Regulatory T-cells and cAMP suppress effector T-cells independently ...

Download PDF
6 downloads 0 Views 805KB Size Report
Comment
Data in (C) show the comparison of PDE gene families and isoforms PDE4B3, PDE4D and PDE7A. No significant differences were detected. There was also.
Biochem. J. (2013) 456, 463–473 (Printed in Great Britain)

463

doi:10.1042/BJ20130064

Regulatory T-cells and cAMP suppress effector T-cells independently of PKA–CREM/ICER: a potential role for Epac Amanda G. VANG*†, William HOUSLEY*, Hongli DONG†‡, Chaitali BASOLE*, Shlomo Z. BEN-SASSON§, Barbara E. KREAM‡¶, Paul M. EPSTEIN†‡1 , Robert B. CLARK* and Stefan BROCKE*†1 *Department of Immunology, University of Connecticut Health Center, 263 Farmington Avenue, Farmington, CT 06030-6125, U.S.A., †Department of Pharmacology, University of Connecticut Health Center, 263 Farmington Avenue, Farmington, CT 06030-6125, U.S.A., ‡Department of Cell Biology, University of Connecticut Health Center, 263 Farmington Avenue, Farmington, CT 06030-6125, U.S.A., §Laboratory of Immunology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892, U.S.A., Department of Medicine, University of Connecticut Health Center, 263 Farmington Avenue, Farmington, CT 06030-6125, U.S.A., and ¶Department of Genetics and Developmental Biology, University of Connecticut Health Center, 263 Farmington Avenue, Farmington, CT 06030-6125, U.S.A.

cAMP signalling is both a major pathway as well as a key therapeutic target for inducing immune tolerance and is involved in Treg cell (regulatory T-cell) function. To achieve potent immunoregulation, cAMP can act through several downstream effectors. One proposed mechanism is that cAMP-mediated suppression, including immunosuppression by Treg cells, results from activation of PKA (protein kinase A) leading to the induction of the transcription factor ICER (inducible cAMP early repressor). In the present study, we examined CD4 + CD25 − Teff cell (effector T-cell) and CD4 + CD25 + Treg cell immune responses in Crem (cAMP-response-element modulator) gene-deficient mice which lack ICER (Crem − / − /ICER-deficient mice). ICER deficiency did not significantly alter the frequency or number of Treg cells and Teff cells. Treg cells or a pharmacological increase in

cAMP suppressed Teff cells from Crem + / + and Crem − / − /ICERdeficient mice to an equivalent degree, demonstrating that ICER is dispensable in these functions. Additionally, activating the cAMP effector Epac (exchange protein directly activated by cAMP) suppressed Teff cells. Treg cells expressed low levels of all cyclic nucleotide Pde (phosphodiesterase) genes tested, but high levels of Epac. These data identify ICER as a redundant mediator of Treg cells and cAMP action on Teff cells and suggest that Epac may function as an alternative effector to promote cAMP-dependent Teff cell suppression.

INTRODUCTION

that function as activators or inhibitors of transcription, including the ICER (inducible cAMP early repressor). ICER is involved in autoregulatory feedback loops of transcription that govern the down-regulation of early response genes critical in immune responses [11]. In T-cells, ICER suppresses production of IL-2 (interleukin2), TNFα (tumour necrosis factor α) and IFNγ (interferon γ ), proliferation, mixed lymphocyte reaction responses and transcription of chemokines and FasL, and anergy [11–13]. In previous studies, a link was identified between cAMP and the function of ICER through which Treg cells (regulatory T-cells) inhibit transcription of the Il2 gene in Teff cells in vivo and in vitro [4,14,15]. Foxp3 (forkhead box p3)-mediated increased levels of cAMP in Treg cells are mediated through direct Foxp3 repression of the Pde3b gene [16]. In cardiomyocytes ICER has been shown to repress PDE3A and PDE4A10 expression resulting in a positive feedback loop leading to apoptosis [17,18]. Thus the PKA– CREM/ICER signalling axis is considered to be a central pathway for cAMP-mediated T-cell suppression and Treg cell function. In contrast, evidence suggests the existence of PKAindependent pathways of cAMP-mediated T-cell suppression [19,20]. Furthermore, rapid suppression of cytokine transcription in human Teff cells by Treg cells was shown to be independent

Control of Teff cell (effector T-cell) proliferation and function by cAMP signalling is well established [1,2]. Several mechanisms exist to suppress Teff cells by activation of cAMP signalling, including the action of anti-inflammatory agents through Gprotein-coupled receptors [3], cell-to-cell interactions [4,5] and inhibition of cyclic nucleotide PDEs (phosphodiesterases) within cells [6,7]. The actions of cAMP in T-cells are known to be mediated through PKA (protein kinase A) [2,8]. Analysis of downstream events identified PKA as a regulator of TCR (Tcell receptor) signalling through the C-terminal Src kinase Csk or through transcriptional regulation [2]. Transcriptional regulation by cAMP is mediated through nuclear substrates of PKA, the CREB (cAMP-response-element-binding protein) subgroup of the ATF (activating transcription factor)/CREB family of DNAbinding proteins [9]. These proteins bind to CREs (cAMPresponse elements) in the promoter of many genes and are encoded by three genes, Creb, Crem (cAMP-response-element modulator) and Atf-1. A large number of CREB, CREM and ATF-1 proteins regulate gene expression by acting as activators or repressors thereby controlling cell functions, including T-cell proliferation and homoeostasis in vivo [10]. Crem encodes multiple isoforms

Key words: cyclic nucleotide phosphodiesterase, immune tolerance, immunosuppression, inducible cAMP early repressor (ICER), T-cell proliferation.

Abbreviations used: ATF, activating transcription factor; Bnz, benzoyladenosine; CRE, cAMP-response element; CREB, cAMP-response-elementbinding protein; CREM, cAMP-response-element modulator; CTLA-4, cytotoxic T-lymphocyte antigen 4; Epac, exchange protein directly activated by cAMP; Foxp3, forkhead box p3; Fsk, forskolin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IBMX, isobutylmethylxanthine; ICER, inducible cAMP early repressor; IFNγ, interferon γ; IL-2, interleukin 2; LN, lymph node; mAb, monoclonal antibody; Me, methyladenosine; PCC, pigeon cytochrome c ; PDE, phosphodiesterase; PE, phycoerythrin; PKA, protein kinase A; qRT-PCR, quantitative reverse transcription real-time PCR; Rp-cAMPS, Rp isomer of cAMPS (adenosine 3 ,5 -monophosphothioate); SP, spleen; TCR, T-cell receptor; TDS, T-cell-depleted splenocyte; Teff cell, effector T-cell; Tg, transgenic; TGFβ, transforming growth factor β; TNFα, tumour necrosis factor α; Treg cell, regulatory T-cell. 1 Correspondence may be addressed to either of these authors (email [email protected] or [email protected]).  c The Authors Journal compilation  c 2013 Biochemical Society

464

A. G. Vang and others

of CREM/ICER [21], and we demonstrated that PDE inhibition suppresses T-cell proliferation in the absence of ICER [22]. These findings indicate that control of Teff cell function by cAMP can proceed through PKA- and CREM/ICER-independent events. These puzzling observations led us to examine concepts regarding the mechanism of cAMP action in T-cells. In the present paper, we address whether intact PKA signalling and CREM/ICER function are required for T-cell suppression, and whether other proteins are able to compensate for PKA and lack of CREM/ICER function in Treg cell- and cAMP-mediated Teff cell suppression. We also determined the role of a novel cAMP effector Epac (exchange protein directly activated by cAMP) [23], an alternative effector of cAMP signalling. Epac is a guanine-nucleotide-exchange factor which is activated when bound by cAMP and in turn activates Rap1 and Rap2, and we tested whether Epac can act as a mediator of the inhibitory cAMP signal in immunoregulation and Teff cell suppression.

qRT-PCR (quantitative reverse transcription real-time PCR) analysis

cDNA (10 ng) was amplified by qRT-PCR in a 25 μl reaction using SYBR Green PCR Master Mix (Applied Biosystems). Primers were designed using Primer Express® Software v3.0 except for Pde3a (PrimerBank ID: 9055303b3), Prkar1a (PrimerBank ID: 30794476a1) and Epac1 (PrimerBank ID: 21450061a1) which were chosen from the public resource PrimerBank [27]. Primers were chosen from gene regions common to all known splice variants of a specific gene product. Primer efficiency was verified by slope analysis to be 100 + − 2.5 %. qRT-PCR was performed using an ABI 7500 fast system and data analysed using the CT method (SDS software v3.0). Primer sequences (Invitrogen and IDT) are listed in Supplementary Table S1 (http://www.biochemj.org/bj/456/bj4560463add.htm). Amplicon sizes were approximately 100 bp. Cell treatment

MATERIALS AND METHODS Animals

Six- to 12-week-old female C57BL/6 mice were from Jackson Laboratories. Crem gene-deficient (Crem − / − ) and littermate mice were bred as described previously [24]. Experiments were performed according to approved protocols at UCHC (University of Connecticut Health Center) and the NIH. 5C.C7/RAG2 − / − /CD45.1 B10.A and CD45.2 B10.A mice were from Taconic Farms [25]. Cell isolation and activation

