RealTime ready Universal ProbeLibrary Redefining and ...

RealTime ready Universal ProbeLibrary Redefining and revolutionizing real-time qPCR assays

Design gene expression assays and quantify virtually any transcript in any genome by using the unique combination of rapid, online assay design and 165 probes. Choose from transcriptome specific sets of 90 probes, the complete library, or select individual probes for your specific design.

RealTime ready

2

Universal ProbeLibrary – Technology

4

Technology

4

Coverage Rate

4

Multiplex Assays

5

Universal ProbeLibrary – Assay Design

6

ProbeFinder Software

6

In silico PCR

6

Design Multiplex Assays

6

Assay Design Process

6

Input Formats for Target Specification

8

Other Organisms

8

Entering Multiple Sequences (Batch Design)

8

Universal ProbeLibrary – Performance Data

9

Comparison to SYBR Green I Assays

9

Quantification of Zea mays mRNAs

10

Comparison of hydrolysis probe assay to UPL on the LightCycler® 480 Instrument

11

Universal ProbeLibrary Assay List

12

Universal ProbeLibrary – Step by Step Assay Design Guide

13

Choose an Organism

14

Specify Your Target

14

Examine the Result

17

View Additional Assays

19

See All Assays

20

Entering Multiple Sequences

21

Make Your Choice

25

Additional Information

26

Glossary

26

Ordering Information

30

RealTime ready Universal ProbeLibrary

Redefine and revolutionize real-time qPCR assays

Based on only 165 short hydrolysis probes and an easy-to-use and fast assay design software Universal ProbeLibrary (UPL) allows you to design real-time qPCR assays in seconds and to analyze over five million transcripts of a large variety of organisms. Significantly reduce assay design time – in just seconds, design specific, intron-spanning assays for multiple organisms with the free, web-based ProbeFinder software, available at www.universalprobelibrary.com

Rely on probe-based qPCR assays that work first time – there is no need to wait for an assay or custom probe or spend weeks on assay optimization. Reduce the costs of gene expression quantitation – by performing multiplex assays with UPL Reference Gene Assays. Utilize standard protocols on any real-time PCR instrument – no special hardware or reaction conditions required.

3

RealTime ready Universal ProbeLibrary – Technology

Perform millions of qPCR assays for any sequenced organism with only 165 short hydrolysis probes Technology

Coverage Rate

Universal ProbeLibrary is based on only 165 short hydrolysis probes, labeled at the 5' end with fluorescein (FAM) and at the 3' end with a dark quencher dye.

94 – 99 % of all transcripts of the organisms that can be selected on the Assay Design Center can be detected with a UPL assay. A large number of those are intron-spanning (Table 1). For all other organisms assays can be designed with a high success rate, when entering the specific sequence information.

The extensive transcript coverage of the UPL probes is due to their short length of just 8–9 nucleotides and the selected sequences. In order to maintain the specificity and melting temperature that hybridizing qPCR probes require, Locked Nucleic Acids (LNA) are incorporated into the sequence of each UPL probe. LNA’s are DNA nucleotide analogues with increased binding strengths compared to standard DNA nucleotides.

Technology

The sequences of the 165 UPL probes have been

carefully selected to detect 8- and 9-mer motifs that are highly prevalent in the transcriptomes, ensuring optimal coverage of all transcripts in a given transcriptome. Within the human transcriptome, each probe binds to approximately 7000 transcripts, while each transcript is detected by approximately 16 different probes. Only one specific transcript is detected at a time in a given PCR assay, as defined by the set of chosen PCR primers. A specific realtime PCR assay is designed by a simple two-step procedure using the ProbeFinder Software, online available at the Assay Design Center. For each assay, the design software suggests an optimal set of PCR primers, a probe, and any possible alternative combinations.

