JOURNAL OF BACTERIOLOGY, Aug. 2007, p. 5441–5451 0021-9193/07/$08.00⫹0 doi:10.1128/JB.00543-07 Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Vol. 189, No. 15
Protein Modulator of Multidrug Efflux Gene Expression in Pseudomonas aeruginosa䌤 Denis M. Daigle,2† Lily Cao,1† Sebastien Fraud,1 Mark S. Wilke,3 Angela Pacey,1 Rachael Klinoski,1 Natalie C. Strynadka,3 Charles R. Dean,2 and Keith Poole1* Department of Microbiology and Immunology, Queen’s University, Kingston, Ontario, Canada K7L 3N61; Infectious Diseases, Novartis Institute for Biomedical Research, Inc., 100 Technology Square, Cambridge, Massachusetts 021392; and Department of Biochemistry and Molecular Biology, University of British Columbia, 2146 Health Sciences Mall, Vancouver, British Columbia, Canada V6T 1Z33 Received 10 April 2007/Accepted 21 May 2007
nalC multidrug-resistant mutants of Pseudomonas aeruginosa show enhanced expression of the mexAB-oprM multidrug efflux system as a direct result of the production of a ca. 6,100-Da protein, PA3719, in these mutants. Using a bacterial two-hybrid system, PA3719 was shown to interact in vivo with MexR, a repressor of mexAB-oprM expression. Isothermal titration calorimetry (ITC) studies confirmed a high-affinity interaction (equilibrium dissociation constant [KD], 158.0 ⴞ 18.1 nM) of PA3719 with MexR in vitro. PA3719 binding to and formation of a complex with MexR obviated repressor binding to its operator, which overlaps the efflux operon promoter, suggesting that mexAB-oprM hyperexpression in nalC mutants results from PA3719 modulation of MexR repressor activity. Consistent with this, MexR repression of mexA transcription in an in vitro transcription assay was alleviated by PA3719. Mutations in MexR compromising its interaction with PA3719 in vivo were isolated and shown to be located internally and distributed throughout the protein, suggesting that they impacted PA3719 binding by altering MexR structure or conformation rather than by having residues interacting specifically with PA3719. Four of six mutant MexR proteins studied retained repressor activity even in a nalC strain producing PA3719. Again, this is consistent with a PA3719 interaction with MexR being necessary to obviate MexR repressor activity. The gene encoding PA3719 has thus been renamed armR (antirepressor for MexR). A representative “noninteracting” mutant MexR protein, MexRI104F, was purified, and ITC confirmed that it bound PA3719 with reduced affinity (5.4-fold reduced; KD, 853.2 ⴞ 151.1 nM). Consistent with this, MexRI104F repressor activity, as assessed using the in vitro transcription assay, was only weakly compromised by PA3719. Finally, two mutations (L36P and W45A) in ArmR compromising its interaction with MexR have been isolated and mapped to a putative C-terminal ␣-helix of the protein that alone is sufficient for interaction with MexR. possibly a virulence factor(s) (18). It is far from clear, therefore, that antimicrobial efflux is the intended function of this system. The mexAB-oprM efflux operon is negatively regulated by MexR, the product of a gene upstream of and divergently transcribed from the efflux genes (50). MexR is a member of the MarR family of regulators (68) and binds as a dimer (28) to two sites in the mexR-mexA intragenic region, near mexR and overlapping promoters for both mexR and mexAB-oprM (1, 13, 54, 57). Mutations in mexR are associated with the increased mexAB-oprM expression and concomitant multidrug resistance of so-called nalB mutants (20, 55, 63). Mutations in two additional repressor genes, nalC (also known as PA3721) (8, 29, 63) and nalD (also known as PA3574) (60), also yield increased mexAB-oprM expression and multidrug resistance. While NalD regulates mexAB-oprM expression directly by binding upstream of mexAB-oprM at a second promoter more mexA proximal than the MexR-binding site (39), NalC regulates efflux gene expression indirectly as a result of its direct control of a two-gene operon, PA3720-PA3719 (8). Upregulation of PA3720-PA3719 in nalC mutants is, in fact, responsible for the increased mexAB-oprM expression in such mutants, with PA3719 alone able to effect this increase (8). PA3719 encodes a protein with a molecular mass of ca. 6,100 Da having no homology
Multidrug efflux systems of the resistance-nodulation-division (RND) family are broadly distributed among gram-negative bacteria, where they are, in many instances, important determinants of intrinsic and/or acquired antimicrobial resistance (48). Comprised of an inner membrane drug-proton antiporter (the RND component), an outer membrane channel-forming component, and a periplasmic membrane fusion protein (40), these pumps function to capture periplasmic and possibly cytosolic substrates and deliver them to the cell exterior (2, 42, 49). In Pseudomonas aeruginosa, seven RND-type pumps have been described to date (36, 46), although the major efflux determinant of intrinsic multidrug resistance and the best studied of these pumps in P. aeruginosa is MexABOprM (45, 46). In addition to numerous medically relevant antimicrobials (47), MexAB-OprM also exports a variety of dyes and detergents (25, 62, 64), inhibitors of fatty acid biosynthesis (58), biocides (10), organic solvents (26, 27), homoserine lactones associated with quorum sensing (14, 43), and
* Corresponding author. Mailing address: Department of Microbiology and Immunology, Queen’s University, Kingston, Ontario, Canada K7L 3N6. Phone: (613) 533-6677. Fax: (613) 533-6796. E-mail:
[email protected]. † D.M.D. and L.C. contributed equally to this work. 䌤 Published ahead of print on 1 June 2007. 5441
5442
DAIGLE ET AL.
J. BACTERIOL. TABLE 1. Bacterial strains and plasmids
E. coli strains DH5␣
Reference or source
Relevant characteristicsa
Strain or plasmid
80dlacZ⌬M15 endA1 recA1 hsdR17 (rK⫺ mK⫹) supE44 thi-1 gyrA96 relA1 F⫺ ⌬(lacZYA-argF)U169 lexA71::Tn5 sulA211 sulA::lacZ ⌬(lacIPOZYA)169 F⬘ lacIq lacZ⌬M15::Tn9
12
P. aeruginosa strains K767 K1491 K1454 K2519 K2276
PAO1 prototroph K767 ⌬mexR K767 nalC K1454 ⌬mexR K1454 ⌬PA3719
32 63 8 This study This study
Plasmids pBluescript II SK(⫹) pLC30 pMS604 pLK452 pLC60 pLC61 pLC62 pLC63 pLC64 pLC65 pDP804 pSF001 pSF002 pSF003 pRK001 pDSK519 pLC23 pLC66 pLC67 pLC68 pLC69 pLC70 pLC71 pLC72 pMMB206 pSF004 pSF005 pSF006 pET-Dest42 pDD1 pTYB12
Cloning vector; Apr pBluescript II SK(⫹)::mexR LexA1-87WT-Fos zipper fusion; ori (ColE1) Tcr pMS604::mexR WT pMS604::mexR L35P pMS604::mexR I104F pMS604::mexR M112T pMS604::mexR L135F pMS604::mexR L28P pMS604::mexR L75P LexA1-87408-Jun zipper fusion; ori (P15A) Apr pDP804::PA3719 WT pDP804::PA3719 W45A pDP804::PA3719 L36P pDP804::PA3719 S25-Y53b Broad-host-range cloning vector; Kmr pDSK519::PA3719 pDSK519::mexR WT pDSK519::mexR L35P pDSK519::mexR I104F pDSK519::mexR M112T pDSK519::mexR L135F pDSK519::mexR L28P pDSK519::mexR L75P Broad-host-range, low-copy-number cloning vector; Cmr pMMB206::PA3719 WT pMMB206::PA3719 W45A pMMB206::PA3719 L36P His6 tag expression vector; Apr pET-Dest42::mexR Intein fusion expression vector
Stratagene This study 12 1 This study This study This study This study This study This study 12 This study This study This study This study 23 8 This study This study This study This study This study This study This study 38 This study This study This study Invitrogen This study New England Biolabs This study This study
SU202
pDD2 pDD3
pTYB12::PA3719 pET-Dest42::mexRI104F
5
a Apr, ampicillin resistant; Tcr, tetracycline resistant; Kmr, kanamycin resistant; Cmr, chloramphenicol resistant; WT, wild type. Mutated residues in the MexR or PA3719 proteins encoded by the plasmids are indicated. b N-terminally truncated PA3719 comprised of residues S25 to Y53.
to any known or predicted gene products in the GenBank databases. Intriguingly, overproduction of PA3719 (from an expression vector or in a nalC mutant) also substantially increases MexR protein levels (8), although the latter clearly no longer represses efflux gene expression. One possibility, then, is that PA3719 somehow modulates MexR repressor activity by interacting directly with this repressor, thereby alleviating repression of both mexAB-oprM and mexR (hence the increased MexR levels in a nalC mutant). We provide here in vivo and in vitro data in support of a PA3719-MexR interaction that modulates MexR repressor activity and in doing so facilitates expression of this efflux operon.
