chondrocytes (Fig. 10A). In contrast, the scramble control siRNA had no effect. p65 knockdown effectively

298 • JUNE 2010 •

www.ajpcell.org

C1452


Fig. 7. CREB1 and ATF4 are not involved in PGE2- and forskolin-induced IL-6 synthesis in human T/C-28a2 chondrocytes. T/C-28a2 cells were transfected with an siRNA oligonucleotide sequence specific for CREB1 or ATF4, or a control siRNA, before being treated with forskolin (20 ␮M) for the indicated periods of time. IL-6, CREB1, and ATF4 mRNA levels were determined by qRT-PCR. GAPDH served as internal control. Data are means ⫾ SE of three independent experiments. *P ⬍ 0.05 with respect to controls.

inhibited the formation of the NF-␬B-specific DNA-protein complex (Fig. 10B) and the supershift of the complex (Fig. 10C). Taken together, this study reveals that PGE2, an activator of the cAMP signaling pathway, and forskolin, an activator of adenylyl cyclase, induce IL-6 expression in human chondrocytes via a cAMP/PKA- and PI3K/Akt-dependent pathways, which in turn regulate the activation and binding of the NF-␬B p65 subunit to the IL-6 promoter (Fig. 11). DISCUSSION

The synovial fluid of RA patients relative to normal controls contains upregulated levels of several soluble mediators including PGE2 and IL-6, which contribute to the systemic inflammatory manifestations of the disease (17, 31, 37). Although OA is classified as a noninflammatory joint disease, prostaglandins and cytokines, among others, are believed to play a role in the pathogenesis and/or progression of the disease. In vivo studies reveal that OA cartilage spontaneously releases PGE2 at 50-fold higher levels than in normal cartilage (2). Although PGE2 has been reported to induce IL-6 production in human articular chondrocytes (21, 35), the underlying AJP-Cell Physiol • VOL

mechanism of this process has yet to be explored. Here, we demonstrate that PGE2 activates cAMP accumulation, which precedes IL-6 mRNA synthesis. Forskolin, an activator of the adenylyl cyclase, mimics the effects of PGE2 on the induction of IL-6 mRNA synthesis, suggesting the involvement of cAMP as a second messenger in the modulation of PGE2 effects. This finding is in accord with previously published data showing that cAMP analogs such as 8-bromo-cAMP and dibutyl-cAMP resemble the effects of PGE2 on the production of soluble factors including IL-6 by OA fibroblasts (18). The pivotal role of cAMP in PGE2-induced signaling pathway is substantiated by the use of the adenylate cyclase inhibitor SQ-11536, which nearly abrogates IL-6 synthesis in human chondrocytes. The effects of PGE2 are mediated via four different transmembrane receptors, namely EP1, EP2, EP3, and EP4, which are involved in the activation of phospholipase C (EP1) and activation (EP2, EP4) or inhibition (EP3) of adenyl cyclase (33). T/C-28a2 chondrocytes express EP2, EP3 and very low levels of EP4, but lack EP1, receptors (data not shown). This expression pattern is in good agreement with previously published data showing that human and mouse articular chondrocytes express EP2 and EP3 but not EP1 or EP4 (4). From the pivotal role of cAMP as a second messenger in the modulation of PGE2 effects and the low expression levels of EP4 relative to EP2/EP3 in human T/C-28a2 chondrocytes, we speculate that PGE2-induced IL-6 mRNA synthesis primarily proceeds via the activation of EP2- and/or inhibition of EP3-dependent signaling pathways, without ruling out a role for EP4 receptor. It was recently reported that the EP2 receptor is predominantly responsible for the anti-anabolic effects of PGE2 in human adult articular chondrocytes (21), as defined by the decreased aggrecan synthesis and proteoglycan accumulation. Li et al. (21) also showed that PGE2 does not alter the expression of representative cartilage-degrading such as matrix metalloproteinase-13 (MMP-13) and aggrecanase 5 (ADAMTS-5). However, their findings are in contrast to those reported by Attur et al. (5), which suggest that PGE2 mediates proteoglycan degradation and upregulation of MMP-13 and ADAMTS-5 in human OA chondrocytes via an EP4-dependent/EP2-independent signaling pathway. The potential involvement of both EP2 and EP4 receptors has been suggested in peptidoglycan-induced IL-6 production in RAW 264.7 macrophages, which has an absolute requirement for cAMP (7). Nevertheless, all these aforementioned results regarding the involvement of distinct EP receptors need to be interpreted with caution, since they were generated using nonselective pharmacological antagonists. For instance, AH-23848, which was used at two different concentrations in Refs. 5 and 21, is not only an EP4 but also a thromboxane A2 receptor antagonist (7). Our data reveal that exogenously added PGE2 enhances the activity of the PI3K/Akt and PKA/CREB pathways in human T/C-28a2 chondrocytes, as evidenced by increased levels of Akt phosphorylation at Ser473 and CREB phosphorylation at Ser133. Treatment of T/C-28a2 chondrocytes with the PI3K inhibitors LY-294002 and wortmannin abrogates the PGE2induced Akt phosphorylation without affecting total Akt levels. Use of the PKA inhibitor H89 nearly abolishes CREB phosphorylation without altering total CREB levels. Furthermore, this pharmacological intervention tended to modestly enhance Akt phosphorylation, suggesting a possible cross-talk between