Table 1: Organism-Specific Coverage Rate of UPL Probes Organism

Species

Noofof No Assays Assays

Human

Homo sapiens

> 639 500

99%

Mouse

Mus musculus

> 509 500

99%

Rat

Rattus norvegicus

> 364 000

98%

Primates

Pan troglodytes

> 519 500

96%

Drosophila

Drosophila melanogaster

> 253 500

99%

Arabidopsis

Arabidopsis thaliana

> 199 000

98%

C. elegans

Caenorhabditis elegans

> 134 000

95%

Maize

Zea mays

> 61 500

94%

Rice

Oryza sativa

> 898 500

98%

Zebrafish

Danio rerio

> 630 000

98%

Yeast

Saccharomyces cerevisiae

> 42 000

95%

Total

Coverage Coverage Rate Rate

> 5 000 000

Product Concept

UPL assays are compatible with all real-time PCR instruments capable of detecting fluorescein, FITC, FAM, and/or SYBR Green I. UPL probes may be purchased either individually or as part of preconfigured sets with 90 probes each, for human, mouse and rat. The complete library is obtained when ordering the Universal ProbeLibrary Set,

4

Human, containing probes # 1 – 90 and the Universal ProbeLibrary Extension Set, containing probes # 91 to 165. Note: PCR primers are not included with the

Universal ProbeLibrary Sets, but can be ordered from any oligonucleotide supplier.

LNA Technology Locked Nucleic Acids (LNA) is a class of nucleic acids analogues, where the ribose ring is “locked” with a methylene bridge connecting the 2’-O atom with the 4’-C atom (see structure). LNA nucleosides containing the six common nucleobases (T, C, G, A, U and mC) are able to form base-pairs with their complementary nucleosides according to the standard base pairing rules. Therefore, LNA nucleotides can be mixed with DNA or RNA bases in the oligonucleotide whenever desired. The locked ribose conformation enhances base stacking and backbone preorganization, this gives rise to an increased thermal stability and discriminative power of duplexes.

Pervect Match Match Perfect

Singe Mismatch Single Mismatch

3’-ACG A CCAC-5’

3’-ACG G CCAC-5

⌬T m

45 °C

26 °C

LNA 8-mer 5’-TGC T GGTG-3’

71 °C

Technology DNA 8-mer 5’-TGC T GGTG-3’

35 °C

25 °C

10 °C

Assay Design

Multiplex Assays with Universal ProbeLibrary Reference Gene Assays Use the Universal ProbeLibrary Reference Gene Assays together with the UPL probes to easily quantify expression levels of a human, mouse, or rat gene of interest in relation to an endogenous reference gene in a dual-color assay. Four reference gene assays are available for human (Human PBGD-, HPRT-, ACTB-, and PGK1 Gene), two for mouse and rat (ACTB-, and GAPD Gene each).

Performance Data

Each Universal ProbeLibrary Reference Gene Assay provides a specifically designed 12-mer UPL reference gene probe and the corresponding reference gene-specific primer pair in a separate tube. The probe is labeled with LightCycler® Yellow 555 at the 5’-end and with a dark quencher dye near the 3’-end, to enable dual-color assays in combination with the standard UPL probes, which are labeled with FAM. The UPL reference gene probes can be detected using real-time PCR instruments with excitation filters of 470 nm to 530 nm and emission filters of 550 nm to 610 nm. The design of multiplex PCR assays for a target gene and a UPL Reference Gene Assay is facilitated by the free web-based ProbeFinder software at the Assay Design Center.

Assay Design Guide

Figure 1: Typical dual-color qPCR results using the Universal ProbeLibrary Reference Gene Assays. cDNA dilutions were amplified in mono- and dual-color assays on the LightCycler ® 480 Instrument and detected either (a) in the FAM channel or (b) in the LightCycler ® Yellow 555 channel.


5

RealTime ready Universal ProbeLibrary – Assay Design

Utilize the free, online ProbeFinder assay design software at www.universalprobelibrary.com to generate qPCR assays for virtually any transcript of any organism

ProbeFinder Software

Technology

Assay Design

ProbeFinder is a web-based software tool, that is used in combination with the UPL probes. Based on the user-defined target information the software designs real-time PCR assays by combining a suitable UPL probe with a set of target specific PCR primer pairs. Together, the probe and PCR primers constitute a specific real-time PCR assay for a given target. ProbeFinder assay design software is based on Primer3 software using optimized settings as default, to give best results with UPL probes without any further optimization of assay conditions, as described in the product information. Experienced Primer3 users can modifiy these settings before they start assay design. (Details about used Primer3 settings can be found in the Glossary.)

