Quantitative biosciences from nano to macro - Biomedical Engineering

42nd IUPAC CONGRESS Chemistry Solutions

Quantitative biosciences from nano to macro www.rsc.org/ibiology

Volume 1 | Number 7 | July 2009 | Pages 437–488

2–7 August 2009 | SECC | Glasgow | Scotland | UK Theme: Chemistry for Health Symposium: The Chemistry-Biology Interface: Drug Targets and Diagnostics Conveners: Harpal Minhas Lab on a Chip Niamh O’Connor Analyst Michael Smith Molecular BioSystems Keynote speakers: Dana Spence Michigan State University, USA Michael Shuler Cornell University, USA Larry J. Kricka University of Pennsylvania, USA Thomas Kodadek UT-Southwestern Medical Center, USA Journal-sponsored speakers: Paul Workman The Institute of Cancer Research, UK (Molecular BioSystems) Douglas Kell University of Manchester, UK (Analyst) Yoshinobu Baba Nagoya University, Japan (Lab on a Chip)

The overlap between chemistry and biology is increasing as many scientists focus on this rapidly developing interface in order to achieve a better balance between research and realworld applications. One of the most exciting, promising and innovative areas at this chemistrybiology interface is the area of Drug Targets and Diagnostics, encompassing subjects such as cell signalling, proteomics/genomics, drug delivery, tissue engineering, biomarkers and diagnostics. The enhanced ability to view and study individual cells and biological molecules using new and miniaturised technologies is also contributing to rapid developments in our fundamental understanding of biological systems that in turn lead to an improved approach to identifying drug targets and disease. Submit an abstract To submit an abstract for oral or poster presentation please visit www.iupac2009.org. Deadlines Oral presentation abstract: 16 January 2009 Poster presentation abstract: 5 June 2009 Early bird registration: 5 June 2009 Standard registration: 3 July 2009

www.iupac2009.org

ISSN 1757-9694

Revzin et al. Hepatic dif ferentiation of ESCs with protein microarray-based cocultures

Vykoukal et al. Dielectric properties of six major white blood cell subpopulations

Registered Charity Number 207890

PAPER

www.rsc.org/ibiology | Integrative Biology

Directing hepatic differentiation of embryonic stem cells with protein microarray-based co-cultures Ji Youn Lee,a Nazgul Tuleuova,a Caroline N. Jones,a Erlan Ramanculov,b Mark A. Zernc and Alexander Revzin*a Received 23rd March 2009, Accepted 29th May 2009 First published as an Advance Article on the web 12th June 2009 DOI: 10.1039/b905757a

Embryonic stem cells hold considerable promise in tissue engineering and regenerative medicine as a source of tissue-specific cells. However, realizing this promise requires novel methods for guiding lineage-specific differentiation of stem cells. In this study, we developed a micropatterned co-culture platform for stimulating hepatic differentiation of mouse embryonic stem cells (mESCs). Studies of mESC and hepatic cell adhesion preferences revealed that mESCs required fibronectin for attachment, while hepatic cells (HepG2) preferred collagen (I) substrate and did not adhere to fibronectin. Printing columns of collagen (I) and fibronectin spots (300 mm diameter), followed by sequential seeding of the two cell types, allowed the positioning of clusters of mESCs adjacent to groups of hepatic cells within the same microarray. These micropatterned co-cultures were maintained for up to two weeks in hepatic differentiation media supplemented. To examine the differentiation, mESCs were selectively extracted from the co-culture using laser microdissection and analyzed using real-time reverse transcriptase (RT)-polymerase chain reaction (PCR). These analyses revealed that mESCs co-cultured with HepG2 cells showed a decrease in pluripotency gene expression concomitant with up-regulation of endodermal genes. In addition, the co-culture format induced a significant increase in the expression of liver genes compared to mESCs cultured alone. In conclusion, micropatterned co-cultures of mESCs and hepatic cells showed a significant promise in driving stem cell differentiation towards hepatic phenotype. In the future, this cell culture platform will be further enhanced to enable efficient conversion of mouse and human ESCs to hepatocytes.

Introduction Given the shortage of donor livers, the concept of liver-related cell therapies has emerged as an alternative strategy.1–4 However, the scarcity of human hepatocytes remains a serious a

Department of Biomedical Engineering, University of California, Davis, 451 East Health Sciences St. #2619, Davis, CA, USA. E-mail: [email protected]; Fax: +1 530-754-5739; Tel: +1 530-752-2383 b National Center for Biotechnology, Astana, Kazakhstan c Internal Medicine and Transplant Research Institute, UC Davis Medical Center, Davis, CA, USA

roadblock in the development of cell-based therapies. Embryonic stem cells (ESCs) are capable of unlimited self-renewal and can acquire any cell phenotype, thereby offering an ideal source of hepatocytes. However, the efficiency of stem cell conversion to hepatocytes, as well as other terminally differentiated cells, remains low, confounding the use of ESCs as a source of mature tissue-specific cells.2 To promote the differentiation of ESCs towards a hepatic fate in vitro, it is important to define a microenvironment or niche conducive to liver-specific commitment of stem cells. The microenvironment encompasses a diverse set of cues including mature hepatocytes, non-parenchymal liver

Insight, innovation, integration This paper describes novel micropatterned co-cultures of mouse embryonic stem cells and hepatocytes created on matrix protein arrays. Our method allowed placing stem cells and hepatocytes on the same surface separated by a distance of tens of micrometers. Spatial segregation of cell types afforded by micropatterning allowed the selective retrieval of stem cells from the co-cultures using laser-catapulting

460 | Integr. Biol., 2009, 1, 460–468

(a variant of laser capture microdissection) for downstream gene expression studies. This analysis revealed enhancement of hepatic gene expression in embryonic stem cells co-cultured with hepatocytes compared to stem cells cultured alone. Overall, micropatterned co-cultures described here provide a general strategy for investigating the effects of heterotypic interactions on tissue-specific lineage selection of stem cells.

