1991; Peterka and Hartl 1992; ... ize four main populations of rabbits in France, Spain, and ...... de sauvetage d'une latrine mtditvale dans la tour des Salius du.
J Mol Evol (1995) 40:227-237
jouoMOLECULAR [EVOLUTION © Springer-Verlag New York Inc. 1995
Rabbit Mitochondrial DNA Diversity from Prehistoric to Modern Times C. Hardy, 1 C. Callou, z J.-D. Vigne, 2 D. Casane, 1 N. Dennebouy, 1 J.-C. Mounolou, 1 M. Monnerot 1
Centre de G~n6tiqueMol6culaire,CNRS, F-91198 Gif-sur-YvetteCedex, France 2 CNRS, URA 1415, Laboratoired'Anatomie Compar6e,MNHN, F-75005Paris, France Received: 7 July 1994 / Accepted: 5 September1994
The mitochondrial genetic variability in European rabbit (Oryctolagus cuniculus) populations present in Europe and North Africa from 11,000 years ago to the present day has been analyzed using ancient DNA techniques. DNA was extracted from 90 rabbit bones found in 22 archaeological sites dated between the Mesolithic and recent times. Nucleotide sequences present in a variable 233-bp domain of the cytochrome b gene were compared to those present in modern-day rabbits. The results show that the structure of ancient populations of wild rabbit exhibited remarkable stability over time until the Middle Ages. At this time, a novel type of mtDNA molecule abruptly appears into most wild populations studied from France. This mtDNA type corresponds to that currently present in the domestic breeds of rabbit examined so far. The relative rapidity by which this mtDNA type established and its absence in all sites examined before 1,700 years ago lend support to the hypothesis that between 2,000 and 1,000 years ago, man may have favored the development, into all regions of France, of animals carrying this particular mtDNA molecule. The origin of such animals has still to be found: animals previously living outside of France or within France but in very restricted areas? This event was concomitant with the documented establishment of warrens after the tenth century A.D. in Europe. Abstract.
Ancient DNA - - cytochrome b - - Oryctolagus cuniculus Key words:
Correspondence to: M . M o n n e r o t
Introduction
European rabbit (Oryctolagus cuniculus) originated in the Iberian Peninsula (Lopez-Martinez 1989) and has subsequently expanded its range throughout the world, principally through introductions by human (Bodson 1978; Rougeot 1981; Flux 1994). Examinations of present-day wild and domestic rabbits have provided a number of parameters which distinguish various populations: size, osteological morphometry, parasitology, hematology, protein polymorphisms, and mitochondrial DNA variability (Saint-Girons, 1973; Beaucournu 1980; Ferrand et al. 1988; Arana et al. 1989; Biju-Duval et al. 1991; Van der Loo et al. 1991; Peterka and Hartl 1992; Monnerot et al. 1994; Vigne et al. 1994). In general a considerable diversity is thus detected. In particular, on the basis of mtDNA site polymorphism, rabbits can be divided into two maternal lineages, with a 4% nucleotide divergence (Biju-Duval et al. 1991): One lineage (lineage A) is present in wild rabbits originating from the southern extent of their original range (southern Spain), whilst the other (lineage B) is found in northern Spain, France, and the rest of Europe. A significant variability is even found within these lineages. DNA techniques have been applied in several studies aimed at understanding the origin of both animal (Thomas et al. 1990; Cooper 1994) and human (Horai et al. 1991; Hauswirth et al. 1994) populations and their diversity over time (reviewed in Villablanca 1994). In these cases, data from ancient DNA samples have been used to compare the diversity present in ancient and modern populations and to measure the effects of bottlenecks on the genetic variability. In order to provide an
228 estimate of how European rabbit populations may have evolved during historical times and be affected by human activities, w e d e c i d e d to e x a m i n e a n c i e n t m t D N A extracted f r o m a r c h a e o l o g i c a l b o n e s d a t e d f r o m p r e h i s t o r i c t i m e s to the m o d e r n era. P r e l i m i n a r y e x p e r i m e n t s h a d s h o w n t h e feasibility o f u s i n g a n c i e n t D N A t e c h n i q u e s to examine rabbit mtDNA variability through time (Hardy et al. 1994a,b; M o n n e r o t et al. 1994). I n particular, a 190-bp r e g i o n at t h e 3' e n d o f t h e c y t o c h r o m e b g e n e w a s f o u n d to b e v a r i a b l e e n o u g h to d i s t i n g u i s h b e t w e e n diff e r e n t p o p u l a t i o n s o f rabbits. I n this p a p e r w e e x t e n d s e q u e n c e data for t h e c y t o c h r o m e b g e n e a n d e x p a n d the s c o p e o f the a n a l y s i s o f r a b b i t p o p u l a t i o n s , b o t h l i v i n g a n d ancient. Series o f b o n e s f r o m sites o f d i f f e r e n t ages l o c a t e d close t o g e t h e r w e r e c h o s e n in o r d e r to p r o v i d e s a m p l e s o f the s a m e g e o g r a p h i c a l p o p u l a t i o n s t h r o u g h time. B o n e s f r o m 22 a r c h a e o l o g i c a l sites d a t e d as bet w e e n 11,000 a n d 300 years o l d w e r e u s e d to c h a r a c t e r ize four m a i n p o p u l a t i o n s o f r a b b i t s i n France, Spain, a n d Africa. T h e data p r e s e n t e d a l l o w the c o m p a r i s o n to m o d e r n - d a y a n i m a l s f r o m the s a m e regions.
