Purification and Characterization of Two Novel Antimicrobial Peptides ...

CURRENT MICROBIOLOGY Vol. 51 (2005), pp. 292–296 DOI: 10.1007/s00284-005-0004-3

Current Microbiology An International Journal ª Springer Science+Business Media, Inc. 2005

Purification and Characterization of Two Novel Antimicrobial Peptides Subpeptin JM4-A and Subpeptin JM4-B Produced by Bacillus subtilis JM4 Shimei Wu,1,2 Shifang Jia,1 Dandan Sun,1 Meiling Chen,1 Xiuzhu Chen,1 Jin Zhong,1 Liandong Huan3 1

Molecular Microbiology Research Center, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100080, P.R. China Graduate School of the Chinese Academy of Sciences, Beijing 100039, P.R. China 3 State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100080, P.R. China 2

Received: 30 January 2005 / Accepted: 12 May 2005

Abstract. An antimicrobial peptides-producing strain was isolated from soil and identified as Bacillus subtilis JM4 according to biochemical tests and 16S rDNA sequence analysis. The corresponding antimicrobial peptides were purified to homogeneity by ammonium sulfate precipitation, sequential SPSepharose Fast Flow, Sephadex G-25 and C18 reverse-phase chromatography, and in the final purification step, two active fractions were harvested, designated as Subpeptin JM4-A and Subpeptin JM4-B. The molecular weights, determined by mass spectrometry, were 1422.71 Da for Subpeptin JM4-A and 1422.65 Da for Subpeptin JM4-B, respectively. Amino acid sequencing showed that they differed from each other only at the seventh amino acid except for three unidentified residues, and the two peptides had no significant sequence homology to the known peptides in the database, indicating that they are two novel antimicrobial peptides. In addition, characteristic measurements indicated that both peptides had a relatively broad inhibitory spectrum and remained active over a wide pH and temperature range.

Peptides with biological activities belong to a large and diverse family of natural products, which include antibiotics, enzyme inhibitors, plant or animal toxins, and immunosuppressants. According to the manner of synthesis, these peptides fall into two classes: nonribosomally synthesized peptide and ribosomally synthesized peptide. The former often contains nonprotein amino acids such as D-amino acids or hydroxy amino acids and other amino acid constituents that undergo extensive modification, including N-methylation, acylation, and covalent linkage to another unusual function group. Examples of this type peptide include the well-known antibiotic polymyxin and penicillin [13, 17]. The latter often undergoes posttranslational modification and proteolytic processing, such as the most studied bacteriocins subtilin and nisin [6]. Correspondence to: Jin Zhong; email: [email protected] & Liandong Huan; email: [email protected]

Bacillus is an interesting genus to be investigated for antimicrobial activity because Bacillus species produce a large number of peptides with biological activities. For example, cerecin 7, produced by B. cereus Bc7, has a molecular weight of 3.94 kDa and inhibits a wide range of Gram-positive bacteria [9]. Tochicin, isolated from B. thuringiensis, appears to be exclusively active against other B. thuringiensis strains [10]. Thuricin 7, thuricin 439, and entomocidus 9 were also isolated from members of the genus Bacillus [1–3]. Thuricin 7 and entomocidus 9 are active against some severe pathogenic and spoilage organisms, such as Listeria monocytogenes, Streptococcus pyogenes, and Pseudomonas aeruginosa. The present study describes the identification of an antimicrobial peptides-producing strain B. subtilis JM4 isolated from soil, and the purification and characterization of the corresponding antimicrobial peptides, Subpeptin JM4-A and Subpeptin JM4-B.

293

S. Wu et al.: Novel peptides from Bacillus Table 1. Inhibition spectra of Subpeptin JM4-A and Subpeptin JM4-B Diameter of zone of inhibition (mm) Strain Gram-positives Bacillus subtilis CGMCC 1.1087 Bacillus cereus CGMCC 1.819 Bacillus megaterium CGMCC 1.941 Lactobacillus plantarum CGMCC 1.3 Lactobacillus casei ATCC2709 Lactobacillus viridescens CGMCC 1.14 Micrococcus flavus NCIB8166 Staphylococcus aureus CGMCC 1.2645 Corynebacterium glutamicum CGMCC 1.299 Streptococcus faecalis CGMCC 1.130 Leuconostoc mesenteroides CGMCC 1.17 Gram-negatives Escherichia coli CMCC44104 Pseudomonas aeruginosa CGMCC 1.50 Salmonella CMCC50311 Shigella flexineri CMCC51285