298 • JUNE 2010 •

www.ajpcell.org


C1453

Fig. 8. PGE2 and forskolin induce NF-␬B activation in human T/C28a2 chondrocytes via cAMP/PKA and PI3K signaling pathways. T/C-28a2 cells were treated with PGE2 (10 ␮M) (A) or forskolin (20 ␮M) (B) for the indicated time intervals. Nuclear extracts were then isolated, and NF-␬B-specific DNA-protein complex formation was determined by EMSA. T/C-28a2 chondrocytes were treated for 2 h with either PGE2 (C, E, G, H) or forskolin (D, F, G, H) in the presence or absence of the PI3K inhibitors [LY-294002 (30 ␮M) or wortmannin (10 ␮M)], the PKA inhibitor H89 (10 ␮M), or the adenylyl cyclase inhibitor SQ-22536 (100 ␮M). Nuclear extracts were prepared for the determination of NF-␬B-specific DNA-protein complex formation by EMSA (C, D). Supershift (E, F) assays using an anti-p65 Ab were carried out as outlined in MATERIALS AND METHODS. Results of a competition experiment using 50-fold unlabeled NF-␬B oligonucleotide (cold probe) are shown. Cross-linked chromatin was immunoprecipitated using an anti-p65 antibody (G, H). In ChIP assays, the anti-RNA polymerase II antibody was used as positive control, whereas the normal mouse IgG and anti-TLR4 antibodies were used as negative controls. DNA purified from both the immunoprecipitated (IP) and preimmune (input) specimens was subjected to PCR amplification using primers for the GAPDH (control) and p65 promoter genes. All experiments are representative of three independent experiments, all revealing similar results.


298 • JUNE 2010 •

www.ajpcell.org

C1454


Fig. 9. Effect of NF-␬B inhibition on IL-6 mRNA synthesis in human T/C-28a2 chondrocytes stimulated with PGE2 or forskolin. T/C-28a2 chondrocytes were treated with either PGE2 (10 ␮M) or forskolin (20 ␮M) for 2 h in the presence of an NF-␬B-specific inhibitor QNZ (10 ␮M). IL-6 mRNA expression was determined by qRTPCR (A, B). GAPDH served as internal control. Data are means ⫾ SE of three independent experiments. *P ⬍ 0.05 with respect to QNZ treatment and no treatment control. Gel-shift (C) and super-shift (D) experiments using an anti-p65 Ab were carried out as described in MATERIALS AND METHODS. These experiments are representative of three independent experiments, all revealing similar results.