MATERIALS AND METHODS Bacterial strains and growth conditions. The bacterial strains and plasmids used in this study are listed in Table 1. Bacterial cells were cultivated in Luria broth (Miller’s Luria broth base [Difco] and 2 g of NaCl per liter of H2O) and agar (Luria broth containing 1.5% [wt/vol] agar), supplemented with appropriate antibiotics when necessary, at 37°C. Plasmid pDSK519 and its derivatives were maintained with 50 g/ml (in Escherichia coli) or 100 g/ml (in P. aeruginosa) kanamycin. Plasmid pMMB206 and its derivatives were maintained with 10 g/ml (in E. coli) or 150 g/ml (in P. aeruginosa) chloramphenicol. Plasmid pBluescript II SK(⫹) and its derivatives were maintained in E. coli using 100 g/ml ampicillin. Plasmids pDD1 (pET-Dest42::mexR), pDD2 (pTYB12::PA3719), and pDD3 (pET-Dest42:: mexRI104F) were maintained in E. coli with 50 g/ml ampicillin. A mexR deletion was introduced into nalC strain K1454 using plasmid pRSP75 as described previously (63) and was confirmed using colony PCR (59) with primers MexRF and MexRR as described below.
VOL. 189, 2007
MULTIDRUG EFFLUX GENE EXPRESSION IN P. AERUGINOSA
DNA protocols. Standard protocols were used for restriction endonuclease digestion, ligation, transformation, electroporation (E. coli), and agarose gel electrophoresis, as described by Sambrook and Russell (56). Electroporation of plasmids into P. aeruginosa was carried out as described previously (9). Ligation mixtures were typically applied to Millipore type VM 0.05-m filter disks over distilled H2O and incubated for 30 min at room temperature prior to electroporation. Genomic DNA of P. aeruginosa was extracted by following the protocol of Barcak et al. (7). Plasmids were isolated from E. coli DH5␣ and E. coli SU202 using a QIAprep Spin MiniPrep kit (QIAGEN, Inc., Chatsworth, CA). DNA fragments used for cloning were excised from agarose gels using Prep-A-Gene (Bio-Rad Laboratories, Richmond, CA) in accordance with the manufacturer’s instructions. PCR products were purified using a QIAquick PCR purification kit (QIAGEN). Oligonucleotides were chemically synthesized by Cortec DNA Services Inc., Kingston, Ontario, Canada, and nucleotide sequencing was carried out by ACGT Corp., Toronto, Ontario, Canada, or by Agencourt, Beverly, MA. Plasmids. The mexR gene was cloned into plasmid pDSK519 following amplification of the gene by PCR using primers MexRF (5⬘-GATCGGATCCCAT TAGGTTTACTCGGCCAAACC-3⬘; BamHI site underlined) and MexRR (5⬘GATCGAATTCCGCCAGTAAGCGGATACCTG-3⬘; EcoRI site underlined) in a reaction mixture (50 l) containing 1 g of PAO1 strain K767 chromosomal DNA as the template, 2.5 U of Vent DNA polymerase (New England Biolabs, Mississauga, Ontario, Canada), 0.2 mM of each deoxynucleoside triphosphate, 1⫻ ThermoPol buffer (New England Biolabs), 30 pmol of each primer, 2 mM MgSO4, and 10% (vol/vol) dimethyl sulfoxide (DMSO). The reaction mixture was subjected to an initial 3-min denaturation step at 95°C, followed by 30 cycles of 45 s at 95°C, 30 s at 60°C, and 45 s at 72°C before a 5-min elongation at 72°C. PCR products were purified, digested with BamHI and EcoRI, and cloned into pDSK519 and pBluescript II SK(⫹), yielding pLC66 and pLC30, respectively. For use in isothermal calorimetry (ITC) studies MexR was expressed with a C-terminal His6 tag from plasmids provided in Invitrogen Gateway cloning and expression kits (Invitrogen, Carlsbad, CA). Briefly, the mexR gene was amplified by PCR using Accuprime GC-rich DNA polymerase and primers MexRsrp-For (5⬘-GGGGACAAGTTTGTACA AAAAAGCAGGCTTCGAAGGCT TCGAA GGAGATAGAACCATGAACTACCCCGTGAATCCC-3⬘) and MexRsrp-Rev (5⬘-GGGGACCACTTTGTACAAGAAAGCTGGGTCAATATCCTCAAGCG GTTGCGC-3⬘) and inserted into pDONOR221 using the BP recombinase according to the manufacturer’s instructions (Invitrogen). The mexR gene was then transferred from pDONOR221 to pET-Dest42 (yielding pDD1) using the LR recombinase, again according to the manufacturers’ instructions,. For ITC studies of MexRI104F, plasmid pDD3 carrying mexRL104F was constructed by introduction of a point mutation into the mexR gene of pDD1 using the Stratagene QuickChange mutagenesis system and a protocol provided by the manufacturer (Stratagene, La Jolla, CA). The PA3719 gene was cloned into the two-hybrid vector pDP804 following amplification of the gene from plasmid pLC23 using PCR and primers PDPPA3719F (5⬘-TCAGCTCGAGCTCGAGATGTCCCTGAACACTCCG-3⬘; tandem XhoI sites underlined) and PDP-PA3719R (5⬘-TCATAGATCTAGATCT TGCGCGGATTCTGATAGCT-3⬘; tandem BglII sites underlined). Reaction mixtures (50 l) containing 100 ng of pLC23, 0.6 M of each primer, 0.2 mM of each deoxynucleoside triphosphate, 2 mM MgSO4, and 1 U of Pfu DNA polymerase (Fermentas Life Sciences, Burlington, Ontario, Canada) in 1⫻ Pfu DNA polymerase buffer were heated at 98°C for 45 s and then subjected to 25 cycles of 98°C for 45 s, 62°C for 45 s, and 72°C for 1 min, followed by 10 min at 72°C. The PA3719-carrying PCR product was purified (see below), digested with XhoI and BglII, and cloned into pDP804, yielding pSF001. A New England Biolabs IMPACT intein fusion kit was used for cloning and expression of PA3719 (as an intein fusion) for use in ITC studies. PCR amplification of the gene was carried out using primers PA3719srp-For (5⬘-GGCGAAGCGGCCGCATGTCCCTGA ACACTCCGC-3⬘; NotI site underlined) and PA3719srp-Rev (5⬘-CGTGGCTC GAGTCAGTAGAAGTGCTCGCCG-3⬘; XhoI site underlined) and Accuprime GC-rich DNA polymerase, and the gene was cloned into the kit-provided plasmid pTYB12, yielding the PA3719-intein fusion-expressing vector pDD2. The 3⬘ end of PA3719 encoding residues S25 to Y53 was cloned into the two-hybrid vector pDP804 as a XhoI-BglII fragment following the annealing of two XhoI- and BglII-flanked 110-bp oligonucleotides corresponding to both strands of the S25- to Y53-encoding region of PA3719. Annealing was achieved by incubating 800 pmol of each oligonucleotide in T4 ligation buffer at 95°C for 3 min and allowing the reaction mixture to cool at room temperature for 5 h, after which the 3⬘ PA3719 DNA was purified using a gel and PCR cleanup kit (Promega). Random mutagenesis. PCR-based random mutagenesis (53) of mexR was carried out using primers RanMuMexRForward (5⬘-GAGCGGTGACCATGAACTACC CCGTGAATCC-3⬘; BstEII site underlined) and RanMuMexRReverse (5⬘-GAGG
5443
CTCGAGTTAAATATCCTCAA-GCGGTTG-C-3⬘; XhoI site underlined). The reaction mixtures (50 l) contained 100 ng of plasmid pLC30 as the template, 2.5 U of Taq DNA polymerase (New England Biolabs, Mississauga, Ontario, Canada), 1⫻ ThermoPol buffer (New England Biolabs), 0.2 mM of each deoxynucleoside triphosphate (except dATP or dCTP [40 M]), 30 pmol of each primer, 2 mM MgSO4, and 10% (vol/vol) DMSO. The PCR mixtures were subjected to an initial 3-min denaturation step at 95°C, followed by 29 cycles of 45 s at 95°C, 30 s at 60°C, and 45 s at 72°C before a 5-min elongation at 72°C. The PCR products were then digested with BstEII and XhoI and cloned into pLK452 (pMS604::mexR) purified so that it was free of the wild-type mexR-containing BstEII-XhoI fragment (i.e., the wild-type gene was replaced with mutagenized mexR). PCR-based random mutagenesis of PA3719 was carried out with primers PDP-PA3719F and PDP-PA3719R (see above) as described above for mexR, omitting DMSO, using pLC23 as the template, and including MnCl2 at a final concentration of 25 to 150 M. The reaction conditions were the same as those described above for PCR of mexR. PCR products were purified, digested with XhoI and BglII, and cloned into pSF001 (pDP840::PA3719) purified so that it was free of the wild-type PA3719-containing XhoI-BglII fragment of this vector (i.e., the wild-type PA3719 gene of pSF001 was replaced with mutagenized PA3719). Mutant mexR genes (screened using the two-hybrid assay [see below]) were cloned into plasmid pDSK519 following their amplification, from plasmid pMS604 derivatives harboring them, with primers RanMexRForward (5⬘-GAG CGGATCCATGAACTACCCCGTGAATCC-3⬘; BamHI site underlined) and RanMexR Reverse (5⬘-GAGGGAATTCTTAAATATCCTCAAG-CGGTTGC3⬘; EcoRI site underlined). The reaction mixtures (50 l) contained 1 g of pMS604 derivative as the template, 2.5 U of Pfu DNA polymerase (New England Biolabs, Mississauga, Ontario, Canada), 1⫻ Pfu buffer (New England Biolabs), 0.2 mM of each deoxynucleoside triphosphate, and 30 pmol of each primer. The PCR mixtures were subjected to an initial 3-min denaturation step at 98°C, followed by 29 cycles of 45 s at 98°C, 30 s at 65°C, and 45 s at 72°C before a 