This journal is

! c

The Royal Society of Chemistry 2009

cells, recruited inflammatory cells, as well as secreted growth-modulating molecules and the extracellular matrix (ECM). Therefore, research efforts for directing mouse or human ESCs towards hepatic lineage have sought to recapitulate aspects of the liver microenvironment through the incorporation of growth and differentiation factors, ECM coatings, constitutive expression of hepatic transcription factors, as well as co-cultivation with other liver paranchymal or non-parcenchymal cells.1 The co-culture system has been widely used to maintain the function of hepatocytes in vitro and is thought to better mimic the intercellular contacts and endocrine signaling observed in vivo.5 Co-cultures have been employed for long-term phenotype maintenance in primary hepatocytes,6,7 for constructing in vitro liver models for hepatic fibrosis or bioartifical livers,8,9 increasing liver-specific functions of fetal hepatocytes,10 as well as differentiating stem cells into specific lineages.3,11–13 Co-cultivation of two cell types in a random configuration limits the ability to control the extent of cell–cell interactions. To remedy this, micropatterning approaches including photoresist photolithography,6 polymer stencils,14,15 polymer microwells,16 electrochemically switchable surfaces17,18 and robotically printed microarrays19,20 have been used to create micropatterned co-cultures of adult cells. A small number of reports have investigated co-cultures of liver cells with ESCs,3,12,21 mesemchymal stem cells,22 or hematopoietic stem cells23 in order to bias stem cells towards hepatic lineage selection. The goals of the present study were (1) to develop a novel strategy for placing small groups of hepatocytes next to clusters of stem cells and (2) to analyze stem cell gene expression without the loss of the local microenvironment context. To achieve the first goal, printed arrays of ECM proteins were employed to identify the adhesion preferences of mouse embryonic stem cells (mESCs) and hepatic cells. Printing of cell type-specific ECM components as alternating columns of spots (300 mm diameter) followed by sequential seeding of the two cell types allowed the positioning of small groups of mESCs next to islands of hepatic cells (see Fig. 1). Importantly, spatial segregation of cell types allowed the selective retrieval of stem cells using laser catapulting for downstream gene expression studies by RT-PCR. The laser catapulting/RT-PCR tandem permitted the analysis of stem cell gene expression in the context of local microenvironment and pointed to enhancement of hepatic gene expression in stem cell—hepatocyte co-cultures. In addition, this location-specific analysis revealed phenotypic heterogeneity within stem cell clusters with mature liver genes being expressed stronger at the interface with hepatocytes and weaker in the center of the stem cell cluster. In summary, this paper describes a novel method for creating stem cell co-cultures based on cell attachment to protein microarrays and proposes a novel method for analyzing stem cell function without losing local microenvironment context. Beyond mESC–hepatocyte co-cultures, protein microarrays may offer a general strategy for placing stem cells next to differentiated cells in order to investigate the effects of heterotypic interactions on tissue-specific lineage selection of stem cells. This journal is

! c


Fig. 1 Schematic description of the assembly of mESC–hepatic cell co-cultures on protein microarrays. Step 1: columns of fibronectin (blue) and collagen (I) (red) spots are printed onto a silane-modified (gray) glass slide. Step 2: after incubation for 1 h and removal of unattached cells, mESCs remained adherent exclusively on the fibronectin spots. Step 3: hepatic cells (HepG2) were seeded on the same surface 24 h after mESC seeding. Hepatic cells attached on collagen I) spots. Step 4: after cultivation for the desired period of time mESCs were extracted from the surface using laser catapulting and were analyzed with RT-PCR.

Materials and methods Chemicals and materials Glass slides (75 " 25 mm) were obtained from VWR international (West Chester, PA). 3-Acryloxypropyl trichlorosilane was purchased from Gelest, Inc (Morrisville, PA). Sulfuric acid, hydrogen peroxide, ethanol, collagen from rat tail (type I), collagen from Engelbreth–Holm–Swarm murine sarcoma basement membrane (type IV), laminin, epidermal growth factor, bovine serum albumin, dexamethasone and Tween 20 were obtained from Sigma-Aldrich (St. Louis, MO). Phosphate-buffered saline (PBS) 10" was purchased from Cambrex (Charles City, IA). Dulbecco’s modified Eagles’ medium (DMEM), minimal essential medium (MEM), Iscove’s Modified Dulbecco’s Medium (IMDM), sodium pyruvate, non-essential amino acids, L-glutamine, ES-qualified fetal bovine serum (FBS), certified FBS, 2-mercaptoethanol, CellTrackert Green CMFDA and Red CMTPX probes for long-term tracing of living cells, and 4 0 ,6-diamidino-2phenylindole, diacetate (DAPI) were purchased from Invitrogen Life Technologies (Carlsbad, CA). QuantiTect Reverse Transcription Kit was purchased from Qiagen (Valencia, CA). FastStart Universal SYBR Master Mix was purchased from Roche (Indianapolis, IN). Glucagon and insulin were obtained from Eli-Lilly (Indianapolis, IN). ESGRO (leukemia inhibitory factor: LIF), primary mouse embryo fibroblasts, Integr. Biol., 2009, 1, 460–468 | 461