Materials and Methods Rabbits. Modern rabbits used in this study came from three domestic breeds (21 animals) and 18 wild populations. Among the 16 already described (Biju-Duval et al. 1991; Hardy et al. 1994a,b; Monnerot et al. 1994) 14 are shown in Fig. 1; the other ones are from Australia (one animal) and Kerguelen Island (two animals). Details on the two new ones are given in the Appendix (respectively noted M and P). Nomenclature of mtDNA RFLP types is as described (Monnerot et al. 1994). Archaeological Sites and Bones. A total of 22 archaeological sites were examined in this study and are described in the Appendix. Dates are determined by either radiocarbon dating, classic dating by potteries or artifacts or historical dating for the sites from the Middle Ages. Because rabbits dig burrows we ensured the ancient origin of some bones. A.M.S. carbon 14 dates (AMS facility, University of Arizona, Tucson, AZ) were obtained directly for a piece taken from eight bone samples from which ancient DNA was successfully extracted (Table 1). Bones were either gifts from various sources or collected by the authors (Zembra: Vigne 1988, Bourges: Callou unpunished). They appeared in variable states of conservation, ranging from small fragments to entire and well-preserved specimens. The majority of them were from limbs (humerus, femur, radius, ulna, and tibia) although other bones were also used. Whenever possible, a series of bones were chosen such that they all were from the same side (left or right) and the same type to avoid extracting DNA more than once from the same animal. In order to be sure that mtDNA extracted from each rabbit bone did not come from a generalized contamination of archaeological sediments we also studied DNA from bones of other species present in the same layer. (see Appendix). DNA Extraction. Total DNA was extracted from soft tissue as described (Hardy et al. 1994a). Bone extractions were performed using a procedure modified from that already described (Hardy et al. 1994a,b): A fragment of bone was taken, heat-sealed in a thick plastic bag, wrapped in several layers of Whatman 3MM paper (the packet of paper was opened only under conditions separated from any modern rabbit research), and struck with a hammer to form a rough powder
(generally less than 1 ram3). Layers of paper were then removed under progressively sterile conditions and the powder was transferred using "sterile procedure" into 15-ml Falcon tubes already containing 5 ml 0.5 M EDTA. The bone powder was then incubated at 37°C for 2 days with three changes in buffer until no further colored matter was present in the superuatant. Following these washes, DNA was extracted overnight at 37°C in 2.5 ml of 0.5 M EDTA pH 8.5, 0.5% N-lanryl sarcosine, 100 gg/ml proteinase K. The supernatant was then phenol:chloroform extracted twice. Following this, the supernatant was concentrated by Centricon 30 dialysis and washed three times with 700 J.tl of water. The DNA was recovered in 25-100-gl water. The presence of DNA was confirmed by examining aliquots of 5-10 btl on a 2% agarose gel. The sample was then used immediately in the PCR reaction. Samples were stored at -20°C for up to a year without appreciable loss of quality as tested by PCR. In all cases, only new, unopened reagents, disposable presterilized plasticware, plugged pipette tips, and glassware were used. In addition, commercially provided sterile water was used to avoid the risk of contaminating the samples from the laboratory environment. Autoclaving reagents was also avoided, and where possible, reagents were prepared in a laboratory where there had never been rabbit extractions or samples prepared. PCR. PCR was performed on total DNA extracts in 50-100 pl of buffer supplied by Promega (50 mM KC1, 10 mM Tris-HC1, pH 9.0, 0.1% Triton X-100), 150 gM dnTPs, and 1 pM primers. In addition 1.6 pg/ml BSA was added to PCR reactions containing ancient DNA. PCR was performed in a Kontron cycler over 30 cycles for modern DNA and 40-60 cycles for ancient DNA: Each cycle consisted of 93°C, 30 s; 55°C, 60 s; 72°C, 10 s. Following the last cycle, the PCR was incubated a further 3 min at 72°C. Rabbit-specific primers (5'-3') used were:
cythll: ATGTCTAAACAACGTAGCATG (15,671-15,691) cytbl2: CTTGCGAGGGGTATAAGAATA (15,854-15,834) cythl3: GCTACTTGTCCAATGGTGATG (15,807-15,787) cytbl8: GCTATCCTACGCTCTATTCCA (15,581-15,601) cytbl9: GACGAGAACTCAGAATAGGAC (15,733-15,713) cytb3: ATGAAACTGGCTCCAACAAC (15,348-15367) Other primers used include two universal primers cyth4: ACTGGTTGGCCTCCGATTCA (15,774-15,755) cytb20: CACATCTAAACAACGAAGCAT (15,670-15,690) and a goat specific primer: cytb21: TAGCTACTGGTATTATTACTA (15,853-15,833) The numbers in parentheses and the sequences indicate the nucleotide positions of the 5' and 3' nucleotides respectively relative to the published human mtDNA sequence (Anderson et al. 1981). In order to avoid the problem of sequence errors associated with cloning (Pg~iboand Wilson 1988), asymmetric PCR (primer ratio 100: 1) was conducted in 100 pl over 40 cycles under the same PCR conditions, except that BSA and tire final 3 rain at 72°C were omitted, using 1 I-tl of the first reaction directly in the second reaction. Prior to sequencing, the single-strand (ssDNA) PCR products were phenol:chloroform (1:1) extracted; ammonium acetate was added to 2.5 M and precipitated away from the primers in 50% ethanol for 15 min at room temperature, followed by centrifugation at 13,000 rpm for 15 min. The DNA pellets were washed in 70% ethanol and centrifuged for a further 5 min at 13,000 rpm, followed by a wash in 100% ethanol, and allowed to air dry inverted for 15 rain. The ssDNA was then dissolved in 25 pl water. Each PCR and ssDNA preparation was done at least
229
•
®
% ® O
# Fig. 1. Location of ancient and modem rabbit samples: Modem rabbits and sites already studied (Monnerot et al. 1994) are noted as follows: • Northern France (6) a: Cerisay (3): b: Versailles (3) • Southern France (45) c: Arjuzanx (8); d: Donz~re (2); e: Camargue (33); f: Torreilles (2) • Northern Spain (18) g: Arroniz (l); h: Castejon (2), i: Sesma (1); j: Tudela (14) • Southern Spain (77) k: Badajoz (16); 1: Las Lomas (61) • Morocco (1) m: Rabbat • Great Britain (1) n: Norwich • Tunisia (17) o: Zembra Island • Italy (1) p: Pisa Details on archaeological and new modem sites and ancient (1-22) and modern (k, m, p) bones are given in the Appendix. twice independently. In some cases a second extraction was performed on a bone to confirm a result.