5-min elongation at 72°C. Following purification and digestion (with BamHI and EcoRI) the mexR-carrying fragments were cloned into appropriately digested pDSK519 and mobilized into P. aeruginosa using a previously described triparental mating procedure (69), with transconjugants selected on LB agar containing kanamycin (750 g/ml) and imipenem (0.5 g/ml) (to counterselect E. coli). Wild-type and mutant (screened using the two-hybrid assay [see below]) PA3719 genes were cloned into plasmid pMMB206 following their amplification, from plasmid pDP804 derivatives harboring them, with primers PA3719SD-F (5⬘-GACTGA ATTCGAATTCACGGGGATGAACTGGTGACGCCGCCATGTCCCTGAAC ACTCCG-3⬘; tandem EcoRI sites underlined) and PA3719DS-R (5⬘-GACTAAG CTTAAGCTTTGCGCGGATTCTGATAGCT-3⬘; tandem HindIII sites underlined). The reaction mixtures were formulated as described above for PA3719 cloning into pDP804, except that Vent DNA polymerase (2 U; New England Biolabs, Ltd., Pickering, Ontario, Canada) and its buffer replaced Pfu and MgSO4 was included at a concentration of 1 mM. The reaction mixtures were also heated as described above, with the exception that an annealing temperature of 65°C (not 62°C) was used. Following purification and digestion (with EcoRI and HindIII) the PA3719-carrying fragments were cloned into appropriately restricted pMMB206. The resultant plasmids were then introduced into P. aeruginosa via electroporation. Bacterial two-hybrid system. To assess an interaction between MexR and PA3719 in vivo and the impact of mutations (or truncations) on this interaction, mexR-carrying pMS604 (or its mutated derivatives) and PA3719-carrying pDP804 (or its mutated or truncated derivatives) were electroporated into E. coli strain SU202 and plated onto 1% (wt/vol) lactose-MacConkey agar containing ampicillin (100 g/ml) and tetracycline (10 g/ml) as described previously (53). Any interaction between MexR and PA3719 sequences encoded by the various mexR- and PA3719-containing pMS604 and pDP804 derivatives was observable as a lack of or reduction in -galactosidase activity in SU202 (i.e., pale pink to white colonies on lactose-MacConkey agar), while the absence of an interaction yielded -galactosidase activity (red colonies) in this reporter strain (53). These results were confirmed using a more quantitative -galactosidase assay, as described below. In screening randomly mutagenized mexR or PA3719 genes for mutations compromising the MexR-PA3719 interaction, the ligation mixtures producing the pLK452 and pSF001 derivatives that carry randomly PCR-mutagenized mexR and PA3719, respectively (see above), were electroporated directly into E. coli SU202, which was then plated onto 1% (wt/vol) lactoseMacConkey agar containing ampicillin and tetracycline and screened as described above. In all instances, whole-cell protein extracts were prepared and screened (using immunoblotting with anti-LexA antibodies [see below]) for the production of LexA-MexR and LexA-PA3719 fusions, to ensure production of wild-type and mutant versions of these proteins. SDS-polyacrylamide gel electrophoresis and immunoblotting. Whole-cell extracts were prepared as described previously (52), electrophoresed on 20%
5444
DAIGLE ET AL.
(wt/vol) sodium dodecyl sulfate (SDS)-polyacrylamide gels, and transferred to Immobilon-P polyvinylidene difluoride membranes (Millipore) (61). Membranes were probed with monoclonal anti-LexA antibodies (Invitrogen) as described previously (61). -Galactosidase assay. E. coli SU202 derivatives containing pDP804 (or its derivatives) and pMS604 (or its derivatives) were grown in LB medium supplemented with ampicillin (100 g/ml) and tetracycline (10 g/ml) for approximately 18 h at 37°C. Cultures were then diluted 1:49 into fresh antibioticsupplemented medium and incubated at 37°C until the optical density at 600 nm was 0.8 to 1.0 before they were assayed for -galactosidase activity as described previously (35). Susceptibility testing. The antibiotic susceptibility of P. aeruginosa was assessed using a previously described broth dilution assay (21), and the data are reported as the MIC for each agent tested. Expression and purification of MexR and PA3719. Wild-type MexR used in mobility shift assays was expressed in and purified from E. coli BL21(DE3) as described previously (28). For use in ITC studies, MexR and MexRI104F were expressed in E. coli BL21(DE3)* Star (Invitrogen) from plasmids pDD1 and pDD3, respectively. Briefly, Luria broth (4 liters) supplemented with ampicillin was inoculated 1:99 with an overnight culture of plasmid-carrying E. coli BL21(DE3)* Star, and the culture was grown to an optical density at 600 nm of ⬃0.5 and induced with IPTG (final concentration, 1 mM) for 4 h at 37°C. Cells were harvested by centrifugation at 7,500 ⫻ g for 10 min at 4°C, resuspended in 10 ml of lysis buffer (20 mM sodium phosphate [pH 7.2], 500 mM NaCl, 10 mM imidazole, 1⫻ Roche Complete EDTA-free protease inhibitor cocktail), and lysed by three consecutive passes through a French pressure cell at 20,000 lb/in2. Protein purification was performed on a HisTrap HP column according to the manufacturer’s instructions (Amersham Biosciences, Piscataway, NJ). Purified MexR proteins were quantitated using the Bradford assay and were verified by A280 measurement after denaturation with 6 M guanidinium-HCl. PA3719 for use in ITC was expressed (as an intein fusion) from the pTYB12::PA3719 vector, pDD2, also in E. coli BL21 (DE3)* Star as described above except for the use of IPTG at a concentration of 0.5 mM and subsequent growth at 18°C for 18 h. Purification of the PA3719-intein fusion protein was performed according to the manufacturer’s instructions (New England Biolabs). The intein-cleaved PA3719 protein retained an AGHMTSSRVDGGR N-terminal extension and was quantitated as described above for MexR. All proteins were ⬎98% pure as determined by SDS-polyacrylamide gel electrophoresis. ITC. MexR, MexRI104F, and PA3719 were purified as described above. The protein samples were buffer exchanged into ITC assay buffer (20 mM Tris-HCl [pH 8.0], 200 mM NaCl) using a combination of an Amicon 8200 stirred concentration cell with a YM1 ultrafiltration membrane to concentrate the samples to 10 ml, followed by dialysis for 8 h at room temperature. Proteins were quantitated using the Bradford assay and were verified by A280 measurement after denaturation in 6 M guanidinium-HCl. ITC experiments were carried out using a VP-ITC Microcal calorimeter (Microcal Inc., Studio City, CA). Solutions were degassed for 15 min prior to experiments using a vacuum degasser. Calorimetric titrations were carried out with wild-type MexR protein at a concentration of 16.2 M in the sample cell, ITC assay buffer in the reference cell, and PA3719 at a concentration of 107.9 M in the automated syringe. The injection sequence consisted of a single 4-l injection followed by a series of 28 injections of 10 l, separated by 300 s of equilibration time. Calorimetric titrations with the site-directed variant MexRI104F were performed as described above except that MexRI104F was present at a concentration of 70 M in the sample cell and PA3719 was present at a concentration of 350 M in the syringe. The mixing speed was 307 rpm, the cell temperature was 25°C, and the reference power was 5 cal/s, with an initial delay of 60 s. The saturation levels of the interaction at the concentrations tested were approximately 2.9-fold for wild-type MexR and 2.2-fold for MexRI104F, giving PA3719/MexR molar ratios of approximately 1.45 and 1.1, respectively, by the end of the titrations. C values of the titrations were calculated using the following equation: C ⫽ KA ⫻ MTot ⫻ n, where KA is the association rate constant, MTot is the concentration of the binding partner in the cell being titrated, and n is the stoichiometry of the interaction. The data were fitted by a single-site model using the ORIGIN ITC software provided by Microcal to obtain a least-squares estimate of KA (in M⫺1). The equilibrium dissociation constant (KD) was calculated using the equation KD ⫽ 1/KA. Mobility shift assay. The mobility shift assay was carried out in 10 l of 20 mM Tris-HCl (pH 7.5)–50 mM NaCl as described previously (28), using purified MexR and PA3719 synthesized (with the N-terminal Met) by C S Bio Company, Inc. (Menlo Park, CA) (www.csbio.com). The proteins (individually and together in various amounts) were mixed with target DNA (28-mer MexR operator [28]; 30 M) at room temperature prior to gel loading.