Fig. 10. Effect of p65 knockdown on IL-6 and p65 mRNA synthesis in human T/C-28a2 chondrocytes stimulated with PGE2 or forskolin. T/C-28a2 chondrocytes were transfected with an siRNA oligonucleotide sequence specific for p65 or an siRNA control before being treated with either PGE2 (10 ␮M) or forskolin (20 ␮M) for 1 or 2 h. IL-6 and p65 mRNA expression was determined by quantitative RT-PCR (A). GAPDH served as internal control. Data are means ⫾ SE of three independent experiments. *P ⬍ 0.05 with respect to p65 knockdown and controls. Gel-shift (B) and super-shift (C) experiments using an anti-p65 Ab were carried out as described in MATERIALS AND METHODS. These experiments are representative of three independent experiments, all revealing similar results.


298 • JUNE 2010 •

www.ajpcell.org


Fig. 11. Proposed cascade of signaling events in human T/C-28a2 chondrocytes stimulated with PGE2 or forskolin. PGE2 stimulates cAMP formation, which in turn upregulates PI3K/Akt and PKA activities, leading to NF-␬B activation. Binding of NF-␬B to IL-6 promoter induces IL-6 synthesis in human T/C28a2 chondrocytes.

PI3K/Akt and PKA. Incubation of T/C-28a2 chondrocytes with either PI3K or PKA inhibitors effectively eliminated PGE2induced IL-6 mRNA expression. The key role of PKA in the induction of IL-6 mRNA synthesis in human chondrocytes stimulated with exogenously added PGE2 or forskolin was validated by using PKA-C␣ siRNA. Use of the Epac-selective cAMP analog CPT failed to induce IL-6 mRNA expression in human chondrocytes. Taken together, our data are in agreement with prior work suggesting the involvement of PKA in peptidoglycan-induced IL-6 production in RAW264.7 macrophages (7) and in PGE2-induced IL-6 secretion in fetal rat osteoblasts (26). Similarly, it was recently reported that PI3K/ Akt partially regulates IL-6 production in microglia stimulated with stromal cell-derived factor-1 (23), whereas blockade of the PI3K signaling pathway nearly abrogates PGE2-induced IL-6 synthesis in human chondrocytes. Interestingly, simultaneous blockade of PI3K and PKA pathways suppresses IL-6 mRNA expression in PGE2-primed T/C-28a2 chondrocytes well below the basal levels of untreated cells, thereby illustrating the synergistic roles of PI3K and PKA in the regulation of IL-6 synthesis in human chondrocytes. The promoter of the human IL-6 gene contains several consensus sequences, including those for CREB and NF-␬B, which have been implicated in the induction of IL-6 in other cell types (7, 12). Even though PGE2 increases CREB phosphorylation in human chondrocytes, knockdown of both CREB1 and CREB2 (or ATF4) failed to attenuate the induction of IL-6 synthesis, suggesting the lack of their functional involvement in this process. Gel shift, supershift, and chromatin immunoprecipitation assays reveal the activation and binding of the NF-␬B p65 subunit to the IL-6 promoter, which is markedly suppressed by selective PI3K or PKA pharmacological inhibitors. Taken together, these data suggest that PGE2 regulates IL-6 synthesis via a cAMP/PKA and PI3K-dependent p65 binding to the IL-6 promoter. Our findings are in concert with prior studies that have implicated NF-␬B activation in the regulation of IL-6 expression induced by different inflammatory mediators in distinct cell types (7, 12, 32). Through the use AJP-Cell Physiol • VOL

