Regulation of programmed cell death following T ... - Semantic Scholar

International Immunology, Vol. 10, No. 2, pp. 175–183

© 1998 Oxford University Press

Regulation of programmed cell death following T cell activation in vivo Yang Yang, Dewey Kim and C. Garrison Fathman Department of Medicine, Division of Immunology and Rheumatology, Stanford University School of Medicine, Stanford, CA 94305-51111, USA

Keywords: apoptosis, bag-1, fas, programmed cell death, T cell activation

Abstract Activation of T cell hybridomas in vitro induces rapid Fas–Fas ligand (FasL)-mediated programmed cell death (apoptosis). In contrast, T cells activated by antigen or superantigen in vivo undergo a population expansion and then decline due to Fas–FasL-mediated activationinduced apoptosis (AIA). We asked how T cells activated by antigen in vivo proliferated before undergoing apoptosis. Two possibilities were analyzed: either (i) the apoptosis program was not ‘turned on’ or (ii) was ‘blocked’ during the period of cellular proliferation in vivo. Data presented in this manuscript support the second of these possibilities. CD4F T cells activated in vivo were resistant to anti-fas-mediated apoptosis until 48 h following staphylococcal enterotoxin B (SEB) administration, despite the fact that activated proliferating T cells expressed high levels of Fas (CD95) antigen and many ‘apoptosis genes’ were induced within 24 h of SEB administration. The analysis of the expression patterns of ‘apoptosis genes’ during the T cell activation further suggested that temporal blockade of AIA may be due to the induction of apoptosis-preventing genes, such as bag-1. Introduction Activation of T cells by engagement of the TCR leads to profound changes in mature T cells resulting in cytokine production, proliferation, as well as programmed cell death (apoptosis) which eliminates the abundant antigen responsive T cells to maintain a balanced immune response. In mature T cells, activation-induced apoptosis (AIA) (1) is mediated by Fas–Fas ligand (FasL) interaction (2). Activation of T cells, either through recognition of antigen, superantigen or antibody cross-linking, induces rapid expression of Fas and FasL (3–5). In T cell hybridomas and some transformed T cell lines (3,6), activation-induced expression of Fas–FasL can trigger apoptosis within a few hours. However, when naive T cells are activated by TCR engagement in vitro, they express Fas and FasL on their surface very quickly (4,7), but are resistant to Fas–FasL-mediated apoptosis until they are rested and reactivated (4,7–9). Therefore, engagement of the TCR in vitro results in either immediate death or resistance to death in T cells, depending upon whether the T cell has been previously activated. T cells activated in vivo undergo AIA with different kinetics than T cells activated in vitro; they first proliferate and, after a period of population expansion, decline due to AIA (10–12). Thus AIA is delayed in the responsive T cell

population in vivo. It is delayed AIA that allows both the development as well as the termination of an immune response. It is not known if T cells, activated by antigen in vivo, rapidly up-regulate Fas–FasL expression or whether AIA is ‘blocked’ even though apoptosis genes are activated and expressed during the period of cellular proliferation. In order to study the regulatory mechanisms of AIA in vivo we administered the superantigen staphylococcal enterotoxin B (SEB) to mice and determined the kinetics of expansion and apoptosis and analyzed the expression of ‘apoptosis genes’ of a subpopulation of SEB-activated T cells (CD41Vβ81 population). The expression of apoptosis genes in naive T cells activated in vitro was also analyzed. Our results demonstrated that activation of T cells, both in vivo and in vitro, rapidly induced or up-regulated the expression of all apoptosis genes examined; however, activated T cells resisted Fas-mediated apoptosis during the early stages of activation. These results suggested that AIA was temporarily blocked in vivo. The resistance to AIA of naive T cells primed in vivo, as well as in vitro, correlated with the expression of ‘apoptosis-preventing genes’, such as bag-1.