J. BACTERIOL. In vitro transcription assay. An 836-bp DNA fragment containing a phage T7 promoter at its 5⬘ end and mex DNA beginning 251 bp upstream of mexA (including the MexR-binding site) and extending 585 bp into mexA was amplified from P. aeruginosa PAO1 genomic DNA by PCR using Accuprime GC-rich DNA polymerase (Invitrogen, Carlsbad, CA) and primers A (5-GAAATTAATACG ACTCACTATAGGGTAAATGTGGTTGATCCAGTCAAC-3⬘; T7 promoter underlined) and B (5⬘-CGGGTCGAGCTGTTGCACGGTGGCCATCGCGTT GGC-3⬘). The PCR product was resolved using agarose (1%, wt/vol) gel electrophoresis, purified using a QIAGEN gel extraction kit (QIAGEN, Valencia, CA), and quantitated using a nanodrop spectrophotomoter (Nanodrop, Wilmington, DE). In vitro transcription from this template was conducted using a Megascript T7 RNA polymerase-based in vitro transcription kit (Ambion, Austin, TX) according to the manufacturers’ instructions, with the exception that the amount of template was reduced to 250 ng (final concentration, 22.7 nM) and one-half the suggested amounts of T7 polymerase enzyme mixture and nucleotides were used. Control experiments using the kit-provided pTRI-Xef-1 template were carried out according to the manufacturer’s instructions. To assess the impact of the MexR or MexRI104F repressors on transcription from these templates, the purified proteins were added at a final concentration of 1 M in 20-l reaction mixtures. To assess the impact of PA3719 on MexR/MexRI104F repressor activity in this assay, PA3719 was added at various concentrations to reaction mixtures containing 1 M of each repressor. Control reactions were also carried out with PA3719 alone. In all instances, reactions were allowed to proceed for 3 h at 37°C, after which the RNA product was purified using a QIAGEN RNeasy RNA purification kit (QIAGEN, Valencia, CA), incorporating on-column DNase digestion for 30 min. Purified RNA products were quantitated using a nanodrop spectrophotometer, mixed with 2⫻ Novex Tris-borate-EDTA-urea sample buffer, heated to 70°C for 3 min, separated by electrophoresis in Novex 6% Tris-borate-EDTA-urea gels (Invitrogen, Carlsbad, CA), and visualized by ethidium bromide staining.
RESULTS MexR-PA3719 interaction. nalC multidrug-resistant mutants of P. aeruginosa show enhanced expression of mexAB-oprM that is dependent upon increased expression of PA3719, the second gene of the NalC repressor-regulated PA3720-PA3719 operon (8). One way in which PA3719 might increase mexABoprM expression is by interacting with and modulating the activity of MexR, the primary repressor of mexAB-oprM expression and a target for mutation in so-called nalB multidrugresistant mutants (63). To assess an interaction between MexR and PA3719, then, a bacterial two-hybrid approach was employed (12), in which the PA3719 and mexR genes were cloned in frame to coding sequences for the DNA-binding domain of LexA on plasmids pDP804 and pMS604, respectively, and introduced into E. coli SU202 carrying a chromosomal lacZ gene under the control of a LexA operator. LexA binding to its operator and subsequent repression of lacZ in this strain require prior dimerization of the LexA-binding domains encoded by pDP804 and pMS604, necessitating interaction of the PA3719 and MexR sequences fused to the LexA DNA-binding domains of these vectors. As such, lack of -galactosidase activity is a measure of the PA3719-MexR interaction. The two-hybrid vectors also contain sequences encoding Jun and Fos zipper motifs (which are known to interact) fused to lexA, such that E. coli SU202 carrying these vectors demonstrates substantial repression of lacZ (Table 2). The unaltered vectors thus provide a positive control for the system, although the Jun and Fos zipper-encoding sequences will be disrupted upon cloning of PA3719 and/or mexR sequences, making lacZ repression dependent upon the PA3719-MexR interaction. As shown in Table 2, individual cloning of mexR or PA3719 into pMS6054 or pDP804 provided substantial -galactosidase activity in SU202 as a result of the absence of an appropriate
MULTIDRUG EFFLUX GENE EXPRESSION IN P. AERUGINOSA
VOL. 189, 2007
TABLE 2. -Galactosidase activity of E. coli SU202 isolates expressing wild-type and mutant MexR and PA3719 proteins in the LexA-based two-hybrid system Two-hybrid plasmid combinationa pDP804 derivative
pMS604 derivative
-Galactosidase activity (Miller units)b
pDP804 pDP804 PA3719 WT PA3719 WT PA3719 WT PA3719 WT PA3719 WT PA3719 WT PA3719 WT PA3719 WT PA3719 W45A PA3719 L36P PA3719 S25-Y53
pMS604 mexR WT pMS604 mexR WT mexR L35P mexR I104F mexR M112T mexR L135F mexR L28P mexR L75P mexR WT mexR WT mexR WT
535 5,856 7,987 54 2,699 2,769 2,778 2,509 2,499 3,312 3,359 1,804 23
a b
WT, wild type. The data are representative of at least three independent determinations.
interacting partner in these vectors to effect lacZ repression. When mexR-carrying pMS604 and PA3719-carrying pDP804 were introduced into SU202, however, the -galactosidase levels were reduced substantially (Table 2), consistent with lacZ repression and thus a MexR-PA3719 interaction. A MexRPA3719 interaction was subsequently confirmed in vitro using ITC analysis (Fig. 1A). Integration of the raw data (peaks of heat released upon binding of PA3719 to wild-type MexR) gave an estimated stoichiometry of 0.54 ⫾ 0.01 mol of PA3719
5445
per mol of MexR, corresponding to one PA3719 binding site per MexR dimer in solution and a KD of 158.0 ⫾ 18.1 nM. PA3719 modulates MexR DNA binding and repressor activity. MexR regulates mexAB-oprM expression by binding to an operator region that overlaps the major promoter of this efflux operon (13, 39). Gel shift assays involving a synthetic mexR operator sequence confirmed this MexR-DNA binding (Fig. 2A, lane 3). Addition of PA3719 yielded, as expected, a MexRPA3719 complex (Fig. 2B, lane 6) and reduced MexR binding to operator DNA (Fig. 2A, lane 6), and this became more pronounced (more complex, less DNA binding) as more PA3719 was added (Fig. 2, lane 7). The smear of DNA apparently comigrating with the MexR-PA3719 complex (Fig. 2A, lane 7) is likely not indicative of DNA-bound MexR-PA3719, as one would not expect a DNA-free PA3719-MexR complex (Fig. 2, lane 5) to show the same mobility as a PA3719-MexRDNA complex, just as DNA-free MexR and its DNA-bound form migrate very differently (Fig. 2B, compare lanes 2 and 3). While these data suggest that PA3719 modulates MexR operator binding and, ultimately, MexR-mediated repression of mexAB-oprM, in the absence of some explanation for the apparently anomalous migration of the MexR operator DNA in the presence of the PA3719-MexR complex we cannot unequivocally make this claim. To assess whether PA3719 does modulate MexR repression of mexAB-oprM, a system for in vitro transcription of mexA was established by first engineering a phage T7 promoter upstream of sequences encompassing the MexR-binding site and extending into mexA and then using T7 RNA polymerase to drive mexA transcription from this template (Fig. 3A, lane 1). While addition of MexR clearly reduced mexA transcription in this assay (Fig. 3A, lane 2), sub-
FIG. 1. Binding of PA3719 to MexR and MexRI104F measured by ITC. (A) ITC titration of wild-type MexR (16.2 M) with 10-l injections of 107.9 M PA3719. The upper panel shows the raw data for heat released by the binding of PA3719 to MexR expressed in microcalories per second versus time in minutes, while the lower panel shows the peak integration for each injection expressed in kilocalories per mole of PA3719 versus the molar ratio of MexR to PA3719 in solution. The line shows the fit of the data to a single-site model. The least-squares estimate for N (stoichiometry) was 0.54 ⫾ 0.01 PA3719 binding site per MexR molecule or one binding site per MexR dimer, the least-squares estimate for KA was 6.29 ⫻ 106 ⫾ 0.72 ⫻ 106 M⫺1, and the least-squares estimate for KD was 158.0 ⫾ 18.1 nM. (B) ITC titration of MexRI104F (70 M) with 10-l injections of 350 M PA3719. The least-squares estimate for N was 0.63 ⫾ 0.01, the least-squares estimate for KA was 1.17 ⫻ 106 ⫾ 0.21 ⫻ 106 M⫺1, and the least-squares estimate for KD was 853.2 ⫾ 151.1 nM.
5446
DAIGLE ET AL.