CD4 + CD25 − Teff cells and CD4 + CD25 + Treg cells were isolated using a Regulatory T-Cell Isolation Kit (Miltenyi Biotec) as described previously [26]. Cells were immediately frozen, used in proliferation assays or activated for 18 h on plate-bound antiCD3 mAb (monoclonal antibody) (5 μg/well; BioLegend) for subsequent Pde gene, cytokine and intracellular cAMP analysis. Generation and isolation of activated CD4 + T-cells in vivo

Naive T-cells (2×106 ) from LNs (lymph nodes) and SPs (spleens) of TCR Tg (transgenic) donor mice (5C.C7/RAG-2 − / − /CD45.1 B10.A) were injected intraperitoneally into normal syngeneic CD45.2 B10.A recipients. The mice were immunized 7–10 days later by implantation of 3-day miniosmotic pumps (Durect) containing 400 μg of antigen [PCC (pigeon cytochrome c); Sigma–Aldrich] in HBSS (Hanks balanced salt solution). The LN and SP were removed and the single cell suspensions were stained with FITC-conjugated anti-CD45.1, PE (phycoerythrin)conjugated anti-Vβ3, APC-conjugated (allophycocyanin) antiCD45.2 and PE-conjugated Cy7 (indotricarbocyanine) anti-CD4 antibodies (BD Biosciences). The Tg cells were purified by FACS sorting of the CD4 + /Vβ3 + /CD45.1 + /CD45.2 − population and the purity of the viable sorted Tg T-cells was >90 %. RNA isolation and cDNA synthesis

Sorted Tg T-cells from PCC-stimulated mice were lysed in TRIzol® (Invitrogen), RNA was extracted with the RNeasy kit and genomic DNA removed using the RNase-Free DNase kit (Qiagen). RNA quality was evaluated by the Agilent 2100 Bioanalyzer. RNA from Teff cells and Treg cells was isolated using the RNeasy mini kit and treated with Turbo DNA-free DNase (Ambion). cDNA was synthesized using Superscript III reverse transcriptase (Invitrogen).  c The Authors Journal compilation  c 2013 Biochemical Society

For assays analysing cAMP signalling, activated Teff cells were removed from plate-bound anti-CD3 mAbs at 18 h. Teff cells (1×105 ) were then incubated in a 96-well plate for 45 or 90 min in media + − 25 μM Fsk (forskolin; Biomol). After treatment, cells were frozen for subsequent RNA isolation and qRT-PCR, or used for cAMP analysis. For proliferation assays, medium or DMSO (0.1 %) as vehicle controls, IBMX (isobutylmethylxanthine) (300 μM; Sigma–Aldrich), Fsk (25 μM), Rp-cAMPS [Rp isomer of cAMPS (adenosine 3 ,5 monophosphothioate)] (1 mM; Biomol), TGFβ (transforming growth factor β) (5 ng/ml; R&D Systems), 8-pCPT-2 -O-MecAMP (where Me is methyladenosine) (50–500 μM; Sigma– Aldrich), or N 6 -Bnz-cAMP (where Bnz is benzyoladenosine) (50–500 μM; Sigma–Aldrich) were diluted directly into the cell cultures at the beginning of the assay. Western immunoblot analysis

Mouse T-cells were centrifuged at 300 g for 5 min, washed twice with ice-cold PBS and lysed in RIPA buffer with protease inhibitor cocktail (1:100 dilution; Sigma) [28]. Protein concentration was determined using a BCA Protein Assay Kit (Pierce). Equal amounts of protein were loaded and run on SDS/PAGE (10 % gels). Proteins were then transferred on to Immobilon-P transfer membrane (Millipore). Membranes were blocked with 5 % BSA in TBS for 1 h at room temperature (21 ◦ C) and probed with primary antibodies overnight at 4 ◦ C. Specificity and source of antibodies directed against PDE gene families and isoforms are listed in Supplementary Table S2 (at http://www. biochemj.org/bj/456/bj4560463add.htm). After probing, membranes were washed three times with TBS-T (TBS with 0.1 % Tween 20) buffer, and incubated with horseradish peroxidaseconjugated secondary antibody [horseradish peroxidaseconjugated anti-(rabbit IgG) was obtained from GE Healthcare] at a final dilution of 1:5000 and then washed three more times. Proteins were visualized and quantified with SuperSignal West Femto Maximum Sensitivity Substrate (Pierce) using a Syngene G:Box with Genesnap BioImaging software. Staining with antiGAPDH (glyceraldehyde-3-phosphate dehydrogenase) antibody (Abcam) was used for loading control and normalization. Proliferation assays

TDSs (T-cell-depleted splenocytes) were obtained by negative selection with murine anti-CD4 and anti-CD8 microbeads (Miltenyi Biotec). Isolated Teff and/or Treg cells (5×104 /well)

Treg cell suppression independent of ICER

465

were cultured in 96-well plates (Costar) with irradiated TDSs (5×104 /well) (2600 rad) in the presence or absence of soluble anti-CD3 mAbs (0.7 μg/ml; R&D Systems). Additional reagents were added as described above. After 48 or 80 h, 2 μCi per well of [3 H]thymidine (NEN® ) was added and cells were harvested 16 h later using a semiautomated cell harvester. [3 H]Thymidine incorporation was determined by scintillation counting. Cell viability in suppression assays was determined using Trypan Blue (2.5 %) at 64 h of incubation. Intracellular cAMP ELISA

Cells were treated as described above for 45 min. cAMP activity was determined using the Correlate EIA Direct cAMP ELISA kit (Assay Designs) using an ELISA reader (Bio-Rad Laboratories) at 405 nm. Statistics

Experimental groups were compared by analysing data with the unpaired Student’s t test or one-way ANOVA followed by Bonferroni t test using Sigmastat and GraphPad software. Probability levels for statistically significant differences are indicated by the P value in the Figure legends and by corresponding asterisks in the Figures. RESULTS Deletion of the Crem gene does not alter T-cell subsets in vivo

Although Crem − / − /ICER-deficient mice have been characterized previously [10,24,29], the specific impact of ICER deletion on Teff cell functions remains largely undefined [22]. We determined the total number of splenocytes (1.2×108 + 6×106 ) − 6 + − 2.5×10 ), CD4 CD25 as well as CD4 + T-cells (1.1×107 + − 6 + + 2×10 Teff cells (1.0×107 + ), and CD4 CD25 Treg cells − 5 −/− (9.2×105 + /ICER− 1.3×10 ) purified from SPs of Crem deficient mice and compared them with heterozygous (Crem + / − ) and normal (Crem + / + ) littermate controls (Figure 1). We find these cell numbers are equivalent to those from wild-type C57BL/6 mice [26]. Our data suggest that ICER is a redundant factor for CD4 + T-cell homoeostasis as there is no significant change in cell number or frequency in Crem − / − /ICER-deficient mice compared with Crem + / + mice. Pde gene expression is reduced in CD4 + CD25 + Treg cells independently of Crem

PDE-catalysed cyclic nucleotide degradation within the cell provides a critical mechanism for regulating cAMP signalling [6,7]. PDEs are encoded by 21 different genes, grouped into 11 different gene families. As a result of different transcriptional promoter regions and alternative splicing, more than 100 different isoforms of PDE have been identified [7]. Since individual PDE isoforms can exert specific functions through their recruitment to distinct signalling complexes [8,30–32], we determined expression of multiple PDE gene families, followed by analysis of individual isoforms. We first analysed Pde3 and Pde4 genes and found that Teff cells and Treg cells from Crem − / − /ICERdeficient mice show levels of Pde3b and Pde4b gene expression that in some cases are significantly different compared with those in Crem + / + mice (Figures 2A and 2B). PDE3A mRNA and protein expression was below the limit of detection in these cells (results not shown). Differences were also seen in other

Figure 1 mice

T-cell subset numbers in Crem − / − /ICER-deficient and control

CD4 + cell (grey bars), CD4 + CD25 − Teff cell (hatched bars) and CD4 + CD25 + Treg cell (white bars) populations were separated by magnetic bead isolation from whole SPs of Crem + / + , Crem + / − or Crem − / − /ICER-deficient littermate mice and counted. Data are the means + − S.E.M. for repeat counts of T-cell numbers isolated from two to four individual SPs from mice of the Crem + / + and Crem − / − /ICER-deficient genotypes and from one SP from a Crem + / − mouse. No significant differences were found between the experimental groups (P values; unpaired Student’s t test).