Correspondence to: C. G. Fathman Transmitting editor: J. F. Kearney

Received 25 April 1997, accepted 24 October 1997

176 Regulation of programmed cell death Methods

FACS analysis and sorting Analysis of cellular expansion. SEB (60 µg) was injected into a group of BALB/cJ mice i.v. on day 0. Individual mice were sacrificed and lymph node and splenic lymphocytes were isolated at 24 h intervals. The lymphocytes were double stained with mAb MR5-2 (anti-Vβ8.1, 8.2 TCR) and RM4-4 (an anti-CD4 mAb) or RR4-7 (anti-Vβ6 TCR) with RM4-4. Dead cells were excluded by propidium iodide (1 µg/ml) staining. Analysis of apoptosis. For the TUNEL assay, CD41 T cells were isolated by magnetic beads coated with anti-CD4 antibody (Miltenyi Biotec, Auburn, CA), resulting in an enriched population (~95% pure). The enriched CD41 cells were stained with antibody MR5-2 and fixed in 1% paraformaldehyde/PBS for 30 min on ice. The fixed cells were permeabilized with 70% ethanol, and washed with PBS and buffer for the terminal deoxynucleotidyl transferase assay (Amersham, Arlington Heights, IL). The TUNEL assay was performed as described (15) with biotin-16-dUTP (Boehringer Mannheim Diagnostics, Indianapolis, IN) and the cells then were stained with streptavidin–allophycocyanin and analyzed by FACS. Analysis of Fas expression. CD41 enriched spleen cells were double stained with FITC–MR5-2 and phycoerythrin (PE)–Jo2 (anti-mouse Fas) or FITC–RR4-7 with PE–Jo2 antibodies. The Vβ81 and Vβ61 subpopulations were then selected by FACS analysis and the intensity of staining of Fas was compared between the two populations. Purification of SEB responsive T cells. CD41 T cells were isolated from individual mice by magnetic beads and then stained with MR5-2 antibody. Vβ81 (1.253106) cells were then further purified by FACS sorting. Cell cultures Determination of the sensitivity to anti-Fas antibody. CD41 T cells were enriched from mice (at the times indicated) before and after SEB injection. Cells were cultured with RPMI for 12 h in 96-well plates (23106 cells) coated with or without 5 µg/ml of Jo2 antibody, and then stained with FITC– MR5-2 antibody, fixed and analyzed by the TUNEL assay as described. Activation of T cells in vitro. Lymphocytes were isolated from 6-week-old naive BALB/c mice and cultured in RPMI with 10% FCS at 2.53106/ml. To activate T cells, enriched CD41 cells were added to a 96-well plate coated with 10 µg/ml plate bound anti-CD3 antibody (145-2C11). At 12 h intervals, 50 µl of supernatant was taken from triplicate cultures and assayed for IL-2 production with HT-2 cells (an IL-2-dependent cell line). Cells (53105) were also taken for RNA preparation and the rest of the cells were pulsed with 1 µCi [3H]thymidine for an additional 12 h and harvested to determine cell proliferation. RT-PCR Total RNA of the CD41Vβ81 T cells sorted from mice injected with SEB was prepared using the RNeasy kit

(Qiagen, Valencia, CA). A RT reaction was performed with oligo(dT). Equal amounts of cDNA were taken from each sample for a PCR template. The PCR products were analyzed on a 2% agarose gel, and visualized by Southern blot using 32P-labeled probes. PCR primers for cDNA of (i) fas ligand: 59-CAGCTCTTCCACCTGCAG; 39-TTAAAGCTTATACAAGCC (size of PCR product: 540 bp), (ii) fas: 59-CTGAGGAGAGGCGGGTTCATGAAAC; 39-GGAGGTTCTAGATTCAGGGTCATCCTG (size of PCR product: 522 bp), (iii) bad: 59-GGAACCCCAAAGCAGCCCTCGC; 39-CTGGGAGGGGGTGGGAGCCTCC (size of PCR product: 609 bp), (iv) bax: 59GACGGGTCCGGGGAGCAGCTTG; 39-GCCCATCTTCTTCCAGATGGTG (size of PCR product: 573 bp), (v) bcl-2: 59-TTGAAGTGCCATTGGTAC; 39-CCAGCCTCCGTTATCCTG (size of PCR product: 618 bp), (vi) bcl-xL: 59-GAACTGCGGTACCGGAGAGCGTTCAGTG; 39-CTTCCGACTGAAGAGTGAGCCCAGC (size of PCR product: 408bp), (vii) bag1: 59-CAACATGGCCAAGACCGA; 39-TCATTCAGCCAGGGCCAA (size of PCR product: 664 bp), (viii) HPRT: 59-GTAATGATCAGTCAACGG; 39-CCAGCAAGCTTGCAACC (size of PCR product: 214bp) (43). The conditions for each PCR reaction with primers for (i) fas and fas ligand: 94°C, 1.5 min; 58°C, 2 min; 72°C, 1 min; 40 cycles, (ii) bad and bax: 94°C, 1.5 min; 55°C, 2 min; 72°C, 1.3 min; 40 cycles, (iii) bcl-2: 94°C, 1.5 min; 60°C, 2 min; 72°C, 1 min; 30 cycles, (iv) bclxL: 94°C, 1.5 min; 58°C, 2 min; 72°C, 1 min; 40 cycles, (v) bag-1: 94°C, 1.5 min; 63°C, 2 min; 72°C, 1 min; 30 cycles. The sequences of probes used in Southern blot analyses were as follows. For cDNA of (i) fas ligand: GGTCTTAGATTCCTCAAAATTG, (ii) fas: CCTGCAGTTTGTATTGCTGGTTG, (iii) bad: GAGCCGAACGCGAGCGTCCTCG, (iv) bax: AGCGAGGCGGTGAGGACTCCAG, (v) bcl-2: CCAGGTGTGCAGATGCCGGTTC, (vi) bcl-xL: CACACCAGCCACACAGTCATGCCCGTC and (vii) bag-1: GTAGACTGCAGCCGCTCTGTCTC.