Materials and Methods Bacterial strains and culture conditions. The antimicrobial peptide Subpeptin JM4-A and Subpeptin JM4-B-producing strain was isolated from a soil sample of Beijing in China and cultured in LB medium at 37
C. Other strains used in this study are listed in Table 1. Lactobacillus strains and Leuconostoc strain were grown in MRS at 30
C, and Micrococcus strain and Staphylococcus strain were grown in SI medium at 30
C, whereas other strains were incubated in LB medium at 37
C. Identification of the antimicrobial peptides-producing strain. To identify the antimicrobial peptides-producing strain, a series of biochemical tests were performed, such as utilization of citrate and propionate, acid production from glucose and xylose, hydrolyzation or degradation of some relative compounds, and acetyl-methyl-carbinol production (VP) test. Primers used for 16S rDNA sequence analysis were 16SF(5¢AGAGTTTGATCCTGGCTCAG3¢) and 16SR(5¢ AAGGAGGTGATCCAGCC 3¢). PCR was performed under the following condition: 94
C for 3 min, 30 cycles of (94
C for 1 min, 52
C for 1 min, 72
C for 2 min), 72
C for 10 min. The PCR product was ligated to pGEM-T vector (Promega) for DNA sequencing. Antimicrobial activity assay. Antimicrobial activity was measured by agar well diffusion assay with plates preseeded with indicator strain Micrococcus flavus NCIB8166 as described by Cintas et al. [4]. The agar wells were filled with 50 lL serial twofold dilutions and corresponding plates were incubated at 37
C overnight. One arbitrary unit (AU) was defined as the reciprocal of the highest dilution yielding a definite zone of inhibition on the indicator lawn. Purification of Subpeptin JM4-A and Subpeptin JM4-B. Bacillus subtilis JM4 was grown in LB broth at 37
C until it reached early stationary phase. Cells were removed by centrifugation (4
C, 8000 g, 10 min) and peptides in the supernatant were precipitated at 4
C overnight with ammonium sulfate of 80% saturation. The resulting precipitate was harvested by centrifugation (4
C, 8000 g, 30 min), resuspended in 50 mM sodium citrate buffer (pH 4.0), dialyzed against the same buffer at 4
C for 12 h, and insoluble debris was removed from

Subpeptin JM4-A

Subpeptin JM4-B

0 15 25 15 20 22 30 0 26 16 20

0 23 30 20 28 30 30 15 30 25 30

0 0 15 0

0 0 22 15

the dialysate. The crude extracts were applied to SP-Sepharose Fast Flow column (Amersham Phamacia Biotech), eluted with 0–0.5 M linear gradient of sodium chloride. Active fractions were concentrated by lyophilizing, loaded onto a Sephadex G-25 column (Amersham Phamacia Biotech), and eluted with distilled water. For final purification, concentrated active fractions were applied to a C18 reverse-phase high-performance liquid chromatograph (RP-HPLC) column (Sinochrom ODS-BP, Japan), and performed with 30–35% acetonitrile/H2O linear gradient containing 0.1% (v/v) trifluoroacetic acid over a 60-min period. The purified antimicrobial peptides were separated by tricine sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDSPAGE) as described by Schagger and von Jagow [15]. For in situ detection of inhibitory activity, the gel was washed with sterile water and placed onto a sterile dish, then overlaid with soft agar containing 106 cells of indicator strain and incubated overnight at 30
C. Amino acid sequencing and mass spectrometry analysis. Amino acid sequencing of the purified Subpeptin JM4-A and Subpeptin JM4B was performed by Edman degradation (Applied Biosystems, USA). Their molecular weights were determined by matrix-assisted laser desorption/ionization time of flight mass spectrometry on a BIFLEX III TOF-MS instrument. Characteristics of Subpeptin JM4-A and Subpeptin JM4-B. To determine their proteolytic nature, samples were incubated at 37
C for 3 h with proteinase K, pronase E, pepsin, and trypsin (all in final concentration of 1 mg/mL), respectively. To analyze thermal stability, samples were exposed to various temperatures ranging from 20
C to 120
C for 30 min. The effect of pH on their activities was determined by adjusting pH of samples from 2 to 12, and incubated at 37
C overnight. Each experiment was done with 1 mL Subpeptin JM4-A and Subpeptin JM4-B at specific activity of 1280 AU/mL, respectively, and assayed by agar well diffusion, and untreated samples were used as control. Isoelectric points of Subpeptin JM4-A and Subpeptin JM4-B were determined according to the method described by Kabir [7]. Inhibition spectra of Subpeptin JM4-A and Subpeptin JM4B. Inhibition spectra of Subpeptin JM4-A and Subpeptin JM4-B