FIG. 2. Electrophoretic mobility shift assay demonstrating disruption of the MexR-operator DNA complex in lieu of formation of a MexR-PA3719 complex as visualized by (A) ethidium bromide staining of the MexR operator DNA and (B) Coomassie brilliant blue staining of the protein. The protein components indicated, MexR (0.6 nmol) and PA3719 (0.6 nmol [⫹] or 1.2 nmol [⫹⫹]), and MexR operator DNA (5⬘-ATTTTAGTTGACCTTATCAACCTTGTTT-3⬘; 0.3 nmol) (28) were incubated in 10-l (final volume) mixtures and subjected to nondenaturing polyacrylamide (12%, wt/vol) gel electrophoresis under reducing conditions at 77 V for 3 h at room temperature. Note that PA3719 has a high pI and migrates in the opposite direction when it is not in a complex with MexR. Thus, a control experiment run with PA3719 and operator DNA only shows no PA3719 and free, unshifted DNA (data not shown).
sequent addition of PA3719 at a concentration equal to its KD (Fig. 3A, lane 3) or threefold greater than its KD (Fig. 3A, lane 4) interfered with MexR repressor activity (i.e., mexA transcription increased), ultimately restoring mexA transcription to levels seen without the repressor (Fig. 3A, compare lane 4 and with lane 1). As expected, PA3719 alone did not impact mexA transcription (Fig. 3B, compare lanes 2 and 3 with lane 1) and MexR did not impact transcription of a control template lacking a MexR-binding site (Fig. 3A, compare lanes 6 and 7 with lane 5). MexR mutations compromising PA3719 interaction. To assess the details of the MexR-PA3719 interaction, including identification of residues or regions of MexR important for or involved in this interaction, mutations in mexR compromising this interaction were selected using the two-hybrid system mentioned above. Thus, mexR-carrying pMS604 was mutagenized and introduced into pDP804::PA3719-carrying SU202, and LacZ⫹ colonies (i.e., red colonies) were selected on MacConkey agar; a defect in the MexR-PA3719 interaction was expected to obviate lacZ repression in the SU202 reporter strain. Following confirmation that putative mutant MexR proteins (as fusions to LexA) defective in the PA3719 interaction
J. BACTERIOL.
FIG. 3. PA3719 and MexR control of in vitro mexA transcription. (A) Impact of PA3719 on MexR repression of mexA transcription. Phage T7 RNA polymerase-based in vitro transcription reactions were initiated from a 836-bp PCR-generated template (250 ng) carrying a T7 promoter and mexA sequences extending from the MexR operator to 585 bp into the mexA gene (lanes 1 to 4). The results for control reactions with a T7 promoter-containing DNA template, pTRI-Xef, provided with the T7 in vitro transcription kit, are shown in lanes 5 to 7. Reactions were carried out at 37°C for 3 h, and RNA was purified and subjected to electrophoresis prior to visualization with ethidium bromide. MexR (1 M) and PA3719 (150 nM [⫹1] or 500 nM [⫹2]) were included in the reaction mixtures as indicated. Equal volumes of RNA were loaded in each instance. The following amounts of RNA were produced: lane 1, 4.2 g; lane 2, 1.1 g; lane 3, 2.0 g; lane 4, 4.2 g; lane 5, 1.7 g; lane 6, 1.6 g; and lane 7, 1.6 g. (B) Impact of PA3719 on mexA transcription. In vitro transcription of the mex (lanes 1 to 3) and pTRI-Xef (lanes 4 to 6) templates was carried out as described above with or without PA3719 (500 nM [⫹2] or 2 M [⫹3]), as indicated. The following amounts of RNA were produced: lane 1, 4.4 g; lane 2, 4.5 g; lane 3, 4.6 g; lane 4, 4.6 g; lane 5, 4.6 g; and lane 6, 4.4 g. (C) Differential impact of PA3719 on the repressor activities of MexR and MexRI104F. In vitro transcription of the mex (lanes 1 to 5) and pTRI-Xef (lanes 6 to 8) templates was carried out as described above with or without PA3719 (500 nM) and MexR/ MexRI104F (1 M), as indicated. The following amounts of RNA were produced: lane 1, 4.2 g; lane 2, 0.8 g; lane 3, 3.8 g; lane 4, 0.9 g; lane 5, 1.9 g; lane 6, 6.6 g; lane 7, 6.5 g; and lane 8, 6.4 g. RNA was quantitated prior to loading, and the values reported reflect the amount loaded and not the total amount produced. Because reaction, recovery, and loading volumes were kept constant throughout, these values accurately reflect the relative transcript levels produced in each instance.
VOL. 189, 2007
MULTIDRUG EFFLUX GENE EXPRESSION IN P. AERUGINOSA
FIG. 4. Whole-cell anti-LexA immunoblot of E. coli SU202 expressing mutant versions of (A) MexR-LexA and (B) PA3719-LexA fusions defective in the MexR-PA3719 interaction. (A) E. coli SU202 carrying pSF001 (pDP804::PA3719WT) and pMS604 derivatives expressing mutant MexR proteins (lane 1, L35P; lane 2, I104F; lane 3, M112T; lane 4, L135F; lane 5, L28P; lane 6, L75P). Note that the band below MexR is a cross-reactive product and not PA3719-LexA, which migrates lower in the gel, as indicated on the right. (B) E. coli SU202 carrying pLK452 (pMS604::mexRWT) and pDP804 derivatives expressing wild-type (lane 4) or mutant (lane 5, W45A; lane 6, L36P) PA3719 proteins. Lane 1, pDP804 alone; lane 2, pMS604 alone; lane 3, pMS604::mexR and pDP804. The positions of the Jun-LexA (lanes 1 and 3) and Fos-LexA (lane 2) fusions encoded by the native pDP804 and pMS604 vectors, respectively, are indicated. PA3719L36P (PA3719*) migrates anomalously on gels (compare lanes 4 and 6). Equal loading of all wells was verified by running duplicate gels that were stained with Coomassie brilliant blue.
were expressed (to eliminate further study of mutations compromising MexR production or stability, which would also compromise the interaction with PA3719 and obviate lacZ repression in SU202), mexR genes were sequenced and the genes carrying single point mutations were saved for further study. Six mutant mexR genes (from more than 40 noninteracting mutants originally selected and sequenced) producing a stable MexR (-LexA) product (Fig. 4A) carried single mutations (L28P, L35P, L75P, I104F, M112T, L135F) and were shown in -galactosidase assays to be defective in PA3719 interaction (i.e., the -galactosidase activity increased relative to that of wild-type MexR) (Table 2). These mutations, while distributed throughout MexR (L28P, helix 1; L35P, loop between helices 1 and 2; L75P, helix 4; and I104F, M112T, and L135P, helix 5), occurred at generally interior sites of the protein (Fig. 5) and are unlikely to define a PA3719-binding site or identify MexR residues involved directly in binding PA3719. More likely, these mutations impact MexR protein conformation and thereby PA3719 binding. Interestingly, four of these six mutations (L35P, I104F, M112T, L135F) did not impact MexR repressor activity, at least to any appreciable extent, as shown by the ability of plasmid pDSK519 derivatives carrying the corresponding cloned mutant mexR genes to reduce multidrug resistance in the ⌬mexR P. aeruginosa strain K1491 to an extent comparable to that seen with the cloned wild-type mexR gene (Table 3). These results were confirmed directly with a representative noninteracting MexR mutant protein, MexRI104F, which was able to repress mexA transcription in the in vitro transcription assay described above (Fig. 3C, compare lanes 1 and 4). The four above-mentioned mutant MexR proteins also showed substantial mexAB-oprM repressor activity in the ⌬mexR nalC strain K2519, as evidenced by their ability to reduce resistance to MexAB-OprM antimicrobial substrates in this strain when they were supplied in trans (Table 3). This was in contrast to wild-type MexR, whose mexAB-oprM repressor activity was
5447
FIG. 5. Location in MexR of mutations compromising interaction with PA3719. Structural details of the MexR dimer (PDB accession no. 1LNW [http://www.ncbi.nlm.nih.gov]) are shown, with sticks highlighting the residues that, when mutated, compromised the interaction with PA3719. Residues are labeled on only one monomer.
largely ameliorated in a nalC background (the cloned gene yielded little or no change in resistance in K2519, similar to the vector control) (Table 3). Since nalC strains show increased expression of PA3719 that is essential for elevated mexABoprM expression and associated multidrug resistance (8), these data are consistent with a PA3719-MexR interaction ameliorating MexR-DNA binding (Fig. 2) and thus repression of mexAB-oprM (Table 3). As such, mutant MexR proteins defective in the PA3719 interaction are unresponsive to PA3719 modulation and hence are able to bind and repress mexABoprM in the presence of PA3719, at least in vivo. To test this in vitro, a representative PA3719-binding-deficient MexR mutant protein (MexRI104F) was purified and examined for PA3719 interaction, again using ITC analysis. As expected, the mutant protein had a lower affinity for PA3719 than wild-type MexR, characterized by a 5.4-fold decrease in the KD (KD, 853.2 ⫾ 151.1 nM) (Fig. 1B). Consistent with these results, while PA3719 effectively reversed wild-type MexR repression of mexA transcription in vitro (Fig. 3C, compare lanes 2 and 3), it had only a modest impact on MexRI104F repression of mexA transcription, providing only a slight increase in transcription (Fig. 3C, compare lanes 4 and 5). Mutations in PA3719 compromising interaction with MexR. To identify residues of PA3719 important for MexR interaction, the PA3719-carrying pDP804 plasmid was mutagenized as described above for mexR and introduced into pMS604carrying E. coli SU202, and again, LacZ⫹ colonies were selected on MacConkey agar. Despite the fact that dozens of putative noninteracting PA3719 mutants were screened, only two bore single point mutations in PA3719 (yielding L36P and W45A changes in the protein) (Table 2). Immunoblotting confirmed production of pDP804-encoded PA3719L36P (fused to LexA), which migrated anomalously on SDS-polyacrylamide gel electrophoresis gels (Fig. 4B, lane 6), although the W45A version was not detected (Fig. 4B, lane 5). Still, control studies with pDP804-encoded wild-type PA3719 revealed that the protein (as a LexA fusion) was unstable and, as a result, undetectable in immunoblots in the absence of MexR (data not shown). One interpretation of these results is that an interac-
5448
DAIGLE ET AL.