DNA Sequencing. Sequencing of single-strand PCR products was with dideoxy nucleotides using the T7 DNA Polymerase Kit supplied by Pharmacia with 10 pmol of the appropriate primer in the annealing reaction. Annealing was accomplished by heating the DNA and primers to 90°C for 2 rain before transferring the tubes directly into ice for 5 rain. Sequencing reactions were then conducted according to the manufacturer' s instructions.
Results Ancient DNA Preservation and Extraction A m p l i f i a b l e D N A was present in 90 o f the 110 ancient bones extracted and in four bones o f recent specimens.
The detection, in all cases, of h i g h - m o l e c u l a r - w e i g h t D N A , probably due to the p r e s e n c e o f m i c r o o r g a n i s m s (Pfifibo 1989; C o o p e r 1994; H u m m e l and H e r r m a n n 1994), was taken as a general indication o f the occurrence o f D N A in the i t e m under study. W e noticed a clear correlation b e t w e e n the apparent quality o f preservation of the bones and the ability to extract ancient D N A . In general, bones f r o m all ages up to the Azilian (11,800 rap.) contained amplifiable D N A w h e n they p r o v e d hard to crush (67 of 72 such bones), whereas only 23 f r o m 38 easily crushed bones p r o v i d e d positive results. It was found unnecessary to m a k e a v e r y fine p o w d e r to obtain amplifiable D N A under the chosen extraction conditions. The state of preservation appears to be m o r e related to
230 1. Data on samples
Table
Code--site
Archaeological date
Code sample
Reference date
Date
16--Montou 16--Montou 16--Montou 16--Montou 15--Mas Coste 7--Abenrador 7--Abeurador 22--Zembra
Final Bronze Age Middte Bronze Age Early Bronze Age Early Bronze Age Roman Mesolithic Mesolithic Islamic
MX MVII M3 M6 MC1 ABE2 ABE5 Zl
AA-12560 AA-12561 AA-12562 AA-13080 AA-13082 AA-13083 AA-13084 AA-13085
2,985 _+90 B.P. 2,840+_65 me. 3,615 _+90 B.V. 2,730+6 B.V. 2,095 +_60 B.P. 9,755 +_110 B.t'. 9,845 + 114 B.v. 1,290+_65 B.p.
*
.
**
*
.
20 B1 B3sa,
*
*
!
40
*
.
.
60
80
*
*
100
120
AAT~%AAcTeGGAGGAGTCCTAGCTCTAGTccTATcCATCCTTG--~TAGcCTT~ATcccATTCcTTCATATGTeTAAACAACGTAGcATGATATTceG~cCCATTAGTCAAGTcCTATTc B4sa
.....
G,.,
...........................
B3sb
.....
G ...........................................
B3sc
...o.G
.........
, ...................................................................... ,...,.
.....................................
, ............................................................
B3sd
.......................
B3se
.....
G ....................................
B4sb
.....
G ...................................................
, ...............
, ..... , ...........
, .....
. ....
, ................................................
. ...............
i%.. ...........................................
,.
. .........
, ........................................
..,
, .............
,.
,. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
° ..............................................................
Bfi,7
..........................................................................
C .............................................
BB-II X!,7
A .....
TT ....
T ...................................
A2
.......................
A .....
TT ....
T .............................
A ...................................
C ...........
A3
.......................
.......................
A .....
~T ........................................
A ...................................
C.
A4
.......................
A .....
TT ....
A ...................................
C..
T .........
A ........ C .....
T .........................
° ..........................
C ............ .....
,
. .....
, .........
AS,6 A8,9 AI0 All
" " ' ."G'" ... . . . . . . . . A. . . . ~ .... • . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ~', ~: ~i:!e. . . . . . . . . . . . a .... ~ .... • ................................... ~ .............................. ~ :~;. ~ , ~ . . . . . . . . . . . . . . . . . . . . . . . . a . . . . ~ .... • . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . &~. ~
A12
...........
AI3
.......................
B1
TQAG__~
.
, ...........
*
1
A .....
TT
A .....
TT ....
....
.
,
T ...................................
A ....................
T .............
A ................................
.
140 T C G TCG
C AGA
A T G AAT
......................
• ................
......................
o ........................
B3s~ B3sd
....................... • ....................... ...........................................
B3se
...............................................
B4sb
.........................................