Results

Kinetics of expansion and apoptosis of SEB-reactive CD41Vβ81 T cells To establish the kinetics of expansion and apoptosis of an SEB-responsive T cell subpopulation, lymph node and spleen cells were collected at serial 24 h intervals from female BALB/c mice following challenge with SEB. Changes in the SEB-responsive CD41 Vβ81 T cell subpopulation over time were compared to changes in the non-SEB-reactive CD41Vβ61 T cell subpopulation. Consistent with other studies (10,13), the CD41Vβ61 subpopulation of T cells was unresponsive to SEB at all time points analyzed. However, the CD41Vβ81 subpopulation underwent dramatic changes within the first few days following SEB administration (Fig. 1A). Although there was no population expansion detected in the CD41Vβ81 T cells during the first 24 h, this subpopulation quickly expanded thereafter and reached peak expansion 72 h following SEB injection. The CD41Vβ81 subpopulation rapidly declined after 72 h until day 7, at which time the percentage of CD41Vβ81 T cells stabilized at about one-half of the preimmunization level (Fig. 1A). To ask whether the SEB-responsive CD41Vβ81 subpopulation of T cells had been

Regulation of programmed cell death 177

Fig. 1. The kinetics of expansion and apoptosis in the CD41Vβ81 T cell subpopulation following SEB immunization. (A) The size of the CD41Vβ81 T cell subpopulation remained unchanged during the first 24 h after SEB injection but expanded between 24 and 72 h. The population quickly declined after peak expansion (these data represent the results from one of three similar experiments). (B) DNA fragmentation detected by dUTP incorporation (TUNEL assay) in the CD41Vβ81 T cell subpopulation. There was no dUTP incorporation detected within 24 h of SEB administration. Thereafter, the fraction of the population incorporating dUTP quickly enlarged and peaked at 72 h. (C) A schematic representation of the CD41Vβ81 T cell subpopulation undergoing apoptosis. Data from (B) are replotted to express the percent of cells undergoing apoptosis as a function of time following SEB administration (these data represent the results from one of two similar experiments).

178 Regulation of programmed cell death

Fig. 2. Expression of Fas antigen and sensitivity of activated T cells to anti-Fas antibody. (A). Fas expression on the surface of CD41Vβ81 and CD41Vβ61 T cells plotted from FACS analyses. Fas was up-regulated in the CD41Vβ81 T cell subpopulation within 24 h following injection of SEB, then gradually decreased to the pre-activation level. There was no change in Fas expression detected in the control CD41Vβ61 T cell subpopulation over time. (B). Fas expression on CD41Vβ81 cells was normalized to that of the CD41 Vβ61 T cells (these data represent one of three similar experiments). (C) The sensitivity of CD41Vβ81 T cells to anti-Fas antibody-induced apoptosis. In this assay, purified CD41 T cells were cultured for 12 h in 96-well plates (23106 cells) coated with 5 µg/ml of Jo2 (anti-Fas antibody). Cells were then stained with FITC– MR5-2 (anti-Vβ8.1, 8.2 TCR) antibody, fixed and then analyzed by the TUNEL assay as described in Methods. Anti-Fas antibody was unable to induce apoptosis in naive or CD41Vβ81 T cells activated in vivo by SEB for 24 h. However, apoptosis was induced by anti-Fas antibody in activated CD41Vβ81 cells 48 h after SEB administration (these data represent one of two similar experiments).

activated during the first 24 h, we analyzed cell size as a marker of activation; activated T cells undergo blastogenesis before proliferation (14). Unprimed lymphocytes were homogeneous in size, whereas the lymphocytes collected 24 h after SEB injection were heterogeneous in size and many cells were enlarged. Most of the CD41Vβ81 cells were enlarged, whereas the CD41Vβ61 cells were unchanged in size following SEB administration (data not shown). After 48 h, the CD41Vβ81 T population had returned to normal size. These results demonstrated that within 24 h following SEB injection, the TCR had been engaged on the surface of most of the SEB-

responsive CD41Vβ81 T cells and these T cells changed from small resting naive T cells to activated blasts. During the first 24 h after SEB challenge, we were unable to detect cells undergoing apoptosis in the CD41Vβ81 population using the TUNEL assay (15) (Fig. 1B and C). Between 48–72 h following SEB challenge, a fraction of SEB-responsive Vβ81 T cells underwent apoptosis; the CD41Vβ81 population undergoing apoptosis peaked by 72 h and then rapidly declined (Fig. 1C). A similar fraction of the CD41Vβ81 population underwent apoptosis between days 4 and 7 (Fig. 1C). At day 9, dUTP incorporation had dropped to background levels.