J. BACTERIOL.
TABLE 3. Influence of mexR and PA3719 mutations on the antibiotic susceptibility of P. aeruginosa Strain
K767 K1491 K2519 K1491(pDSK519)a K1491(pLC66) K1491(pLC67) K1491(pLC68) K1491(pLC69) K1491(pLC70) K1491(PLC71) K1491(pLC72) K2519(pDSK519)a K2519(pLC66) K2519(pLC67) K2519(pLC68) K2519(pLC69) K2519(pLC70) K2519(PLC71) K2519(pLC72) K2276 K2276(pMMB206)b K2276(pSF001) K2276(pSF002) K2276(pSF003)
MIC (g/ml) of:
MexR protein expressed
PA3719 protein expressed
Carbenicillin
Chloramphenicol
Novobiocin
Norfloxacin
Nalidixic acid
Wild type None None None Wild type L35P I104F M112T L135F L28P L75P None Wild type L35P I104F M112T L135F L28P L75P Wild type Wild type Wild type Wild type Wild type
None None Wild type None None None None None None None None Wild type Wild type Wild type Wild type Wild type Wild type Wild type Wild type None None Wild type W45A L36P
64 512 512 512 32 64 128 128 64 512 512 512 256 64 64 64 128 512 512 32 32 128 32 32
32 256 256 128 16 16 32 32 16 128 128 128 128 32 32 16 64 128 128 ND ND ND ND ND
128 1,024 1,024 1,024 128 128 128 128 128 1,024 1,024 1,024 512 64 128 64 128 1,024 1,024 ND ND ND ND ND
0.5 2 2 2 0.5 0.5 0.5 0.5 0.5 2 2 2 2 0.5 1 0.5 1 2 2 ND ND ND ND ND
NDc ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND 128 128 512 128 128
a Plasmid pDSK519 derivatives encoding the MexR proteins indicated were introduced into P. aeruginosa strains K1491 (⌬mexR) and K2519 (nalC ⌬mexR), and antimicrobial susceptibility was assessed. PA3719 is expressed only in K2519, as a result of the nalC mutation. b Plasmid pMMB206 derivatives encoding the PA3719 proteins indicated were introduced into P. aeruginosa strain K2276 (nalC ⌬PA3719), and antimicrobial susceptibility was assessed. c ND, not determined.
tion with MexR stabilizes the PA3719 (-LexA) protein in this system and mutations in PA3719 that compromise this interaction (or the absence of its interacting partner) render the protein unstable. Interestingly, both L36 and W45 occur within the only predicted (using PSIPRED [http://bioinf.cs.ucl.ac.uk /psipred/]) secondary structure of note in the protein (an ␣-helix that extends from D31 to D46), which is likely involved in the MexR interaction. Indeed, an N-terminally truncated PA3719 derivative encompassing this region (S25 to Y53) was able to interact with MexR in the two-hybrid assay (Table 2). DISCUSSION In light of MexR’s role as a repressor of mexAB-oprM expression, earlier observations of increased production of both MexAB-OprM and MexR in nalC strains of P. aeruginosa were initially hard to explain (8). Clearly, MexR in such mutants was inactive as a repressor (hence, there was increased MexABOprM), and increased production of MexR reflected a loss of negative autoregulation. The current study confirms the loss of repressor activity of MexR in nalC strains and demonstrates that this results from an interaction between PA3719 (ArmR), whose expression increases in nalC mutants, and MexR. Thus, MexR is unique among MarR family regulators, which tend to bind or be modulated by chemical effectors (typically aromatic compounds) (15, 19, 51, 67) that also abrogate operator binding and thereby promote expression of MarR family-regulated genes (68). Indeed, while MarR DNA binding and thus repressor activity are modulated by salicylate, an agent known to
induce expression of the MarR-regulated marRAB locus in E. coli (3), and the crystallized MarR repressor demonstrates two possible binding sites for this agent, salicylate does not modulate MexR DNA binding and at least one of the proposed salicylate-binding sites of MarR is absent in MexR (4). Clearly then, MexR differs from MarR (and other Mar family regulators) with regard to the mechanism by which its activity is modulated. Protein effectors of regulatory proteins, including repressors, are not uncommon in bacteria and may reflect a need to integrate multiple signals in controlling regulatory protein activity and/or perhaps a need to respond to a physical signal(s). In certain nitrogen-fixing organisms of the gamma subgroup of the Proteobacteria, for example, expression of the nitrogen fixation or nif genes is under the control of the NifA activator, whose activity is, however, modulated by NifL in response to both oxygen and fixed nitrogen (31). Apparently, NifL negatively controls NifA activity via a stable protein-protein interaction (24, 37) that is modulated by redox changes (which NifL can sense), ligand binding, and interactions with other proteins (31). Similarly, redox and blue light control of expression of photosynthesis genes in Rhodobacter sphaeroides is mediated by a repressor, PpsR, whose activity is modulated by the AppA antirepressor that responds to redox and blue light and forms a complex with PpsR (33). As observed with PA3719 (ArmR) and MexR, AppA-PpsR complex formation abrogates PpsR binding to target DNA (33). In addition, the ComA response regulator and transcription factor for competence development in Bacillus subtilis is also negatively regulated, by RapC,
VOL. 189, 2007
MULTIDRUG EFFLUX GENE EXPRESSION IN P. AERUGINOSA
whose binding to ComA inhibits the latter’s DNA-binding activity (11). Still, in each of these examples, the effector proteins are large (NifL, 519 amino acids; AppA, 450 amino acids; RapC, 382 amino acids) and capable of ligand and/or cofactor binding (31, 33), something that PA3719 (ArmR), which consists of 52 amino acids, is unlikely to be capable of. Interestingly, a small protein effector/antirepressor reminiscent of ArmR has been described in Myxococcus xanthus, where it mediates light inducibility of carotenoid biosynthesis (30, 66). The 111-amino-acid protein, CarS, modulates the activity of a CarA repressor that controls expression of carotenoid biosynthetic genes (crtEBDC) by binding to CarA and preventing the latter’s binding to its operator sequence in the crtEBDC promoter (30, 66). In contrast to AppA, however, CarS does not respond directly to light; rather, its expression is light inducible and mediated by the ECF sigma factor CarQ, whose release by the anti-sigma factor CarR occurs in response to light (17, 34). Other small protein effectors that have been described include SinI, a 56-amino-acid residue antagonist of the SinR negative regulator of sporulation in B. subtilis (6), and the 88-aminoacid Hpr and 85-amino-acid Crh effectors found in low-G⫹Ccontent gram-positive bacteria and Bacillus sp., respectively, which function as corepressors (with CcpA) in carbon catabolite regulation in these organisms (16, 22). While sinI expression itself (and SinI activity as an antirepressor) responds to unknown environmental stimuli that promote sporulation (6), the Hpr and Crh effectors are controlled by phosphorylation, with the phosphorylated forms of these proteins only able to bind CcpA and promote repressor binding to target promoters (16). PA3719 (armR) expression is under the control of the NalC repressor, and so modulation of NalC by some hitherto unknown signal(s) to effect PA3719 production may be sufficient for PA3719 to act on MexR, although we cannot rule out the possibility that some modification of the antirepressor might also be involved. In any case, the nature of the signal(s) to which NalC responds remains unknown, as do the reasons for MexAB-OprM recruitment under conditions where NalC repression of PA3719 (ArmR) is alleviated. As well, the functional significance of the PA3720 gene that forms an operon with the PA3719 gene is unclear; the deduced protein product of this gene shows no significant homology to any known protein, and no observable phenotype is associated with either overexpression or loss of this gene. One possibility, however, is that it modulates NalC repressor activity in response to the “signals” that require PA3719 and, ultimately, mexAB-oprM expression. How PA3719 (ArmR) negatively impacts MexR DNA binding and repression of target gene (mexR and mexAB-oprM) expression is uncertain, although the identification of mutations in MexR that compromise its interaction with this effector provides some room for speculation. Three of the six mutations disrupting the PA3719 (ArmR) interaction (L35P, L75P, and I104F) occur in regions of MexR which, if substantially altered by PA3719 binding, would likely alter the structure and/or disposition of the DNA recognition helix ␣-4. Clearly, this would be expected to adversely impact MexR binding to its operator sequences in the mexR-mexAB-oprM intergenic region. Still, it is unclear whether PA3719 (ArmR) acts directly on the ␣-4 helix, thereby interfering with the MexR-DNA interaction, or indirectly by altering the relative
5449