fibronectin, and ES cell characterization kit were obtained from Millipore (Temecula, CA). Monoclonal anti-human/ mouse a-fetoprotein antibody was purchased from R&D Systems (Minneapolis, MN). Anti-mouse IgG FITC conjugated was purchased from Santa Cruz Biotehcnology, Inc (Santa Cruz, CA). Mouse embryonic stem cells (D3) and hepatic cells (HepG2) were purchased from ATCC (Manassas, VA). Surface modification Glass slides were cleaned by immersion in piranha solution consisting of a 3 : 1 mixture of concentrated sulfuric acid and 35% w/v of hydrogen peroxide for 10 min. The glass slides were thoroughly rinsed with deionized (DI) water and dried under nitrogen. For silane modification, the glass slides were treated in an oxygen plasma chamber (YES-R3, San Jose, CA) at 300 W for 5 min and then placed in a solution containing 3-acrylopropyl trichlorosilane diluted in anhydrous toluene (20 ml per 40 mL) for 10 min. The reaction was performed in a glove box filled with nitrogen to eliminate atmospheric moisture. The slides were rinsed with fresh toluene, dried under nitrogen and cured at 100 1C for 2 h. The silane quality was assessed using LSE Stokes ellipsometer (Gaertner Scientific, Chicago, IL) and contact angle goniometer (Rame-Hart, Netcong, NJ). The silane-modified glass slides were stored in a desiccator before use. Protein microarraying All ECM proteins were dissolved in 1" PBS at a 0.2 mg mL#1 concentration, with the addition of 0.005% (v/v) Tween 20. Protein microarrays were contact-printed under ambient conditions on silane-modified glass slides using a MicroCaster hand-held microarrayer system (Schleicher & Schuell) or GMS 417 robotic arrayer (Genetic Micro Systems, Inc.). Collagen (I) and fibronectin were arrayed in alternating columns to create a six-by-twelve array of spots. In the case of MicroCaster, the spot size was around 500 mm in diameter. The center-to-center distance between the spots was 1250 mm. With a GMS 417 arrayer, spots of 300 mm diameter were arrayed with 375 mm pitch. The glass slides with the protein microarrays were stored in a refrigerator for at least one month without detriment to arrays. Construction of micropatterned co-cultures of mESCs and hepatic cells Mouse ESCs (D3 cells) were maintained with growth-arrested murine embryonic fibroblast (MEF) feeder cells on gelatincoated tissue culture plates at 37 1C in a humidified 5% CO2 atmosphere. The culture medium consisted of DMEM supplemented with 15% ES-qualified FBS, 200 U mL#1 penicillin, 200 mg mL#1 streptomycin, 2 mM L-glutamine, 1 mM nonessential amino acids, 100 nM 2-mercaptoethanol, and 1000 U mL#1 LIF. For the cell seeding experiments, the glass slides containing protein microarray were cut and placed into wells of a conventional six-well plate. The samples were sterilized with 70% ethanol, and washed twice with 1" PBS. Cellular micropatterning was carried out by exposing glass slides to D3 cell suspension in culture medium at a 462 | Integr. Biol., 2009, 1, 460–468

concentration of 1 " 106 cells mL#1. After 1 h of incubation at 37 1C, the medium containing unattached cells was removed and the surfaces were washed twice with 1" PBS. The cell patterns formed on the glass slide were imaged by a brightfield microscope (Carl Zeiss Inc., Thornwood, NJ). Hepatoma cells (HepG2) were employed as model hepatocytes in our studies. HepG2 cells were maintained in MEM supplemented with 10% FBS, 200 U mL#1 penicillin, 200 mg mL#1 streptomycin, 1 mM sodium pyruvate, and 1 mM nonessential amino acids at 37 1C in a humidified 5% CO2 atmosphere. To introduce HepG2 cells, glass slides containing surface-bound arrays of mESCs were exposed to HepG2 cell suspension at a concentration of 1 " 106 cells mL#1. After 1 h of incubation at 37 1C, unbound cells were removed by washing with 1" PBS twice and the culture was maintained in differentiation medium consisting of IMDM supplemented with 20% FBS, 200 U mL#1 penicillin, 200 mg mL#1 streptomycin, 1 mM nonessential amino acids, 0.5 U mL#1 insulin, 14 ng mL#1 glucagon, and 100 nM dexamethasone. Alkaline phosphatase staining and intracellular immunostaining Alkaline phosphatase activity of ES cells was assessed using an ES characterization kit according to the manufacturer’s instructions. For the AFP immunostaining, cells were fixed with 4% paraformaldehyde in PBS for 20 min and then permeabilized with 0.2% Triton X-100 for 5 min. The cells were then incubated in blocking solution (1% BSA in 1" PBS) for 1 h at room temperature and exposed to 1 : 100 diluted a-fetoprotein (AFP) antibody overnight at 4 1C. The following day, the cells were incubated in 1 : 50 diluted secondary antibodies conjugated with FITC and then they were counterstained with DAPI. The cells were washed between each step with 1" PBS containing 0.005% Tween 20 three times for 5 min. All incubations were performed at room temperature if not specified. The stained cells were visualized and imaged using a confocal microscope (Zeiss LSM Pascal). Laser catapulting of stem cells and RT-PCR analysis of gene expression Prior to laser catapulting, cells on glass slides were fixed with ice-cold 70% ethanol, and dried under nitrogen. Fixed cells were stored in an airtight container at #80 1C and were catapulted within 2 w. ES cells were retrieved from micropatterned surfaces by the PALM LMPC system (PALM Microlaser Technologies). Extracted cells were stabilized in 200 mL of 1" Applied Biosystems (AB) lysis buffer and stored at #20 1C. Total RNA was extracted from the cell lysates using a 6100 Nucleic Acid PrepStation (Applied Biosystems) according to the manufacturer’s instructions. The RNA from extracted cells was precipitated and resuspended in DI water. cDNA was synthesized using Quantitect Reverse Transcription Kit according to the manufacturer’s instructions. Briefly, 4 mL of wipeout buffer was added to the RNA sample (20 mL) and the sample was incubated at 42 1C for 2 min. Then, 16 mL of Reverse Transcription Mix was added and the sample was incubated at 42 1C for 40 min. The reaction was terminated by heating the sample for 3 min at 95 1C. This journal is