In silico PCR

Performance Data

Assay Design Guide

All primer pairs designed by ProbeFinder are checked by an in-house developed in silico PCR algorithm. The algorithm searches the relevant genome and transcriptome for possible mis-priming sites for either of the two PCR primers. If any of the identified mis-priming sites are positioned in the genome or the transcriptome in a way that could potentially give rise to an unintended amplicon, the assay is downgraded in the list of available assays and flagged as having failed the in silico PCR check. The in silico PCR function minimizes: Risk of false assay signals from genomic DNA Risk of false assay signals from unrelated transcripts generated by splice variants or homologous genes/gene family members Detection of pseudogenes Targeting of genes with introns that are too short for effective intron-spanning assays


6

Design of Multiplex Assays with Human, Mouse or Rat Reference Genes When the option “Design multiplex PCR with reference gene” is chosen, ProbeFinder will conduct assay design for your gene of interest, while at the same time subjecting each of these designs to an in silico test to evaluate its ability to be multiplexed with the selected UPL reference gene assays. The in silico PCR for multiplex assays, takes the following paramenter into consideration: • Primer-primer interactions • Primer-probe interactions • Probe-probe interactions • Probe-amplicon interactions (to prevent the probe from incorrectly generating signal on the amplicon) • In silico PCR with all 4 primers (to prevent amplification of undesired cDNA fragments)

Assay Design Process ProbeFinder performs a number of steps to select the optimal real-time PCR probe from the Universal ProbeLibrary in combination with a set of PCR primers. The following databases are available to ProbeFinder: h_sap_gene, h_sap_exon, h_sap_refseq, h_sap_embl, h_sap_genome. Database updates are done regularly. (Details about data bases and sequence identifiers can be found in the Glossary.)

Locate exon-exon junctions

Introns are identified by one of following methods: • Look-up in Ensembl (if available) • Prediction by in house algorithm based on BLAST • User annotated in the input sequence Technology

ProbeFinder uses the following criteria when predicting introns: • The identity must be at least 95% certain • The exon must be at least 40 nucleotides long • The intron must be at least 30 nucleotides long

Find appropriate UPL probe

• Search input sequence for UPL probes target sites avoiding known human SNP’s (only for Ensembl sequences). • The human, mouse and rat design relies on the 90 probes of the respective organism specific UPL sets where as the remaining are based on the complete 165 UPL probes

Design PCR primer for each target site

• Search the genome to ensure primer uniqueness • Search for gene family members and splice variants • Perform in silico PCR

Rank the available assays to

• Favour a unique assay without cross hybridizations to other areas of the genome (in silico PCR) • Favour intron spanning amplicons to remove false signals from contaminating genomic DNA • Favour a small amplicon size for reproducible and robust assays • Best multiplex combination with selected reference gene

Display results

• ProbeFinder always displays the best assay according to the above described ranking criteria. Assay details contain probe number, primer and amplicon sequence. In addition the “Multiplex PCR with Reference Gene” option is depicted. Results can be downloaded as pdf or text report. More assay details are shown in the“Transcript Overview” or the “Detailed View”. When a sequence identifier from the GenBank/EMBL (e.g. ENST00000217133.1) is entered, SNPs of the whole transcript are displayed and details can be seen with the mouse over function. • When the “More Assays” option is selected, all possible assays for your gene of interest (with or without reference gene assays) are displayed in detail so that you select the best assay for your particular experiment.

Assay Design

Performance Data

Assay Design Guide


7

Technology

Assay Design

Input Formats for Target Specification

Entering Multiple Sequences

The assay design process is startet by selecting the appropriate organism and entering target information in the depicted input windows. Target information can be entered either by gene accession number, gene name or keyword, or the target nucleotide sequence. Acceptable entry formats include RefSeq, enBank/EMBL and Ensembl sequence IDs (details about the different sequence identifiers can be found in the Glossary). When gene names or keywords are entered, ProbeFinder provides results from a number of databases, containing your keyword, to help you select the gene ID or nucleotide sequence.

The “Batch processing” feature of ProbeFinder allows you to:

Other Organisms Performance Data

Assay Design Guide


8

When your organism of interest is not available in the drop down menue on the Assay Design Center, you can still use the ProbeFinder software to design assays. The UPL probes can be used to analyze any organism, and assays can be designed for any sequence from any organism (or any sequence from a non-natural source) provided that the sequence contains a probe binding site and corresponding acceptable primer sites. To design an assay for such a sequence select the button “Other Organisms” and paste the sequence into the “sequence”-field.

Enter up to 10 different target genes at the same time See all results displayed on a single page Find assays that target splice variants or gene families Please note: this feature is currently extended to process up to 200 design requests at a time.