positioning of the individual DNA-binding domains of the MexR homodimer. MexR operator binding probably requires that its recognition helices fit into successive major grooves in the DNA, and thus, the spacing between the two recognition helices in the MexR dimer must match the major groove spacing in the target DNA. Thus, one way in which MexR DNA binding might be modulated and its repressor activity controlled is by altering the spacing of the DNA-binding helices (28), as has been seen for other repressor proteins (e.g., TetR [41] and FadR [65]). Mutations in MexR distant from ␣-4 also negatively impact PA3719 (ArmR) binding, and it is impossible to predict with any certainty how these mutations might impact MexR structure and thus compromise PA3719 (ArmR) binding. Significantly, four of six mutations compromising PA3719 (ArmR) binding did not adversely affect MexR repressor activity, indicating that the lack of PA3719 (ArmR) binding is not explained by a gross alteration in the MexR structure but is explained by local perturbations specifically impacting PA3719 (ArmR) binding. This in itself suggests that the DNA-binding and PA3719 (ArmR)-binding domains may, in fact, be separate entities in MexR. This is reminiscent of another MarR family regulator, OhrR, which is involved in organic hydroperoxide resistance in several bacteria and whose effector- and DNA-binding regions are also distinct (19), but it is in contrast to MarR (68) (and CarA [44]), whose effector- and DNAbinding sites overlap. Ongoing efforts to determine the structure of the PA3719-MexR complex should identify the site of interaction and thus provide insights into the mechanism of action of this protein modulator of MexR activity. ACKNOWLEDGMENTS This work was supported by operating grants from the Canadian Cystic Fibrosis Foundation (to K.P.) and the Canadian Institutes of Health Research (to N.S.). N.S. is a Howard Hughes Medical Institute International Research Scholar. M.W. is supported by studentships from the Canadian Institutes of Health Research and the Michael Smith Foundation for Health Research. D.M.D. is a Novartis Presidential Fellow. REFERENCES 1. Adewoye, L., A. Sutherland, R. Srikumar, and K. Poole. 2002. The MexR repressor of the mexAB-oprM multidrug efflux operon in Pseudomonas aeruginosa: characterization of mutations compromising activity. J. Bacteriol. 184:4308–4312. 2. Aires, J. R., and H. Nikaido. 2005. Aminoglycosides are captured from both periplasm and cytoplasm by the AcrD multidrug efflux transporter of Escherichia coli. J. Bacteriol. 187:1923–1929. 3. Alekshun, M. N., and S. B. Levy. 1999. Alteration of the repressor activity of MarR, the negative regulator of the Escherichia coli marRAB locus, by multiple chemicals in vitro. J. Bacteriol. 181:4669–4672. 4. Alekshun, M. N., S. B. Levy, T. R. Mealy, B. A. Seaton, and J. F. Head. 2001. The crystal structure of MarR, a regulator of multiple antibiotic resistance, at 2.3 Å resolution. Nat. Struct. Biol. 8:710–714. 5. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1992. Short protocols in molecular biology, 2nd ed. John Wiley & Sons, Inc., New York, NY. 6. Bai, U., I. Mandic-Mulec, and I. Smith. 1993. SinI modulates the activity of SinR, a developmental switch protein of Bacillus subtilis, by protein-protein interaction. Genes Dev. 7:139–148. 7. Barcak, G. J., M. S. Chandler, R. J. Redfield, and J. F. Tomb. 1991. Genetic systems in Haemophilus influenzae. Methods Enzymol. 204:321–342. 8. Cao, L., R. Srikumar, and K. Poole. 2004. MexAB-OprM hyperexpression in NalC type multidrug resistant Pseudomonas aeruginosa: identification and characterization of the nalC gene encoding a repressor of PA3720-PA3719. Mol. Microbiol. 53:1423–1436. 9. Choi, K. H., A. Kumar, and H. P. Schweizer. 2006. A 10-min method for preparation of highly electrocompetent Pseudomonas aeruginosa cells: ap-
5450
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20. 21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
DAIGLE ET AL.
plication for DNA fragment transfer between chromosomes and plasmid transformation. J. Microbiol. Methods 64:391–397. Chuanchuen, R., R. R. Karkhoff-Schweizer, and H. P. Schweizer. 2003. High-level triclosan resistance in Pseudomonas aeruginosa is solely a result of efflux. Am. J. Infect. Control 31:124–127. Core, L., and M. Perego. 2003. TPR-mediated interaction of RapC with ComA inhibits response regulator-DNA binding for competence development in Bacillus subtilis. Mol. Microbiol. 49:1509–1522. Dmitrova, M., G. Younes-Cauet, P. Oertel-Buchheit, D. Porte, M. Schnarr, and M. Granger-Schnarr. 1998. A new LexA-based genetic system for monitoring and analyzing protein heterodimerization in Escherichia coli. Mol. Gen. Genet. 257:205–212. Evans, K., L. Adewoye, and K. Poole. 2001. MexR repressor of the mexABoprM multidrug efflux operon of Pseudomonas aeruginosa: identification of MexR binding sites in the mexA-mexR intergenic region. J. Bacteriol. 183: 807–812. Evans, K., L. Passador, R. Srikumar, E. Tsang, J. Nezezon, and K. Poole. 1998. Influence of the MexAB-OprM multidrug efflux system on quorumsensing in Pseudomonas aeruginosa. J. Bacteriol. 180:5443–5447. Galan, B., A. Kolb, J. M. Sanz, J. L. Garcia, and M. A. Prieto. 2003. Molecular determinants of the hpa regulatory system of Escherichia coli: the HpaR repressor. Nucleic Acids Res. 31:6598–6609. Galinier, A., J. Deutscher, and I. Martin-Verstraete. 1999. Phosphorylation of either Crh or HPr mediates binding of CcpA to the Bacillus subtilis xyn cre and catabolite repression of the xyn operon. J. Mol. Biol. 286:307–314. Gorham, H. C., S. J. McGowan, P. R. Robson, and D. A. Hodgson. 1996. Light-induced carotenogenesis in Myxococcus xanthus: light-dependent membrane sequestration of ECF sigma factor CarQ by anti-sigma factor CarR. Mol. Microbiol. 19:171–186. Hirakata, Y., R. Srikumar, K. Poole, N. Gotoh, T. Suematsu, S. Kohno, S. Kamihira, R. E. Hancock, and D. P. Speert. 2002. Multidrug efflux systems play an important role in the invasiveness of Pseudomonas aeruginosa. J. Exp. Med. 196:109–118. Hong, M., M. Fuangthong, J. D. Helmann, and R. G. Brennan. 2005. Structure of an OhrR-ohrA operator complex reveals the DNA binding mechanism of the MarR family. Mol. Cell 20:131–141. Jalal, S., and B. Wretlind. 1998. Mechanisms of quinolone resistance in clinical strains of Pseudomonas aeruginosa. Microb. Drug Resist. 4:257–261. Jo, J. T., F. S. Brinkman, and R. E. Hancock. 2003. Aminoglycoside efflux in Pseudomonas aeruginosa: involvement of novel outer membrane proteins. Antimicrob. Agents Chemother. 47:1101–1111. Jones, B. E., V. Dossonnet, E. Kuster, W. Hillen, J. Deutscher, and R. E. Klevit. 1997. Binding of the catabolite repressor protein CcpA to its DNA target is regulated by phosphorylation of its corepressor HPr. J. Biol. Chem. 272:26530–26535. Keen, N. T., S. Tamaki, D. Kobayashi, and D. Trollinger. 1988. Improved broad-host-range plasmids for DNA cloning in Gram-negative bacteria. Gene 70:191–197. Lei, S., L. Pulakat, and N. Gavini. 1999. Genetic analysis of nif regulatory genes by utilizing the yeast two-hybrid system detected formation of a NifLNifA complex that is implicated in regulated expression of nif genes. J. Bacteriol. 181:6535–6539. Li, X. Z., K. Poole, and H. Nikaido. 2003. Contributions of MexAB-OprM and an EmrE homologue to intrinsic resistance of Pseudomonas aeruginosa to aminoglycosides and dyes. Antimicrob. Agents Chemother. 47:27–33. Li, X. Z., L. Zhang, and K. Poole. 1998. Role of the multidrug efflux systems of Pseudomonas aeruginosa in organic solvent tolerance. J. Bacteriol. 180: 2987–2991. Li, X. Z., and K. Poole. 1999. Organic solvent-tolerant mutants of Pseudomonas aeruginosa display multiple antibiotic resistance. Can. J. Microbiol. 45:18–22. Lim, D., K. Poole, and N. C. Strynadka. 2002. Crystal structure of the MexR repressor from the multidrug efflux operon in Pseudomonas aeruginosa. J. Biol. Chem. 277:29253–29259. Llanes, C., D. Hocquet, C. Vogne, D. Benali-Baitich, C. Neuwirth, and P. Plesiat. 2004. Clinical strains of Pseudomonas aeruginosa overproducing MexAB-OprM and MexXY efflux pumps simultaneously. Antimicrob. Agents Chemother. 48:1797–1802. Lopez-Rubio, J. J., M. Elias-Arnanz, S. Padmanabhan, and F. J. Murillo. 2002. A repressor-antirepressor pair links two loci controlling light-induced carotenogenesis in Myxococcus xanthus. J. Biol. Chem. 277:7262–7270. Martinez-Argudo, I., R. Little, N. Shearer, P. Johnson, and R. Dixon. 2004. The NifL-NifA system: a multidomain transcriptional regulatory complex that integrates environmental signals. J. Bacteriol. 186:601–610. Masuda, N., and S. Ohya. 1992. Cross-resistance to meropenem, cephems, and quinolones in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 36:1847–1851. Masuda, S., and C. E. Bauer. 2002. AppA is a blue light photoreceptor that antirepresses photosynthesis gene expression in Rhodobacter sphaeroides. Cell 110:613–623. McGowan, S. J., H. C. Gorham, and D. A. Hodgson. 1993. Light-induced
J. BACTERIOL.
35. 36.