! c


Table 1

Primer sequences for real-time PCR

Gene

Sequence 5 0 to3 0

Conc./mM

b-Actin

F: ACGGCCAGGTCATCACTATTG R: ATACCCAAGAAGGAAGGCTGGA F: CCTCAGCCTCCAGCAGATGC R: CCGCTTGCACTTCACCCTTTG F: GAAGCAGAAGAGGATCACCTTG R: TTCTTAAGGCTGAGCTGCAAG F: CGAGCCAAAGCGGAGTCTC R: TGCCAAGGTCAACGCCTTC F: CCTCAGCCTCCAGCAGATGC R: GCGGATCACCTGAGACACATC F: TCGTTCCCATTCCGCTTC R: TTCTTAAGGCTGAGCTGCAAG F: CCAGGACCAGGAAGTCTGTT R: TAAGCCAAAAGGCTCACACC F: TTGCCTCGCTGGACTGGTA R: AGGACATTTGGATTCTCCAGCT F: GCAAGGCTGCTGACAAGGA R: GGCGTCTTTGCATCTAGTGACA F: TCGTTCCCATTCCGCTTC R: GGCTTCAGAGAGTCAAAGAGATGC F: CGGTTTGCCTATGCCAAGAG R: AATCCACCTCCACACTGACC

1 0.5 1 1 1 1 1 1 1 1 1 1 1 1 0.5 1 1 1 1 1 1 1

Nanog Oct-4 Sox17 b-Tubulin 3 (Tubb3) a-Actin, cardiac (Actac) a-fetoprotein (Afp) Transthyretine (Ttr) Albumin (Alb) Glucose-6-phosphatase (G6p) g-Glutamyl transferase (Ggt)

The oligonucleotide sequences for genes of pluripotency, Oct4 and Nanog, were adapted from the literature.24 The oligonucleotide sequences for genes of three germ layers, a-fetoprotein (Afp) and Sox17 (endoderm), Actac (mesoderm) and b-tubulin 3 (Tubb3, ectoderm), and b-actin (house keeping gene) were adapted from the Real-Time PCR Primer and Probe Database (http://medgen.ugent.be/rtprimerdb). The oligonucleotide sequences for liver-associated genes, b-actin, albumin, transthyretine, glucose-6-phosphatase, g-glutamyl transferase, have been reported previously.25 Quantitative real-time PCR was performed using FastStart Universal SYBR Master (Rox) Mix. Primer (Sigma Genosys) concentrations were optimized before use. SYBR Green Master Mix was used with the appropriate concentrations of forward and reverse primers (Table 1), and cDNA in a total volume of 12 mL. All PCR reactions were done in duplicate. PCR amplification was performed as follows: 95 1C for 10 min, 40 cycles of 95 1C for 15 s, 60 1C for 10 s and 68 1C for 1 min on Mastercycler Realplex (Eppendorf). The relative expression level of each gene was calculated using the comparative threshold cycle (Ct) method using b-actin as a housekeeping gene and an internal standard. Median Ct values of duplicate samples were used to calculate DCt of the housekeeping gene for the same sample. A denaturing curve for each gene was used to confirm homogeneity of the PCR product. We found it challenging to average out PCR results from several experiments as DCt values varied from one experiment to the next. Therefore, a representative PCR result (out of n = 3) is shown in this paper.

Results and discussion In this study, ECM microarrays were employed to assemble micropatterned co-cultures of mESCs and hepatic cells. Preferential adhesion of mESCs and hepatic cells on fibronectin and collagen (I), respectively, allowed the placement of these cells on the adjacent protein islands (300 or 500 mm diameter) This journal is

! c


within the same cell microarray. Analysis of gene expression revealed enhanced endodermal and liver-specific differentiation of mESCs co-cultivated with hepatic cells compared to stem cell monocultures. Micropatterned stem cell co-cultures formed on protein arrays Both mESCs and hepatocytes require surfaces coated with ECM proteins for attachment and cultivation. Gelatin-coated plastic substrates are typically used for maintenance of mESCs, while hepatocytes attach and function well on substrates coated with collagen (I, IV) or laminin.26 The adhesion preferences of mESCs were tested by printing arrays of ECM proteins including collagen (I) and (IV), laminin, and fibronectin, followed by cell seeding. These cell adhesion studies (results not shown) revealed that after 1 h incubation, mESCs preferentially attached on fibronectin spots, with minimal adhesion observed on other matrix proteins. Conversely, when seeded on the ECM proteins discussed above, HepG2 cells did not adhere on fibronectin, whereas attachment could be observed on other ligands. To take advantage of the cell attachment preferences, columns of fibronectin and collagen (I) spots were printed onto silane-modified glass slides and the two cell types were sequentially seeded onto the same surface (see Fig. 1 for an overview of the process). We previously showed that glass surfaces modified with acrylated silane resist attachment of hepatocytes, since these epithelial cells do not produce appreciable quantities of endogenous ECM proteins and therefore require substrates to be pre-coated with adhesive ligands.27 The silane-modified surfaces do become fouled by the protein adsorption from solution over time; however, incubation of hepatocytes or mESCs on these substrates for a short period of time (B1 h) allowed the confinement of these cells to the printed protein domains, with limited attachment observed on the silane-modified glass regions. Due to partial fouling of the silane-modified surfaces, cells were able to Integr. Biol., 2009, 1, 460–468 | 463