Regulation of programmed cell death 179

Fig. 3. Expression of genes promoting and preventing apoptosis in CD41Vβ81 T cells before and after SEB injection. To detect expression of apoptosis genes, RT-PCR reactions were performed with the CD41Vβ81 T cells purified at the times (24 h intervals) indicated in each lane. At each time point, an equal number of cells was purified to prepare cDNA and in all PCR reactions, cDNA from equivalent number of cells was used. In addition, a PCR for the constitutively expressed HPRT gene was performed with each sample as an internal quantitative control. (A) The expression of fas, fas ligand, bad and bax was induced or up-regulated following T cell activation. Expression of fas ligand and bad steadily increased until 120 h after SEB challenge. Expression of bax and fas peaked at 24–48 h, then decreased from 48 and 72 h respectively. (B). Expression of bcl-2 was constant before and after SEB injection, whereas bcl-xL was induced several-fold by activation and remained at a similar level of expression after day 3. In contrast, SEB injection strongly induced bag-1 expression within 24 h, which diminished over the next 48 h.

The expression of Fas antigen did not correlate with the kinetics of apoptosis in the CD41Vβ81 subpopulation This kinetic analysis demonstrated an absence of apoptosis in the activated CD41Vβ81 T cells in the first 24 h following SEB administration. We examined the expression of Fas on SEB-responsive and non-responsive T cell subpopulations to ask whether the induction of apoptosis at 48 h (Fig. 1C) was temporally correlated with the expression of Fas. Fas was upregulated on the surface of the enlarged (activated) CD41Vβ81 T cells within the first 24 h (Fig. 2) when compared to naive CD41Vβ81 or non-responsive CD41Vβ61 cells following SEB administration. Expression levels of Fas on CD41Vβ81 cells from SEB-immunized mice decreased over the next 3 days to a level similar to that of the control CD41Vβ61 T cells (Fig. 2A and B). Thus, a high level of Fas was present on the SEB-responsive T cell subpopulation at a time when they were expanding (Fig. 1A), not undergoing apoptosis. It has been previously demonstrated that the Fas–FasL interaction is responsible for apoptosis in SEB-activated T cells (4). However, despite up-regulated Fas expression 24 h after SEB activation, CD41Vβ81 T cells did not undergo apoptosis. We tested the sensitivity of the 24 h SEB-activated CD41Vβ81 T cells to anti-Fas antibody (Fig. 2C). Despite the high level of Fas expression on the SEB-activated T cells, anti-Fas antibody was unable to induce apoptosis in activated CD41Vβ81 T cells isolated 24 h after SEB injection. In an attempt to further analyze the induction of AIA, the expression of ‘apoptosis genes’ was analyzed as a function

of time following SEB activation in vivo in the CD41Vβ81 subpopulation.

Expression of ‘apoptosis genes’ Activation-induced programmed cell death in T cells requires expression of both Fas and its ligand (2,16–18). It was previously shown that the gene products of bad and bax were also crucial for commitment of T cells to apoptosis (19–21). Thus, the expression of these death-inducing genes in CD41Vβ81 T cells was examined before and after SEB administration. We purified an equal number (1.253106) of CD41Vβ81 cells by FACS sorting at 24 h intervals following SEB administration in vivo. The purified subpopulation allowed a semiquantitative determination of multi-gene expression using RT-PCR. Expression of the death-inducing genes was rapidly up-regulated following SEB activation (Fig. 3A). Consistent with the FACS analysis, expression of fas was upregulated during the first 48 h following SEB administration and decreased thereafter. Expression of the fas ligand steadily increased over the 5 days of analysis. SEB activation strongly induced bax during the first 2 days and expression of bad was up-regulated for at least 3 days following SEB administration. The increased expression of all of the ‘apoptosispromoting genes’ examined indicated that SEB challenge activated the death program within the first 24 h. We further examined bcl-2 and bcl-xL genes since overexpression of bcl-2 and bcl-xL prevented cell death from apoptosis in several

180 Regulation of programmed cell death

Fig. 4. Expression of apoptosis genes in T cells activated in vitro with anti-CD3 antibody. Lymphocytes isolated from naive BALB/c mice were cultured with 10 µg/ml plate-bound anti-CD3 antibody (145-2C11). Thymidine incorporation and IL-2 production was monitored at 12 h intervals. The cultured cells proliferated and produced IL-2 at a relative constant level until day 6 when the culture was ended (data not shown). The expression of apoptosis genes was determined by RT-PCR at 24 h intervals (A) for apoptosis-promoting genes and (B) apoptosispreventing genes. Cells (53105) were taken at the times indicated for RNA and cDNA preparation. The same panel of genes were examined as in the T cells activated in vivo (Fig. 4). Due to a very weak signal, the PCR product for the bad gene was visualized by Southern blot, all the other PCR results by ethidium bromide staining. In (C), the expression of bag-1 and bcl-2 was further examined at 12 h intervals in an additional experiment. The induction of bag-1 was detected 12 h after activation and remained at a constant level thereafter, whereas bcl-2 expression was constitutive.