Pde genes although these differences did not reach the level of statistical significance in each comparison (Supplementary Table S3 at http://www.biochemj.org/bj/456/bj4560463add.htm). However, we detected consistent differences between Teff cells and Treg cells in the expression of all Pde genes measured. Treg cells contain high levels of cAMP ascribed, in part, to Foxp3-mediated repression of the Pde3b gene [4,16]. We found this reported pattern in Crem − / − /ICER-deficient and Crem + / + mice with Pde3b gene expression 2–3-fold higher in naive Teff cells than Treg cells and Pde4b gene expression 8–10fold higher in naive Teff cells (Figures 2A and 2B). To further analyse the cAMP signalling pathway in Treg and Teff cells, we determined the expression pattern of other Pde genes also reported to be expressed in T-cells, Pde1a, Pde1b, Pde2a, Pde5a, Pde7a and Pde8a, in Crem − / − /ICER-deficient and Crem + / + mice (Figures 2C and 2D). As these results show, increased expression of Pde3b and Pde4b genes in naive Teff cells compared with Treg cells is a characteristic shared by a wide spectrum of Pde genes. Comparing the Pde genes present in T-cells between different subpopulations, remarkably, the Treg cell subset shows significantly lower expression for all Pde genes analysed than the naive Teff cell subset (Figures 2C and 2D). Although variations in the relative expression levels of Pde genes can be seen in Teff and Treg cells from Crem + / + and Crem − / − /ICER-deficient mice (Figures 2C and 2D, and Supplementary Table S3), our overall results demonstrate that differences in Pde gene expression are more consistently associated with the Teff cell and Treg cell phenotype rather than the expression of Crem/ICER. cAMP signalling and Teff cell functions in Crem − / − /ICER-deficient mice

PDEs are dynamic regulators and respond rapidly to increases in cAMP levels. We found an over 3-fold increase in Pde4b gene expression in both Crem + / + and Crem − / − /ICER-deficient mice after 90 min of cell treatment with Fsk (25 μM), a potent activator of adenylyl cyclase (Figures 2E and 2F). This kinetic is consistent with a compensatory up-regulation of the Pde4b gene due to a cAMP increase, as previously reported [22,33]. Functional consequences of up-regulating PDE4B or PDE4D in vivo could be exacerbation of inflammatory processes due to a possible decrease in activity of endogenous anti-inflammatory agents such  c The Authors Journal compilation  c 2013 Biochemical Society

466

Figure 2

A. G. Vang and others

The cAMP signalling pathway is functional in Crem − / − / ICER-deficient T-cells

Pde gene expression was analysed by qRT-PCR in ex vivo isolated naive CD4 + CD25 − Teff and CD4 + CD25 + Treg cells from Crem + / + and Crem − / − /ICER-deficient mice. The data are presented as (A and B) the ratio of Pde /Rpl19 housekeeping gene expression for the major isoforms Pde3b and Pde4b (Crem + / + mice, closed bars; Crem − / − /ICER-deficient mice, open bars). Values are means + S.E.M. for at least triplicate determinations (P values; unpaired Student’s t test). (C) and (D) show a comparison of a large panel of expressed Pde genes between the CD4 + T-cell subpopulations (naive Teff cells, closed bars; Treg cells, open bars) with data given as means + S.E.M. for triplicate determinations and Pde expression in the Teff cell populations set as 100 % (*P < 0.05, **P < 0.001; unpaired Student’s t test). The function of activated Teff cells from Crem + / + and Crem − / − /ICER-deficient mice was addressed by incubation with Fsk (25 μM; open bars), or vehicle control (closed bars) for 90 min followed by qRT-PCR analysis of Pde gene expression (E and F). Similarly, cytokine gene expression (G and H) was analysed by qRT-PCR after 90 min and cellular cAMP content (I) was determined by ELISA after 45 min in Teff cells from Crem − / − /ICER-deficient mice treated with Fsk (open bars) or vehicle control (closed bars). Data are means + S.E.M. for triplicate determinations (A–H) and double determinations (I) for two to three independent experiments (*P < 0.05, **P < 0.001; unpaired Student’s t test).

as PGE2 and suboptimal responses to therapy with β-agonists [34]. The intact feedback loop in Crem − / − /ICER-deficient mice also demonstrates that ICER is redundant for the transient changes in Pde gene expression that regulate intracellular cAMP levels. cAMP-mediated inhibition of Teff cell function is largely attributed to a decrease in Ifng, Tnfa and Il2 transcription [2,35]. Transcription of the Il2 gene and access to external IL-2 determine the ability of Teff cells to survive and proliferate [36]. Since competition between CREB and ICER for the CRE sites on the  c The Authors Journal compilation  c 2013 Biochemical Society

Il2 promoter results in a decrease of Il2 transcription, we tested the role of ICER in cAMP-mediated suppression of cytokine gene transcription by Teff cells. Treatment of activated Crem − / − /ICERdeficient Teff cells with Fsk (25 μM) decreased expression of Ifng by 50 %, Tnfa by 75 % and Il2 by 95 % (Figures 2G and 2H). The decrease in cytokine gene expression in Teff cells deficient in ICER is equivalent to that in Crem + / + Teff cells, which are capable of transcriptional repression through PKA– ICER signalling. Therefore, although the cAMP–PKA–ICER

Treg cell suppression independent of ICER

Figure 3

467

Western immunoblot analyses of PDE proteins in Teff and Treg cells

PDEs were analysed by immunoblot in ex vivo isolated naive CD4 + CD25 − Teff and CD4 + CD25 + Treg cells. (A) Comparison of PDE gene families and isoforms PDE3B, PDE4B2, PDE4B4 and PDE8A (for details see Supplementary Table S2 at http://www.biochemj.org/bj/456/bj4560463add.htm) between the CD4 + T-cell subpopulations and GAPDH as a loading control for each immunoblot. (B) Protein ratios determined by immunoblot densitometry between PDEs in Treg and Teff cells normalized to GAPDH expression. Data shown are for at least three independent experiments (*P < 0.05; Student’s t test). Data in (C) show the comparison of PDE gene families and isoforms PDE4B3, PDE4D and PDE7A. No significant differences were detected. There was also no detectable expression of PDE3A or PDE4A protein (results not shown).

signalling pathway has been shown to actively suppress cytokine production in Crem + / + T-cells [11], we conclude that it is not the sole regulator of cAMP-mediated transcriptional repression of Tcell effector functions. To directly confirm that Fsk still elevates cAMP levels in Crem − / − /ICER-deficient mice, we measured the increase in cAMP by ELISA following a 45-min stimulation with Fsk. Activated Crem − / − /ICER-deficient Teff cells responded to Fsk with a 60-fold increase in cAMP levels (Figure 2I), which is even higher than the increase seen in Crem + / + Teff cells. Taken together, these results demonstrate that overall regulation of cAMP signalling and its suppressive action on proliferation and cytokine production in Teff cells are not exclusively dependent on ICER.

β-agonists [37] or their PDEs are targeted by selective inhibitors [28]. Therefore, in addition to changes in PDE gene expression (Figure 2), we also investigated expression of PDE proteins in Teff and Treg cells (Figure 3 and Supplementary Table S2). We found that, in addition to lower expression of PDE3B [relative expression of 0.57 + − 0.15 (S.D.)] as had been reported previously [16], expression of PDE4B2 [relative expression of 0.86 + − 0.09 (S.D.)] and PDE8A [relative expression of 0.67 + − 0.13 (S.D.)] were also significantly reduced in Treg cells as compared with Teff cells (Figure 3B). Data in Figure 3(C) show the comparison of PDE gene families and isoforms PDE4B3, PDE4D and PDE7A. No significant differences were detected between Treg and Teff cells.

PDE3B, PDE4B and PDE8A protein expression are reduced in Treg cells

PDE4 isoform regulation in response activation of cAMP signalling

We and others reported differences between changes in PDE gene expression and protein abundance when cells are challenged by

As individual PDEs can exert selective functions through their sequestration to distinct signalling complexes [8,30], we determined expression of Pde4 gene splice variants and isoforms,  c The Authors Journal compilation  c 2013 Biochemical Society

468

A. G. Vang and others

PDE4B5 protein expression ranging from 1.05- to 1.2-fold at 24 h of stimulation. Consistent with little expression of PDE4A mRNA (Supplementary Table S4 and Figure 4), we did not detect protein expression of this PDE by Western blotting (results not shown). Our data demonstrate that PDE4B is induced at both the gene and protein levels after treatment of Teff cells with agonists that increase cAMP, and the increased PDE4B expression at the protein level can be accounted for by increases in PDE4B2, PDE4B3, PDE4B4 and PDE4B5 expression. Of note, PDE4B1 expression was not observed in these cells at the RNA or protein level (Supplementary Table S4 and Figure 4, and results not shown). CREM/ICER signalling is a redundant pathway for suppression of activated Teff cells by Treg cells

Figure 4 Expression of Pde4 genes and splice variants are differentially regulated following stimulation of the cAMP signalling pathway The contribution of Pde4a , Pde4b , Pde4d genes (A) and Pde4b splice variants Pde4b1, Pde4b2 , Pde4b3 , Pde4b4 and Pde4b5 (B) to the changes in gene expression following a 90 min incubation with Fsk (25 μM; open bars) compared with vehicle control (closed bars) was analysed by qRT-PCR in Teff cells. Primers were chosen from gene regions common to all known splice variants of a specific gene product for pan-Pde gene probes and from regions unique to the splice variant for Pde4b1–Pde4b5 probes. Data are means + S.E.M. for triplicate determinations of three independent experiments. (C) Western immunoblot analyses of PDE proteins in Teff cells stimulated with Fsk. PDEs were analysed by immunoblot in ex vivo isolated naive CD4 + CD25 − Teff cells. The Figure shows a comparison of a panel of PDE4B isoforms (for details see Supplementary Table S2 at http://www.biochemj.org/bj/456/bj4560463add.htm) between the vehicle control (C) or Fsk-stimulated CD4 + Teff cells, as indicated in the Figure, with GAPDH as a loading control for each immunoblot. Times of stimulation (60 min to 24 h) are as indicated in the Figure. Protein ratios between PDEs normalized to corresponding GAPDH expression between Fsk and control stimulated Teff cells were 1.1 at 60 min, 1.01 at 90 min, 1.1 at 24 h for PDE4B3; 1.0 at 60 min, 0.99 at 90 min, 1.05 at 24 h for PDE4B2; 1.0 at 30 min, 1.05 at 90 min and 1.06 at 24 h for PDE4B4; and 0.9 at 30 min, 1.04 at 90 min and 1.2 at 24 h for PDE4B5. Data are representative of results from two (60 min) and three to five (90 min and 24 h) independent experiments. Differences did not reach statistical significance (Student’s t test). PDE4B1 expression was not observed at the RNA or protein level.

