Purification and characterization of a thermotolerant ...

International Biodeterioration & Biodegradation 93 (2014) 186e194

Contents lists available at ScienceDirect

International Biodeterioration & Biodegradation journal homepage: www.elsevier.com/locate/ibiod

Purification and characterization of a thermotolerant laccase isoform in Trametes trogii strain and its potential in dye decolorization Jinping Yan a, 1, Daidi Chen a, 1, En Yang a, Jiezhen Niu a, Yuhui Chen b, Irbis Chagan a, * a b

Biotechnology Research Center of Life Science and Technology College, Kunming University of Science and Technology, Kunming Yunnan 650500, PR China College of Life Science, the Southwest Forest University, Kunming Yunnan 650224, PR China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 29 November 2013 Received in revised form 28 May 2014 Accepted 3 June 2014 Available online 22 June 2014

Using response surface methodology, the maximum laccase activity of 122.9 U ml1 was obtained in Trametes trogii S0301. The major isoform of the laccase secreted in the optimized medium was purified by 4-fold to a specific activity of 352.1 U mg1 protein. The laccase (a molecular mass of 56 kDa), acted optimally at pH 3.0 and exhibited an optimum temperature of 45 C using ABTS as substrate, with the half-life at 60 C and 75 C for 3 h and 10 min, respectively. The purified laccase was highly resistant to Co2þ, Cu2þ, Zn2þ and Mn2þ (100 mM). In addition, the purified laccase was effective to decolorize malachite green, bromophenol blue, crystal violet and acid red without the addition of redox mediators. Peptide-mass fingerprinting analysis by MALDI-TOF MS showed the purified laccase of T. trogii S0301 was a typical laccase isoform, which shared 99.3% identity with a laccase from Coriolopsis gallica. Further, the full-length DNA of the laccase was cloned based on the highly conservative copper-binding domains using degenerate PCR and TAIL-PCR, and the deduced amino acid sequence of the matured protein matched exactly with the peptides of the purified laccase. © 2014 Elsevier Ltd. All rights reserved.

Keywords: Trametes trogii Laccase Purification Characterization Dye decolorization

1. Introduction Laccase (EC1.10.3.2) is a group of copper-containing polyphenol oxidases which belongs to multi-copper oxidases family (Solomon et al., 1996; Hakulinen et al., 2002). The enzyme can nonspecifically oxidize various phenolic and non- phenolic compounds, using molecular oxygen as the final electron acceptor n et al., 2009; Polak and Jarosz-Wilkolazka, (Baldrian, 2006; Hilde 2012). Thus, laccase has many kinds of actual and potential applications in various fields, including pulp and paper industries, textile and dye industries, bioremediation (Couto and Herrera, 2006; Kunamneni et al., 2008; Dwivedi et al., 2011), organic synthesis, nanobiotechnology (Couto and Herrera, 2006; Dwivedi et al., 2011), cosmetics (Couto and Herrera, 2006), cross-linking of polysaccharides, medical applications, enzymatic and immunochemical assays (Dwivedi et al., 2011). The first laccase was found in the Japanese lacquer tree Rhus vernicifera by Yoshida (1883). Nowadays, laccases have been found in plants, insects, bacteria and fungi (Dwivedi et al., 2011), but

* Corresponding author. Tel.: þ86 871 65952573. E-mail address: sunfl[email protected] (I. Chagan). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.ibiod.2014.06.001 0964-8305/© 2014 Elsevier Ltd. All rights reserved.

white rot fungi (WRF) are the major producers (Palonen et al., 2003; Baldrian, 2006; Dwivedi et al., 2011; Schückel et al., 2011). Interestingly, there are several isoforms with different kinetic or physicochemical features even in the same fungus strain, and those isoforms can express under different cultivation conditions or at different stages during the fungal life cycle (Baldrian, 2006; Kunamneni et al., 2008). The activity of fungal laccases usually drops rapidly when the n et al., 2009; Dwivedi et al., temperature is above 60 C (Hilde 2011). Exceptionally, most laccases from the Trametes (synonym n et al., Coriolous) species show highly thermal stability (Hilde 2009). Moreover, the Trametes species are among the most important sources for laccases with other attractive properties such as higher resistance to high alkalinity, extreme acidity, organic n et al., 2009; solvents and heavy metals (Boonlue et al., 2003; Hilde ^ssi et al., 2013). As a result, laccases from the Grassi et al., 2011; Daa Trametes strains, such as Trametes trogii, Trametes pubescens and Trametes versicolor have attracted much more attention (Guan et al., 2011; Zhu et al., 2011; Si et al., 2013). The ability of T. trogii strains and the efficiency of their laccases to decolorize and degrade industrial dyes have been confirmed by several studies (Levin et al., 2003, 2005; Chakroun et al., 2009; Khlifi et al., 2010; Zeng et al., 2011). And some laccase isoforms of