Fig. 5. Expression patterns of bcl-2, bcl-xL and bag-1 in the activated T cells. Densitometry analysis was performed on the expression levels of bcl-2, bcl-xL and bag-1 of T cells activated in vivo (A) and in vitro (B). The density of the bands was presented as the ratio of the band density of HPRT gene at the each time point. The expression of bcl-2 was consistent in vivo and might have slightly increased during the in vitro activation. The activation up-regulated the expression of bcl-xL both in vivo and in vitro in the first 3 days. The expression was downregulated thereafter in vitro but remained a lifted level in vivo though the AIA was advanced. The expression patterns of bag-1 were different in the T cells activated in vivo and in vitro. However, both in vivo and in vitro, the increased bag-1 expression was correlative to the resistance of AIA induction.

Regulation of programmed cell death 181 systems studied previously (22–24). bcl-2 was expressed constitutively in the CD41Vβ81 T cell subpopulation (Fig. 3B). The expression of bcl-xL increased in CD41Vβ81 cells upon SEB activation; however, the expression of bcl-xL remained at this high level for 5 days after SEB challenge (Fig. 3B). When we examined another potential apoptosis inhibitory gene, bag-1 (25), we found that SEB activation of T cells in vivo induced a strong but transient expression of bag-1 whose kinetics of expression correlated with the blockade of apoptosis. The activation-induced expression of bag-1 was quite prominent at 24 h following SEB activation (Fig. 3B) and then rapidly declined. The strong early induction of bag-1 coincided with inhibition of AIA and the decrease in bag-1 expression was mirrored by increased apoptosis.

Correlation of bag-1 expression with AIA resistance of naive T cells activated in vitro Naive T cells activated in vitro are resistant to Fas-mediated cell death (7). In order to examine the differences in AIA between T cells activated in vivo and in vitro, T lymphocytes were isolated from naive BALB/cJ mice and cultured with anti-CD3 antibody. Proliferation and IL-2 production were monitored at 12 h intervals for 6 days and equal numbers of cultured cells were taken every 24 h to examine expression of apoptosis genes in these naive T lymphocytes activated in vitro. Naive T lymphocytes proliferated vigorously and produced IL-2 within 12 h following culture with plate-bound anti-CD3 antibody. IL-2 production peaked at 12 h and diminished from 48 to 60 h, and then plateaued (data not presented). It has been demonstrated that naive T cells activated in vitro did not undergo programmed cell death unless the cells were rested and re-engaged with activation signals (7–9). Activation in vitro seemingly rendered T cells resistant to Fas-mediated apoptosis; we detected little cell death during 6 days of culture. We then examined expression of apoptosis genes and found that ‘apoptosis-promoting genes’, including fas, fas ligand, bax and bad, were all rapidly induced or up-regulated in naive T cells activated with plate-bound anti-CD3 (Fig. 4). These apoptosis-promoting genes were expressed in a pattern very similar to that found in CD41 T cells activated in vivo. fas and bax were induced for the first 2 days and then declined, whereas expression of fas ligand and bad increased continuously. Again, the induction of apoptosispromoting genes was unable to trigger AIA in naive T cells activated in vitro. Bcl-2 was expressed continuously in T cells activated in vitro, as in T cells activated in vivo, consistent with another study (26). The expression of bcl-xL was upregulated and gradually decreased after 2 days; however, bag-1 was up-regulated within 12 h and remained high thereafter (Fig. 4). It is interesting to note that the expression patterns of bcl-xL and bag-1 were reciprocal in T cells activated in vivo and in vitro (Fig. 5). In the T cells activated in vivo, the expression of bag-1 declined prior to the demonstration of fas-mediated apoptosis whereas expression of bcl-xL was constantly up-regulated. The expression pattern of bag-1 was correlated with resistance to AIA in naive T cells activated in vitro as well as in T cells activated in vivo. The bag-1 gene encodes a bcl-2 binding protein that has been demonstrated to greatly inhibit Fas-mediated apoptosis when