and assessed whether they are differentially regulated following stimulation of the cAMP signalling pathway. We focused on PDE4 since its roles in inflammation [38] and T-cell function [31,32,39] are well established. The contribution of Pde4a, Pde4b, Pde4d genes (Figure 4A) and Pde4b splice variants Pde4b1, Pde4b2, Pde4b3, Pde4b4 and Pde4b5 (Figure 4B) to the changes in gene expression following a 90 min incubation with Fsk (25 μM; open bars) compared with vehicle control (closed bars) was analysed by qRT-PCR in Teff cells. Primers were chosen from gene regions common to all known splice variants of a specific gene product for pan-Pde gene probes and from regions unique to the splice variant for Pde4b1– Pde4b5 probes (Supplementary Table S1). Fsk increased the mRNA expression of Pde4b, Pde4d and of all the Pde4b splice variants that were expressed at this level (Figures 4A and 4B), but these differences were not significant (Supplementary Table S4 at http://www.biochemj.org/bj/456/bj4560463add.htm). Next, by Western immunoblotting, we analysed PDE proteins in ex vivo isolated naive CD4 + CD25 − Teff cells that were stimulated with Fsk (Figure 4C). Using a panel of PDE gene family and isoform-specific antibodies (Supplementary Table S2), we detected small increases in PDE4B2, PDE4B3, PDE4B4 and  c The Authors Journal compilation  c 2013 Biochemical Society

We directly examined whether ICER is essential for Tregmediated Teff cell suppression using Crem − / − /ICER-deficient mice. By co-culturing purified Teff cells, Treg cells and TDSs as antigen-presenting cells, we determined the effect of lack of ICER on activated Teff cell proliferation by measuring [3 H]thymidine incorporation after 64 or 96 h of incubation. Both in cultures with T-cells matched for Crem gene expression (Figures 5A and 5B) and cultures mismatched for Crem gene expression (Figure 5C), proliferation of activated Crem − / − /ICER-deficient Teff cells was significantly suppressed by 70–79 % by Treg cells. Similarly, the function of Treg cells is preserved in the absence of ICER as Crem − / − /ICER-deficient Treg cells are able to suppress the proliferation of Crem + / + Teff cells by 55 %. Utilizing this genetic approach we could demonstrate the ability of Crem − / − /ICER-deficient Treg cells to mediate suppression of Crem + / + Teff cells (results not shown) and of Crem − / − /ICERdeficient Teff cells to be susceptible to suppression in culture by Crem + / + Treg cells. Notably, Crem + / + and Crem − / − /ICERdeficient Teff cells were equally susceptible to TGFβ-mediated suppression of proliferation [26] (Supplementary Figure S1 at http://www.biochemj.org/bj/456/bj4560463add.htm). PKA–CREM/ICER signalling is not essential for Treg- and cAMP-mediated suppression

To determine whether cAMP-mediated Teff cell suppression may selectively act through the cAMP–PKA pathway, we tested the PKA-selective inhibitor Rp-cAMPS combined with a genetic approach on cAMP-mediated suppression in Crem − / − /ICERdeficient Teff cells. Strikingly, the addition of Rp-cAMPS (1 mM) failed to reverse Treg-mediated suppression of activated Teff cells or to reverse the anergic phenotype of Treg cells (Figures 6A and 6B). Consistent with these results, addition of Rp-cAMPS did not reverse cAMP-mediated suppression of Teff cell proliferation induced by Fsk (Figure 6C). Activation of cAMP signalling was highly effective and equivalent in Teff cells from Crem + / + and Crem − / − /ICER-deficient mice as demonstrated by the suppressive action of Fsk alone or Fsk in combination with the PDE inhibitor IBMX. The latter treatment regimen, known to maximally increase intracellular cAMP by inducing both its synthesis and blocking its degradation, almost completely abolished Teff cell proliferation (Fsk + IBMX: 0.03 % for Crem + / + and 1 % for Crem − / − /ICER-deficient Teff cells) (Figure 6C). Taken together, these data show that ICER is not a required transcriptional regulator of cAMP-mediated suppression of Teff cell proliferation and that PKA-independent cAMP-mediated pathways are likely to be contributing to this suppression. Thus, although transcriptional regulation through

Treg cell suppression independent of ICER

Figure 5

469

ICER is a redundant mediator of Teff cell suppression

Purified CD4 + CD25 − Teff cells (5×104 /well) from Crem + / + (closed bars) or Crem − / − /ICER-deficient (open bars) mice were co-cultured with CD4 + CD25 + Treg cells (5×104 /well) that were (A and B) matched or (C) mismatched for Crem gene expression. All co-cultures were performed with irradiated TDSs (5×104 well) presenting soluble anti-CD3 mAbs (0.75 μg/ml) with [3 H]thymidine added for the final 16 h. The extent of proliferation was determined by [3 H]thymidine incorporation at 64 h (A and C) and at 96 h (B). Results are presented as percentage of proliferation normalized to the proliferation of Teff cells. Data are means + S.E.M. for three experiments (A) run in triplicate or one experiment (B and C) run in triplicate. (*P < 0.05, **P < 0.001; one-way ANOVA followed by Bonferroni t test). Values designated as N.D. were below the detection limit of the assay.

Figure 6

The PKA–ICER pathway is redundant for cAMP-mediated inhibition of Teff cells

Purified CD4 + CD25 − Teff cells (5×104 /well) from Crem + / + (closed bars) or Crem − / − /ICER-deficient (open bars) mice were (A and B) co-cultured with genotypically identical CD4 + CD25 + Treg cells (5×104 /well) with irradiated TDSs (5×104 /well) presenting soluble anti-CD3 mAbs (0.75 μg/ml) in the presence or absence of the PKA antagonist Rp-cAMPS (1 mM) or (C) on plate-bound anti-CD3 mAbs (5 μg/well) in the presence or absence of Fsk (25 μM), Rp-cAMPS (1 mM), IBMX (300 μM) or media as vehicle control. The extent of proliferation was determined by [3 H]thymidine incorporation at 64 h and results are presented as percentage of proliferation normalized to the proliferation of Teff cells with vehicle. Data are means + S.E.M. for two independent experiments performed in triplicate (**P < 0.001; one-way ANOVA followed by Bonferroni t test). Values designated as N.D. were below the detection limit of the assay.

ICER and PKA signalling participate in cAMP-mediated suppression, they are not essential in this process. cAMP suppresses Teff cell proliferation in Crem + / + and Crem − / − /ICER-deficient mice by PKA-dependent and -independent mechanisms

To analyse further the cAMP signalling pathway in Teff cell suppression, we examined the expression and function of cAMP effector molecules in Teff cells. We identified the cAMP targets PKA RIα and Epac1 in our Teff cell populations and determined their gene expression by qRT-PCR. Prkar1a gene expression was high and ranged between 10 and 30 % of that for the Rpl19 housekeeping gene, but did not significantly differ between CD4 + T-cells activated in vivo, naive Teff cells, Treg cells or Teff cells activated in vitro (Figure 7A). In contrast, Rapgef3 (Epac1) expression, although lower than Prkar1a expression, was selectively up-regulated in Treg cells exhibiting 10-fold greater expression levels (Figure 7B) than in any other T-cell population tested. The elevated Epac expression levels in Treg cells are consistent with the action of cAMP in maintaining the anergic phenotype of Treg cells in response to anti-CD3 antibody stimulation and may suggest a role for Epac in this process. With direct evidence indicating up-regulation of Epac1 expression in Treg cells compared with Teff cells, we next

characterized the function of Epac activation in Teff cells. To determine whether cAMP-mediated Teff cell suppression may act through the cAMP–Epac pathway, we used selective cAMP analogues. The cAMP analogues N 6 -Bnz-cAMP and 8pCPT-2 -O-Me-cAMP discriminate between the PKA and Epac signalling pathways. 8-pCPT-2 -O-Me-cAMP is a highly potent and selective activator of Epac and is over 10-fold more efficient as an allosteric regulator of Epac1 and Epac2 than cAMP (K d is 2.9 μM compared with 45 μM for cAMP) [23,40]. Importantly, 8-pCPT-2 -O-Me-cAMP binds to Epac with a 107-fold greater selectivity than to the PKA regulatory subunit RIα and fails to activate CREB, whereas it produces maximal activation of Rap1 at concentrations of up to 500 μM, depending on the cell types examined [41]. In contrast, N 6 -Bnz-cAMP somewhat selectively activates PKA on the basis of its 3-fold greater affinity for PKA than Epac [41]. Our results show that 8-pCPT2 -O-Me-cAMP significantly reduced Teff cell proliferation at concentrations as low as 250 μM by 48 % (Figure 7C). These results identify Epac as an alternative mediator of cAMP-induced Teff cell suppression. N 6 -Bnz-cAMP also reduced proliferation, and more profoundly than 8-pCPT-2 -O-Me-cAMP, at the same concentrations. The lower selectivity of N 6 -Bnz-cAMP for the known cAMP effectors may be responsible for its 2-fold stronger suppression when compared with the Epac-selective analogue 8pCPT-2 -O-Me-cAMP (Figure 7C). Notably, suppression through N 6 -Bnz-cAMP and the PKA pathway was equivalent in Crem + / +  c The Authors Journal compilation  c 2013 Biochemical Society