J. Yan et al. / International Biodeterioration & Biodegradation 93 (2014) 186e194

T. trogii strains have been purified and characterized (Vares and Hatakka, 1997; Levin et al., 2002; Deveci et al., 2004; Patrick et al., 2009; Grassi et al., 2011; Guan et al., 2011). However, those studies reported that the half-life of laccase activity (T1/2) of the purified laccase from T. trogii only was 30 min at 60 C (Patrick et al., 2009), and T. trogii 463 with T1/2 of 2 h at 60 C (Levin et al., 2002; Grassi et al., 2011). In addition, only two different laccase genes (lcc1, CAC13040 and lcc2, CAL23367) have been cloned in T. trogii until now (Colao et al., 2003). T. trogii is a thermotolerant species preferring sun-exposing habitat, and the properties of the laccases are usually correlated with the temperature range of the growth of n et al., 2009). Therefore, it is evident the source organism (Hilde that there are other laccase isoforms with attractive properties in T. trogii strain. T. trogii Berk S0301 strain was obtained in our previous studies, and the crude laccase of that strain showed efficient decolorization of malachite green at high temperatures and ionic concentrations (Yan et al., 2014). Based on those results, the main objectives of this study were (i) to enhance the laccase production in T. trogii S0301 by response surface methodology; (ii) to purify and characterize the major isoform of laccase secreted in the optimized medium; (iii) to assess the decolorization ability of the purified laccase without the addition of redox mediators, and to (iv) identify the gene of the laccase. 2. Materials and methods 2.1. Chemicals and fungal strain 2, 20 -azino bis (3-ethylbenzthiazoline-6-sulphonic acid) (ABTS) is from Sigma (USA), and Malachite Green (MG), Gentian Violet and Bromophenol Blue from Merck (USA). Acid Red is supplied by the Environmental Monitoring Station of Dali, Yunnan province, China. T. trogii S0301 strain is stored at the strain collection of Biotechnology Research Center of Life Science and Technology College, Kunming University of Science and Technology. Strain is routinely maintained on GYP slant at 4 C (Fan et al., 2011). 2.2. Culture condition The mycelia from the slant were transferred to the GYP plates and incubated at 30 C for 5 d. Inocula were prepared in 250 ml Erlenmeyer flask containing 50 ml of GYP starting from 4 mycelial plugs (1 cm in diameter). Cultures grow for 5 days at 30 C were homogenized by beaded glasses (0.3 mm in diameter), and 5% (v/v) aliquots of the mycelia suspension were used as inocula for the further study. 2.3. Optimization of laccase production by response surface methodology (RSM) In this study, the production optimization medium contained glucose, yeast extract/peptone (1/1), FeSO4, CaCl2, MgSO4, MnSO4, VB1, CuSO4, phenol, Tween-80 and PEG 4000. CuSO4, phenol and PEG 4000 were considered the most effective independent variables based on the results of the earlier PlacketteBurman experiment (Design-Expert 8.0.5 b). Using the laccase production as the response variable, further optimization was conducted by the central composite design (CCD) of RSM, and CuSO4, phenol and PEG 4000, at five different levels (-a, 1, 0, þ1 and þa), were chosen in this study. The levels of these variables and twenty runs were designed by Design-Expert 8.0.5 b (Table 1). The proof tests were carried out under the optimum medium contained glucose 28 g L1, yeast extract/peptone 10 g L1, FeSO4 0.4 mM, VB1 0.2 g L1, CuSO4

187

Table 1 Experimental design and results of CCD. Std CuSO4 (mM)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

Phenol (mg l1)

PEG4000 (mg l1)

Response for Residual value activity (U ml1) (U ml1)

X1

X2

X3

Actual Predicted

1.15 1.65 1.15 1.65 1.15 1.65 1.15 1.65 0.98 1.82 1.40 1.40 1.40 1.40 1.40 1.40 1.40 1.40 1.40 1.40

24.50 24.50 31.50 31.50 24.50 24.50 31.50 31.50 28.00 28.00 22.11 33.89 28.00 28.00 28.00 28.00 28.00 28.00 28.00 28.00

45.00 45.00 45.00 45.00 75.00 75.00 75.00 75.00 60.00 60.00 60.00 60.00 34.77 85.23 60.00 60.00 60.00 60.00 60.00 60.00

63.95 66.15 93.92 98.45 49.88 54.04 115.42 117.32 82.04 83.75 77.33 76.78 56.96 56.04 78.63 80.05 33.61 31.09 81.03 78.43 80.13 77.18 71.91 69.75 125.32 119.46 102.16 102.92 94.36 91.87 85.70 91.87 94.43 91.87 98.34 91.87 86.60 91.87 90.89 91.87

2.20 4.53 4.17 1.90 1.72 0.55 0.92 1.42 2.52 2.59 2.95 2.16 5.86 0.75 2.49 6.17 2.57 6.48 5.27 0.98

1.65 mM, phenol 30.54 mg L1, Tween-80 6 g L1 and PEG4000 45 mg L1 according to the fitted equation below (X1-CuSO4, X2phenol and X3 -PEG4000). Variance (ANOVA) and regression analysis, and contour plots were drawn by Design-Expert 8.0.5 b.