combined with overexpression of bcl-2 (25). It has been demonstrated that Bcl-2 binds to Bad or Bax to prevent cell death (27). The pronounced induction of bag-1, shortly after T cell activation may enhance or stabilize the formation of the complex between Bcl-2 and Bad or Bax to prevent programmed cell death. Discussion It is widely accepted that AIA is a part of the process of T cell activation and has important physiological consequences: it ensures a proper immune response and it may help eliminate autoreactive T cells (28–30). However, AIA must be regulated to allow expansion of antigen responsive populations. In this study, we provide evidence that engagement of the TCR in vivo by SEB rapidly increased expression of both fas and fas ligand; however, the death signal from Fas–FasL interaction was not sufficient in the early stage of activation to induce apoptosis. The activated T cells were resistant to the Fasmediated death signal even when the Fas antigen was crosslinked by antibody 24 h after activation. However, the time at which AIA peaked matched the peak of cellular expansion (Fig. 1A), indicating that apoptosis was triggered in a large number of CD41Vβ81 T cells simultaneously to terminate cellular expansion. AIA is precisely programmed in those activated T cells. It is unlikely that the delay of AIA was due to an insufficient activation signal because the same signal induced AIA rapidly when T cells were reactivated (7–9). Furthermore, we found that all of the seven apoptosis genes examined were induced or up-regulated almost immediately by activation (except bcl-2 which was expressed at a constant level). These results indicate that programmed cell death is tightly associated with activation and that apoptosis genes were induced by activation signals. In addition, the expression of apoptosis genes, such as bax, has been suggested to be a sign of the initiation of apoptosis (31). However, strong induction of bax was seen 24 h after SEB injection in the activated CD41Vβ81 T cells in the absence of apoptosis. Thus the data presented in this study strongly indicate that delayed AIA is due to a temporal blockage of Fas-mediated cell death. Evidence has suggested that the fate of activated T cells may be determined by the balance or interaction between products of two groups of genes (27,32–34), i.e. apoptosispromoting genes such as bad and bax, and apoptosispreventing genes such as bcl-2 and bcl-xL. Since activation of T cells via engagement of the TCR modulates expression of many genes, it is possible that T cell activation results in programmed expression of both apoptosis-promoting and -preventing genes whose interaction determines the ultimate fate of the activated T cells. bcl-2 and bcl-xL have been shown to block apoptosis in different cells under various conditions. Our results showed a relatively constant expression of the bcl-2 gene in T cells activated in vivo or in vitro. Another study showed similar results by measuring protein production in T cells activated in vitro (26). Thus expression of the bcl-2 gene is unlikely to regulate AIA. Special attention has been paid to bcl-xL because cross-linking of the TCR along with a co-stimulation signal (via the CD28 molecule) increased bcl-xL expression and enhanced cell survival in

182 Regulation of programmed cell death culture (26,35). Engagement of the TCR without the CD28 co-stimulatory signal was unable to induce bcl-xL (35–37). These results may represent the fate of improperly activated T cells. T cell activation by SEB requires co-stimulation (14,38), and we showed up-regulated bcl-xL expression in T cells activated both in vivo and in vitro. However, the increase of bcl-xL expression over time in activated T cells did not prevent SEB responsive T cells from undergoing apoptosis in vivo nor was decreased bcl-xL expression, following peak expression at 2 days, followed by apoptosis in naive T cells activated in vitro. Thus, consistent with other studies (39–41), this study demonstrates that the kinetics of expression of bcl-2 and bclxL did not seem to be relevant to a transient blockade of AIA. Despite profound differences in the induction of AIA, expression of bag-1 coincided with the kinetics of apoptosis in T cells activated both in vivo and in vitro. bag-1 may not be the only regulator for activation-induced apoptosis, but its candidacy has been implied in gene transfection studies which showed that overexpression of bag-1 alone had no effect on Fas-mediated apoptosis, whereas together with bcl2, bag-1 brought about a complete resistance to Fas-mediated apoptosis (25). This current study has presented evidence that the death program was induced by activation in vivo but temporarily blocked and this blockade was most likely due to the transient expression of apoptosis-preventing genes, such as bag-1. We are unable to rule out that unknown gene(s) required for apoptosis may not be activated during the early proliferative stage at the present. However, data from T cells activated both in vivo and in vitro, though they expressed apoptosis genes in somewhat different patterns, supported the idea that AIA is regulated not only by the induction of the death program but, more importantly, by the appearance of a transient regulatory blockade in apoptosis. Acknowledgements This work was supported by grants NIH CA65237 (ADA Mentor Based Postdoctoral Fellowship) to Y. Y. and 5T32 AI07290 to D. K.