294

CURRENT MICROBIOLOGY Vol. 51 (2005)

Table 2. Activity recoveries of Subpeptin JM4-A and Subpeptin JM4-B at different purification stages Purification stage Growth medium Ammonium sulfate precipitation SP-Sepharose F. F. Sephadex G-25 RP-HPLC JM4-A RP-HPLC JM4-B

Volume (mL)

Specific activity (AU/mL)

1000 64 6 3 1 1.5

640 5120 20,480 25,600 5120 40,960

Total activity (AU) 6.4 3.28 1.23 0.77 0.05 0.61

· · · · · ·

105 105 105 105 105 105

Recovery (%) 100 51.2 19.2 12 0.8 9.6

Fig.1. RP-HPLC elution profile of antimicrobial peptide purification. Elution was performed with 30%– 35% acetonitrile/H2O linear gradient over a 60-min period. Two active fractions were eluted at 22 min (Subpeptin JM4-A) and 31 min (Subpeptin JM4-B), respectively. were determined by agar well diffusion assay. All strains were preseeded in agar plates as previously described: the wells were filled with 50 lL Subpeptin JM4-A and Subpeptin JM4-B under the specific activity of 1280 AU/mL, respectively, and corresponding plates were incubated at 37
C overnight before examining the inhibition zones. In order to investigate a possible synergetic effect, combinations of Subpeptin JM4-A and Subpeptin JM4-B at three different volume ratios of 1:3, 1:1, and 3:1 were tested against the indicator strain.

Tricine SDS-PAGE and in situ detection of inhibitory activity confirmed the homogeneity and activity of the purified Subpeptin JM4-A and Subpeptin JM4-B (Fig. 2).

Strain identification. Biochemical tests showed that the antimicrobial peptides-producing strain could utilize citrate and propionate, produce acid from glucose, xylose, and hydrolyze or degrade starch, casein, and tyrosine, and give positive result for the acetyl-methylcarbinol production test (VP). Furthermore, partial sequencing of 16S rDNA (GenBank accession number of AY728013) showed that it was closely related to B. licheniformis and B. subtilis. Based on above results, the antimicrobial peptides-producing strain was designated B. subtilis JM4.

Molecular weight determination and amino acid sequencing analysis. Tricine SDS-PAGE showed that the molecular weights of Subpeptin JM4-A and Subpeptin JM4-B were smaller than 2.5 kDa. Their accurate molecular weights were examined by means of mass spectrometry with the results of 1422.71 Da and 1422.65 Da for Subpeptin JM4-A and Subpeptin JM4-B, respectively, which coincided with the results obtained from tricine SDS-PAGE (Fig. 2). Amino acid sequences of Subpeptin JM4-A and Subpeptin JM4-B were carried out (Fig. 3), in which X represents unidentified amino acid. It was showed that Subpeptin JM4-A and Subpeptin JM4-B consist of 12 amino acids, and both peptides differed from each other only at the seventh amino acid except the three unidentified residues.

Purification of Subpeptin JM4-A and Subpeptin JM4-B. Subpeptin JM4-A and Subpeptin JM4-B were purified by ammonium sulfate precipitation, sequential SP-Sepharose Fast Flow, Sephadex G-25, and C18 RPHPLC (Table 2), and the final step of the purification procedure gave two active peptide peaks designated as Subpeptin JM4-A and Subpeptin JM4-B (Fig. 1).

Characteristics of Subpeptin JM4-A and Subpeptin JM4-B. As shown in Table 3, no loss of activity was observed when they were incubated with pronase E and pepsin, whereas proteinase K and trypsin decreased their activity to a different degree, and Subpeptin JM4-A was more sensitive to trypsin than Subpeptin JM4-B was. Both peptides retained full activity when exposed to

Results

295

S. Wu et al.: Novel peptides from Bacillus

Fig. 2. Tricine SDS-PAGE and in situ activity assay of Subpeptin JM4-A and Subpeptin JM4-B. (A) The gel was washed with sterile water, overlaid with soft agar containing the indicator strain, and incubated overnight to show inhibition zones. (B) The gel was stained with Coomassie brilliant blue R 250, and the peptide molecular weight standard is shown on the right lane.

Fig. 3. Amino acid sequences of Subpeptin JM4-A and Subpeptin JM4-B.