C1455

of RNA interference (RNAi), we here demonstrate for the first time the functional role of the NF-␬B p65 subunit in PGE2induced IL-6 mRNA synthesis in human T/C-28a2 chondrocytes. The biological actions of PGE2 in articular cartilage appear to be controversial. For instance, PGE2 has been reported to exert chondroprotective effects in resting zone rat chondrocytes (28) and human synovial fibroblasts (9), as evidenced by its ability to inhibit IL-1␤-induced MMP expression. In contrast, other studies suggest that PGE2, at nano- to micromolar concentrations produced by arthritic tissues (2, 3), elicits catabolic effects that perturb cartilage homeostasis. Increased PGE2 production causes cartilage resorption by suppressing the production of proteoglycans, stimulating the degradation of extracellular matrix and potentiating the effects of other inflammatory mediators (5, 13, 24, 30). Our data suggest that micromolar concentrations of PGE2 induce IL-6 expression in human chondrocytes, which may be critical to the IL-6-dependent pain symptoms associated with RA and OA in human joints. In summary, we have shown that PGE2 as well as the adenylyl cyclase activator forskolin induce IL-6 synthesis in human chondrocytes via cAMP/PKA and PI3K-dependent pathways. cAMP/PKA and PI3K in turn regulate the activation and binding of the NF-␬B p65 subunit to the IL-6 promoter, which is responsible for PGE2-induced IL-6 expression. Understanding the signal transduction pathway of PGE2-induced IL-6 synthesis in human chondrocytes will enable us to design therapeutic strategies to reduce inflammation and pain in arthritic patients. GRANTS This work was supported, in whole or in part, by the National Institutes of Health National Institute of Arthritis and Musculoskeletal and Skin Diseases Grant RO1 AR053358. DISCLOSURES No conflicts of interest are declared by the author(s). REFERENCES 1. Abulencia JP, Gaspard R, Healy ZR, Gaarde WA, Quackenbush J, Konstantopoulos K. Shear-induced cyclooxygenase-2 via a JNK2/c-Jundependent pathway regulates prostaglandin receptor expression in chondrocytic cells. J Biol Chem 278: 28388 –28394, 2003. 2. Amin AR, Attur M, Patel RN, Thakker GD, Marshall PJ, Rediske J, Stuchin SA, Patel IR, Abramson SB. Superinduction of cyclooxygenase-2 activity in human osteoarthritis-affected cartilage. Influence of nitric oxide. J Clin Invest 99: 1231–1237, 1997. 3. Anderson GD, Hauser SD, McGarity KL, Bremer ME, Isakson PC, Gregory SA. Selective inhibition of cyclooxygenase (COX)-2 reverses inflammation and expression of COX-2 and interleukin 6 in rat adjuvant arthritis. J Clin Invest 97: 2672–2679, 1996. 4. Aoyama T, Liang B, Okamoto T, Matsusaki T, Nishijo K, Ishibe T, Yasura K, Nagayama S, Nakayama T, Nakamura T, Toguchida J. PGE2 signal through EP2 promotes the growth of articular chondrocytes. J Bone Miner Res 20: 377–389, 2005. 5. Attur M, Al-Mussawir HE, Patel J, Kitay A, Dave M, Palmer G, Pillinger MH, Abramson SB. Prostaglandin E2 exerts catabolic effects in osteoarthritis cartilage: evidence for signaling via the EP4 receptor. J Immunol 181: 5082–5088, 2008. 6. Blom MA, van Twillert MG, de Vries SC, Engels F, Finch CE, Veerhuis R, Eikelenboom P. NSAIDS inhibit the IL-1 beta-induced IL-6 release from human post-mortem astrocytes: the involvement of prostaglandin E2. Brain Res 777: 210 –218, 1997. 7. Chen BC, Liao CC, Hsu MJ, Liao YT, Lin CC, Sheu JR, Lin CH. Peptidoglycan-induced IL-6 production in RAW 264.7 macrophages is

298 • JUNE 2010 •

www.ajpcell.org

C1456

8. 9.

10.

11.

12. 13.

14.

15.

16. 17.

18.

19.

20.

21.

22.