6

7 8 9

10 11 12 13 14

15

16 17 18 19 20 21

Abbreviations AIA FasL PE SEB

activation-induced apoptosis Fas ligand phycoerythrin staphylococcal enterotoxin B

22

23

References 1 Green, D. R. and Scott, D. W. 1994. Activation-induced apoptosis in lymphocytes. Curr. Opin. Immunol. 6:476. 2 Singer, G. G. and Abbas, A. K. 1994. The fas antigen is involved in peripheral but not thymic deletion of T lymphocytes in T cell receptor transgenic mice. Immunity 1:365. 3 Dhein, J., Walczak, H., Baumler, C., Debatin, K. M. and Krammer, P. H. 1995. Autocrine T-cell suicide mediated by APO-1/(Fas/ CD95). Nature 373:438. 4 Ettinger, R., Panka, D. J., Wang, J. K., Stanger, B. Z., Ju, S. T. and Marshak-Rothstein, A. 1995. Fas ligand-mediated cytotoxicity is directly responsible for apoptosis of normal CD41 T cells responding to a bacterial superantigen. J. Immunol. 154:4302. 5 Anel, A., Buferne, M., Boyer, C., Schmitt-Verhulst, A. M. and Golstein, P. 1994. T cell receptor-induced Fas ligand expression

24 25

26

27

in cytotoxic T lymphocyte clones is blocked by protein tyrosine kinase inhibitors and cyclosporin A. Eur. J. Immunol. 24:2469. Ju, S. T., Panka, D. J., Cui, H., Ettinger, R., el-Khatib, M., Sherr, D. H., Stanger, B. Z. and MarshakRothstein, A. 1995. Fas(CD95)/ FasL interactions required for programmed cell death after T-cell activation. Nature 373:444. Klas, C., Debatin, K. M., Jonker, R. R. and Krammer, P. H. 1993. Activation interferes with the APO-1 pathway in mature human T cells. Int. Immunol. 5:625. Russell, J. H., White, C. L., Loh, D. Y. and Meleedy-Rey, P. 1991. Receptor-stimulated death pathway is opened by antigen in mature T cells. Proc. Natl Acad. Sci. USA 88:2151. Owen-Schaub, L. B., Yonehara, S., Crump, W. L. d. and Grimm, E. A. 1992. DNA fragmentation and cell death is selectively triggered in activated human lymphocytes by Fas antigen engagement. Cell Immunol. 140:197. Kawabe, Y. and Ochi, A. 1991. Programmed cell death and extrathymic reduction of Vbeta81 CD41 T cells in mice tolerant to Staphylococcus aureus enterotoxin B. Nature 349:245. Rocha, B. and von Boehmer, H. 1991. Peripheral selection of the T cell repertoire. Science 251:1225. Webb, S., Morris, C. and Sprent, J. 1990. Extrathymic tolerance of mature T cells: clonal elimination as a consequence of immunity. Cell 63:1249. Marrack, P. and Kappler, J. 1990. The staphylococcal enterotoxins and their relatives. Science 248:705. Muraille, E., De Smedt, T., Thielemans, K., Urbain, J., Moser, M. and Leo, O. 1995. Activation of murine T cells by bacterial superantigens requires B7-mediated costimulation. Cell. Immunol. 162:315. Gorczyca, W., Gong, J. and Darzynkiewicz, Z. 1993. Detection of DNA strand breaks in individual apoptotic cells by the in situ terminal deoxynucleotidyl transferase and nick translation assays. Cancer Res. 53:1945. Suda, T., Takahashi, T., Golstein, P. and Nagata, S. 1993. Molecular cloning and expression of the Fas ligand, a novel member of the tumor necrosis factor family. Cell 75:1169. Suda, T. and Nagata, S. 1994. Purification and characterization of the Fas-ligand that induces apoptosis. J. Exp. Med. 179:873. Nagata, S. and Suda, T. 1995. Fas and Fas ligand: lpr and gld mutations. Immunol. Today 16:39. Oltvai, Z. N., Milliman, C. L. and Korsmeyer, S. J. 1993. Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell 74:609. Yang, E., Zha, J., Jockel, J., Boise, L. H., Thompson, C. B. and Korsmeyer, S. J. 1995. Bad, a heterodimeric partner for Bcl-XL and Bcl-2, displaces Bax and promotes cell death. Cell 80:285. Hanada, M., Aime-Sempe, C., Sato, T. and Reed, J. C. 1995. Structure–function analysis of Bcl-2 protein. Identification of conserved domains important for homodimerization with Bcl-2 and heterodimerization with Bax. J. Biol. Chem. 270:11962. Negrini, M., Silini, E., Kozak, C., Tsujimoto, Y. and Croce, C. M. 1987. Molecular analysis of mbcl-2: structure and expression of the murine gene homologous to the human gene involved in follicular lymphoma. Cell 49:455. Boise, L. H., Gonzalez-Garcia, M., Postema, C. E., Ding, L., Lindsten, T., Turka, L. A., Mao, X., Nunez, G. and Thompson, C. B. 1993. bcl-x, a bcl-2-related gene that functions as a dominant regulator of apoptotic cell death. Cell 74:597. Cory, S, 1995. Regulation of lymphocyte survival by the bcl-2 gene family. Annu Rev Immunol. 13:513. Takayama, S., Sato, T., Krajewski, S., Kochel, K., Irie, S., Millan, J. A. and Reed, J. C. 1995. Cloning and functional analysis of BAG-1: a novel Bcl-2-binding protein with anti-cell death activity. Cell 80:279. Boise, L. H., Minn, A. J., Noel, P. J., June, C. H., Accavitti, M. A., Lindsten, T. and Thompson, C. B. 1995. CD28 costimulation can promote T cell survival by enhancing the expression of Bcl-XL. Immunity 3:87. Sedlak, T. W., Oltvai, Z. N., Yang, E., Wang, K., Boise, L. H., Thompson, C. B. and Korsmeyer, S. J. 1995. Multiple Bcl-2 family members demonstrate selective dimerizations with Bax. Proc. Natl Acad. Sci. USA 92:7834.