Table 3. Effect of different enzymes, temperature, and pH on inhibitory activities of Subpeptin JM4-A and Subpeptin JM4-B Inhibitory activities (AU/mL) Treatment Enzymes Control Pronase E Pepsin Proteinase K Trypsin Temperature (
C) Control 20 40 60 100 120 pH Control 2 4 6 8 10

Subpeptin JM4-A

Subpeptin JM4-B

1280 1280 1280 640 320

1280 1280 1280 640 640

1280 1280 1280 1280 1280 640

1280 1280 1280 1280 1280 640

1280 1280 1280 1280 1280 640

1280 1280 1280 1280 1280 640

temperatures ranging from 20
C to 100
C for 30 min, and only about 50% of activities were lost when they were exposed to 120
C for 30 min. pH had little effect on them because their activities only declined as pH went up to 10. Isoelectric focusing electrophoresis showed that the isoelectric point of Subpeptin JM4-A was about 7.3 and that of Subpeptin JM4-B was about 8.0.

Inhibitory spectra of Subpeptin JM4-A and Subpeptin JM4-B. The spectra of Subpeptin JM4-A and Subpeptin JM4-B against Gram-positive and Gram-negative bacteria were tested (Table 1). Both peptides were active mainly against Gram-positive bacteria, including some pathogenic and spoilage microorganisms, such as Bacillus cereus, Leuconostoc mesenteroides, and Staphylococcus aureus. Among Gram-negative bacteria tested, only the pathogenic bacteria Salmonella strain and Shigella flexineri were inhibited. Furthermore, the inhibitory activity of Subpeptin JM4-A was lower than that of Subpeptin JM4-B, and combination of the two peptides at different volume ratio did not result in a significant synergistic effect.

Discussion The homogeneity of Subpeptin JM4-A and Subpeptin JM4-B was obtained by a four-step purification procedure, and Edman sequencing indicated that Subpeptin JM4-A and Subpeptin JM4-B consist of 12 amino acids with the first, second, and sixth residue unidentified. Previous works showed that some antimicrobial peptides produced by Bacillus genus often contained unusual residues, such as amino acids of formylated, acylated, and covalent linked to another function group in nonribosomal peptide gramicidin, surfactin, and iturin [5, 8, 16], as well as posttranslational modified amino acids in ribosomal peptide subtilin and sublacin [6, 11]. It is well known that such unusual residues interfere with peptide sequencing. In addition, the presence of cysteine at such a position also results in unidentified residue by Edman sequencing. Therefore, the existence of unidentified residues in Subpeptin JM4-A and Subpeptin JM4-B might be a result of presence of one or more of these elements. A BLAST search in the NCBI database indicates that the two antimicrobial peptides are unique. The most homologous antimicrobial peptides are bacteriocin-like

296 lichenin and nonribosomal peptide bacitracin, but the identity between them is only about 50%–60%, and their characteristics are largely different. For example, the production and biological activity of lichenin is strictly dependent upon the absence of oxygen [12], and bacitracin activity requires the presence of divalent metal ions [14], whereas the production and activity of Subpeptin JM4-A and JM4-B are independent of the absence of oxygen and still retain full activity when treated with EDTA (data not shown). Based on these results, the two antimicrobial peptides appear to be novel, so we designated them as Subpeptin JM4-A and JM4-B and deposited them in the Swissprot database under the accession numbers of P83878 and P83879, respectively. Some strains, especially in Bacillus genus, often produce a series of nonribosomal peptide isoforms. For example, fengycin produced by B. subtilis is a mixture of isoform fengycin A and fengycin B, wherein fengycin A differs from fengycin B only at position 6 [18]. Linear gramicidin produced by B. brevis contains isoforms of gramicidin A, gramicidin B, and gramicidin C [8]. More interestingly, nonribosomal peptide iturin A and mycosubtilin are almost identical, except that the sixth and seventh amino acids are inverted [16]. In addition, nonribosomal peptide often contains unusual residues at Nterminal, such as amino acids of methylated and formylated in cyclosporin A and gramicidin [8, 19]. Considering the characteristics of Subpeptin JM4-A and Subpeptin JM4-B and our preliminary work on gene disruption, which resulted in a great decrease in antimicrobial activity (data not shown), Subpeptin JM4-A and Subpeptin JM4-B might be nonribosomally synthesized, and related work is under way in our laboratory. In general, all antimicrobial compounds used in the food and health industry should be stable. Subpeptin JM4-A and Subpeptin JM4-B are active against a broad spectrum of bacteria including some pathogenic and spoilage microorganisms, such as Salmonella, Shigella flexineri, Bacillus cereus, Staphylococcus aureus, and Leuconostoc mesenteroides, and retain full activity over a wide pH and temperature range. These characteristics make them good candidates for the food industry and human health in future. ACKNOWLEDGMENTS This work was supported by a grant (021021) from the State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese Academy of Sciences.