Fig. 2 Creating micropatterned co-cultures of mESCs and hepatic cells on protein arrays. (A) Seeding mESCs onto arrays comprised of alternating 300 mm diameter spots of fibronectin and collagen (I) resulted in selective attachment of stem cells on fibronectin. FITC-labeled collagen (I) was used to highlight that collagen islands were free of stem cells and were available for hepatocyte attachment. (B) Staining co-cultures for alkaline phosphatase—a stem cell marker—revealed a strong signal from the stem cell-containing spot (right) and no signal from the hepatic cell cluster (left). (C) A low magnification (4") view of the micropatterned co-cultures shows a 14 " 10 array of cell clusters. Clusters of mESCs appear more three dimensional and scatter light, while hepatic cells appear planar and darker. (D–E) Stem cells in mono- or co-cultures were able to expand out of the original attachment sites over time in culture. The images shown here were taken on day 8. Mouse ESCs adherent on fibronectin spots and cultured in hepatic differentiation media (D) were compared to mESC-hepatic cells co-cultures (E). (F) A higher magnification view of the stem cell cluster after 8 d in co-culture shows endodermal-looking cells spreading/migrating out of the cluster.

expand and grow outside of the original attachment sites over time (days) in culture, as shown in Fig. 2. Fig. 2A shows a close-up view of the protein spots after seeding mESCs. As can be seen from this image, stem cells are confined to specific locations on the surface (fibronectin domains), while collagen (I) spots, fluorescently stained for visualization, remain free of cells. The mESCs were allowed to proliferate on the spots for 24 h to ensure formation of a confluent monolayer prior to seeding of hepatic cells. Minimal to no attachment of hepatic cells on top of the stem cells was observed during co-culture construction. To highlight the distinct spatial arrangement of stem cells and hepatic cells, the co-cultures where stained with alkaline phosphatase—a commonly used marker of stem cells. As shown in Fig. 2B, an intense alkaline phosphatase signal was observed from mESC clusters (right column), while a minimal signal was seen from hepatic cell clusters (left column of spots). The co-cultures arrangement of alternating columns of hepatic and stem cell clusters occurred on a large scale as shown in Fig. 2C. After adding hepatic cells, co-cultures were maintained in a differentiation medium containing FBS, insulin, and dexamethasone for up to 10 d. As a control, mono-cultured ES cells were also maintained in the same medium. After initial seeding, mESCs and hepatic cells have been attached to 300 mm diameter spots with 375 mm edge-to-edge spacing (Fig. 2A and B); however, as discussed above, silane-modification of the surfaces allowed for expansion of the cells out of their original locations. As shown in Fig. 2C–E, this expansion occurred in both mESC mono-cultures and co-cultures. In the case of co-cultures, cell proliferation and 464 | Integr. Biol., 2009, 1, 460–468

spatial expansion led to the creation of a hepatic–stem cell interface, where physical contact between the cell types was possible. Based on our microscopy observations, the boundary between mESCs and hepatic cells remained distinct and minimal re-sorting of the two cell types was observed. Effects of mESC–hepatic cell co-cultures on pluripotency and germ layer selection In order to assess the effects of hepatic cells on differentiation and maturation, mESCs gene expression indicative of pluripotency, germ layer selection and hepatic phenotype were analyzed. In a typical experiment, cells were enzymatically removed from a surface and then were subjected to gene expression analysis using RT-PCR. However, this method of nucleic acid collection does not allow the connection of gene expression to a local microenvironment experienced by cells during cultivation. The ability to capture cell function without the loss of the local microenvironment context is particularly appealing for micropatterned cultures where cells may be experiencing different signals at different locations of the same surface. Previously, we showed that laser microdissectionmediated cell retrieval from micropatterned co-cultures followed by RT-PCR analysis could be used for connecting cell phenotype to a location on a micropatterned surface.27 In the present study, the same approach was employed for analysis of mESC differentiation in the micropatterned co-cultures by removing stem cells at different cultivation time-points. Fig. 3A shows an example where the stem cell cluster has been removed (right side), but the hepatic cell This journal is

! c


Fig. 3 RT-PCR analysis of pluripotency and germ layer gene expression in stem cell micropatterns. Stem cells were cultured in hepatic differentiation media either alone or together with hepatic cells (HepG2). (A) Mouse ESCs were selectively retrieved from the co-culture using laser catapulting and were immediately used in RT-PCR studies. (B) Expression of pluripotency gene Nanog decreased over time for both mono- and co-cultivated mESCs; however, the co-culture induced a more pronounced and more rapid decrease in Nanog expression. (C) Expression levels of germ layer genes at day 1 and day 8. The endodermal marker, Sox17, was up-regulated, while other germ layer markers remained unchanged or decreased.