37. 38. 39. 40. 41. 42.
43. 44.
45. 46. 47. 48. 49. 50.
51. 52. 53.
54. 55.
56. 57. 58.
59. 60.
carotenogenesis in Myxococcus xanthus: DNA sequence analysis of the carR region. Mol. Microbiol. 10:713–735. Miller, J. H. 1992. A short course in bacterial genetics. A laboratory manual and handbook for Escherichia coli and related bacteria, p. 72–74. Cold Spring Harbor Laboratory Press, Plainview, NY. Mima, T., H. Sekiya, T. Mizushima, T. Kuroda, and T. Tsuchiya. 2005. Gene cloning and properties of the RND-type multidrug efflux pumps MexPQOpmE and MexMN-OprM from Pseudomonas aeruginosa. Microbiol. Immunol. 49:999–1002. Money, T., T. Jones, R. Dixon, and S. Austin. 1999. Isolation and properties of the complex between the enhancer binding protein NifA and the sensor NifL. J. Bacteriol. 181:4461–4468. Morales, V. M., A. Backman, and M. Bagdasarian. 1991. A series of widehost-range low-copy-number vectors that allow direct screening for recombinants. Gene 97:39–47. Morita, Y., L. Cao, G. Gould, M. B. Avison, and K. Poole. 2006. nalD encodes a second repressor of the mexAB-oprM multidrug efflux operon of Pseudomonas aeruginosa. J. Bacteriol. 188:8649–8654. Murakami, S., and A. Yamaguchi. 2003. Multidrug-exporting secondary transporters. Curr. Opin. Struct. Biol. 13:443–452. Orth, P., D. Schnappinger, W. Hillen, W. Saenger, and W. Hinrichs. 2000. Structural basis of gene regulation by the tetracycline inducible Tet repressor-operator system. Nat. Struct. Biol. 7:215–219. Palmer, M. 2003. Efflux of cytoplasmically acting antibiotics from gramnegative bacteria: periplasmic substrate capture by multicomponent efflux pumps inferred from their cooperative action with single-component transporters. J. Bacteriol. 185:5287–5289. Pearson, J. P., C. Van Delden, and B. H. Iglewski. 1999. Active efflux and diffusion are involved in transport of Pseudomonas aeruginosa cell-to-cell signals. J. Bacteriol. 181:1203–1210. Perez-Marin, M. C., J. J. Lopez-Rubio, F. J. Murillo, M. Elias-Arnanz, and S. Padmanabhan. 2004. The N terminus of Myxococcus xanthus CarA repressor is an autonomously folding domain that mediates physical and functional interactions with both operator DNA and antirepressor protein. J. Biol. Chem. 279:33093–33103. Poole, K. 2001. Multidrug efflux pumps and antimicrobial resistance in Pseudomonas aeruginosa and related organisms. J. Mol. Microbiol. Biotechnol. 3:255–264. Poole, K. 2004. Efflux pumps, p. 635–674. In J.-L. Ramos (ed.), Pseudomonas, vol. I. Genomics, life style and molecular architecture. Kluwer Academic/Plenum Publishers, New York, NY. Poole, K. 2004. Efflux-mediated multiresistance in Gram-negative bacteria. Clin. Microbiol. Infect. 10:12–26. Poole, K. 2005. Efflux-mediated antimicrobial resistance 2007. J. Antimicrob. Chemother. 56:20–51. Poole, K. p. 304–324. Antimicrobial and stress resistance. In M. Ehrmann (ed.), The periplasm. ASM Press, Washington, DC. Poole, K., K. Tetro, Q. Zhao, S. Neshat, D. Heinrichs, and N. Bianco. 1996. Expression of the multidrug resistance operon mexA-mexB-oprM in Pseudomonas aeruginosa: mexR encodes a regulator of operon expression. Antimicrob. Agents Chemother. 40:2021–2028. Providenti, M. A., and R. C. Wyndham. 2001. Identification and functional characterization of CbaR, a MarR-like modulator of the cbaABC-encoded chlorobenzoate catabolism pathway. Appl. Environ. Microbiol. 67:3530–3541. Redly, A., and K. Poole. 2003. Pyoverdine-mediated regulation of FpvA synthesis in Pseudomonas aeruginosa: involvement of a probable ECF sigma factor, FpvI. J. Bacteriol. 185:1261–1265. Redly, G. A., and K. Poole. 2005. FpvIR control of fpvA ferric pyoverdine receptor gene expression in Pseudomonas aeruginosa: demonstration of an interaction between FpvI and FpvR and identification of mutations in each compromising this interaction. J. Bacteriol. 187:5648–5657. Saito, K., S. Eda, H. Maseda, and T. Nakae. 2001. Molecular mechanism of MexR-mediated regulation of MexAB-OprM efflux pump expression in Pseudomonas aeruginosa. FEMS Microbiol. Lett. 195:23–28. Saito, K., H. Yoneyama, and T. Nakae. 1999. nalB-type mutations causing the overexpression of the MexAB-OprM efflux pump are located in the mexR gene of the Pseudomonas aeruginosa chromosome. FEMS Microbiol. Lett. 179:67–72. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sanchez, P., F. Rojo, and J. L. Martinez. 2002. Transcriptional regulation of mexR, the repressor of Pseudomonas aeruginosa mexAB-oprM multidrug efflux pump. FEMS Microbiol. Lett. 207:63–68. Schweizer, H. P. 1998. Intrinsic resistance to inhibitors of fatty acid biosynthesis in Pseudomonas aeruginosa is due to efflux: application of a novel technique for generation of unmarked chromosomal mutations for the study of efflux systems. Antimicrob. Agents Chemother. 42:394–398. Sheu, D. S., Y. T. Wang, and C. Y. Lee. 2000. Rapid detection of polyhydroxyalkanoate-accumulating bacteria isolated from the environment by colony PCR. Microbiology 146:2019–2025. Sobel, M. L., D. Hocquet, L. Cao, P. Plesiat, and K. Poole. 2005. Mutations
VOL. 189, 2007
61.
62. 63. 64.
MULTIDRUG EFFLUX GENE EXPRESSION IN P. AERUGINOSA
in PA3574 (nalD) lead to increased MexAB-OprM expression and multidrug resistance in lab and clinical isolates of Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 49:1782–1786. Srikumar, R., T. Kon, N. Gotoh, and K. Poole. 1998. Expression of Pseudomonas aeruginosa multidrug efflux pumps MexA-MexB-OprM and MexCMexD-OprJ in a multidrug-sensitive Escherichia coli strain. Antimicrob. Agents Chemother. 42:65–71. Srikumar, R., X.-Z. Li, and K. Poole. 1997. Inner membrane efflux components are responsible for the -lactam specificity of multidrug efflux pumps in Pseudomonas aeruginosa. J. Bacteriol. 179:7875–7881. Srikumar, R., C. J. Paul, and K. Poole. 2000. Influence of mutations in the mexR repressor gene on expression of the MexA-MexB-OprM multidrug efflux system of Pseudomonas aeruginosa. J. Bacteriol. 182:1410–1414. Srikumar, R., and K. Poole. 1999. Demonstration of ethidium bromide efflux by multiresistant pumps of Pseudomonas aeruginosa. Clin. Microbiol. Infect. 5:5S58–5S59.
5451
65. van Aalten, D. M., C. C. DiRusso, and J. Knudsen. 2001. The structural basis of acyl coenzyme A-dependent regulation of the transcription factor FadR. EMBO J. 20:2041–2050. 66. Whitworth, D. E., and D. A. Hodgson. 2001. Light-induced carotenogenesis in Myxococcus xanthus: evidence that CarS acts as an anti-repressor of CarA. Mol. Microbiol. 42:809–819. 67. Wilkinson, S. P., and A. Grove. 2004. HucR, a novel uric acid-responsive member of the MarR family of transcriptional regulators from Deinococcus radiodurans. J. Biol. Chem. 279:51442–51450. 68. Wilkinson, S. P., and A. Grove. 2006. Ligand-responsive transcriptional regulation by members of the MarR family of winged helix proteins. Curr. Issues Mol. Biol. 8:51–62. 69. Zhao, Q., X.-Z. Li, R. Srikumar, and K. Poole. 1998. Contribution of outer membrane efflux protein OprM to antibiotic resistance in Pseudomonas aeruginosa independent of MexAB. Antimicrob. Agents Chemother. 42: 1682–1688.