B6,7
• ~,°
BS-II
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
AI,7
• . ./b-q .................
A2
° • .~.¢. ..........
A3
° . . ~
A4
.
. ...... .
.
° ......
................
• • .~=.~ .................
,,G
.
.
.
.
.
.
.
G .....
.
G C C AAC .....
.
.
.
.
.
.
....G .
.
.
.
.
G ...........
G..,,.G
.....
°, . . . .
,G,°.°.G
...........
A .....
G ...........
.....
G ..... G .....
G .....
G ...........
G .....
G .....
G ...........
G..T..G
•~ . q ....
AI2
.....
AI3
.o . A . C
.................
G .....
G..,
........
.
,. ....
G .....
**
200
AC C C G T T C A TCACCATTG
TAG
CAT
T C TACT
,...,.°
G ..............
A ...........................
C,.
G ..............
A ..............................................
A . . . . . . . . . . . . .
o .....
.............. G,
............. ..............
.........
eA TCC T
°o.,
.................... ..°.
~ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
T ....................
C ..........
T .....
,,°o, A .....
/% . . . . .
T .....
C ..........
T...,.A
....
T ....................
C .....
T .....
A .....
A .....
T ........
Coo
A,
....
A .....
. ..............
G.,.
........
. ....
........
T ....................
C ........
T ....................
C ..........
T .......
, ............
C ..........
To,.o.A ,,T
....
.....
A .....
T...,.A
.....
T .....
G .....
G ...........
G..T.
.G ..............
A .....
T ....................
C ...........
T .....
A.
C .................
G .....
G.
G..T..G
..............
A .....
T ....................
C ...........
T .....
/% . . . . .
.................
G .....
A ...........
G .....
G ..............
A .....
T .............
C ...........
T .....
A .....
, ......
°
o
A .....
.C .................
• • ........
,,...
T .....
A .....
A .....
G ..............
T CACCAC
, ............. , .....................
G~ . . . . . . . . . . . . .
........
.. ....
o ............
. .................
A ................................ A ............................
G ....................
.......
.
C TGTCC
A ..................................................
G ..............
......
220
I
G AC AAG
A ..................................... A ..........
....,,C C..C
G .............. ..............
G..T..G
• • o~u.~ ................. . • .~_
All
~
, ........
G ..............
G,.T..G G .....
AS,6
A10
G ........
o..,G
A8,9
.................
,
C AG TAGAAC
G ..............
G .....
.......................... .
*
180
C G GAG
B3sa,B4sa
.
*
160
T C T T C T CACACTCAC
B3sb
.
. .....................
• •• •
Fig. 2. Nucleotidesequence changes at the carboxy terminusof rabbit cytochrome b. The sequences are shown relative to that present in domestic rabbit mtDNA and correspondto a 233-bp fragmentbetween primers cytbl8 and cytbl2. Position 1 = position 318 relative to the published fragment of rabbit cytochrome b sequence (Mignotte et al.
1990) and position 15,602 in the human mitochondrialDNA sequence (Andersonet al. 1981). Variablenucleotidepositions are indicatedby an asterisk. ! = Variablenucleotidepositionexpressed as an aminoacid change (underlined).
the quality of bone preservation than to the age of the archaeological site. For example, most bones preserved in dry caves up to 11,000 years old were very well preserved and provided amplifiable DNA. By contrast, bones found in nonprotected sites like Laouret (3,000 raP.), Lunel-Vieil (1,800 B.v.), and Chevreuse (600 B.P.), and which could have been subject to rapid degradation in the soil, provided a much lower yield. No fluorescent material, reportedly associated with an inhibition of the PCR reaction (P~i~bo 1989; H~inni et al. 1990), was detected in any of the D N A extractions performed using the method described in this paper. However, a strong inhibitor of PCR was present in some samples (e.g., AND6, L1, L2, Appendix), as seen by the absence of formation of primer-dimers and PCR products during the reaction.
Controls
A major concern has been to avoid error or contamination at the different steps. Radiocarbon datings (Table 1) confirmed that bones which have yielded mtDNA were dated with certainty by the age of the archaeozoological layer they came from. This rules out intrusions from more recent burrows. All pre-PCR solutions were set up under sterile conditions in a biohazard hood in a separate room from that used for conducting the PCR reactions and were run with both a control and blank. The study of DNA extracted from pig, sheep, goat, or chicken from the same layer as rabbit bones had two aims: it permitted exclusion of any generalized contamination of the sediments by rabbit material and any " c a r r i e r effect" (Thomas and Pg~ibo 1993). In addition, the primer pairs
231 were chosen to be specific to rabbit mtDNA to avoid amplifying nonrabbit DNA. In the event an extraction blank gave a positive result (on three occasions), all solutions were replaced and a second independent extraction of the bones was performed. A second control involved extracting independently two bones suspected to have come from the same animal (as in the case for the two femur bones AND 1 and AND4). A third control is provided by the fact that amplification generally succeeded only for short fragments. In some extracts PCR products of 275 bp could be produced using the primer pairs cytb l 8, cyth 12 apparently independent of the age of the archaeological sites (result not shown), but PCR products of 389 bp using the primers cytb3, cytbl9 could only be obtained from the modern or recent samples (R1, R5, MOR1, and PIS1).