cluster (left side) still remains. As discussed later in the paper, this location-specific cell retrieval also enable analysis of stem cells at the interface with hepatic cells, as opposed to the center of mESC cluster. Nanog is a homeodomain factor responsible for maintaining self-renewal and pluripotency of ESCs,28 which is commonly used as an indicator for undifferentiated mESC phenotype. The loss of pluripotency and early differentiation of ESCs is characterized by a decrease in the expression of these genes. This journal is

! c


As shown in Fig. 3B, the expression level of Nanog relative to a housekeeping gene, b-actin, at day 1 was similar to that of undifferentiated ESCs, which suggested that mESCs were largely pluripotent after 1 d of co-culture in differentiation media. (Note: all of the days in this paper mean ‘days after co-culture’. Therefore, day 1 indicates the second day of culture for ESCs.) Over the time in culture, the pluripotency gene expression of mESCs decreased gradually in both mono- and co-cultures; however, this decrease was more pronounced in the case of co-cultures. After 8 d of co-culture, Nanog was still observed, although the levels decreased to 35 and 17% in a mono-culture and co-culture respectively, compared to mESC maintained under conditions promoting pluripotency. The results presented in Fig. 3B imply that a certain population of stem cells remained undifferentiated and coexisted with more differentiated mESCs. Similar trends in the down-regulation of gene expression were observed with another pluripotency gene Oct4 (data not shown). We next examined the expression of the genes associated with three germ layers: endoderm (marker gene-Sox17), ectoderm (marker gene Class III b-tubulin (Tubb3)), and mesoderm (marker gene-cardiac a-actin (Actac)). Sox17 is a Sry-related HMG-box transcription factor developmentally expressed in both the definitive endoderm and extraembryonic endoderm. The liver develops from a definitive endoderm; therefore, the expression of genes associated with this germ layer is an important prerequisite of hepatic differentiation of ESCs.29 Tubb3 is specific for a neuronal differentiation and Actac is initially expressed in the endomesoderm, but subsequently in the mesoderm.15 Fig. 3C shows the expression level of each gene at day 1 and day 8. Interestingly, mESCs co-cultivated with hepatic cells showed a three-fold increase in Sox17 gene expression compared to mESCs cultured alone in a differentiation medium. This up-regulation in endodermal gene expression was concomitant with decreased levels of mesoderm marker gene expression (Actac) and constant levels of ectoderm (Tubb3) gene. The results shown in Fig. 3C suggest that co-cultivation with hepatic cells induced endodermal differentiation of mESCs—an important prerequisite of hepatic differentiation. It should be noted that some endodermal differentiation was observed in mESCs mono-cultures adherent on fibronectin microarray spots and cultivated in hepatic differentiation medium; however, this was considerably lower compared to co-cultures (Fig. 3C). Early and mature hepatic gene expression in mESCs co-cultures During liver development, hepatocytes originate from a definitive endoderm and the first evidence of hepatic specification within the endodermal cells is the up-regulation of transcripts of the genes encoding a-fetoprotein and albumin.30 Afp is widely used as a marker gene of definitive endoderm as well as early hepatic differentiation. Alb is a key marker for functional hepatocytes and is the most abundant protein synthesized by mature hepatocytes. In addition, another liver-specific serum protein, transthyretin (Ttr) (also known as pre-albumin), was used in our studies as an early liver marker.31 We compared the definitive endoderm and Integr. Biol., 2009, 1, 460–468 | 465

oncostatin M.32 We chose to monitor the expression of two mature liver genes, G6p and Ggt, in the mESCs cultivated on protein microarrays alongside hepatic cells. G6p is predominantly expressed in the liver at a mid–late gestational stage and is considered to be a marker of mature hepatic phenotype.33 Ggt is an enzyme involved in glutathione metabolism and is commonly found in the liver. Expression of G6p and Ggt is thought to mark the emergence of the hepatoblast, a common progenitor for two main lineages of the liver: hepatocytes and bile duct epithelial cells.29,34 RT-PCR analysis of late liver gene expression in micropatterned mESC co-cultures vs. mono-cultures (see Fig. 5) showed that mature liver genes were not observed in mono-cultures after 8 d of cultivation. By contrast, the presence of hepatic cells (co-cultures) induced expression of G6p and Ggt genes in mESCs, pointing to the appearance of maturing hepatoblast-like cell populations. In the case of G6p, gene expression became detectable in co-cultures from day 3 (data not shown) and reached levels equivalent to 32.76% of

Fig. 4 Expression of early hepatic phenotype in micropatterned mESC cultures. (A) Expression of Afp, TTR and Alb-genes associated with early hepatic phenotype-occurred earlier and was more pronounced in mESC co-cultures compared to mono-cultures. (B) Immunofluorescent staining was used to corroborate the presence of AFP protein in mESC-derived cells after 5 d in culture.