mediated by cyclooxygenase-2, PGE2/PGE4 receptors, protein kinase A, I kappa B kinase, and NF-kappa B. J Immunol 177: 681–693, 2006. Ciullo I, Diez-Roux G, Di Domenico M, Migliaccio A, Avvedimento EV. cAMP signaling selectively influences Ras effectors pathways. Oncogene 20: 1186 –1192, 2001. DiBattista JA, Martel-Pelletier J, Fujimoto N, Obata K, Zafarullah M, Pelletier JP. Prostaglandins E2 and E1 inhibit cytokine-induced metalloprotease expression in human synovial fibroblasts. Mediation by cyclic-AMP signalling pathway. Lab Invest 71: 270 –278, 1994. Goldring MB, Birkhead JR, Suen LF, Yamin R, Mizuno S, Glowacki J, Arbiser JL, Apperley JF. Interleukin-1 beta-modulated gene expression in immortalized human chondrocytes. J Clin Invest 94: 2307–2316, 1994. Goss JA, Mangino MJ, Callery MP, Flye MW. Prostaglandin E2 downregulates Kupffer cell production of IL-1 and IL-6 during hepatic regeneration. Am J Physiol Gastrointest Liver Physiol 264: G601–G608, 1993. Grassl C, Luckow B, Schlondorff D, Dendorfer U. Transcriptional regulation of the interleukin-6 gene in mesangial cells. J Am Soc Nephrol 10: 1466 –1477, 1999. Hardy MM, Seibert K, Manning PT, Currie MG, Woerner BM, Edwards D, Koki A, Tripp CS. Cyclooxygenase 2-dependent prostaglandin E2 modulates cartilage proteoglycan degradation in human osteoarthritis explants. Arthritis Rheum 46: 1789 –1803, 2002. Healy ZR, Lee NH, Gao X, Goldring MB, Talalay P, Kensler TW, Konstantopoulos K. Divergent responses of chondrocytes and endothelial cells to shear stress: cross-talk among COX-2, the phase 2 response, and apoptosis. Proc Natl Acad Sci USA 102: 14010 –14015, 2005. Healy ZR, Zhu F, Stull JD, Konstantopoulos K. Elucidation of the signaling network of COX-2 induction in sheared chondrocytes: COX-2 is induced via a Rac/MEKK1/MKK7/JNK2/c-Jun-C/EBP␤-dependent pathway. Am J Physiol Cell Physiol 294: C1146 –C1157, 2008. Hidaka H, Kobayashi R. Pharmacology of protein kinase inhibitors. Annu Rev Pharmacol Toxicol 32: 377–397, 1992. Houssiau FA, Devogelaer JP, Van Damme J, de Deuxchaisnes CN, Van Snick J. Interleukin-6 in synovial fluid and serum of patients with rheumatoid arthritis and other inflammatory arthritides. Arthritis Rheum 31: 784 –788, 1988. Inoue H, Takamori M, Shimoyama Y, Ishibashi H, Yamamoto S, Koshihara Y. Regulation by PGE2 of the production of interleukin-6, macrophage colony stimulating factor, and vascular endothelial growth factor in human synovial fibroblasts. Br J Pharmacol 136: 287–295, 2002. Kamat SG, Turner NA, Konstantopoulos K, Hellums JD, McIntire LV, Kleiman NS, Moake JL. Effects of Integrelin on platelet function in flow models of arterial thrombosis. J Cardiovasc Pharmacol 29: 156 –163, 1997. Kokenyesi R, Tan L, Robbins JR, Goldring MB. Proteoglycan production by immortalized human chondrocyte cell lines cultured under conditions that promote expression of the differentiated phenotype. Arch Biochem Biophys 383: 79 –90, 2000. Li X, Ellman M, Muddasani P, Wang JH, Cs-Szabo G, van Wijnen AJ, Im HJ. Prostaglandin E2 and its cognate EP receptors control human adult articular cartilage homeostasis and are linked to the pathophysiology of osteoarthritis. Arthritis Rheum 60: 513–523, 2009. Lowe GN, Fu YH, McDougall S, Polendo R, Williams A, Benya PD, Hahn TJ. Effects of prostaglandins on deoxyribonucleic acid and aggrecan synthesis in the RCJ 3.1C518 chondrocyte cell line: role of second messengers. Endocrinology 137: 2208 –2216, 1996.