Y ¼ 665:95 þ 553:32X1 þ 21:18X2 þ 1:77X3 þ 8:85X1 X2 2:62X1 X3 0:074X2 X3 209:90X12 0:53X22 þ 0:030X32 2.4. Laccase purification The supernatants of 9-day-old liquid culture of T. trogii S0301 were obtained by centrifugation (9000 rpm, 5 min at 4 C), and then the total protein was precipitated from the supernatants with ammonium sulfate (80% saturation). The precipitates formed was dissolved in buffer A (50 mM TriseHCl, pH 6.0) and dialyzed against the same buffer overnight at 4 C (8 kDa cut off). The dialyzed enzyme solution was loaded onto a Q SepharoseTM ion-exchange chromatography column (GE Healthcare) pre-equilibrated with 1 M NaCl in buffer A, and then the enzyme was eluted with a linear salt gradient in 0e1 M NaCl in buffer A at the flowing rate of 2 ml min1. The fractions with laccase activity were collected, concentrated by lyophilization and dissolved in 3 ml buffer A. And then, the concentrated enzyme solution was loaded onto a Sephadex G-75 Medium chromatography (Biotopped) column preequilibrated with buffer A, and then eluted with buffer A at the flowing rate of 0.4 ml min1. The purified laccase was collected and stored at 20 C until use. 2.5. Enzyme assay Laccase activity was determined with ABTS (3420 ¼ 36(mM cm)1) as substrate. Mixture of 0.5 ml appropriately diluted crude or purified enzyme and 1.1 ml of 2 mM ABTS in phosphate citrate buffer (100 mM, pH 4.0) was used to determine the activity. The increase in absorbance was monitored at 420 nm for 3 min (Bourbonnais and Michael, 1990). One unit of the enzyme activity was defined as the amount of the enzyme that oxidized 1 mmol of the ATBS per minute. Protein concentration was estimated by the Bradford method (Bradford, 1976), with bovine serum albumin as the standard. All experiments were

188


repeated at least three times, and control samples were run in parallel containing the same amount of heat-denatured laccase. 2.6. Gel electrophoresis Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and native-PAGE were carried according to Si et al. (2013) with a 5% (w/v) stacking gel and a 12% (w/v) separating gel using a vertical gel electrophoresis system (Bio-Rad). After electrophoresis, the SDS-PAGE was stained with Coomassie Brilliant Blue R-250 at 37 C for 45 min, while the native-PAGE with citrate-phosphate buffer (100 mM, pH 4.0) containing 1.0 mM ABTS (Si et al., 2013). Low-molecular-mass protein marker (TaKaRa) was used. 2.7. Effects of temperature, pH and metal ions on laccase activity and stability For the optimum temperature assay, the activity of the purified laccase was measured at a temperature range of 30e80 C for 3 min with ABTS as substrate (Halaburgi et al., 2011). To determine the thermostability, the purified laccase was incubated at a temperature range of 20e85 C in phosphate citrate buffer (100 mM, pH 4.0) for 30 min and then the residual laccase activity was determined at room temperature. To further determine the half-life at certain temperature, the residual laccase activity was determined after the purified laccase was incubated at given temperature in phosphate citrate buffer (100 mM, pH 4.0) with different time intervals. The optimum pH of the purified laccase was measured at a pH range from 2.0 to 8.0 using 100 mM citrate-phosphate buffer at 30 C for 3 min with ABTS as substrate (Guan et al., 2011). To determine the pH stability, the purified laccase was incubated in 100 mM citrate-phosphate buffer (pH 2.0e8.0) for 12 h and 24 h at 30 C, and the residual laccase activity was determined with ABTS as substrate. To determine the effect of metal ions on the activity of the purified laccase, the reaction mixture containing 100 mM citratephosphate buffer (pH 4.0), 2 mM ABTS and 12 U ml1 the purified laccase, was added with Cu2þ, Co2þ, Mg2þ, Mn2þ, Zn2þ, Fe2þ, Cd2þ or Naþ to get a final concentration of 5 mM or 100 mM (Younes and Sayadi, 2011; Zhu et al., 2011). The laccase activity of the reaction mixture without metal ions was recorded as 100%. 2.8. Kinetic studies The laccase steady-state kinetic parameters (Km and Kcat) were determined using ABTS as substrate at the optimal condition (pH 3.0 and 45 C) of the purified laccase according to Younes and Sayadi, 2011. The concentration of ABTS was range from 0 to 2 mM and the Km and Kcat values were calculated based on LineweavereBurk plots. Kinetic studies were performed in triplicate. 2.9. Peptide-mass fingerprinting analysis The laccase band was cut up from the SDS-PAGE and digested with trypsin. After desalination, the trypsin-digested fragments were subjected to matrix-assisted laser desorption ionization timeof-flight mass spectrometry (MALDI-TOF MS) analysis using commercial service provided by Sangon Biotech on 4800 Plus MALDI TOF/TOFTM Analyzer (ABI, Foster City). Amino acid sequences were identified by homology using an mass spectrometry data analysis program, SEQUEST (Thermo Finnigan, San Jose, CA, USA), against the database of the National Center for Biotechnology Information (NCBI) fungal laccase sequence database.