early liver gene expression in mESCs cultured alone and in co-cultures with HepG2 cells. Liver gene expression in mouse a hepatoma cell line (Hepa 1-6) served as a benchmark for comparison in our stem cell differentiation studies. As shown in Fig. 4A the early liver genes were detected from day 3 onwards in the mESC–hepatic cell co-cultures, but appeared only after day 5, and at a much lower level, in the mESC monocultures. After becoming detectable at day 3, the level of Afp transcripts at day 8 in co-culture was 33.5% of Hepa 1-6 cells, suggesting that many ESCs still remained at early stages of hepatic lineage. In the case of Ttr, the transcripts rapidly increased to the maximum level (11.8% of Hepa 1-6), and remained at this level throughout the culture period (Fig. 4A). Serum albumin (Alb) is the most abundant protein synthesized by hepatocytes. Its production starts in the early stages of liver development and reaches the maximum level in the adult liver. In our experiments, Alb expression increased with time and by day 8 reached levels equivalent to 20.45% of that observed in Hepa 1-6. Significantly, 5–10-fold higher levels of Alb gene expression were observed in mESCs co-cultured with hepatic cells compared to mESC monocultures. This is an important indicator of enhanced hepatic differentiation of mESCs in the micropatterned co-cultures. In addition to the analysis of gene transcripts, immunostaining of mESCs revealed the presence of Afp after 5 d in co-culture with hepatic cells (Fig. 4B). While ESCs have been reported to spontaneously differentiate towards endoderm or early hepatic lineage, these cells do not express mature hepatocyte genes unless induced by specific exogenous growth factors such as hepatocyte growth factor or 466 | Integr. Biol., 2009, 1, 460–468

Fig. 5 Expression of genes associated with mature hepatic phenotype. (A) In order to investigate location-specific differences in gene expression, cells were laser-catapulted from the center of the stem cell cluster as well as from the periphery of the cluster (edge). (B) Cells from different locations were catapulted into distinct centrifuge tubes and were analyzed using RT-PCR. These studies revealed considerable heterogeneity in G6p and Ggt gene expression with expression levels being higher at the edge (stem cell–hepatocyte interface) compared to the center of stem cell spot. It should be noted that no G6p and Ggt expression was observed in mono-cultured stem cells.

This journal is

! c


that observed in Hepa 1-6. Ggt showed a similar trend to G6p and the level at day 8 was 24.49% of that observed in mouse hepatic cells. Importantly, neither G6p nor Ggt gene expression was observed in mESC mono-cultures cultivated in hepatic differentiation medium. An important goal of this paper was to develop an analytical technique that would complement micropatterned stem cell co-cultures and would allow the characterization of stem cell phenotype expression in a location-specific manner. Laser catapulting offered the possibility of collecting desired cells from the micropatterned substrate and performing downstream RT-PCR analysis without losing the local microenvironment. In our experiments, mESCs were originally confined to fibronectin spots but then grew both upward as well as outward in the direction of hepatic cell islands (Fig. 2D). We sought to investigate the expression of mature hepatic genes in stem cells at the center of the embryoid body-like cluster vs. the stem cells residing on the periphery of the island, in close proximity to hepatic cells. As shown in Fig. 5A, to investigate the location-specific difference in gene expression, stem cells were laser catapulted from the center of the 300 mm diameter stem cells cluster (far from hepatic cells) as well as from the edge of the stem cell cluster (near hepatic cells). This location-specific analysis revealed heterogeneity in stem cell gene expression (Fig. 5B) with 10–16-fold higher expression of mature liver genes observed at the edge of the stem cell cluster, next to the hepatocytes, compared to the center of the cluster, further away from hepatocytes. These preliminary results point to the importance of heterotypic paracrine–juxtacrine interactions for the induction of mature hepatic phenotype in ESCs. Importantly, stem cells and hepatic cells were morphologically different and could be easily identified using brightfield microscopy prior to catapulting. Furthermore, we verified the species selectivity of the PCR assays for mouse G6p and Ggt genes.

Conclusions This study employed protein arrays to create micropatterned co-cultures of mESCs with hepatic cells. When compared with mono-cultures, micropatterned co-cultures showed enhanced endodermal and hepatic gene expression concomitant with a more rapid decrease in pluripotency. Interestingly, among genes representative of the three germ layers, only endodermal gene expression was up-regulated in the mESC–hepatic cell co-cultures, while other germ layer genes were either unaffected or down-regulated. The presence of hepatic cells in micropatterned co-cultures also induced the expression of early and mature liver genes in mESCs. In terms of early liver genes, ESCs in a co-culture at day 3 started producing detectable amount of transcripts, while those in a monoculture started at day 5. Although some early liver genes were detected in ESC monocultures exposed to differentiation medium, no late liver genes were observed. This suggests that the communication between ESCs and hepatic cells was particularly important for induction of mature hepatic phenotype in stem cells. In addition, location-specific analysis of stem cells in the micropatterned co-cultures showed heterogeneity in gene expression as a function of distance This journal is

! c


between adjacent heterotypic cell clusters. Taken together, our study outlines new methods of cultivating and analyzing stem cells and highlights the possibility of using hepatocytes as the source of ‘‘instructive’’ signals for guiding liver-specific differentiation of mESCs. In the future, the protein microarray-based co-culture platform described here may be used for differentiation of human ESCs towards hepatic lineage or may be adapted to deriving other tissue-specific cells from ESCs.

Acknowledgements NT was supported by a fellowship from the National Center for Biotechnology, Republic of Kazakhstan. Financial support for this work was provided by NIH grant DK073901 awarded to AR.