470

Figure 7

A. G. Vang and others

Epac is a mediator of cAMP-induced Teff cell suppression

(A) Prkar1a and (B) Epac1 gene transcript levels were determined by qRT-PCR from in vivo - and in vitro -activated CD4 + T-cells. In vivo -activated cells were produced by injection of naive T-cells from LNs of TCR Tg donor mice (5C.C7/RAG-2 − / − /CD45.1 B10.A) intraperitoneally into normal syngeneic CD45.2 B10.A recipients and activated in vivo through implantation of 3-day miniosmotic pumps containing 400 μg of antigen (PCC). The LNs were removed and single cell suspensions of CD4 + T-cells were collected. Ex vivo -naive Teff and Treg cells were separated by magnetic bead isolation. In vitro -activated Teff cells were produced by stimulating naive CD4 + CD25 − Teff cells with plate-bound anti-CD3 mAbs for 18 h. All cells were lysed for RNA isolation followed by qRT-PCR analysis. The results represent the mean relative expression + S.E.M. for three independent experiments. To investigate downstream PKA signalling on a functional level, (C) Crem + / + (closed bars) or Crem − / − /ICER-deficient (open bars) mice derived Teff cells (5×104 /well) were incubated with the Epac-selective agonist 8-pCPT-2 -O -Me-cAMP (50–500 μM), the PKA-selective agonist N 6 -Bnz-cAMP (50–500 μM) or media as vehicle control on plate-bound anti-CD3 mAbs (5 μg/well) for 64 h with [3 H]thymidine added for the final 16 h. The extent of proliferation was determined by [3 H]thymidine incorporation at 64 h and results are means + S.E.M. for proliferation normalized to the vehicle condition of an experiment run in triplicate. The results are representative of two independent experiments (*P < 0.05, **P < 0.001; one-way ANOVA followed by Bonferroni t test).

and Crem − / − /ICER-deficient Teff cells (Figure 7C), supporting our previous conclusion of efficient PKA-mediated suppression independently of ICER. Taken together, our results suggest that in this system cAMP exerts its suppressive effects on Teff cells in parallel through both PKA and Epac-dependent pathways, as has been seen in some other cell types [41,42]. In conclusion, we were able demonstrate the involvement of Epac in Teff cell suppression by the ability to mimic the cAMP response with the Epac-selective cAMP analogue 8-pCPT-2 -O-Me-cAMP (Figure 7), combined with the insensitivity of the cAMP response to inhibitors of PKA (Figure 6). Of note, all pharmacologic suppression results were comparable whether T-cells were cultured directly on plate-bound antiCD3 mAbs (Figures 6 and 7) or using soluble anti-CD3 antibody together with TDSs as antigen-presenting cells. Furthermore, Tcell viability after culture with Fsk (25 μM), IBMX (300 μM), 8-pCPT-2 -O-Me-cAMP (50–500 μM) and N 6 -Bnz-cAMP (50– 500 μM) was not significantly different from the appropriate vehicle control treated cells as determined by Trypan Blue exclusion (Supplementary Figure S2 at http://www.biochemj.org/ bj/456/bj4560463add.htm).

DISCUSSION

cAMP is a pleiotropic regulator of cell growth and function. Despite promoting proliferation in some cell types, in T-cells, cAMP suppresses TCR-triggered proliferation and cytokine production [1,2,35]. In addition, previous studies demonstrated  c The Authors Journal compilation  c 2013 Biochemical Society

the ability of Treg cells to suppress Teff cell function through raising intracellular cAMP [4,5]. cAMP has been further implicated in suppression since Treg cells that lost their suppressive capacity as a result of nonfunctional Foxp3 expression have reduced intracellular cAMP levels, whereas all other Treg cell markers are unchanged [43]. Subsequently, several mechanisms were identified, including cellto-cell transfer of cAMP through gap junctions formed between Treg and Teff cells [4], the generation of adenosine by Treg cells [5] or induction of ICER through high-affinity CTLA-4 (cytotoxic T-lymphocyte antigen 4) interaction with B7 expressed on Foxp3 − responder Teff cells by ‘reverse signalling’ [14,15]. Thus, although Treg cells may use multiple processes to control immune responses, cAMP signalling appears to play a significant role. In the present study, we studied the cAMP–PKA–CREM/ICER pathway using pharmacological inhibitors in Crem + / + and Crem − / − mice. We found that the selective PKA antagonist Rp-cAMPS failed to reverse inhibition of Teff cell proliferation induced by Fsk or Treg cells. These results were unexpected since it is generally considered that the actions of cAMP in T-cells are mediated by PKA [2,31,32,44]. cAMP–PKA signalling in Tcells presumably acts through inhibition of IL-2 production [45]. Previous studies identified PKA as a regulator of TCR signalling through the C-terminal Src kinase Csk [2], induction of cell cycle inhibitor proteins like p27Kip1 that cause a block of the G1 -phase in T-cells [44], or direct transcriptional regulation [11,14,15,45]. Since PKA was shown to inhibit T-cell function at the transcriptional level, we investigated the cAMP signalling

Treg cell suppression independent of ICER

pathway downstream of PKA by analysing the role of the CRE-binding transcription factor CREM in T-cell suppression. We chose Crem − / − /ICER-deficient mice as a model system to probe the role of PKA-dependent transcriptional repression in our assays since, in T-cells, ICER is the predominant isoform of CREM and the only inducible repressor of its class [11]. ICER binds to promoter regions containing CRE sites and thus modulates the activity of ATF/CREB factors by repressing cAMP-inducible genes. In T-cells, CRE-like motifs functioning as ICER-interaction sites have been identified in many cytokinegene promoters, including the Il2, Ifng and Mip1b promoter regions [11,13–15]. ICER was shown to bind to CRE and AP-1 (activator protein-1) regions adjacent to NFAT (nuclear factor of activated T-cells) and NF-κB (nuclear factor κB)-binding sites in these cytokine and chemokine promoters [11,14]. The established role of ICER in mediating transcriptional attenuation of IL-2 and other T-cell cytokines has led to studies of its involvement in Treg cell function [11,14,15]. Some of these reports demonstrated that ICER mediated transcriptional attenuation of IL-2, which was dependent on direct contact between CD4 + CD25 + Treg and Teff cells and involved reverse signalling through the CTLA-4–B7. The authors concluded that Treg cells suppress IL-2 transcription through induction of ICER in Teff cells. In the present study, we examined whether ICER plays a non-redundant role in regulating TCR-triggered T-cell responses through cAMP signalling. Our results demonstrate that Treg cells effectively suppress Teff cells from Crem − / − /ICER-deficient mice. This function is not restricted by the presence of the Crem gene as Treg cells from both Crem + / + and Crem − / − /ICER-deficient mice suppress proliferation of CD4 + CD25 − Teff cell from Crem + / + and Crem − / − /ICER-deficient mice. To address the underlying mechanism, we subjected CD4 + T-cells from Crem + / + and Crem − / − /ICER-deficient mice to various treatment regimens that activate cAMP signalling. Our results show that Teff cells from Crem − / − /ICER-deficient mice are susceptible to cAMP-mediated suppression at levels equivalent to T-cells from Crem + / + mice. These observations are in line with a previous study on human Teff cells which is consistent with our findings [21]. Several reports provide evidence for PKA-independent mechanisms for immunosuppressive effects of cAMP in T-cells [19,20]. We therefore focused on cAMP functions reported to be independent of PKA, such as activation of the small GTPase Rap1 [46]. cAMP analogues activate Rap 1 in leukaemic cells and PKA inhibitors have no known effect on cAMP-induced Rap 1 activation [47]. Importantly, active GTP-bound Rap1 is found in anergic T-cells and overexpression of Rap1–GTP in leukaemic T-cells blocks Il2 gene transcription [48]. Thus realization that distinct signalling actions of cAMP are independent of PKA, coupled with the finding that cAMP activates the Ras GTPase homologues Rap1 and Rap2, led us to investigate the family of cAMP-activated guanine-nucleotide-exchange factors Epac, which mediate cAMP activation of Rap. Epac represents an alternative effector governing signalling specificity in response to cAMP independently of PKA, but its role in the regulation of T-cell proliferation is controversial. Fuld et al. [44] examined whether the cAMP–Epac–Rap1 pathway mediates growth inhibitory signals and the up-regulation of antiproliferative proteins such as p27Kip1 . In contrast with earlier reports that indicated an inhibitory effect of Epac and Rap1 on Il2 transcription and T-cell proliferation [48], the Epac-selective agonist 8-pCPT2 -O-Me-cAMP failed to induce growth arrest in Jurkat T-cells [44]. Similarly, the expression of active Rap1 in Tg T-cells provoked activation of integrins and cell adhesion, but did not induce growth arrest [49]. However, some of these studies were performed with leukaemic T-cell lines and not in primary T-cell