O/tb
100bp I
tRNA thr
cytb 18
B
l -
A16S
G6
G
A24 w "m0-T31 - T3G-A72 i
14
mutations
e108 - A124 - -
c~2e-
C210 -T222 -A228 -
Determination of Cytochrome b Sequence
B3sc/B3se position 43 GTT val ~ ATT ile (TOU1) B4sa/B4sb position 21l GTC val --~ CTC leu (CM6.1) B/A position 124 GTT val --~ ATT ile
cytb12
k1~2
-
G14~ -G150 --
A total of 19 distinct sequences were found among present-day rabbits or ancient bones in the 233-bp DNA region between primers cytbl8 and cytbl2 (Fig. 2). In this sequence, 27 nucleotides are variable and there are 13 nucleotide differences between the sequences belonging to the two divergent lineages already described (lineage A and lineage B, Biju-Duval et al. 1991). The remaining variations are associated with subtypes within each lineage. Nine different lineage B and ten different lineage A sequence types were distinguished from both the modern and ancient samples. Some modern DNA types distinguishable by RFLP analysis of whole mtDNA, however, cannot be separated in this region (for example, types B8-11, Fig. 2). By contrast, in B3 and B4 RFLP types five distinctions were introduced by sequence examination. A total of nine of these types were detected in ancient bone samples. One of the 12 most parsimonious networks between mtDNA types, based on the sequence data, is shown in Fig. 3: It evidences the existence of five possible homoplasies (positions 6, 72, 124, 162, and 183). Types B8-11 (from Northern Spain) always represent the node sequence for lineage B when A3 and A11 (from Southern Spain) are alternately proposed for lineage A. Four subsequence mtDNA types were present only in ancient extracts (B3sd in AND1, AND4, VR3, and M9; B3se in TOU1; B4sb in CM6.1; and A12s in ALG1) and one type (A13s) is present only in the recent sample MOR1 from Morocco. A total of three variable amino acid changes were observed: two are only present in the ancient samples CM6.1 and TOU1 and they are all conservative changes between valine and isoleucine or leucine:
I
tRNA glu
%
--
--
,,:o
A
~
124
Fig, 3. Relationship between ancient and modern rabbit mtDNA types in the cytochrome b gene between primers cyth18 and cytbl2. The positions and changes between the types are shown relative to the sequence found in types B8-11 from northern Spain. Small circles: Modern mtDNA types; large circles: mtDNA types also found in ancient bone samples; shaded circles: mtDNA types which have been found in ancient bone samples.
Comparison Between Ancient and Modern mtDNA Sequences The archaeological sites examined (Fig. 1) are located in four geographically distinct regions: France (19 sites), northern Spain (l site), Portugal (1 site), and Tunisia (1 site). Modern rabbit populations from each of these regions have been already studied and can be distinguished on the basis of mtDNA sequence and RFLP polymorphisms (Table 2). Types B1--4 are found in France; types B8-11 in northern Spain; types B6-7 on Zembra and types AI-11 and B3 in southern Spain (Biju-Duval et al. 1991; Monnerot et al. 1994). The analysis of ancient DNA types found in all regions compared to modern types reveals that essentially the same sequences have been present in these regions for thousands of years (Table 2, Fig. 4). This demonstrates a remarkable stability of populations through time. The sole exception is the occurrence of mtDNA type B 1 in the Middle Ages throughout France when it was
232
oern-[128 Ages B1
B3sc B4sa
AzilianRoman
B1
B3sc B4sa
apparently previously absent. Type B 1 could not be detected in any of the 47 rabbit bones examined from the nine different Azilian (11,800 rap.) to Roman (1,600 B.P.) sites, whereas it was present on all the 11 other more recent sites dated between the 10th and the 18th centuries A.D. (29 of 41 bones examined). It has not been detected either in ancient wild populations of rabbit examined so far from Spain (this study) or Zembra Island (Hardy et al. 1994a,b). However, this result has to be considered with caution since data for the ancient Iberian populations are limited to only four extractions from Huesca in Northern Spain (types B8-11) and a single extraction from A1gares in Portugal (type A12s).
Discussion Rabbit is an ideal organism in which to study the history of populations and the evolution of diversity using ancient DNA, since fossil remains of this species are extremely abundant at many archaeological sites dated to over 10,000 years ago. Modern rabbit communities are the result of a complex interaction between the original populations and those introduced or manipulated by humans. In the Iberian Peninsula, rabbits have been present for millenia (Donard 1982; Lopez-Martinez 1989), but recently the colonies have been adversely affected by the arrival of viral diseases such as myxomatosis and hemorrhagic disease and by the subsequent transfer of animals from less
O O O Q
B1 B3sc B4sa B3sb,d,e
Fig. 4. Distribution of rabbit mtDNA types from prehistoric to modern times in France. The number of rabbit samples for each main mtDNA type and for each historic period is indicated. For numbers and letters refer to Table 1. For mtDNA types refer to the Appendix.