Literature Cited 1. Ahern M, Verschueren S, van Sinderen D (2003) Isolation and characterization of a novel bacteriocin produced by Bacillus thuringiensis strain B439. FEMS Microbiol Lett 220:127–131

CURRENT MICROBIOLOGY Vol. 51 (2005) 2. Cherif A, Chehimi S, Limem F, et al. (2003) Detection and characterization of the novel bacteriocin entomocin 9, and safety evaluation of its producer, Bacillus thuringiensis ssp. entomocidus HD9. J Appl Microbiol 95:990–1000 3. Cherif A, Ouzari H, Daffonchio D, et al. (2001) Thuricin 7: a novel bacteriocin produced by Bacillus thuringiensis BMG1.7, a new strain isolated from soil. Lett Appl Microbiol 32:243– 247 4. Cintas LM, Rodriguez JM, Fernandez MF, et al. (1995) Isolation and characterization of pediocin L50, a new bacteriocin from Pediococcus acidilactici with a broad inhibitory spectrum. Appl Environ Microbiol 61:2643–2648 5. Cosmina P, Rodriguez F, de Ferra F, et al. (1993) Sequence and analysis of the genetic locus responsible for surfactin synthesis in Bacillus subtilis. Mol Microbiol 8:821–831 6. Entian KD, de Vos WM (1996) Genetics of subtilin and nisin biosyntheses: biosynthesis of lantibiotics. Antonie Van Leeuwenhoek 69:109–117 7. Kabir S (1995) The isolation and characterisation of jacalin [Artocarpus heterophyllus (jackfruit) lectin] based on its charge properties. Int J Biochem Cell Biol 27:147–156 8. Kessler N, Schuhmann H, Morneweg S, et al. (2004) The linear pentadecapeptide gramicidin is assembled by four multimodular nonribosomal peptide synthetases that comprise 16 modules with 56 catalytic domains. J Biol Chem 279:7413–7419 9. Oscariz JC, Lasa I, Pisabarro AG (1999) Detection and characterization of cerein 7, a new bacteriocin produced by Bacillus cereus with a broad spectrum of activity. FEMS Microbiol Lett 178:337–341 10. Paik HD, Bae SS, Park SH, et al. (1997) Identification and partial characterization of tochicin, a bacteriocin produced by Bacillus thuringiensis subsp tochigiensis. J Ind Microbiol Biotechnol 19:294–298 11. Paik SH, Chakicherla A, Hansen JN (1998) Identification and characterization of structural and transporter genes for, and the chemical and biological properties of sublacin 168, a novel lantibiotic produced by Bacillus subtilis 168. J Biol Chem 273:23134–23142 12. Pattnaik P, Kaushik JK, Grover S, et al. (2001) Purification and characterization of a bacteriocin-like compound (Lichenin) produced anaerobically by Bacillus licheniformis isolated from water buffalo. J Appl Microbiol 91:636–645 13. Pristovsek P, Kidric J (1999) Solution structure of polymyxins B and E and effect of binding to lipopolysaccharide: an NMR and molecular modeling study. J Med Chem 42:4604–4613 14. Richard HA, John ES (1962) Requirement of divalent metal ions for bacitracin activity. J Bacteriol 83:1315–1317 15. Schagger H, von Jagow G (1987) Tricine-sodium dodecyl sulfatepolyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal Biochem 166:368–379 16. Tsuge K, Akiyama T, Shoda M (2001) Cloning, sequencing, and characterization of the iturin A operon. J Bacteriol 183:6265–6273 17. van der Lende TR, van de Kamp M, Berg M, et al. (2002) delta-(Lalpha-aminoadipyl)-L-cysteinyl-D-valine synthetase, that mediates the first committed step in penicillin biosynthesis, is a cytosolic enzyme. Fungal Genet Biol 37:49–55 18. Vanittanakom N, Loeffler W, Koch U, et al. (1986) Fengycin-a novel antifungal lipopeptide antibiotic produced by Bacillus subtilis F-29-3. J Antibiot (Tokyo) 39:888–901 19. Weber G, Schorgendorfer K, Schneider-Scherzer E, et al. (1994) The peptide synthetase catalyzing cyclosporine production in Tolypocladium niveum is encoded by a giant 45.8-kilobase open reading frame. Curr Genet 26:120–125