References 1 H. Baharvand, S. M. Hashemi, S. K. Ashtian and A. Farrokhi, Int. J. Dev. Biol., 2006, 50, 645–652. 2 C. Chan, F. Berthiaume, B. D. Nath, A. W. Tilles, M. Toner and M. L. Yarmush, Liver Transplantation, 2004, 10, 1331–1342. 3 C. H. Cho, N. Parashurama, E. Y. H. Park, K. Suganuma, Y. Nahmias, J. Park, A. W. Tilles, F. Berthiaume and M. L. Yarmush, FASEB J., 2008, 22, 898–909. 4 N. Lavon and N. Benvenisty, J. Cell. Biochem., 2005, 96, 1193–1202. 5 A. Corlu, G. Ilyin, S. Cariou, I. Lamy, P. Loyer and C. GuguenGuillouzo, Cell Biol. Toxicol., 1997, 13, 235–242. 6 S. N. Bhatia, M. L. Yarmush and M. Toner, J. Biomed. Mater. Res., 1997, 34, 189–199. 7 B. Clement, C. Guguen-Guillouzo, J.-P. Campton, D. Glaise, M. Bourel and A. Guillouzo, Hepatology, 1984, 4, 373–380. 8 A. Arnaud, L. Fontana, A. J. Angulo, A. Gil and J. M. LopezPedrosa, Dig. Dis. Sci., 2003, 48, 1406–1413. 9 Y. S. Zinchenko, L. W. Schrum, M. Clemens and R. N. Coger, Tissue Eng., 2006, 12, 751–761. 10 D. van Poll, C. Sokmensuer, N. Ahmad, A. W. Tilles, F. Berthiaume, M. Toner and M. L. Yarmush, Tissue Eng., 2006, 12, 2965–2973. 11 I. S. Schroeder, A. Rolletschek, P. Blyszczuk, G. Kania and A. M. Wobus, Nat. Protoc., 2006, 1, 495–507. 12 A. Soto-Gutierrez, N. Navarro-Alvarez, D. Zhao, J. D. RivasCarrillo, J. Lebkowski, N. Tanaka, I. J. Fox and N. Kobayashi, Nat. Protoc., 2007, 2, 347–356. 13 T. T. Qing, Y. Shi, H. Qin, X. Ye, W. Wei, H. S. Liu, M. X. Ding and H. K. Deng, Differentiation, 2007, 75, 902–911. 14 D. Wright, B. Rajalingam, S. Selvarasah, M. R. Dokmeci and A. Khademhosseini, Lab Chip, 2007, 7, 1272–1279. 15 J. Park, C. H. Cho, N. Parashurama, Y. W. Li, F. Berthiaume, M. Toner, A. W. Tilles and M. L. Yarmush, Lab Chip, 2007, 7, 1018–1028. 16 A. Khademhosseini, L. Ferreira, J. Blumling, 3rd, J. Yeh, J. M. Karp, J. Fukuda and R. Langer, Biomaterials, 2006, 27, 5968–5977. 17 M. N. Yousaf, B. T. Houseman and M. Mrksich, Proc. Natl. Acad. Sci. U. S. A., 2001, 98, 5992–5996. 18 S. S. Shah, J. Y. Lee, S. Verkhoturov, N. Tuleuova, E. A. Schweikert and A. Revzin, Langmuir, 2008, 24, 6837–6844. 19 A. Revzin, P. Rajagopalan, A. W. Tilles, F. Berthiaume, M. L. Yarmush and M. Toner, Langmuir, 2004, 20, 2999–3005. 20 J. Y. Lee, C. Zimmer, G. Y. Liu and A. Revzin, Langmuir, 2008, 24, 2232–2239. 21 R. N. Moore, A. Dasgupta, N. Rajaei, M. L. Yarmush, M. Toner, L. Larue and P. V. Moghe, Biotechnol. Bioeng., 2008, 101, 1332–1343. 22 C. Lange, P. Bassler, M. V. Lioznov, H. Bruns, D. Kluth, A. R. Zander and H. C. Fiegel, World J. Gastroenterol., 2005, 11, 4497–4504.

Integr. Biol., 2009, 1, 460–468 | 467

23 Y. Y. Jang, M. I. Collector, S. B. Baylin, A. M. Diehl and S. J. Sharkis, Nat. Cell Biol., 2004, 6, 532–539. 24 E. Willems, I. Mateizel, C. Kemp, G. Cauffman, K. Sermon and L. Leyns, Int. J. Dev. Biol., 2006, 50, 627–635. 25 H. Shirahashi, J. Wu, N. Yamamoto, A. Catana, H. Wege, B. Wager, K. Okita and M. A. Zern, Cell Transplant., 2004, 13, 197–211. 26 F. Berthiaume, P. V. Moghe, M. Toner and M. L. Yarmush, FASEB J., 1996, 10, 1471–1484. 27 J. Y. Lee, C. N. Jones, M. A. Zern and A. Revzin, Anal. Chem., 2006, 78, 8305–8312. 28 A. M. Singh, T. Hamazaki, K. E. Hankowski and N. Terada, Stem Cells, 2007, 25, 2534–2542.

468 | Integr. Biol., 2009, 1, 460–468

29 K. S. Zaret, Mech. Dev., 2000, 92, 83–88. 30 V. Gouon-Evans, L. Boussemart, P. Gadue, D. Nierhoff, C. I. Koehler, A. Kubo, D. A. Shafritz and G. Keller, Nat. Biotechnol., 2006, 24, 1402–1411. 31 T. Hamazaki, Y. Iiboshi, M. Oka, P. J. Papst, A. M. Meacham, L. I. Zon and N. Terada, FEBS Lett., 2001, 497, 15–19. 32 T. Hamazaki and N. Terada, Methods Enzymol., 2003, 365, 277–287. 33 A.-B. Hu, J.-Y. Cai, Q.-C. Zheng, X.-Q. He, Y. Shan, Y.-L. Pan, G.-C. Zeng, A. Hong, Y. Dai and L.-S. Li, Liver Int., 2004, 24, 237–245. 34 K. S. Zaret, Curr. Opin. Genet. Dev., 2001, 11, 568–574.

This journal is

! c