RealTime ready Universal ProbeLibrary – Performance Data

UPL assay performance is comparable to SYBR Green I assays, but no primer-dimers are detected. Universal ProbeLibrary offers the flexibility of SYBR Green I, by being independent from designing and ordering of fluorescence labeled probes. In addition, UPL assays provide a specificity which is comparable to commonly used probe formats, such as hydrolysis probes or HybProbe probes.

Technology

Figure 2: Real-time RT-PCR assays for GAPDH with a dilution series of cDNA on a LightCycler ® 2.0 Instrument.

A

NTC

Assay Design

A: Amplification curve of SYBR Green I assay; B: Amplification curve of Universal ProbeLibrary assay; NTC = No template control. Data is kindly provided by Amy Jassen, Ph.D., New England Primate Research Center, Harvard Medical School.

Performance Data

B Assay Design Guide

NTC Additional Information

9

Quantification of Zea mays mRNAs by real-time PCR using the Universal ProbeLibrary

Technology

Assay Design

Universal ProbeLibrary assays for 20 different maize (Zea mays) mRNA sequences as a representative subset, indicating whether UPL is suitable for the detection of maize transcripts. Assays could be designed with a high success rate and the majority showed excellent performance. In addition the performance of the Universal ProbeLibrary was tested on two different qPCR platforms, the LightCycler® System and a competitor

A

sequence detection system. Figure 3 shows a representative result with a primer-probe combination specific for phosphoenolpyruvate carboxykinase (PEPCK), a photosynthetic enzyme of intermediate abundance. Universal ProbeLibrary assays worked efficiently on both systems. The crossing points were usually slightly lower with the LightCycler® System and this occasionally resulted in a higher sensitivity. Figure 3: Comparison of the UPL assay for PEPCK mRNA on two different platforms. A: Amplification curves for PEPCK mRNA with the LightCycler ® System (Display mode F1/F3). B: Amplification curves for PEPCK mRNA a competitor real-time PCR sequence detection system.

Performance Data

Data kindly provided by Christoph Peterhänsel, RWTH Aachen, Institute for Biology I, Aachen, Germany B Assay Design Guide


10

Comparison of a commercially available hydrolysis probe assay to a Universal ProbeLibrary assay on the LightCycler ® 480 Instrument. GAPDH was amplified from dilutions of a qPCR human reference cDNA (BD Biosciences) performing a UPL assay with probe # 60 and appropriate primers and a commercially available competitor hydrolysis probe assay for GAPDH. The UPL assay was performed with the same concentrations of primers and probe (900nM primers and 250nM probe) as used in the competitor assay. Both type of assays were run on a LightCycler® 480 Instrument.

A

For both assays the LightCycler® 480 Probes Master was used. Both assays perform with optimal PCR efficiency of approx. E = 2. The Universal ProbeLibrary assay for GAPDH creates slightly earlier crossing points than the competitor assay.

Technology

Assay Design

B

Performance Data

Figure 4: Real-time RT-PCR assays for GAPDH with a dilution series of commercially available cDNA on a LightCycler ® 480 Instrument; A: Amplification curve of a commercially available hydrolysis probe assay; (primer conc. 900nM, probe conc. 250nM) B: Amplification curve of a Universal ProbeLibrary assay with elevated primer (900nM) and probe (250nM) concentrations.

Assay Design Guide

Please visit the Universal ProbeLibrary site, www.universalprobelibrary.com for customer statements and more data in numerous applications.


11

Universal ProbeLibrary Assay List

Technology

Assay Design

Performance Data

Assay Design Guide


12

A constantly growing compilation of successfully designed and used assays is provided on the Universal ProbeLibrary internet page www.universalprobelibrary.com, also accessible via the Roche Applied Science home page. You may add your own Universal ProbeLibrary assays as well as recommendations or hints for other scientists.

Step by Step Guide through Universal ProbeLibrary Assay Design

To access the ProbeFinder Assay Design Center, point your browser to www.universalprobelibrary.com In the left navigation bar, click on Assay Design Center. Technology

Assay Design

Performance Data

Assay Design Guide


13

Step by Step Guide,

continued

Choose an Organism On the Assay Design Center screen select your organism of interest from the drop down menu to get to the target input screen. When your organism of interest is not available in the drop down menu, you can still design an assay by selecting “Other Organism”. In this case, you are asked to provide the sequence of the transcript, for which you want to design an assay (please refer to the option “Paste a Sequence”.) Technology

Assay Design

Performance Data

Specify your Target

Assay Design Guide


14

Option I: Enter a Sequence ID This field accepts sequence identifiers from any of the following databases: Ensembl (e.g., ENST00000158302), RefSeq (e.g., NM_001101), and GenBank/EMBL (e.g., AB062273), gene names or keywords.