23. Lu DY, Tang CH, Yeh WL, Wong KL, Lin CP, Chen YH, Lai CH, Chen YF, Leung YM, Fu WM. SDF-1alpha up-regulates interleukin-6 through CXCR4, PI3K/Akt, ERK, and NF-kappaB-dependent pathway in microglia. Eur J Pharmacol 613: 146 –154, 2009. 24. Martel-Pelletier J, Pelletier JP, Fahmi H. Cyclooxygenase-2 and prostaglandins in articular tissues. Semin Arthritis Rheum 33: 155–167, 2003. 25. McCoy JM, Wicks JR, Audoly LP. The role of prostaglandin E2 receptors in the pathogenesis of rheumatoid arthritis. J Clin Invest 110: 651–658, 2002. 26. Millet I, McCarthy TL, Vignery A. Regulation of interleukin-6 production by prostaglandin E2 in fetal rat osteoblasts: role of protein kinase A signaling pathway. J Bone Miner Res 13: 1092–1100, 1998. 27. Misra UK, Pizzo SV. Upregulation of AKT1 protein expression in forskolin-stimulated macrophage: evidence from ChIP analysis that CREB binds to and activates the AKT1 promoter. J Cell Biochem 100: 1022– 1033, 2007. 28. Miyamoto M, Ito H, Mukai S, Kobayashi T, Yamamoto H, Kobayashi M, Maruyama T, Akiyama H, Nakamura T. Simultaneous stimulation of EP2 and EP4 is essential to the effect of prostaglandin E2 in chondrocyte differentiation. Osteoarthritis Cartilage 11: 644 –652, 2003. 29. Noguchi K, Shitashige M, Endo H, Kondo H, Ishikawa I. Binary regulation of interleukin (IL)-6 production by EP1 and EP2/EP4 subtypes of PGE2 receptors in IL-1beta-stimulated human gingival fibroblasts. J Periodontal Res 37: 29 –36, 2002. 30. O’Keefe RJ, Crabb ID, Puzas JE, Rosier RN. Influence of prostaglandins on DNA and matrix synthesis in growth plate chondrocytes. J Bone Miner Res 7: 397–404, 1992. 31. Portanova JP, Zhang Y, Anderson GD, Hauser SD, Masferrer JL, Seibert K, Gregory SA, Isakson PC. Selective neutralization of prostaglandin E2 blocks inflammation, hyperalgesia, and interleukin 6 production in vivo. J Exp Med 184: 883–891, 1996. 32. Skurk T, van Harmelen V, Hauner H. Angiotensin II stimulates the release of interleukin-6 and interleukin-8 from cultured human adipocytes by activation of NF-kappaB. Arterioscler Thromb Vasc Biol 24: 1199 – 1203, 2004. 33. Sugimoto Y, Narumiya S. Prostaglandin E receptors. J Biol Chem 282: 11613–11617, 2007. 34. Takaoka Y, Niwa S, Nagai H. Interleukin-1beta induces interleukin-6 production through the production of prostaglandin E(2) in human osteoblasts, MG-63 cells. J Biochem 126: 553–558, 1999. 35. Tetlow LC, Woolley DE. Histamine and PGE(2) stimulate the production of interleukins -6 and -8 by human articular chondrocytes in vitro. 6 Human and clinical aspects of histamine. Inflamm Res 55, Suppl 1: S73–S74, 2006. 36. Tobe M, Isobe Y, Tomizawa H, Nagasaki T, Takahashi H, Fukazawa T, Hayashi H. Discovery of quinazolines as a novel structural class of potent inhibitors of NF-kappa B activation. Bioorg Med Chem 11: 383– 391, 2003. 37. Trang LE, Granstrom E, Lovgren O. Levels of prostaglandins F2 alpha and E2 and thromboxane B2 in joint fluid in rheumatoid arthritis. Scand J Rheumatol 6: 151–154, 1977. 38. Zhu F, Massana R, Not F, Marie D, Vaulot D. Mapping of picoeucaryotes in marine ecosystems with quantitative PCR of the 18S rRNA gene. FEMS Microbiol Ecol 52: 79 –92, 2005. 39. Zhu F, Wang P, Kontrogianni-Konstantopoulos A, Konstantopoulos K. Prostaglandin (PG)D2 and 15-deoxy-⌬12,14-PGJ2, but not PGE2, mediate shear-induced chondrocyte apoptosis via protein kinase a-dependent regulation of polo-like kinases. Cell Death Differ. In Press.

298 • JUNE 2010 •

www.ajpcell.org