affected regions (Rogers et al. 1994). By contrast, in northwestern Europe (north of the Loire Valley in France) most populations have been created by humans during the last 2,000 years (Bodson 1978; Rougeot 1981; Donard 1982). During the same period humans have developed a succession of efforts to control rabbits: establishment of Roman leporaria, medieval warren development, and finally, translocations of animals associated with domestication (Monnerot et al. 1994). Introductions occurred early in the Mediterranean Basin, whereas later ones have been made at localities throughout the world, particularly during the last 300 years (Flux 1994). The net result has been to modify the original population structures when they existed and to create new genetic entities. For Zembra Island (Tunisia), our preliminary experiments on ancient DNA using the 16S rRNA sequences have been confirmed by present data on the cytochrome b genes. The mtDNA type found uniquely on this island has been present for over 1,400 years. Both the mitochondrial homogeneity (Hardy et al. 1994a,b) and the specificity of nuclear alleles detected only in this population (Benammar and Cazenave 1982) suggest a strong founder effect due to the introduction from a limited number of individuals all from the same maternal lineage. In Europe, examination of mtDNA diversity (cytochrome b gene) over longer periods of time (Mesolithic to Bronze Age) indicates that in the absence of active interference by humans, rabbit populations appear to stay
233 Table 2.
Geographical distribution of ancient and modem mtDNA types in European rabbita Locations of mtDNA types according to historical period
DNA typeb
Modem
Middle Ages
Roman
Bronze Age
Neolithic-Azilian
B1
abcdfn pqrs k a cf --e
1-6,8 12,18 . . 4-6,8 8 18 2,4
--
--
--
16 16 ---
---7,11,17 11
- -
- -
B3sa° B3sb B3sc B3sda B3sed B4sa° B4sba B6/B7 B8-11 A1/A7
.
o
ghij 1
A 2
1
A3 A4 A5/A6 A8/A9 A10 All A12sa A13sd
1 1 1 kl k k -m
.
. .
.
. . 9,10,15,19 19 -14
. .
.
22
22
- -
- -
- -
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-.
21 .
-.
20
--
.
a The numbering of the sites is according to Fig. 1 b Ancient mtDNA types based on cytochrome b gene sequence data between primers cytbl8 and cytbl2 (Fig. 2); modem DNA types based on sequence and RFLP data MtDNA types B3sa and B4sa are distinguishable by RFLP in modem
samples but not in the cytochrome b gene sequence used for ancient samples d MtDNA type has as yet only been found in archaeological or museum specimens
stable (at least for 11,000 years in some cases) with respect to m t D N A types (Fig. 4). Moreover, the two major m t D N A types from southern France (B3sc and B4sa) have not yet been found on the same archaeological sites, despite the close proximity of some of them (for example, A b e u r a d o r and M o n t o u less than 100 k m apart). This suggests a strict allopatry with very poor or no introgression. The only exception appears to be at sites in the north of F r a n c e where rabbits introduced from elsewhere during the M i d d l e A g e s (Louvre) exhibited mixtures of m t D N A types. This indicates that a n i m a l s transferred originated from several different wild populations. A similar situation might be encountered in other areas where rabbit did not exist previously (England, Italy, and elsewhere). W e have d o c u m e n t e d here the a p p e a r a n c e of the m t D N A type B 1 into populations in France and its dispersal d u r i n g the M i d d l e Ages. The absence of this type from earlier samplings of southern France suggests that, in this area, it has b e e n either introduced or strongly selected for in existing populations. Future studies of populations from various regions of Spain m a y provide the original geographic origin of the type B 1 probably introduced into F r a n c e (as suggested for types B6, 7 introduced to Z e m b r a , Hardy et al. 1994a,b) and m a y
also explain w h y it is the only type found in domestics stocks until now. It will be of great interest to e x p a n d the data obtained for m t D N A diversity in ancient populations and include nuclear D N A data. This will shed light on the elaboration of the genetic structure of populations and help in understanding w h y there is a general decrease in the n u m ber of alleles for biochemical p o l y m o r p h i s m s (Arana et al. 1989; Ferrand et al. 1988) and i m m u n o g l o b u l i n s (Van der Loo et al. 1991) in present wild populations of rabbits from south to north, m a n y o f which are absent in the domestic rabbits.
Acknowledgments. The authors acknowledge particularly F. Claustre (Montou), J. Courtin (Chfiteauneuf les Martigues), J. Kotarba (Caner), and M.-R. Sdronie-Vivien (P6gouri6) for their collaboration. The authors want also to thank many researchers for giving an easy access to archaeological or modern bones: P. Castafios Ugarte (Huesca), M. Cavailles (Parthenay), J. Chapelot and B. Clavel (Vincennes), V. Forest (Lunel-Vieil), J. Gasco (Laouret), P. M6niel and P.-J. Trombetta (Chevrense), P. M6niel and P. Van Ossel (Louvre), P. Migaud (Andone), I. Rodet-Belarbi (L'Isle Jourdain, Toulouse et Algares), C. Sorrerltino (Pise), M. Tranier (M.N.H.N.; Maroc), J. Vaquer (Auriac and Abeurador), and J.-H. Yvinec (Douai). C. Hardy acknowledges Anne Loyau and Florence Mougel for help in DNA sequencing. His work has been made possible by the financial assistance provided by a French government postdoctoral scholarship. This study has been supported by the EPHE and BRG.
234
~o I
i
+
+
.F
¢
~):.}:.:.
+ + + + + ÷ + + + + +
+ + + ÷ + + + ÷ +
+
'¢~¢¢¢¢¢¢¢44
¢
,.l-
oo
d
Ys
llilli I
".4 i
,
.
'dd~dddd~
~
er~
Z
I
M~M~MMMM~MM~
~
Z
)
l.,F.l
=~
~'~"~
~
~ I~
~
~
d u
°~
•~ ~ ~..~
~.~
o
o
~c~
i
°
235
0 e~
ca ca "~
+ + + + + + + + +
++
+ ÷ + + ÷
+
÷
4
4
4- + + + + + .
.
.
,
,"
m
• ÷++
+
44.4.~.
4.