Option II: Paste a Sequence This field accepts input sequences in either the FASTA or plain text formats. The software accepts standard IUPAC nucleotide symbols (acgtuACGTU), but will ignore spaces, numbers and non-nucleotide characters. When you want to design intronspanning assays, use opening and closing square brackets [ ] to indicate the position of exon-exon boundaries. The square brackets may be “empty” or contain a number to show intron size in the overview graphics, but must not contain characters (e.g. intron sequence information). Otherwise, please deselect the “Automatically select an intron spanning assay” option.

Technology

Assay Design

Performance Data

Option III: Enter a Gene Name When you do not know the sequence ID of your target or the sequence itself, simply type a gene name, e.g., tubulin into the By sequence ID field. When you then click the “Design” button, ProbeFinder will first display all sequence entries from the database that include this name in their description. Select one or up to 10 entries and click “Design”.

Assay Design Guide


15

Step by Step Guide,

continued

Option III continued

Before you click the “Design” button you can select:

Technology

a) Reference Gene Assay When you want to design a multiplex assay with one of the UPL reference gene assays for human, mouse and rat, please check the respective box. Select “Any” when you want to leave it to ProbeFinder to find the most suitable reference gene assay for your gene of interest or select one of the provided assays in the check box.

Assay Design

Performance Data

b) Intron-spanning Assay The intron-spanning Assay option is active by default. When you do not want to design intron-spanning assays or did not depict introns in your input sequence by square bracket, you must deselect the intron-spanning option first. When you click “Design” now, ProbeFinder will design the appropriate primers for your assays and select the best matching UPL probe. In any case ProbeFinder will display the best available multiplex assay.

Assay Design Guide


16

Examine the Result The best (highest ranked) real-time PCR assay is presented on the Result screen. The Result screen has four parts: Assay details, Multiplex details, Transcript overview and Detailed view. Assay details Assay details (see screen below) lists the number and catalog number of the UPL probe and provides sequence detailes for the forward and reverse primer and the amplicon.

Technology

Assay Design

You can download the detailed product instructions and save the assay details either as “Text report” or “PDF report”. The “Order probes or sets” button takes you to the Roche Applied Science online catalog and ordering. Paste the catalog or probe number of the probe into the e-Shop Search field to find that probe in the online catalog. Multiplex details Information about the multiplex assay that you have choosen or which is recommended by ProbeFinder are shown. When you click on the small Information Icon information about the respective reference gene assay is displayed.

Performance Data

Assay Design Guide

Transcript overview A graphical overview of the complete target transcript is displayed. The small shaded areas depict the location of the amplicon with the respective UPL probe. When a sequence from Ensemble was chosen for target specifications, known SNPs are shown in red and detailes can be seen with the mouse over function.


17

Step by Step Guide,

continued

Detailed view Is an enlarged graphical overview of the target transcript region.

Technology

Assay Design

Detailes on the different information are obtained when using the mouse over function. Click the “Zoom In” button below the graphical overview to enlarge the graphic. Clicking other buttons will move the displayed sector (indicated by the rectangle) left or right.

Figure legend? When you click this button, you get an explanation of the different elements of the result screen. Performance Data

Assay Design Guide


18

View Additional Assays Typically, the ProbeFinder software is able to design several real-time PCR assays for a single transcript. The availability of many real-time PCR assays for each transcript ensures that each gene expression result can be cross-evaluated. Also, if the highest ranked assay does not fit your needs, you can use one of the other suitable assays. To see a table of alternative real-time PCR assays, click the “More assays” button on the Result screen.

Technology

Assay Design

Performance Data

UPL probes for additional assays are listed in a table and their position is shown in the “Transcript Overview”. Assays are ranked according to the degree of fulfillment of scoring parameters and marked in decreasing shades of green, indicating whether all ranking criteria were met or not. All multiplex options are shown for each assay. When you use “mouse over” the scoring column, additional information about the scoring is provided, which helps to select the optimal assay.