Regulation of programmed cell death 183 28 Chen, Y., Inobe, J., Marks, R., Gonnella, P., Kuchroo, V. K. and Weiner, H. L. 1995. Peripheral deletion of antigen-reactive T cells in oral tolerance. Nature 376:177. 29 Critchfield, J. M., Racke, M. K., Zuniga-Pflucker, J. C., Cannella, B., Raine, C. S., Goverman, J. and Lenardo, M. J. 1994. T cell deletion in high antigen dose therapy of autoimmune encephalomyelitis. Science 263:1139. 30 McFarland, H. I., Critchfield, J. M., Racke, M. K., Mueller, J. P., Nye, S. H., Boehme, S. A. and Lenardo, M. J. 1995. Amelioration of autoimmune reactions by antigen-induced apoptosis of T cells. Adv. Exp. Med. Biol. 383:157. 31 Bargou, R. C., Bommert, K., Weinmann, P., Daniel, P. T., Wagener, C., Mapara, M. Y. and Dorken, B. 1995. Induction of Bax-alpha precedes apoptosis in a human B lymphoma cell line: potential role of the bcl-2 gene family in surface IgM-mediated apoptosis. Eur. J. Immunol. 25:770. 32 Steller, H. 1995. Mechanisms and genes of cellular suicide. Science 267:1445. 33 Thompson, C. B. 1995. Apoptosis in the pathogenesis and treatment of disease. Science 267:1456. 34 Korsmeyer, S. J. 1995. Regulators of cell death. Trends Genet. 11:101. 35 Radvanyi, L. G., Shi, Y., Vaziri, H., Sharma, A., Dhala, R., Mills, G. B. and Miller, R. G. 1996. CD28 costimulation inhibits TCRinduced apoptosis during a primary T cell response. J. Immunol. 156:1788.

36 Broome, H. E., Dargan, C. M., Krajewski, S. and Reed, J. C. 1995. Expression of Bcl-2, Bcl-x, and Bax after T cell activation and IL-2 withdrawal. J. Immunol. 155:2311. 37 Mueller, D. L., Seiffert, S., Fang, W. and Behrens, T. W. 1996. Differential regulation of bcl-2 and bcl-x by CD3, CD28, and the IL-2 receptor in cloned CD41 helper T cells. A model for the longterm survival of memory cells. J. Immunol. 156:1764. 38 Muraille, E., De Smedt, T., Urbain, J., Moser, M. and Leo, O. 1995. B7. 2 provides co-stimulatory functions in vivo in response to staphylococcal enterotoxin B. Eur. J. Immunol. 25:2111. 39 Strasser, A., Harris, A. W. and Cory, S. 1991. bcl-2 transgene inhibits T cell death and perturbs thymic self-censorship. Cell 67:889. 40 Strasser, A., Harris, A. W., Huang, D. C., Krammer, P. H. and Cory, S. 1995. Bcl-2 and Fas/APO-1 regulate distinct pathways to lymphocyte apoptosis. EMBO J. 14:6136. 41 Van Parijs, L., Ibraghimov, A. and Abbas, A. K. 1996. The roles of costimulation and Fas in T cell apoptosis and peripheral tolerance. Immunity 4:321. 42 Rathmell, J. C., Cooke, M. P., Ho, W. Y., Grein, J., Townsend, S. E., Davis, M. M. and Goodnow, C. C. 1995. CD95 (Fas)-dependent elimination of self-reactive B cells upon interaction with CD41 T cells. Nature 376:181. 43 Murphy, E., Hieny, S., Sher, A. and O’Garra, A. 1993. Detection of in vivo expression of interleukin-10 using a semi-quantitative polymerase chain reaction method in Schistosoma mansoni infected mice. J. Immunol. Methods 162:211.