+ + , +
÷ +
+
;4
4 c~
I
ddd4dd~dddddd-d-d-dBdddd
dddd
c~ e4 c~ ~4
:
,4
ddddddd~d
e~e~
d
e~e4
N
e~te~
o
,4,4
,4
el
Z o
2^~EEZ
Z Z Z Z
>
;>
"2. ~ o o o ~ 6 o 6 4 ~
6
~
~6666
6~
m
c~ c~
c~
N c~ .-; d c~ d 6
~
e~ ,.4
MMMMMMMMMMM~ m m t'~ m m t~1 e.t
g.
g ~0
0
~o
4
~
en,,~
~o~.~
~e
~g
% uuc~u OCDCDOOO
.
.
.
.
Oo
.
.
.
.
~8
2~2~
.
I ++÷ ÷
+++
+
+
:-444:-444:-4:-:-4
,-
+
+
+
4
4
4
~,,+,
÷ +
m~
c~0
~ 0 o o o o 0 o o o Z
~N~NNNd
N ~ o d d ~
NN
0
z Z Z N N N N N N N N N
d N d d d d d d d d N o ~
c~ c~ c5
oo
or-
.;6
Z
~.-E_ ¢. u~
~
~,~
~o
236
References Anderson S, Bankier AT, Barrell BG, De Bruijin MHL, Coulson AR, Drouin J, Eperon JC, Nierlich D, Roe BA, Sanger F, Schreier PH, Smith AJH, Staden R, Young IG (1981) Sequence and organization of the human mitochondrial genome. Nature 290:457-765 Arana A, Zaragosa P, Rodellar C, Amorena B (1989) Blood biochemical polymorphisms as markers for genetic characteristics of wild Spanish and domestic rabbits. Genetica 79:1-9 Benammar A, Cazenave PA (1982) Rabbit immunoglobulin allotypes: cross-reactivities of the b95 and b96 allotype specificities with the allotypes of the b series present in domestic rabbits. Ann Immunol (Inst Pasteur) 133c:365-376 Beaucournu JC (1980) Les ectoparasites du lapin de garenne, Oryetolagus cuniculus: apports ~ son histoire. Bull Mens Off Nation Chasse, N ° Sp Scien Tech, Dec 1980, pp 23-36 Biju-Duval C, Ennafaa H, Dennebouy N, Monnerot M, Mignotte F, Soriguer R, E1 Gaied A, E1 Hill A, Mounolou J-C (1991) Mitochondrial DNA evolution in Lagomorphs: origin of systematic heteroplasmy, organization of diversity in European rabbits. J Mol Evol 33:92-102 Bodson L (1978) Donn6es antiques de zoogdographie. L' expansion des Ltporidts dans la Mtditerrante classique. Naturalistes Beiges 59: 66-81 Cavailles M (1991) Les rtsultats des fouilles archtologiques de la maison des Cultures de Pays. In: Dialogues. II ~tait une fois Ia rue de la van Saint Jacques ... et l'Egypte en Poitou-Charentes. Associations Parthenay-Remparts et Muste et Service Patrimoine de la ville, pp 114-141 Clavel B (1991) Etude archtozoologique. Premiers r6sultats. In: Fouille de sauvetage d'une latrine mtditvale dans la tour des Salius du Chfiteau de Vincennes (Jan-Avr 1991). Rapport Scientifique No. 2 Equipe de Recherche sur le Ch~tean de Vincennes et le banlieue est, pp 158-162 Cooper A (1994) DNA from museum specimens. In: Herrmann B, Hummel S (eds) Ancient DNA. Springer-Verlag, New York, pp 149-165 Courtin J, Evin J, Thommeret Y (1985) R6vision de la stratigraphie et de la chronologie absolue du site de Chfiteauneuf-les-Martigues (Bouches-du-Rhone). Anthropologie (Paris) Tome 89(4):543-556 Donard E (1982) Recherches sur les 16porin6s quaternaires (P16istoc6ne moyen et sup6rienr, Holoc~ne). Unpublished doctoral thesis, Universit6 de Bordeaux Ferrand N, Carvalho G, Amotim A (1988) Transferrin (Tf) polymorphism in wild rabbit, Oryctolagus cuniculus. Animal Genet 19: 295-300 Flux JEC (1994) World distribution. In: Thomson HV, King CM (eds) The European rabbit. The history and biology of a successful colonizer. Oxford Science Publications, Oxford, pp 8-21 Gasco J, Guilaine J, Sol J (1986) Le Laouret (Floure, Aude). Un site de hauteur de l'Age du Bronze final La c6ramique. Rev Arch6ologique Narbonnaise Tome 19:321-330 Grenouilloux A, Migaud P (1993) Sanvages commensaux ou domestiques, l'animal dans l'economie aiimentaire d'un "Castrum" de l'an Mil. In: L'Homme, l'Animal domestique et l'Environnement du Moyen Age au XVIIY siecle. Documents et enqu~tes No. 19, Centre de Recherche sur l'Histoire du monde Atlantique. Ouest Editions, University Nantes, pp 163-176 Hanni C, Laudet V, Sakka M, Bggue A, St6helin D (1990) Amplification de fragments d'ADN mitochondrial ~ partir de dents et d'os humains anciens. C R Acad Sci III 310:365-370 Hardy C, Vigne J-D, Casane D, Dennebouy N, Mounolou J-C, Monnerot M (1994a) Origin of the European rabbit (Oryctolagus cu-