Assay Design Guide


19

Step by Step Guide,

continued

See All Assays

Technology

Assay Design

Performance Data

Assay Design Guide


20

Click the “see all assays” button to display all assays found by the software, including those that do not meet all design criteria as amplicon size, intron spanning assay in silico PCR and (for human Ensembl) absence of SNPs in primer or probe binding regions. These assays are marked with a brownish color. If you decide to use such an assay, check the “not met” criteria to assure, that these are not critical for your experiment.

Entering Multiple Sequences ProbeFinder can process up to 10 designs at a time*, so you can enter multiple targets on the Input screen. These sequences do not all need to be entered in the same format. However, each sequence in the list must be in one of the acceptable entry formats, which include: sequence IDs, gene names, plain text versions of the sequences, or sequences in FASTA format. If you enter Ensembl Gene IDs (rather than transcript IDs), ProbeFinder will look up the IDs in the Ensembl database and identify all available transcript variants of the input gene. The software will then display a Verification screen, which asks you to identify which sequence(s) should be considered further.

Technology

Assay Design

The Batch Assay feature offers three options for assay design: Batch Assay (default option), Differentiating Assay or Common Assay. When the results are displayed, you can select one of the following options: Batch Assay In Batch Assay mode, ProbeFinder processes multiple input sequences and displays assays for each exactly as if each sequence had been input individually. While processing the sequences, the software does not consider any interrelationships between the input sequences or their available assays. This option provides a convenient way to design new real-time PCR assays for a large number of sequences. • On the Sequence Input Screen, enter up to 10 sequence IDs, gene names, or plain text sequences in any combination. Separate sequence IDs or gene names by comma. • If you enter several plain text sequences into the ‘By sequence’ field, start each sequence with the “>” sign and separate them by pressing “Enter”. Avoid the use of any of the boolean operators AND, OR, NOT.

Performance Data

Assay Design Guide

* This feature is currently extended to process up to 200 design requests at a time.


21

Step by Step Guide,

continued

Batch Assay continued

The next screen will list all identified sequences. Select those sequences for which you want to design an assay by clicking the corresponding check boxes () or by choosing “Select All” (). Technology

Assay Design

On the Result screen, ProbeFinder will display the best assay for each of the input sequences. Note that these assays are designed independently of each other.

Performance Data

Assay Design Guide

Note: It is important to realize that the software works on an “all or nothing” principle.

If ProbeFinder cannot recognize one of the input sequences, it will not generate a result for any of the input sequences. At the bottom of the Result screen, there are buttons for two more options: Additional Information

22

“Differentiating Assay” and “Common Assay”.

Differentiating Assay In Differentiating Assay mode, ProbeFinder tries to design assays that uniquely identify (differentiate) each of the input sequences by targeting areas of those sequences that are distinctly different. The “Differentiating Assay” option is particularly useful when you wish to target splice variants of your gene. When you select this option, ProbeFinder applies strict criteria to identify those assays that are specific to each of the submitted gene family members or splice variants. If it cannot find a unique design, ProbeFinder will not generate a solution. To identify assays that are Differentiating Assays, the software performs a new search that is similar to the in silico PCR routine performed on each assay during the normal assay design process. The new search is performed only on the input sequences and does not include any additional database searches. By reducing the scope of the search, the software can apply much tighter parameters without requiring additional computing time.The narrow search also effectively minimizes cross-hybridization between the input sequences.

Technology

Assay Design

Differentiating Assay result will be displayed in a different color than the one used for a Batch Assay result. Performance Data

Assay Design Guide


23

Step by Step Guide,

Technology

Assay Design

Performance Data

Assay Design Guide


24

continued

Common Assay In Common Assay mode, ProbeFinder scans all the available assays and tries to identify one assay that targets an area found in all the input sequences. The “Common Assay” option is particularly useful when you wish to target all members of a gene family, e.g.; all splice variants, rather than particular splice variants. When you select this mode, ProbeFinder does its utmost to design an assay that will target all the submitted gene transcripts with a single Universal ProbeLibrary probe and primer pair. Common Assay result will be displayed in a different color than those used for a Batch Assay or a Differentiating Assay result.