471

subsets which significantly differ in growth regulation by cAMP [28]. Indeed, we found that selectively activating Epac through 8-pCPT-2 -O-Me-cAMP in both Crem + / + and Crem − / − /ICERdeficient mice causes suppression of CD4 + CD25 − Teff cell proliferation. The alternative function of Epac is highlighted by our finding that a PKA-selective antagonist failed to reverse Treg cell or cAMP-induced suppression. Of note, an Epac-selective antagonist has not been reported. Nevertheless, our data suggest that Epac acts as an alternative effector of cAMP-induced Teff cell suppression. In line with this view, Rap1 was shown to be activated by CTLA-4 engagement on T-cells and to critically mediate the subsequent inhibitory signal on IL-2 production [50]. Whether as reported in other systems, PKA and Epac act in synergy, in parallel, or even in opposition remains to be elucidated in future studies [41,42]. Our data suggest that both pathways can act independently from one another during suppression of Teff cell functions. Of note, Treg cells expressed low levels of all Pde genes tested, whereas Teff cells displayed higher Pde gene expressions. Conversely, we detected increased gene expression of Epac1 in both naive and activated Treg cells in comparison with Teff cells. Thus Epac may be a novel marker for the Treg cell population. Importantly, we also show that activation of PKA through N 6 -Bnz-cAMP suppresses T-cell function independently of CREM/ICER. These data suggest that PKA may suppress Teff cell function by any of the established ICER-independent mechanisms [44]. Despite suppression through N 6 -Bnz-cAMP and PKA, our observations identify a redundant role of PKA and CREM/ICER signalling in cAMP-mediated control of Teff cell functions and indicate that an alternative effector such as Epac can mediate suppression. AUTHOR CONTRIBUTION Amanda Vang researched data, contributed to the research design and discussion and wrote the paper. William Housley, Hongli Dong and Chaitali Basole researched data and contributed to the discussion. Shlomo Ben-Sasson researched data and reviewed/ edited the paper before submission. Barbara Kream provided materials and reviewed/edited the paper before submission. Paul Epstein contributed to the research design and discussion and wrote the paper. Robert Clark contributed to the research design and discussion and reviewed/edited the paper before submission. Stefan Brocke led the research design and discussion, and wrote the paper.

ACKNOWLEDGEMENTS We thank the late Dr Ramadan Sha’afi for his invaluable advice and support.

FUNDING This work was supported by the National Multiple Sclerosis Society [grant numbers RG 4544A1/1 (to S.B.) and RG 4070A6 (R.C.)], institutional start-up funds (to S.B.), the Connecticut Breast Health Initiative (to P.M.E. and S.B.), the CT Department of Public Health (to P.M.E. and S.B.), the Smart Family Foundation (to P.M.E. and S.B.), the Lea’s Foundation for Leukemia Research (to P.M.E.) and the National Institutes of Health [grant numbers 1R56 AI072533-01 A1 (to R.B.C.) and R01 AR046542 (to B.E.K.)].

REFERENCES 1 Bourne, H. R., Lichtenstein, L. M., Melmon, K. L., Henney, C. S., Weinstein, Y. and Shearer, G. M. (1974) Modulation of inflammation and immunity by cyclic AMP. Science 184, 19–28 2 Tasken, K. and Ruppelt, A. (2006) Negative regulation of T-cell receptor activation by the cAMP-PKA-Csk signalling pathway in T-cell lipid rafts. Front. Biosci. 11, 2929–2939 3 Ohta, A., Ohta, A., Madasu, M., Kini, R., Subramanian, M., Goel, N. and Sitkovsky, M. (2009) A2A adenosine receptor may allow expansion of T cells lacking effector functions in extracellular adenosine-rich microenvironments. J. Immunol. 183, 5487–5493  c The Authors Journal compilation  c 2013 Biochemical Society

472

A. G. Vang and others

4 Bopp, T., Becker, C., Klein, M., Klein-Hessling, S., Palmetshofer, A., Serfling, E., Heib, V., Becker, M., Kubach, J., Schmitt, S. et al. (2007) Cyclic adenosine monophosphate is a key component of regulatory T cell-mediated suppression. J. Exp. Med. 204, 1303–1310 5 Deaglio, S., Dwyer, K. M., Gao, W., Friedman, D., Usheva, A., Erat, A., Chen, J. F., Enjyoji, K., Linden, J., Oukka, M. et al. (2007) Adenosine generation catalyzed by CD39 and CD73 expressed on regulatory T cells mediates immune suppression. J. Exp. Med. 204, 1257–1265 6 Conti, M. and Beavo, J. (2007) Biochemistry and physiology of cyclic nucleotide phosphodiesterases: essential components in cyclic nucleotide signaling. Annu. Rev. Biochem. 76, 481–511 7 Lerner, A. and Epstein, P. M. (2006) Cyclic nucleotide phosphodiesterases as targets for treatment of haematological malignancies. Biochem. J. 393, 21–41 8 Baillie, G. S., Scott, J. D. and Houslay, M. D. (2005) Compartmentalisation of phosphodiesterases and protein kinase A: opposites attract. FEBS Lett. 579, 3264–3270 9 Hai, T. and Hartman, M. G. (2001) The molecular biology and nomenclature of the activating transcription factor/cAMP responsive element binding family of transcription factors: activating transcription factor proteins and homeostasis. Gene. 273, 1–11 10 Baumann, S., Kyewski, B., Bleckmann, S. C., Greiner, E., Rudolph, D., Schmid, W., Ramsay, R. G., Krammer, P. H., Schutz, G. and Mantamadiotis, T. (2004) CREB function is required for normal thymic cellularity and post-irradiation recovery. Eur. J. Immunol. 34, 1961–1971 11 Bodor, J. and Habener, J. F. (1998) Role of transcriptional repressor ICER in cyclic AMP-mediated attenuation of cytokine gene expression in human thymocytes. J. Biol. Chem. 273, 9544–9551 12 Higai, K., Tsukada, M., Moriya, Y., Azuma, Y. and Matsumoto, K. (2009) Prolonged high glucose suppresses phorbol 12-myristate 13-acetate and ionomycin-induced interleukin-2 mRNA expression in Jurkat cells. Biochim. Biophys. Acta 1790, 8–15 13 Powell, J. D., Lerner, C. G., Ewoldt, G. R. and Schwartz, R. H. (1999) The − 180 site of the IL-2 promoter is the target of CREB/CREM binding in T cell anergy. J. Immunol. 163, 6631–6639 14 Bodor, J., Fehervari, Z., Diamond, B. and Sakaguchi, S. (2007) ICER/CREM-mediated transcriptional attenuation of IL-2 and its role in suppression by regulatory T cells. Eur. J. Immunol. 37, 884–895 15 Vaeth, M., Gogishvili, T., Bopp, T., Klein, M., Berberich-Siebelt, F., Gattenloehner, S., Avots, A., Sparwasser, T., Grebe, N., Schmitt, E. et al. (2011) Regulatory T cells facilitate the nuclear accumulation of inducible cAMP early repressor (ICER) and suppress nuclear factor of activated T cell c1 (NFATc1). Proc. Natl. Acad. Sci. U.S.A. 108, 2480–2485 16 Gavin, M. A., Rasmussen, J. P., Fontenot, J. D., Vasta, V., Manganiello, V. C., Beavo, J. A. and Rudensky, A. Y. (2007) Foxp3-dependent programme of regulatory T-cell differentiation. Nature 445, 771–775 17 Ding, B., Abe, J., Wei, H., Xu, H., Che, W., Aizawa, T., Liu, W., Molina, C. A., Sadoshima, J., Blaxall, B. C. et al. (2005) A positive feedback loop of phosphodiesterase 3 (PDE3) and inducible cAMP early repressor (ICER) leads to cardiomyocyte apoptosis. Proc. Natl. Acad. Sci. U.S.A. 102, 14771–14776 18 McCahill, A., Campbell, L., McSorley, T., Sood, A., Lynch, M. J., Li, X., Yan, C., Baillie, G. S. and Houslay, M. D. (2008) In cardiac myocytes, cAMP elevation triggers the down-regulation of transcripts and promoter activity for cyclic AMP phosphodiesterase-4A10 (PDE4A10). Cell. Signalling 20, 2071–2083 19 Bryce, P. J., Dascombe, M. J. and Hutchinson, I. V. (1999) Immunomodulatory effects of pharmacological elevation of cyclic AMP in T lymphocytes proceed via a protein kinase A independent mechanism. Immunopharmacology 41, 139–146 20 Staples, K. J., Bergmann, M., Tomita, K., Houslay, M. D., McPhee, I., Barnes, P. J., Giembycz, M. A. and Newton, R. (2001) Adenosine 3 ,5 -cyclic monophosphate (cAMP)-dependent inhibition of IL-5 from human T lymphocytes is not mediated by the cAMP-dependent protein kinase A. J. Immunol. 167, 2074–2080 21 Oberle, N., Eberhardt, N., Falk, C. S., Krammer, P. H. and Suri-Payer, E. (2007) Rapid suppression of cytokine transcription in human CD4 + CD25 − T cells by CD4 + Foxp3 + regulatory T cells: independence of IL-2 consumption, TGF-β, and various inhibitors of TCR signaling. J. Immunol. 179, 3578–3587 22 Vang, A. G., Ben-Sasson, S. Z., Dong, H., Kream, B., DeNinno, M. P., Claffey, M. M., Housley, W., Clark, R. B., Epstein, P. M. and Brocke, S. (2010) PDE8 regulates rapid Teff cell adhesion and proliferation independent of ICER. PLoS ONE 5, e12011 23 Gloerich, M. and Bos, J. L. (2010) Epac: defining a new mechanism for cAMP action. Annu. Rev. Pharmacol. Toxicol. 50, 355–375 24 Liu, F., Lee, S. K., Adams, D. J., Gronowicz, G. A. and Kream, B. E. (2007) CREM deficiency in mice alters the response of bone to intermittent parathyroid hormone treatment. Bone 40, 1135–1143 25 Ben-Sasson, S. Z., Gerstel, R., Hu-Li, J. and Paul, W. E. (2001) Cell division is not a “clock” measuring acquisition of competence to produce IFN-γ or IL-4. J. Immunol. 166, 112–120  c The Authors Journal compilation  c 2013 Biochemical Society