niculus) in a Mediterranean island: zooarchaeology and ancient DNA examination. J Evol Biol 7:217-226 Hardy C, Casane D, Vigne J-D, Callou C, Dennebouy N, Mounolou J-C, Monnerot M (1994b) Ancient DNA from Bronze Age bones of European rabbit (Oryctolagus cunieulus). Experientia Hauswirth WW, Dickel CD, Lawler DA (1994) DNA analysis of the Windover population. In: Herrmann B, Hummel S (eds) Ancient DNA. Springer-Verlag, New York, pp 104-121 Horai S, Kondo R, Murayama K, Hayashi S, Koike H, Nakai N (1991) Phylogenetic affiliation of ancient and contemporary humans inferred from mitochondrial DNA. Philos Trails R Soc Lond Biol 333:409-417 Hummel S, Herrmann B (1994) General aspects of sample preparation. In: Herrmann B, Hummel S (eds) Ancient DNA. Springer-Verlag, New York, pp 59-68 Kotarba J (1991) Villeneuve de la Raho Mas Sauvy In: Sondages de reconnaissance. Association Patrimonie Archtologique Villeneuvoise et des environs Kotarba J (1993) Mas Coste, Perpignan. In: Bulletin de l'Association Archtologique des Pyrendes Orientales No. 7, pp 28-30 Lopez-Martinez N (1989) Revision sistematica y biostratigrafica de los lagomorphos (Mammalia) del neogeno y cuaternario de Espana. Memorias del museo paleontologico de la Universidad de Zaragoza. Diputacion general de Aragon (eds) Meniel P, Arbogast R-M (1989) Les restes de Mammifers de la cour Napoleon du Louvre (Paris) du XIVe au XVIIIe siecles. Rev Pa16obiol 8(2):405-466 Mignotte F, Gueride M, Champagne AM, Mounolou J-C (1990) Direct repeats in the non-coding region of mitochondrial DNA. Involvement in the generation of intra- and inter-individual heterogeneity. Eur J Biochem 194:561-571 Monnerot M, Vigne J-D, Biju-Duval C, Casane D, Callou C, Hardy C, Mougel F, Sorigner R, Dennebouy N, Mounolou J-C (1994) Rabbit and man: genetic and historic approach. Genet Select Evol 26: 167s-182s P~i~ibo S (1989) Ancient DNA: extraction, characterization, molecular cloning and enzymatic amplification. Proc Natl Acad Sci USA 86:1939-1943 P~i~iboS, Wilson AC (1989) Polymerase chain reaction reveals cloning artifacts. Nature 334:387-388 Peterka M, Hartl GB (1992) Biochemical-genetic variation and differentiation in wild and domestic rabbits. Z Zool Syst Evolut Forsch 30:129-141 Rogers PM, Arthur CP, Soriguer RC (1994) The rabbit in continental Europe. In: Thomson HV, King CM (eds) The European rabbit. The history and biology of a successful colonizer. Oxford Science Publications, Oxford, pp 22-63 Rougeot J (1981) Origin et histoire du lapin. Ethnozootechnie 27:1-9 Saint-Girons MC (1973) Lagomorphes. In: Saint-Girons MC (ed) Les Mammif'eres de France et du Benelux. Doin Editions, Paris, p 402 Stronie-Vivien M-R (1989) Un habitat en grotte: La grotte de Ptgouri6 (Carniac-dn-Cansse, Lot) Perigurdien-Badegoulien-Azilien-Age du Bronze Bulletin de la SPF Tome 10112:363-369 Thomas W, P~i~iboS, Villablanca FX, Wilson AC (1990) Spacial and temporal continuity of kangaroo rat populations shown by sequencing mitochondrial DNA from museum specimens. J Mol Evol 31: 101-112 Thomas W, P~i~iboS (1993) DNA sequences from old tissue remains. In: Zimmer E, White TJ, Cann RL, Wilson AC (eds) Academic Press, Methods Enzymol 224:406-419 Treinen-Clanstre F (1989) Fouilles rtcentes ti la grotte de Montou (Corb~re-les-Cabanes, Pyr6ndes-Orientales). Etudes roussillonnaises offertes ~ Pierre Ponsich. Le Publicateur, Perpignan, pp 8391 Trombetta P-J (1980) Les fouilles du chfiteau de la Madeleine ~tChevreuse, juin 1979-mars 1980, Catalogue d'exposition, Chevreuse Vaquer J, Barbaza M (1987) Cueillette ou horticulture mtsolithique: la
237 Balma de l'Abeurador. In: Premi6res communant~s paysannes en Mdditerrande occidentale. Actes du Colloque International du C.N.R.S.C.N.R.S., Paris, pp 231-242 Van der Loo W, Ferrand N, Soriguer RC (1991) Estimation of gene diversity at the b-locus of the constant region of the immunoglobulin light chain in natural populations of European rabbits (Oryctolagus cunieulus) in Portugal, Andalusia and on Azorean islands. Genetics 127:789-799 Vigne J-D (1988) Donn~es prEliminaires sur l'bistoire du peuplement
mammalien de l'Ilot de Zembra (Tunisie). Mammalia 52(4):571574 Vigne J-D, Biju-Duval C, Soriguer RC, Dennebouy N, Monnerot M (1994) Multiple characterization of a reference population of European rabbit (Oryctolagus cuniculus) from Las Lomas (Southern Spain). Polish Ecological Studies 20:591-604 Villablanca FX (1994) Spatial and temporal aspects of populations revealed by mitochondrial DNA. In: Herrmann B, Hummel S (eds) Ancient DNA. Spriuger-Verlag, New York, pp 31-58