Make Your Choice Finally, choose your preferred assay. Then ask any oligonucleotide supplier to synthesize the PCR primers and deliver them overnight. When the primers arrive, take the appropriate Universal ProbeLibrary probe from your freezer and set up the real-time PCR assay. For best results we recommend the use of the following master in your assay: Real-Time PCR Instrument

Recommended Master Mix

Reference Dye

LightCycler® 480 Instrument *

LightCycler® 480 Probes Master *

-

LightCycler® 2.0 Instrument *

LightCycler® TaqMan® Master *

-

LightCycler® 1.5 Instrument * and lower versions

LightCycler® TaqMan® Master *

-

Real-Time PCR Instruments requiring reference dye

FastStart Universal Probe Master (Rox)*

Included in the master mix

Real-Time PCR Instruments not requiring reference dye

FastStart TaqMan® Probe Master *

Technology

Remarks

Assay Design

Please note: the UPL Reference Assays, labeled with the LightCycler® Yellow 555 are not recommended for use on this instrument Performance Data Rox Reference Dye* can be added to the reaction, if required

For PCR product carry-over prevention (optional): • LightCycler® Uracil-DNA Glycosylase* in combination with LightCycler® TaqMan® Master or FastStart TaqMan® Probe Master and • Uracil-DNA Glycosylase, heat-labile* in combination with FastStart Universal Probe Master (Rox) and other real-time PCR reagents.

Assay Design Guide

* products are available from Roche Applied Science. Please refer to Ordering Information. Additional Information

25

Glossary

EMBL Sequence Identifier

Technology

Assay Design

The EMBL Nucleotide Sequence Database (also known as EMBL-GeneBank; http://www.ebi.ac.uk/embl/) is the European component of the International Nucleotide Sequence Database Collaboration (INSD) and is maintained at the EBI. All records in the database are synchronized with the NCBI GenBank (North America) and the DNA Data-base of Japan (DDBJ). Each of the three groups collects a portion of the total sequence data reported worldwide, and all new and updated entries are exchanged between the databases. Main sources for DNA and RNA sequences in the EMBL-Bank are direct submissions from individual researchers, genome sequencing projects and patent applications. As such, EMBL-Bank is a repository database that contains highly redundant data.

Performance Data

To reduce search times, ProbeFinder uses a subset of the EMBL database, which includes only entries that are from the relevant species, are annotated as mRNA, and are between100 nt and 20,000 nt long.

Ensembl Sequence Identifier Assay Design Guide

Ensembl (http://www.ensembl.org/) is a joint project between EMBL-EBI and the Sanger Center. This is a system that automatically tracks all the sequenced pieces of the human genome, attempts to assemble them into large single stretches and then analyzes the assembled DNA to find genes and other features that will interest biologists and medical researchers. Unlike most other databases (e.g., RefSeq and EMBL), Ensembl transcript entries contain informa-


26

tion about exon-exon splice sites, as predicted by Ensembl. Ensembl intron/exon predictions are based on a set of heuristic rules and are substantiated by supporting experimental evidence from UniProt/Swiss-Prot, UniProt/TrEMBL, NCBI RefSeq, as well as cDNA entries from EMBL.

Since the Ensembl database contains intron information, an Ensembl ID is the input format preferred by ProbeFinder. When Ensembl IDs are submitted, ProbeFinder will use the information on intron/exon locations available in the Ensembl database to design intron-spanning assays.

FASTA

FASTA is a common sequence file format that is used by many sequence alignment and homology search programs. A sequence in FASTA format begins with a single-line description, followed by lines of sequence data. The description line is distinguished from sequence data by a “>” symbol. Sequences must contain only the standard IUB/IUPAC nucleic acid symbols. However, lowercase versions of these symbols are accepted (but will be transformed into upper-case by the database software). >AB000263 |acc=AB000263|descr=Homo sapiens mRNA for prepro cortistatin like peptide, complete cds.|len=368ACAA GATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGG GCCACGGCCACCGCTGCCCTGCCCCTGGAGGGTGGCCCCAC CGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAA GGAAAAGCAGCCTCCTGACTTTCCTCGCTTGGTGGTTTGAGTG GACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGGAAG CTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCA GCAATCCGCGCGCCGGGACAGAATGCCCTGCAGGAACTTCTT CTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAA TGCTCACGCAAGTTTAATTACAGACCTGAA

In silico PCR

(In silico: in or by means of a computer simulation.) All primer pairs designed by ProbeFinder (using Primer3) are checked with an in silico PCR algorithm. The algorithm searches the relevant genome and transcriptome for possible mispriming sites (“genome hits” or “transcriptome hits”) for either or both PCR primers.

If any of the identified mispriming sites could potentially lead to an unintended amplicon, the assay that uses those primers is ranked lower on the list of available assays and flagged as having failed the in silico PCR check. Assays that span a small intron (