26 Wohlfert, E. A., Gorelik, L., Mittler, R., Flavell, R. A. and Clark, R. B. (2006) Cutting edge: deficiency in the E3 ubiquitin ligase Cbl-b results in a multifunctional defect in T cell TGF-β sensitivity in vitro and in vivo . J. Immunol. 176, 1316–1320 27 Spandidos, A., Wang, X., Wang, H. and Seed, B. (2010) PrimerBank: a resource of human and mouse PCR primer pairs for gene expression detection and quantification. Nucleic Acids Res. 38, D792–D799 28 Dong, H., Zitt, C., Auriga, C., Hatzelmann, A. and Epstein, P. M. (2010) Inhibition of PDE3, PDE4 and PDE7 potentiates glucocorticoid-induced apoptosis and overcomes glucocorticoid resistance in CEM T leukemic cells. Biochem. Pharmacol. 79, 321–329 29 Blendy, J. A., Kaestner, K. H., Weinbauer, G. F., Nieschlag, E. and Schutz, G. (1996) Severe impairment of spermatogenesis in mice lacking the CREM gene. Nature 380, 162–165 30 Houslay, M. D. (2010) Underpinning compartmentalised cAMP signalling through targeted cAMP breakdown. Trends Biochem. Sci. 35, 91–100 31 Bjorgo, E., Solheim, S. A., Abrahamsen, H., Baillie, G. S., Brown, K. M., Berge, T., Okkenhaug, K., Houslay, M. D. and Tasken, K. (2010) Cross talk between phosphatidylinositol 3-kinase and cyclic AMP (cAMP)-protein kinase A signaling pathways at the level of a protein kinase B/β-arrestin/cAMP phosphodiesterase 4 complex. Mol. Cell. Biol. 30, 1660–1672 32 Abrahamsen, H., Baillie, G., Ngai, J., Vang, T., Nika, K., Ruppelt, A., Mustelin, T., Zaccolo, M., Houslay, M. and Tasken, K. (2004) TCR- and CD28-mediated recruitment of phosphodiesterase 4 to lipid rafts potentiates TCR signaling. J. Immunol. 173, 4847–4858 33 Jiang, X., Paskind, M., Weltzien, R. and Epstein, P. M. (1998) Expression and regulation of mRNA for distinct isoforms of cAMP-specific PDE-4 in mitogen-stimulated and leukemic human lymphocytes. Cell Biochem. Biophys. 28, 135–160 34 Torphy, T. J., Zhou, H. L., Foley, J. J., Sarau, H. M., Manning, C. D. and Barnette, M. S. (1995) Salbutamol up-regulates PDE4 activity and induces a heterologous desensitization of U937 cells to prostaglandin E2. Implications for the therapeutic use of β-adrenoceptor agonists. J. Biol. Chem. 270, 23598–23604 35 Schillace, R. V. and Carr, D. W. (2006) The role of protein kinase A and A-kinase anchoring proteins in modulating T-cell activation: progress and future directions. Crit. Rev. Immunol. 26, 113–131 36 Feinerman, O., Jentsch, G., Tkach, K. E., Coward, J. W., Hathorn, M. M., Sneddon, M. W., Emonet, T., Smith, K. A. and Altan-Bonnet, G. (2010) Single-cell quantification of IL-2 response by effector and regulatory T cells reveals critical plasticity in immune response. Mol. Syst. Biol. 6, 437 37 Niimi, K., Ge, Q., Moir, L. M., Ammit, A. J., Trian, T., Burgess, J. K., Black, J. L. and Oliver, B. G. (2012) β2-Agonists upregulate PDE4 mRNA but not protein or activity in human airway smooth muscle cells from asthmatic and nonasthmatic volunteers. Am. J. Physiol. Lung Cell. Mol. Physiol. 302, L334–L342 38 Jin, S. L., Lan, L., Zoudilova, M. and Conti, M. (2005) Specific role of phosphodiesterase 4B in lipopolysaccharide-induced signaling in mouse macrophages. J. Immunol. 175, 1523–1531 39 Jin, S. L., Goya, S., Nakae, S., Wang, D., Bruss, M., Hou, C., Umetsu, D. and Conti, M. (2010) Phosphodiesterase 4B is essential for TH 2-cell function and development of airway hyperresponsiveness in allergic asthma. J. Allergy Clin. Immunol. 126, 1252–1259 40 Ponsioen, B., Gloerich, M., Ritsma, L., Rehmann, H., Bos, J. L. and Jalink, K. (2009) Direct spatial control of Epac1 by cyclic AMP. Mol. Cell. Biol. 29, 2521–2531 41 Holz, G. G., Chepurny, O. G. and Schwede, F. (2008) Epac-selective cAMP analogs: new tools with which to evaluate the signal transduction properties of cAMP-regulated guanine nucleotide exchange factors. Cell. Signalling 20, 10–20 42 Chepurny, O. G., Kelley, G. G., Dzhura, I., Leech, C. A., Roe, M. W., Dzhura, E., Li, X., Schwede, F., Genieser, H. G. and Holz, G. G. (2009) PKA-dependent potentiation of glucose-stimulated insulin secretion by Epac activator 8-pCPT-2 -O-Me-cAMP-AM in human islets of Langerhans. Am. J. Physiol. Endocrinol. Metab. 298, E622–E633 43 Lahl, K., Mayer, C. T., Bopp, T., Huehn, J., Loddenkemper, C., Eberl, G., Wirnsberger, G., Dornmair, K., Geffers, R., Schmitt, E. et al. (2009) Nonfunctional regulatory T cells and defective control of Th2 cytokine production in natural scurfy mutant mice. J. Immunol. 183, 5662–5672 44 Fuld, S., Borland, G. and Yarwood, S. J. (2005) Elevation of cyclic AMP in Jurkat T-cells provokes distinct transcriptional responses through the protein kinase A (PKA) and exchange protein activated by cyclic AMP (EPAC) pathways. Exp. Cell Res. 309, 161–173 45 Anastassiou, E. D., Paliogianni, F., Balow, J. P., Yamada, H. and Boumpas, D. T. (1992) Prostaglandin E2 and other cyclic AMP-elevating agents modulate IL-2 and IL-2R α gene expression at multiple levels. J. Immunol. 148, 2845–2852 46 de Rooij, J., Zwartkruis, F. J., Verheijen, M. H., Cool, R. H., Nijman, S. M., Wittinghofer, A. and Bos, J. L. (1998) Epac is a Rap1 guanine-nucleotide-exchange factor directly activated by cyclic AMP. Nature 396, 474–477

Treg cell suppression independent of ICER 47 von Lintig, F. C., Pilz, R. B. and Boss, G. R. (2000) Quantitative determination of Rap 1 activation in cyclic nucleotide-treated HL-60 leukemic cells: lack of Rap 1 activation in variant cells. Oncogene 19, 4029–4034 48 Boussiotis, V. A., Freeman, G. J., Berezovskaya, A., Barber, D. L. and Nadler, L. M. (1997) Maintenance of human T cell anergy: blocking of IL-2 gene transcription by activated Rap1. Science 278, 124–128

473

49 Sebzda, E., Bracke, M., Tugal, T., Hogg, N. and Cantrell, D. A. (2002) Rap1A positively regulates T cells via integrin activation rather than inhibiting lymphocyte signaling. Nat. Immunol. 3, 251–258 50 Hara, S., Nakaseko, C., Yamasaki, S., Hattori, M., Bos, J. L., Saito, Y., Minato, N. and Saito, T. (2009) Involvement of Rap-1 activation and early termination of immune synapse in CTLA-4-mediated negative signal. Hematology 14, 150–158

Received 10 January 2013/2 September 2013; accepted 5 September 2013 Published as BJ Immediate Publication 5 September 2013, doi:10.1042/BJ20130064

 c The Authors Journal compilation  c 2013 Biochemical Society

Biochem. J. (2013) 456, 463–473 (Printed in Great Britain)

doi:10.1042/BJ20130064

SUPPLEMENTARY ONLINE DATA

Regulatory T-cells and cAMP suppress effector T-cells independently of PKA–CREM/ICER: a potential role for Epac Amanda G. VANG*†, William HOUSLEY*, Hongli DONG†‡, Chaitali BASOLE*, Shlomo Z. BEN-SASSON§, Barbara E. KREAM‡¶, Paul M. EPSTEIN†‡1 , Robert B. CLARK* and Stefan BROCKE*†1 *Department of Immunology, University of Connecticut Health Center, 263 Farmington Avenue, Farmington, CT 06030-6125, U.S.A., †Department of Pharmacology, University of Connecticut Health Center, 263 Farmington Avenue, Farmington, CT 06030-6125, U.S.A., ‡Department of Cell Biology, University of Connecticut Health Center, 263 Farmington Avenue, Farmington, CT 06030-6125, U.S.A., §Laboratory of Immunology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892, U.S.A., Department of Medicine, University of Connecticut Health Center, 263 Farmington Avenue, Farmington, CT 06030-6125, U.S.A., and ¶Department of Genetics and Developmental Biology, University of Connecticut Health Center, 263 Farmington Avenue, Farmington, CT 06030-6125, U.S.A.