2.10. Laccase gene cloning The sequences of the oligonucleotide primers used in this study are shown in Table 2. The degenerate primers (Cu I and Cu IV) were synthesized according to Fan et al. (2011). Total genomic DNA extracted from T. trogii S0301 by CTAB method was used as the template for degenerate PCR. The 1.6 kb products were cloned into pMD19-T vector (TaKaRa) and sequenced. Based on the sequence of the cloned 1.6 kb fragment, six nested primers (L3' sp1, L 3' sp2 and L3' sp3 for 3'-flanking sequence; L5' sp1, L5' sp2 and L5' sp3 for 5'flanking sequence) were designed and TAIL-PCR was carried out to get the full laccase gene according to the standard procedures for the genome walking kit (TaKaRa). The products of TAIL-PCR were cloned into pMD19-T vector (TaKaRa) and sequenced. The oligonucleotide primers were generated with Primer Premier 5.0 software. The full laccase gene was generated with DNAMAN 6.0 software. The gene structure and amino acid sequences of full laccase were predicted and analyzed with Soft Berry-FGENSH/HMM-based gene structure prediction (http://linux1.softberry.com/berry.phtml? topic¼fgenesh&group¼programs&subgroup¼g find). The homology between the presumed amino acid sequences of full laccase and other known laccase proteins were analyzed by BLAST. The multiple amino acid sequences alignments of the full laccase and other laccases protein were generated with Vector NTI 1.0 software. 2.11. Dyes decolorization The dye decolorization reaction was performed by adding 0.5 U purified laccase to a 2-ml reaction mixture containing different dyes in 100 mM citrate-phosphate buffer (pH 4.0) and incubated at 30 C (Younes et al., 2007; Schückel et al., 2011). And the concentration of each dye was as follows: 10 mg l1 for malachite green, 25 mg l1, 50 mg l1 and 125 mg l1 for bromophenol blue, 25 mg l1 for crystal violet and acid red (Younes et al., 2007; Grassi et al., 2011; Schückel et al., 2011). The absorbance of the mixture at the maximum wavelength of various dyes was recorded within different time intervals. The maximum wavelength of malachite green, bromophenol blue, crystal violet and acid red is 618 nm, 592 nm, 590 nm and 510 nm, respectively. Decolorization was calculated according to the following formula: decolorization (%) ¼ A0At/A0*100%, while A0 was the initial absorbance and At was the final absorbance. All experiments were preformed in triplicate, and control samples were also run in parallel and contained the reaction mixture with the same amount of the heatdenatured laccase. 3. Results and discussion 3.1. Fermentation optimization For the laccase production, the signification variables were screened by PlacketteBurman experiment, and the most effective Table 2 Oligonucleotide primers used in this study. Primer

Nucleotide sequence

Cu I Cu IV L3’sp1 L3’sp2 L3’sp3 L5’sp1 L5’sp2 L5’sp3

CAYTGGCAYGGNTTYTTYCA TGRAARTCDATRTGRCARTG GTCTCGCTCGTCCATCCCTTAG CTCCTGCAGATCCTGAGCGGC CCCATTCGCTCACAGCACGC CCAGACGAAATAGACTCACGGGA TTAGCATTCGCAAAGACTCCAGTATCA GGCTATTAGCACCGGACTTTGTTCG

D ¼ A/G/T, N ¼ A/G/C/T, R ¼ A/G, Y]C/T.


189

Fig. 1. The interaction between CuSO4, phenol and PEG 4000 for the maximum laccase production on 3D response surface plot. (a), CuSO4 and phenol; (b), CuSO4 and PEG 4000; (c), phenol and PEG 4000.

independent variables (CuSO4, phenol and PEG 4000) were screened for CCD to study the relationship between the independent variables and the response. Table 1 shows the comparison of observed values, predicted values and the comparison of the residual values, which indicated

that the actual values of experiments fit to the predicted value of central composite design. The F-value of 39.85 indicated that the significance of the model. The P-value