Figure S1 TGF-β suppresses proliferation of Teff cells from Crem − / − /ICERdeficient mice Purified CD4 + CD25 − Teff cells (5×104 /well) from Crem + / + (closed bars) or Crem − / − / ICER-deficient (open bars) mice were co-cultured with irradiated TDSs (5×104 /well) presenting soluble anti-CD3 mAbs (0.75 μg/ml). The cultures were incubated with TGFβ (5 ng/ml) or vehicle (medium) for 64 h with [3 H]thymidine added for the final 16 h. The extent of proliferation was determined by [3 H]thymidine incorporation at 64 h and data are presented as mean c.p.m. + S.E.M. for an experiment run in triplicate. The results are representative of two independent experiments (**P < 0.001; one-way ANOVA followed by Bonferroni t test).

Figure S2

cAMP effector molecules do not affect the viability of Teff cells +

Purified CD4 CD25 − Teff cells (5×104 /well) from Crem + / + (closed bars) or Crem − / − / ICER-deficient (open bars) mice were incubated with medium, 0.1 % DMSO, Fsk (25 μM), the Epac-selective agonist 8-pCPT-2 -O -Me-cAMP (50–500 μM), and the PKA-selective agonist N 6 -Bnz-cAMP (50–500 μM), on plate-bound anti-CD3 mAbs (5 μg/well) for 64 h. Viability was determined by counting by live compared with dead cells in culture with Trypan Blue exclusion. Results are means + S.E.M. for duplicate wells.

1

Correspondence may be addressed to either of these authors (email [email protected] or [email protected]).  c The Authors Journal compilation  c 2013 Biochemical Society

A. G. Vang and others Table S1 Genes and DNA sequences of forward and reverse primers used in qRT-PCR All forward (fwd) and reverse (rvs) primers were chosen using Primer Express software from ABI or Primer-BLAST from NCBI (National Center for Biotechnology Information) except for Pde3a (PrimerBank ID: 9055303b3), Prkar1a (PrimerBank ID: 3079446a1) and Epac1 (PrimerBank ID: 21450061a1), which were chosen from the public resource PrimerBank (see the Materials and methods section of the main text). Amplicon sizes are approximately 100 bp. Gene

GenBank accession number

Primer sequence (5 –3 )

Pde1a

NM_016744

Pde1b

NM_008800

Pde2a

NM_001008548

Pde3a

NM_018779.1

Pde3b

NM_011055

Pde4a

NM_183408

Pde4b

NM_019840

Pde4b1

NM_019840.2

Pde4b2

NM_001177980.1

Pde4b3

NM_001177981.1

Pde4b4

NM_001177982.1

Pde4b5

NM_001177983.1

Pde4d

NM_011056.3

Pde5a

NM_153422

Pde7a

NM_008802

Pde8a

NM_008803

Ifng

NM_008337

Tnfa

NM_013693

Il2

NM_008366

Prkar1a

NM_021880

Rapgef3 (Epac1)

NM_144850

Rpl19

NM_009078

(fwd) ACTGCTGGACACAGAGGATGA (rvs) CCCCATTTTGCGTGTGAAAG (fwd) CGAGTGCAGCCAGGTAAAGC (rvs) CAAGAGAGGAGGAGGCAGTCA (fwd) AAGTGTGAGTGCCAGGCTCTT (rvs) TTCTGGCTTCCGTGATGATCT (fwd) CCCACCGTGACCTTCAGTG (rvs) CTTCTCAGGCGCTTGGAAATG (fwd) TGGTTCTGGACAGATTGCTTACA (rvs) AATGCAGGGATGTTTGAAGATAGG (fwd) CACCGGAAGCTTGAACATCAAT (rvs) GGCCCCATTTGCTCAAGTT (fwd) ACCTGAGCAACCCCACCAA (rvs) CCCCTCTCCCGTTCTTTGTC (fwd) GAACCTTCATGGAGCGCCGA (rvs) CAGCGTCTCCATTGCTAGTTTCTGA (fwd) AAGTCTATGCCTCGGGCTTGTCCG (rvs) TGTGCTGTTCTCAGGCAGGACAGT (fwd) GAGGGAGGGAGCGAGCGCATA (rvs) GCCTTCCAGACGGGTGGTACTCC (fwd) GACCTCCATTTGTGTACTTCGCCAT (rvs) GTGTGTCAGCTCCCGGTTCAGC (fwd) TGGTTCCGCCCTTTGTGCAGA (rvs) GCTGCATTAACTCGGACAGTAAGCA (fwd) TTTCTTCCCGCAGCATTCAG (rvs) AGTTGGCCGAGGGATGTTCT (fwd) TCAAGGATTCCGAGGGAACA (rvs) TGGTCCCCTTCATCACTATCAAA (fwd) TCAGCAGCAATCTTGATGCAA (rvs) AGAGGCTGGGCACTTCACAT (fwd) CCTGCAGCATTCCCAAGTC (rvs) TGCATAAGGTTAGGCAGGTCAA (fwd) TCCTCCTGCGGCCTAGCT (rvs) TGGCAGTAACAGCCAGAAACA (fwd) AACTCCAGGCGGTGCCTAT (rvs) CGATCACCCCGAAGTTCAGT (fwd) GCTCGCATCCTGTGTCACAT (rvs) CTGCTGTGCTTCCGCTGTAG (fwd) ATGGCGTCTGGCAGTATGG (rvs) GCTGCACGATGGAGTCCTTC (fwd) TCTTACCAGCTAGTGTTCGAGC (rvs) AATGCCGATATAGTCGCAGATG (fwd) CCAAGAAGATTGACCGCCAT (rvs) CAGCTTGTGGATGTGCTCCAT

 c The Authors Journal compilation  c 2013 Biochemical Society

Treg cell suppression independent of ICER Table S2

Anti-PDE antibodies used for Western immunoblotting

Antibodies were purchased from Abcam, FabGennix or Santa Cruz Biotechnology as indicated. Where available, specificity was confirmed by using an inhibitory peptide from the same vendor. H, human; M, mouse; Monk, monkey; R, rat; Sc, Saccharomyces cerevisiae ; Xi, Xenopus laevis . Antibody specificity

Source

Catalogue number

Lot number

Clonality

Size of target PDE (kDa)

Host

Species cross-reactivity

PDE3A PDE3B PDE4A PDE4B PDE4B1 PDE4B2 PDE4B3 PDE4B4 PDE4D PDE7A PDE8A GAPDH

FabGennix Abcam FabGennix Abcam FabGennix FabGennix Abcam FabGennix Santa Cruz Biotechnology Santa Cruz Biotechnology FabGennix Abcam

PD3A-101AP ab95814 PD4-112AP ab82712 PD4-261AP PD4-251AP ab14615 PD4-231AP sc-25100 sc-11131 PD8A-101AP ab9385

534.pb3.AP GR31592-2 K53Ig02-pb7 960225 fgi591.ap.pb2 fgi593.ap.pb2 926568 fgi348.ap.pb2 F0208 E1303 A13pb1AP GR44319-1

Polyclonal Monoclonal Polyclonal Polyclonal Polyclonal Polyclonal Polyclonal Polyclonal Polyclonal Polyclonal Polyclonal Polyclonal

125 145 66/76/102/ 106/109 66/83 107 78 107 66 65/68/105/ 95/119 50/57 98–102 36

Rabbit Rat Rabbit Rabbit Rabbit Rabbit Rabbit Rabbit Goat Goat Rabbit Rabbit

R, M and H M R, M, H and Monk R, M and H R, M, H and Monk R, M, H and Monk R, M and H R, M, H and Monk R, M and H R, M and H R, M, H and Monk R, M, H, Sc and Xi

Table S3

Statistical analyses of Pde gene expression in T-cells from Crem + / + and Crem − / − /ICER-deficient mice

qRT-PCR was performed using an ABI 7500 fast system and data analysed using the C T method (SDS software v3.0). Primer sequences are listed in Table S1. Expression values from at least triplicate determinations were analysed by the unpaired Student’s t test and calculated P values are presented in the Table. N.D., not detected.

Gene

Differences in expression (P value), Teff cells from Crem + / + compared with Crem − / − /ICER-deficient mice

Differences in expression (P value), Treg cells from Crem + / + compared with Crem − / − /ICER-deficient mice

Pde1a Pde1b Pde2a Pde3b Pde4b Pde5a Pde7a Pde8a

N.D. Crem + / + >Crem − / − Crem + / + >Crem − / − Crem + / + Crem − / − Crem + / + >Crem − / − Crem + / + >Crem − / − Crem + / + >Crem − / − Crem + / + >Crem − / − Crem + / +